Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
COL24A1	255631	broad.mit.edu	37	1	86590963	86590963	+	Silent	SNP	G	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86590963G>T	uc001dlj.2	-	3	1098	c.1056C>A	c.(1054-1056)ACC>ACA	p.T352T	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Silent_p.T352T	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	352					cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TGCGATGAGTGGTCACTGACA	0.413													5	60	---	---	---	---	PASS
ETV3L	440695	broad.mit.edu	37	1	157067666	157067666	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157067666C>T	uc001fqq.1	-	4	886	c.601G>A	c.(601-603)GTC>ATC	p.V201I		NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	201						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				TCACGGTAGACGCTGCTGCTG	0.632													15	88	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160287402	160287402	+	Intron	SNP	T	C	C			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160287402T>C	uc009wti.2	-						COPA_uc001fvv.3_Intron|COPA_uc009wtj.1_Intron|SUMO1P3_uc001fvw.2_RNA	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform						COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGTCAGAGAATTGCTGATAAT	0.383													6	61	---	---	---	---	PASS
INTS7	25896	broad.mit.edu	37	1	212118153	212118153	+	Silent	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212118153C>T	uc001hiw.1	-	19	2679	c.2574G>A	c.(2572-2574)CTG>CTA	p.L858L	INTS7_uc009xdb.1_Silent_p.L838L|INTS7_uc001hix.1_Silent_p.L734L|INTS7_uc001hiy.1_Silent_p.L844L|INTS7_uc010pta.1_Silent_p.L809L	NM_015434	NP_056249	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	858					snRNA processing	integrator complex	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		ATTTACTCTGCAGTGTGGAAG	0.423													6	51	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235860536	235860536	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235860536C>T	uc001hxj.2	-	46	10586	c.10411G>A	c.(10411-10413)GAA>AAA	p.E3471K	LYST_uc001hxi.2_Missense_Mutation_p.E695K	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	3471					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CCCACGTATTCCCCCCATTTC	0.453									Chediak-Higashi_syndrome				6	31	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128381808	128381808	+	Silent	SNP	C	T	T	rs13422424	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128381808C>T	uc002top.2	+	29	3935	c.3882C>T	c.(3880-3882)CAC>CAT	p.H1294H	MYO7B_uc002toq.1_Silent_p.H147H|MYO7B_uc002tor.1_Silent_p.H147H	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1294	FERM 1.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CCCCCTGGCACGACTCCCGGG	0.632													2	3	---	---	---	---	PASS
USP19	10869	broad.mit.edu	37	3	49149418	49149418	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49149418G>T	uc003cwd.1	-	19	2681	c.2520C>A	c.(2518-2520)TAC>TAA	p.Y840*	USP19_uc003cwa.2_Nonsense_Mutation_p.Y648*|USP19_uc003cvz.3_Nonsense_Mutation_p.Y943*|USP19_uc011bcg.1_Nonsense_Mutation_p.Y931*|USP19_uc003cwb.2_Intron|USP19_uc003cwc.1_Nonsense_Mutation_p.Y598*|USP19_uc011bch.1_Nonsense_Mutation_p.Y941*	NM_006677	NP_006668	O94966	UBP19_HUMAN	ubiquitin thioesterase 19	840	Cytoplasmic (Potential).				ER-associated protein catabolic process|positive regulation of cell cycle process|protein deubiquitination|regulation of protein stability|response to endoplasmic reticulum stress|skeletal muscle atrophy	endoplasmic reticulum membrane|integral to membrane	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(4)|breast(2)|lung(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCAGGAAGGGGTAGCCAATGT	0.592													4	12	---	---	---	---	PASS
RPL9	6133	broad.mit.edu	37	4	39457894	39457894	+	Intron	SNP	T	C	C			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39457894T>C	uc003gub.2	-						RPL9_uc003guc.2_Intron|RPL9_uc011byk.1_Intron|RPL9_uc011byl.1_3'UTR|LIAS_uc003gue.3_5'Flank|LIAS_uc011bym.1_5'Flank|LIAS_uc003guf.2_5'Flank|LIAS_uc003gug.2_5'Flank|LIAS_uc003guh.2_5'Flank	NM_001024921	NP_001020092	P32969	RL9_HUMAN	ribosomal protein L9						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|nucleolus|ribosome	rRNA binding|structural constituent of ribosome			skin(1)	1						GAGATAATTCTAAAACAAATC	0.328													2	1	---	---	---	---	PASS
TEC	7006	broad.mit.edu	37	4	48139432	48139432	+	3'UTR	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48139432C>T	uc003gxz.2	-	18						NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase						intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						TCACACATCACTTATCTTCCA	0.408													6	12	---	---	---	---	PASS
SCFD2	152579	broad.mit.edu	37	4	54011576	54011576	+	Silent	SNP	T	C	C	rs79628372	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54011576T>C	uc003gzu.2	-	5	1619	c.1485A>G	c.(1483-1485)GAA>GAG	p.E495E	SCFD2_uc010igm.2_Silent_p.E495E	NM_152540	NP_689753	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	495					protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TGACTTTTTCTTCTGCTTCAC	0.443													28	32	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55979558	55979558	+	Missense_Mutation	SNP	C	T	T	rs2305948	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55979558C>T	uc003has.2	-	7	1191	c.889G>A	c.(889-891)GTA>ATA	p.V297I	KDR_uc003hat.1_Missense_Mutation_p.V297I|KDR_uc011bzx.1_Missense_Mutation_p.V297I	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	297	Ig-like C2-type 3.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CTCCGGGTTACACCATCTATA	0.443			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			35	30	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56309992	56309992	+	Silent	SNP	A	G	G	rs3736544	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56309992A>G	uc003haz.1	-	21	2690	c.1764T>C	c.(1762-1764)AAT>AAC	p.N588N	CLOCK_uc003hba.1_Silent_p.N588N|CLOCK_uc010igu.1_RNA	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	588					circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			GTTGCTGGATATTAGATGAAT	0.348													20	18	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57190356	57190356	+	Silent	SNP	G	A	A	rs7695701	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57190356G>A	uc003hbk.2	+	10	3856	c.3465G>A	c.(3463-3465)AGG>AGA	p.R1155R	KIAA1211_uc010iha.2_Silent_p.R1148R	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	1155										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					AAGAGAAGAGGCCCGAGACTG	0.567													14	15	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57194460	57194460	+	3'UTR	SNP	A	G	G	rs6811153	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57194460A>G	uc003hbk.2	+	11					KIAA1211_uc010iha.2_3'UTR	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					AAGAACACCCATTCTCCTGAA	0.403													21	23	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57194712	57194712	+	3'UTR	SNP	A	C	C	rs6811616	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57194712A>C	uc003hbk.2	+	11					KIAA1211_uc010iha.2_3'UTR	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					GAAGAAAGACAATTCTAGATC	0.373													5	7	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57215677	57215677	+	Missense_Mutation	SNP	G	A	A	rs3796544	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57215677G>A	uc003hbn.2	-	11	2393	c.2240C>T	c.(2239-2241)GCG>GTG	p.A747V	AASDH_uc010ihb.2_Missense_Mutation_p.A262V|AASDH_uc011caa.1_Missense_Mutation_p.A594V|AASDH_uc003hbo.2_Missense_Mutation_p.A647V|AASDH_uc011cab.1_Missense_Mutation_p.A262V|AASDH_uc010ihc.2_Missense_Mutation_p.A747V|AASDH_uc003hbp.2_Missense_Mutation_p.A747V	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	747					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				AGTCCCTATCGCAGGTTTCCC	0.418													36	33	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57237683	57237683	+	Silent	SNP	G	A	A	rs6554354	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57237683G>A	uc003hbn.2	-	5	948	c.795C>T	c.(793-795)TCC>TCT	p.S265S	AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_Silent_p.S112S|AASDH_uc003hbo.2_Silent_p.S165S|AASDH_uc011cab.1_5'UTR|AASDH_uc010ihc.2_Silent_p.S265S|AASDH_uc003hbp.2_Silent_p.S265S	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	265					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GCAACTTGACGGAAGTTGGTA	0.408													12	16	---	---	---	---	PASS
PPAT	5471	broad.mit.edu	37	4	57273840	57273840	+	Silent	SNP	C	G	G	rs11538098	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57273840C>G	uc003hbr.2	-	2	373	c.171G>C	c.(169-171)TCG>TCC	p.S57S		NM_002703	NP_002694	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	57	Glutamine amidotransferase type-2.				glutamine metabolic process|nucleoside metabolic process|purine base biosynthetic process|purine ribonucleoside monophosphate biosynthetic process	cytosol	4 iron, 4 sulfur cluster binding|amidophosphoribosyltransferase activity|metal ion binding				0	Glioma(25;0.08)|all_neural(26;0.101)				L-Glutamine(DB00130)|Thioguanine(DB00352)	ATGTTGGCACCGAACTCCCAT	0.289													13	19	---	---	---	---	PASS
REST	5978	broad.mit.edu	37	4	57797414	57797414	+	Missense_Mutation	SNP	C	T	T	rs3796529	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57797414C>T	uc003hch.2	+	4	2737	c.2390C>T	c.(2389-2391)CCA>CTA	p.P797L	REST_uc003hci.2_Missense_Mutation_p.P797L|REST_uc010ihf.2_Missense_Mutation_p.P471L	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	797	Pro-rich.				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					CAGAGGGAGCCACCTCCTCCC	0.532													54	55	---	---	---	---	PASS
POLR2B	5431	broad.mit.edu	37	4	57889677	57889677	+	Silent	SNP	C	T	T	rs1056364	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57889677C>T	uc003hcl.1	+	19	2740	c.2697C>T	c.(2695-2697)AGC>AGT	p.S899S	POLR2B_uc011cae.1_Silent_p.S892S|POLR2B_uc011caf.1_Silent_p.S824S|POLR2B_uc003hcm.1_Silent_p.S392S	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B	899					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					TCAGAACTAGCGAGACGGGCA	0.393													25	24	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62598689	62598689	+	Silent	SNP	C	T	T	rs10434219	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62598689C>T	uc010ihh.2	+	5	785	c.612C>T	c.(610-612)CAC>CAT	p.H204H	LPHN3_uc003hcq.3_Silent_p.H204H|LPHN3_uc010ihg.1_Silent_p.H272H|LPHN3_uc003hcs.1_Silent_p.H33H	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	204	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						AGCTCCCTCACAGGGTGGATG	0.453													6	12	---	---	---	---	PASS
MIR1269	100302177	broad.mit.edu	37	4	67142620	67142620	+	RNA	SNP	G	A	A	rs73239138	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67142620G>A	hsa-mir-1269|MI0006406	+			c.79G>A																				0						ggactgagccgtgctactggc	0.000													43	31	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68930465	68930465	+	Missense_Mutation	SNP	G	A	A	rs143544573	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68930465G>A	uc003hdt.1	-	8	1002	c.953C>T	c.(952-954)TCT>TTT	p.S318F	LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron|SYT14L_uc010ihn.2_5'Flank	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	318	Peptidase S1.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						CAACTTTATAGATGAGTCTGG	0.388													21	21	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69870721	69870721	+	Silent	SNP	A	G	G	rs111542944		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69870721A>G	uc011cao.1	-	9	1465	c.1329T>C	c.(1327-1329)CAT>CAC	p.H443H	UGT2B10_uc011can.1_Silent_p.H359H			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	480					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						AGGTGAGGTCATGGGCTGCAA	0.478													25	43	---	---	---	---	PASS
UGT2B7	7364	broad.mit.edu	37	4	69964337	69964337	+	Silent	SNP	A	T	T	rs7438284	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69964337A>T	uc003heg.3	+	2	847	c.801A>T	c.(799-801)CCA>CCT	p.P267P	UGT2B7_uc010ihq.2_Silent_p.P267P	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	267					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						TTCAGTTTCCATATCCACTCT	0.393													47	50	---	---	---	---	PASS
HTN3	3347	broad.mit.edu	37	4	70898907	70898907	+	Silent	SNP	C	T	T	rs1849937	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70898907C>T	uc003hew.2	+	5	243	c.126C>T	c.(124-126)GGC>GGT	p.G42G		NM_000200	NP_000191	P15516	HIS3_HUMAN	histatin 3	42					biomineral tissue development|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular region	metal ion binding|protein binding			ovary(1)|skin(1)	2						CACATCGAGGCTATAGATCAA	0.368													9	17	---	---	---	---	PASS
CSN3	1448	broad.mit.edu	37	4	71115152	71115152	+	Silent	SNP	T	C	C	rs3775738	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71115152T>C	uc003hfe.3	+	4	583	c.525T>C	c.(523-525)GTT>GTC	p.V175V		NM_005212	NP_005203	P07498	CASK_HUMAN	casein kappa precursor	175						extracellular region	protein binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						CAACCACAGTTGCAGTTACTC	0.448													8	19	---	---	---	---	PASS
SMR3A	26952	broad.mit.edu	37	4	71232701	71232701	+	Missense_Mutation	SNP	C	T	T	rs6853742	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71232701C>T	uc003hfg.1	+	3	476	c.395C>T	c.(394-396)CCT>CTT	p.P132L	SMR3B_uc011cas.1_Intron	NM_012390	NP_036522	Q99954	SMR3A_HUMAN	submaxillary gland androgen regulated protein 3	132	Pro-rich.					extracellular region					0		all_hematologic(202;0.196)				CTCCCTACTCCTGCACCCTAA	0.488													11	23	---	---	---	---	PASS
AMTN	401138	broad.mit.edu	37	4	71396989	71396989	+	Silent	SNP	C	T	T	rs17676820	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71396989C>T	uc003hfk.1	+	8	680	c.591C>T	c.(589-591)ATC>ATT	p.I197I	AMTN_uc010ihy.1_Silent_p.I196I	NM_212557	NP_997722	Q6UX39	AMTN_HUMAN	amelotin precursor	197					biomineral tissue development|cell adhesion|odontogenesis of dentine-containing tooth	basal lamina|cell-cell junction				large_intestine(1)|central_nervous_system(1)	2			Lung(101;0.235)			CACATGCCATCGAGGAAGCCA	0.522													4	10	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71503556	71503556	+	Missense_Mutation	SNP	G	T	T	rs143129444	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71503556G>T	uc011caw.1	+	8	865	c.584G>T	c.(583-585)GGG>GTG	p.G195V		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	195					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			AATGAAGAAGGGGGGGTAAGT	0.428													22	22	---	---	---	---	PASS
SDAD1	55153	broad.mit.edu	37	4	76877285	76877285	+	Missense_Mutation	SNP	C	G	G	rs140718662	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76877285C>G	uc003hje.3	-	21	1978	c.1859G>C	c.(1858-1860)GGA>GCA	p.G620A	SDAD1_uc003hjf.3_Missense_Mutation_p.G523A|SDAD1_uc011cbr.1_Missense_Mutation_p.G583A	NM_018115	NP_060585	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	620					protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GTCTGTCTTTCCAGCCTACCA	0.259													20	26	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	78979141	78979141	+	5'UTR	SNP	C	T	T	rs34237418	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78979141C>T	uc003hlb.2	+	1					FRAS1_uc003hkw.2_5'UTR	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CTGGGCTCCTCCATCGTGGGT	0.637													7	5	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79300899	79300899	+	Silent	SNP	T	C	C	rs35774552	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79300899T>C	uc003hlb.2	+	27	3752	c.3312T>C	c.(3310-3312)AGT>AGC	p.S1104S	FRAS1_uc003hkw.2_Silent_p.S1104S	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1103	CSPG 1.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ACACCCCTAGTCTTCATGTGA	0.413													13	24	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79300993	79300993	+	Missense_Mutation	SNP	G	A	A	rs12512164	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79300993G>A	uc003hlb.2	+	27	3846	c.3406G>A	c.(3406-3408)GAA>AAA	p.E1136K	FRAS1_uc003hkw.2_Missense_Mutation_p.E1136K	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1135	CSPG 1.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GGGTAGGGTCGAAGATCTCCT	0.483													13	23	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79372930	79372930	+	Silent	SNP	C	T	T	rs753752	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79372930C>T	uc003hlb.2	+	46	6908	c.6468C>T	c.(6466-6468)CAC>CAT	p.H2156H		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TTATAGGCCACGTAGAATATA	0.378													3	5	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79387442	79387442	+	Silent	SNP	C	T	T	rs7660664	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79387442C>T	uc003hlb.2	+	50	7550	c.7110C>T	c.(7108-7110)CAC>CAT	p.H2370H		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2369	CSPG 11.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						AGCATTTCCACCTCACCTCCA	0.547													11	18	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79437155	79437155	+	Silent	SNP	C	T	T	rs3749487	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79437155C>T	uc003hlb.2	+	66	10817	c.10377C>T	c.(10375-10377)ACC>ACT	p.T3459T		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	3454	Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GCTCTGTAACCGCTGACTTCC	0.507													7	9	---	---	---	---	PASS
C4orf22	255119	broad.mit.edu	37	4	81283916	81283916	+	Silent	SNP	C	T	T	rs17004886	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81283916C>T	uc003hmf.2	+	2	169	c.120C>T	c.(118-120)ACC>ACT	p.T40T	C4orf22_uc010ijp.2_Silent_p.T40T	NM_152770	NP_689983	Q6V702	CD022_HUMAN	hypothetical protein LOC255119	40										skin(2)	2						AGGATGAAACCCTGGCCCGCC	0.433													20	22	---	---	---	---	PASS
BMP3	651	broad.mit.edu	37	4	81967610	81967610	+	Missense_Mutation	SNP	G	C	C	rs61729826	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81967610G>C	uc003hmg.3	+	2	1355	c.1035G>C	c.(1033-1035)AAG>AAC	p.K345N		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	345					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						CTCATCGGAAGAGCCAGACGC	0.493													15	14	---	---	---	---	PASS
SEC31A	22872	broad.mit.edu	37	4	83763393	83763393	+	Silent	SNP	G	A	A	rs113126252	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83763393G>A	uc003hnf.2	-	22	3032	c.2868C>T	c.(2866-2868)GGC>GGT	p.G956G	SEC31A_uc003hnd.2_Silent_p.G112G|SEC31A_uc003hne.2_Silent_p.G720G|SEC31A_uc011ccl.1_Silent_p.G917G|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Silent_p.G956G|SEC31A_uc003hnh.2_Silent_p.G956G|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Silent_p.G917G|SEC31A_uc011ccm.1_Silent_p.G951G|SEC31A_uc011ccn.1_Silent_p.G956G|SEC31A_uc003hnk.2_Silent_p.G917G|SEC31A_uc003hnm.2_Silent_p.G956G	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1	956	Interaction with PDCD6.|Pro-rich.				COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				CTCCTGGTCCGCCATGCTGGA	0.587													12	7	---	---	---	---	PASS
C4orf36	132989	broad.mit.edu	37	4	87809020	87809020	+	Missense_Mutation	SNP	C	G	G	rs72613147	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87809020C>G	uc003hqe.3	-	4	560	c.247G>C	c.(247-249)GTG>CTG	p.V83L		NM_144645	NP_653246	Q96KX1	CD036_HUMAN	hypothetical protein LOC132989	83											0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00141)		AGACGCTTCACTTCATACTCC	0.378													11	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	88813100	88813100	+	Missense_Mutation	SNP	G	A	A	rs3811816	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88813100G>A	uc010iko.1	+	1	106	c.106G>A	c.(106-108)GAG>AAG	p.E36K						SubName: Full=Heat shock protein 90kDa alpha (Cytosolic), class B member 1, isoform CRA_a; SubName: Full=cDNA, FLJ92550, Homo sapiens heat shock 90kDa protein 1, beta (HSPCB), mRNA;																		CTATTCCAACGAGGAGATTTT	0.463													22	22	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	88813126	88813126	+	Silent	SNP	C	A	A	rs3811817	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88813126C>A	uc010iko.1	+	1	132	c.132C>A	c.(130-132)ATC>ATA	p.I44I						SubName: Full=Heat shock protein 90kDa alpha (Cytosolic), class B member 1, isoform CRA_a; SubName: Full=cDNA, FLJ92550, Homo sapiens heat shock 90kDa protein 1, beta (HSPCB), mRNA;																		AGGAGTTGATCTCTAATGCTT	0.443													22	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	88814048	88814048	+	Missense_Mutation	SNP	A	C	C	rs3811818	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88814048A>C	uc010iko.1	+	3	881	c.881A>C	c.(880-882)AAC>ACC	p.N294T						SubName: Full=Heat shock protein 90kDa alpha (Cytosolic), class B member 1, isoform CRA_a; SubName: Full=cDNA, FLJ92550, Homo sapiens heat shock 90kDa protein 1, beta (HSPCB), mRNA;																		AAAAAGAACAACATCAAACTG	0.433													20	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	88815148	88815148	+	Missense_Mutation	SNP	G	A	A	rs56105763	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88815148G>A	uc010iko.1	+	4	1775	c.1775G>A	c.(1774-1776)CGC>CAC	p.R592H						SubName: Full=Heat shock protein 90kDa alpha (Cytosolic), class B member 1, isoform CRA_a; SubName: Full=cDNA, FLJ92550, Homo sapiens heat shock 90kDa protein 1, beta (HSPCB), mRNA;																		GATGCGTCTCGCATGGAAGAA	0.532													12	14	---	---	---	---	PASS
SPP1	6696	broad.mit.edu	37	4	88902692	88902692	+	Silent	SNP	T	C	C	rs4754	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88902692T>C	uc003hra.2	+	6	447	c.282T>C	c.(280-282)GAT>GAC	p.D94D	SPP1_uc003hrb.2_Silent_p.D67D|SPP1_uc003hrc.2_Silent_p.D80D|SPP1_uc011cde.1_Silent_p.D107D|SPP1_uc003hrd.2_Silent_p.D53D	NM_001040058	NP_001035147	P10451	OSTP_HUMAN	secreted phosphoprotein 1 isoform a	94					biomineral tissue development|cell adhesion|decidualization|embryo implantation|ossification|response to vitamin D	extracellular space	cytokine activity			ovary(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		AAGATGATGATGACCATGTGG	0.433													34	35	---	---	---	---	PASS
SPP1	6696	broad.mit.edu	37	4	88903853	88903853	+	Silent	SNP	C	T	T	rs1126616	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88903853C>T	uc003hra.2	+	7	915	c.750C>T	c.(748-750)GCC>GCT	p.A250A	SPP1_uc003hrb.2_Silent_p.A223A|SPP1_uc003hrc.2_Silent_p.A236A|SPP1_uc011cde.1_Silent_p.A263A|SPP1_uc003hrd.2_Silent_p.A209A	NM_001040058	NP_001035147	P10451	OSTP_HUMAN	secreted phosphoprotein 1 isoform a	250					biomineral tissue development|cell adhesion|decidualization|embryo implantation|ossification|response to vitamin D	extracellular space	cytokine activity			ovary(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		AGCGGAAAGCCAATGATGAGA	0.473													23	24	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90170118	90170118	+	Missense_Mutation	SNP	A	G	G	rs28622301	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90170118A>G	uc003hsm.1	-	2	1663	c.1144T>C	c.(1144-1146)TCC>CCC	p.S382P		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	382										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CACTGGCTGGACTCCTGGGGG	0.567													22	28	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	93511396	93511396	+	Missense_Mutation	SNP	C	T	T	rs34144324	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93511396C>T	uc011cdt.1	+	2	461	c.203C>T	c.(202-204)ACG>ATG	p.T68M	GRID2_uc010ikx.2_Missense_Mutation_p.T68M|GRID2_uc011cdu.1_Missense_Mutation_p.T68M	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	68	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TTTTCAGTGACGTTTGTTGAT	0.388													27	24	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94316763	94316763	+	Silent	SNP	T	G	G	rs1385405	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94316763T>G	uc011cdt.1	+	9	1509	c.1251T>G	c.(1249-1251)GGT>GGG	p.G417G	GRID2_uc011cdu.1_Silent_p.G322G	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	417	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TTCAGCTTGGTTGCTGGAATC	0.423													21	26	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95170839	95170839	+	Missense_Mutation	SNP	G	A	A	rs11722476	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95170839G>A	uc003htc.3	+	7	995	c.740G>A	c.(739-741)AGT>AAT	p.S247N	SMARCAD1_uc003htb.3_Missense_Mutation_p.S247N|SMARCAD1_uc003htd.3_Missense_Mutation_p.S247N|SMARCAD1_uc010ila.2_Missense_Mutation_p.S110N	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	247					chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		GAATCTAGCAGTAATTGGGAA	0.328													20	14	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95186055	95186055	+	Silent	SNP	A	G	G	rs2306802	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95186055A>G	uc003htc.3	+	10	1734	c.1479A>G	c.(1477-1479)CAA>CAG	p.Q493Q	SMARCAD1_uc003htb.3_Silent_p.Q493Q|SMARCAD1_uc003htd.3_Silent_p.Q493Q|SMARCAD1_uc010ila.2_Silent_p.Q356Q|SMARCAD1_uc011cdw.1_Silent_p.Q63Q	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	493					chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		TTCTAAACCAAAGGTAATCTT	0.308													13	11	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95197520	95197520	+	Silent	SNP	C	T	T	rs6823404	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95197520C>T	uc003htc.3	+	15	2094	c.1839C>T	c.(1837-1839)GAC>GAT	p.D613D	SMARCAD1_uc003htb.3_Silent_p.D613D|SMARCAD1_uc003htd.3_Silent_p.D613D|SMARCAD1_uc010ila.2_Silent_p.D476D|SMARCAD1_uc011cdw.1_Silent_p.D183D	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	613	Helicase ATP-binding.				chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		GTTCTGATGACCGTAGTCTGT	0.398													15	17	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95506842	95506842	+	Silent	SNP	G	A	A	rs11097431	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95506842G>A	uc003hti.2	+	6	988	c.837G>A	c.(835-837)CAG>CAA	p.Q279Q	PDLIM5_uc003htf.2_Silent_p.Q156Q|PDLIM5_uc003htg.2_Silent_p.Q176Q|PDLIM5_uc011cdx.1_Silent_p.Q176Q|PDLIM5_uc003hth.2_Silent_p.Q170Q|PDLIM5_uc003htj.2_5'UTR|PDLIM5_uc003htk.2_Silent_p.Q176Q|PDLIM5_uc011cdy.1_Silent_p.Q157Q|PDLIM5_uc003htl.2_5'UTR	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	279					regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		GAACAACTCAGTCTCGCTCTT	0.453													13	10	---	---	---	---	PASS
C4orf37	285555	broad.mit.edu	37	4	98893437	98893437	+	Silent	SNP	A	G	G	rs783960	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98893437A>G	uc003htt.1	-	7	1017	c.927T>C	c.(925-927)GAT>GAC	p.D309D		NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555	309											0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		TTACCTGATAATCAGCAGGTC	0.333													12	25	---	---	---	---	PASS
C4orf37	285555	broad.mit.edu	37	4	98893476	98893476	+	Silent	SNP	C	T	T	rs783959	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98893476C>T	uc003htt.1	-	7	978	c.888G>A	c.(886-888)TCG>TCA	p.S296S		NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555	296											0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		CTTTCTGAACCGAGAAGAAAG	0.363													10	27	---	---	---	---	PASS
EIF4E	1977	broad.mit.edu	37	4	99808254	99808254	+	Silent	SNP	G	A	A	rs62323192	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99808254G>A	uc003hue.2	-	5	1898	c.375C>T	c.(373-375)GAC>GAT	p.D125D	EIF4E_uc011cea.1_Silent_p.D145D|EIF4E_uc011ceb.1_Silent_p.D125D|EIF4E_uc011cec.1_Silent_p.D125D	NM_001968	NP_001959	P06730	IF4E_HUMAN	eukaryotic translation initiation factor 4E	125					G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|interspecies interaction between organisms|mRNA export from nucleus|nuclear-transcribed mRNA poly(A) tail shortening|positive regulation of mitotic cell cycle|regulation of translation	cytoplasmic mRNA processing body|cytosol|eukaryotic translation initiation factor 4F complex|mRNA cap binding complex|RNA-induced silencing complex	protein binding|RNA cap binding|translation initiation factor activity			lung(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)|LUSC - Lung squamous cell carcinoma(721;0.00227)		AGCGATCGAGGTCACTTCGTC	0.383													45	53	---	---	---	---	PASS
ADH4	127	broad.mit.edu	37	4	100047812	100047812	+	Silent	SNP	G	A	A	rs1126672	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100047812G>A	uc003hun.2	-	8	1127	c.1051C>T	c.(1051-1053)CTG>TTG	p.L351L	uc003hum.1_Intron|ADH4_uc011ced.1_Silent_p.L370L	NM_000670	NP_000661	P08319	ADH4_HUMAN	class II alcohol dehydrogenase, pi subunit	351					alcohol catabolic process|cellular aldehyde metabolic process|ethanol oxidation|quinone cofactor metabolic process|retinol metabolic process|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	alcohol dehydrogenase activity, zinc-dependent|all-trans retinal binding|benzaldehyde dehydrogenase activity|NAD binding|NADPH:quinone reductase activity|retinol binding|retinol dehydrogenase activity|zinc ion binding			skin(2)	2				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)	NADH(DB00157)	TGGGTCACCAGTGCATCCAGA	0.363													25	24	---	---	---	---	PASS
C4orf17	84103	broad.mit.edu	37	4	100443720	100443720	+	Missense_Mutation	SNP	G	A	A	rs13143848	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100443720G>A	uc003huw.2	+	3	514	c.191G>A	c.(190-192)GGA>GAA	p.G64E	C4orf17_uc003hux.2_RNA	NM_032149	NP_115525	Q53FE4	CD017_HUMAN	hypothetical protein LOC84103	64											0				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		ACATTGTGGGGAGTTGGCCAG	0.428													17	23	---	---	---	---	PASS
RG9MTD2	93587	broad.mit.edu	37	4	100470132	100470132	+	3'UTR	SNP	T	C	C	rs1054730	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100470132T>C	uc003huy.2	-	8					RG9MTD2_uc003huz.3_3'UTR|RG9MTD2_uc003hva.3_3'UTR	NM_152292	NP_689505	Q8TBZ6	RG9D2_HUMAN	RNA (guanine-9-) methyltransferase domain								methyltransferase activity			ovary(2)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.7e-08)		AAAAAGTTTTTAAAAATCACA	0.234													7	2	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100504664	100504664	+	Missense_Mutation	SNP	T	C	C	rs3816873	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100504664T>C	uc003hvc.3	+	4	639	c.383T>C	c.(382-384)ATC>ACC	p.I128T	MTTP_uc011cej.1_Missense_Mutation_p.I155T|MTTP_uc003hvb.2_Missense_Mutation_p.I128T	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	128	Vitellogenin.				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	CTTCATCTAATCCATGGAAAG	0.383													41	21	---	---	---	---	PASS
DAPP1	27071	broad.mit.edu	37	4	100738035	100738035	+	5'UTR	SNP	G	T	T	rs715239	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100738035G>T	uc003hvf.3	+	1					DAPP1_uc011cek.1_5'UTR|DAPP1_uc010ilh.2_5'UTR	NM_014395	NP_055210	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		GAGCAGCCCAGTTGTGTCTCT	0.542													3	1	---	---	---	---	PASS
SLC39A8	64116	broad.mit.edu	37	4	103189036	103189036	+	Silent	SNP	G	A	A	rs17823966	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103189036G>A	uc003hwb.1	-	6	1570	c.1041C>T	c.(1039-1041)CAC>CAT	p.H347H	SLC39A8_uc011ceo.1_Silent_p.H347H|SLC39A8_uc003hwa.1_Silent_p.H280H|SLC39A8_uc003hwc.2_Silent_p.H347H	NM_022154	NP_071437	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter),	347	Cytoplasmic (Potential).|XEXPHE-motif.					integral to membrane|organelle membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		TACCTAACTCGTGGGGAAACT	0.448													13	8	---	---	---	---	PASS
MANBA	4126	broad.mit.edu	37	4	103553090	103553090	+	3'UTR	SNP	A	G	G	rs3194585	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103553090A>G	uc003hwg.2	-	17					MANBA_uc011ces.1_3'UTR	NM_005908	NP_005899	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		CAATCGCTCAAATGCGTGGCA	0.517													4	6	---	---	---	---	PASS
MANBA	4126	broad.mit.edu	37	4	103555992	103555992	+	Silent	SNP	A	G	G	rs2272697	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103555992A>G	uc003hwg.2	-	16	2468	c.2368T>C	c.(2368-2370)TTG>CTG	p.L790L	MANBA_uc011ces.1_Silent_p.L733L	NM_005908	NP_005899	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal precursor	790					carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		GGTGAGGACAAGAAGTGGTAG	0.567													10	22	---	---	---	---	PASS
DKK2	27123	broad.mit.edu	37	4	107845794	107845794	+	Missense_Mutation	SNP	C	T	T	rs17037102	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107845794C>T	uc003hyi.2	-	3	1142	c.437G>A	c.(436-438)CGG>CAG	p.R146Q	DKK2_uc010ilw.1_RNA|DKK2_uc003hyj.1_Missense_Mutation_p.R146Q	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN	dickkopf homolog 2 precursor	146					multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		ATCTCTGTGCCGAGTACCATC	0.438													29	38	---	---	---	---	PASS
PAPSS1	9061	broad.mit.edu	37	4	108535335	108535335	+	3'UTR	SNP	C	T	T	rs9569	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108535335C>T	uc003hyk.2	-	12						NM_005443	NP_005434	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|sulfate adenylyltransferase (ATP) activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		CAAAGAAATGCCAACAGAGAC	0.413													11	12	---	---	---	---	PASS
GAR1	54433	broad.mit.edu	37	4	110737389	110737389	+	Silent	SNP	T	C	C	rs2276326	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110737389T>C	uc003hzt.2	+	2	376	c.69T>C	c.(67-69)GGT>GGC	p.G23G	GAR1_uc003hzu.2_Silent_p.G23G|GAR1_uc010imh.1_Silent_p.G23G|GAR1_uc010imi.2_Silent_p.G23G	NM_018983	NP_061856	Q9NY12	GAR1_HUMAN	nucleolar protein family A, member 1	23	RGG-box 1.				rRNA processing|snRNA pseudouridine synthesis	box H/ACA snoRNP complex|Cajal body	cation channel activity|pseudouridine synthase activity|snoRNA binding				0						tcaaccgaggtggcagcagca	0.259													3	8	---	---	---	---	PASS
LRIT3	345193	broad.mit.edu	37	4	110790911	110790911	+	Missense_Mutation	SNP	A	T	T	rs764205	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110790911A>T	uc003hzx.3	+	3	1064	c.871A>T	c.(871-873)ATG>TTG	p.M291L	LRIT3_uc003hzw.3_Missense_Mutation_p.M153L	NM_198506	NP_940908	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and	291	Ig-like.					integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		TCTGGCTGGGATGTCAGAAGC	0.468													36	31	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111409705	111409705	+	Missense_Mutation	SNP	T	C	C	rs1126483	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111409705T>C	uc003iab.3	+	2	995	c.653T>C	c.(652-654)GTG>GCG	p.V218A		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	218	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	AGGAGCATAGTGGCCACCGAT	0.373													3	11	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113506711	113506711	+	Missense_Mutation	SNP	C	T	T	rs76187047	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113506711C>T	uc003iau.2	-	14	4298	c.4087G>A	c.(4087-4089)GAA>AAA	p.E1363K	C4orf21_uc003iav.2_RNA	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	185						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TTTGGACCTTCCTTTTTAACC	0.363													6	7	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113544993	113544993	+	Missense_Mutation	SNP	G	T	T	rs61745597	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113544993G>T	uc003iau.2	-	4	353	c.142C>A	c.(142-144)CTG>ATG	p.L48M	C4orf21_uc003iaw.2_Missense_Mutation_p.L48M	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TTAAGAAACAGACTCTCCAAA	0.264													4	6	---	---	---	---	PASS
SEC24D	9871	broad.mit.edu	37	4	119736796	119736796	+	Silent	SNP	A	C	C	rs2389688	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119736796A>C	uc003ici.3	-	5	755	c.483T>G	c.(481-483)CCT>CCG	p.P161P	SEC24D_uc003icj.3_Silent_p.P161P|SEC24D_uc003icl.2_RNA|SEC24D_uc010imz.1_RNA|SEC24D_uc011cgg.1_RNA	NM_014822	NP_055637	O94855	SC24D_HUMAN	Sec24-related protein D	161	Pro-rich.				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0						GCAAAATGGAAGGCTGTGGAG	0.562													22	21	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121958091	121958091	+	Silent	SNP	T	G	G	rs3733558	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121958091T>G	uc003idq.1	-	4	1562	c.1035A>C	c.(1033-1035)CTA>CTC	p.L345L		NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor	345											0						TCCCATCTTTTAGCTCGACTG	0.418													28	36	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121958187	121958187	+	Silent	SNP	A	G	G	rs3822230	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121958187A>G	uc003idq.1	-	4	1466	c.939T>C	c.(937-939)GAT>GAC	p.D313D		NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor	313	Fibronectin type-III 1.										0						CCACAAATACATCAAAGTAGT	0.448													16	33	---	---	---	---	PASS
QRFPR	84109	broad.mit.edu	37	4	122301622	122301622	+	Missense_Mutation	SNP	A	C	C	rs17438900	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122301622A>C	uc010inj.1	-	1	560	c.181T>G	c.(181-183)TTT>GTT	p.F61V	QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_Missense_Mutation_p.F61V|QRFPR_uc010inl.1_Missense_Mutation_p.F61V	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	61	Helical; Name=1; (Potential).					plasma membrane	neuropeptide Y receptor activity				0						GCATTGCCAAAGAGCGCCAGG	0.627													9	15	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123145751	123145751	+	Silent	SNP	T	A	A	rs7658836	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123145751T>A	uc003ieh.2	+	21	2757	c.2712T>A	c.(2710-2712)CCT>CCA	p.P904P	KIAA1109_uc003iei.1_Silent_p.P657P|KIAA1109_uc010ins.1_Silent_p.P247P|KIAA1109_uc003iej.1_Silent_p.P289P	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	904					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AAGGTCTTCCTTTGGGAAGCG	0.488													16	17	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123192383	123192383	+	Silent	SNP	T	C	C	rs45574236	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123192383T>C	uc003ieh.2	+	45	7749	c.7704T>C	c.(7702-7704)GAT>GAC	p.D2568D	KIAA1109_uc003iel.1_Silent_p.D503D|KIAA1109_uc003iek.2_Silent_p.D1187D	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2568					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AGCATGTAGATATGGCTTTGG	0.393													45	46	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123229132	123229132	+	Silent	SNP	C	T	T	rs7688384	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123229132C>T	uc003ieh.2	+	56	9915	c.9870C>T	c.(9868-9870)GCC>GCT	p.A3290A	KIAA1109_uc003iel.1_Silent_p.A1225A	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	3290					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						ATTATAAGGCCGCCTATGACA	0.353													36	45	---	---	---	---	PASS
BBS12	166379	broad.mit.edu	37	4	123664445	123664445	+	Silent	SNP	C	T	T	rs2292493	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123664445C>T	uc003ieu.2	+	2	1591	c.1398C>T	c.(1396-1398)GGC>GGT	p.G466G		NM_152618	NP_689831	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	466					cellular protein metabolic process	cilium	ATP binding			ovary(2)	2						ATTGTGTGGGCGACGGGGTCT	0.468									Bardet-Biedl_syndrome				16	15	---	---	---	---	PASS
NUDT6	11162	broad.mit.edu	37	4	123814308	123814308	+	Missense_Mutation	SNP	C	T	T	rs1048201	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123814308C>T	uc003iew.2	-	5	658	c.626G>A	c.(625-627)CGG>CAG	p.R209Q	FGF2_uc003iev.1_3'UTR|NUDT6_uc003iex.2_Missense_Mutation_p.R40Q	NM_007083	NP_009014	P53370	NUDT6_HUMAN	nudix-type motif 6 isoform a	209	Nudix hydrolase.					mitochondrion|nucleus	growth factor activity|hydrolase activity				0						GTGCTGTTGCCGAATACTCAG	0.403													26	37	---	---	---	---	PASS
NUDT6	11162	broad.mit.edu	37	4	123838758	123838758	+	Missense_Mutation	SNP	A	G	G	rs12648093	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123838758A>G	uc003iew.2	-	2	372	c.340T>C	c.(340-342)TGC>CGC	p.C114R	NUDT6_uc003iex.2_5'UTR	NM_007083	NP_009014	P53370	NUDT6_HUMAN	nudix-type motif 6 isoform a	114						mitochondrion|nucleus	growth factor activity|hydrolase activity				0						TGGTGAAAGCAGAAGCCCAGG	0.512													22	25	---	---	---	---	PASS
SPATA5	166378	broad.mit.edu	37	4	123868606	123868606	+	Silent	SNP	C	T	T	rs139834687	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123868606C>T	uc003iez.3	+	9	1750	c.1677C>T	c.(1675-1677)TAC>TAT	p.Y559Y	SPATA5_uc003iey.2_Silent_p.Y558Y	NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	559					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						CTCATGGATACGTTGGAGCAG	0.468													23	13	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126329789	126329789	+	Silent	SNP	T	C	C	rs958415	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126329789T>C	uc003ifj.3	+	4	5760	c.5760T>C	c.(5758-5760)GAT>GAC	p.D1920D	FAT4_uc011cgp.1_Silent_p.D218D	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1920	Cadherin 18.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GAGCAGAAGATGGTGGGGGAC	0.338													20	36	---	---	---	---	PASS
SCLT1	132320	broad.mit.edu	37	4	129924977	129924977	+	Silent	SNP	C	A	A	rs3113487	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129924977C>A	uc003igp.2	-	6	851	c.345G>T	c.(343-345)CTG>CTT	p.L115L	SCLT1_uc003igq.2_Silent_p.L115L|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1	115	Potential.					centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						CCTCTGTGCCCAGGGGAAAGG	0.378													16	16	---	---	---	---	PASS
C4orf33	132321	broad.mit.edu	37	4	130023759	130023759	+	5'UTR	SNP	A	T	T	rs1757935	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130023759A>T	uc003igu.3	+	2					C4orf33_uc010ioc.1_5'UTR|C4orf33_uc010iod.2_5'UTR	NM_173487	NP_775758	Q8N1A6	CD033_HUMAN	hypothetical protein LOC132321											upper_aerodigestive_tract(1)	1						TCTTTTAGAGACTTCAGATGG	0.353													17	22	---	---	---	---	PASS
C4orf33	132321	broad.mit.edu	37	4	130030652	130030652	+	Missense_Mutation	SNP	A	G	G	rs337277	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130030652A>G	uc003igu.3	+	5	683	c.319A>G	c.(319-321)ATG>GTG	p.M107V	C4orf33_uc010ioc.1_Missense_Mutation_p.M107V|C4orf33_uc010iod.2_Missense_Mutation_p.M107V	NM_173487	NP_775758	Q8N1A6	CD033_HUMAN	hypothetical protein LOC132321	107										upper_aerodigestive_tract(1)	1						ATCGTTCAGAATGTCCAGAGG	0.348													15	17	---	---	---	---	PASS
SCOC	60592	broad.mit.edu	37	4	141302314	141302314	+	3'UTR	SNP	C	T	T	rs358314	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141302314C>T	uc003iif.2	+	4					SCOC_uc003iib.2_3'UTR|SCOC_uc011che.1_3'UTR|SCOC_uc003iid.2_3'UTR|SCOC_uc011chf.1_3'UTR|SCOC_uc011chg.1_3'UTR|SCOC_uc011chh.1_3'UTR|SCOC_uc003iig.2_3'UTR	NM_001153484	NP_001146956	Q9UIL1	SCOC_HUMAN	short coiled-coil protein isoform 1							Golgi apparatus|nucleus	protein binding				0	all_hematologic(180;0.162)					TTCTTTAAAACTTGGATAGAT	0.318													7	9	---	---	---	---	PASS
CLGN	1047	broad.mit.edu	37	4	141320021	141320021	+	Missense_Mutation	SNP	C	T	T	rs2175563	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141320021C>T	uc011chi.1	-	9	1086	c.868G>A	c.(868-870)GTC>ATC	p.V290I	CLGN_uc003iii.2_Missense_Mutation_p.V290I	NM_001130675	NP_001124147	O14967	CLGN_HUMAN	calmegin precursor	290	Lumenal (Potential).|1-2.				protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding			ovary(2)|skin(1)	3	all_hematologic(180;0.162)					TCTGGTTTGACGGCAGAAGGA	0.294													31	47	---	---	---	---	PASS
CLGN	1047	broad.mit.edu	37	4	141323162	141323162	+	Missense_Mutation	SNP	C	A	A	rs2567241	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141323162C>A	uc011chi.1	-	7	696	c.478G>T	c.(478-480)GCA>TCA	p.A160S	CLGN_uc003iii.2_Missense_Mutation_p.A160S	NM_001130675	NP_001124147	O14967	CLGN_HUMAN	calmegin precursor	160	Lumenal (Potential).				protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding			ovary(2)|skin(1)	3	all_hematologic(180;0.162)					TCAGTGTCTGCTAGGAGTTTA	0.264													16	10	---	---	---	---	PASS
INPP4B	8821	broad.mit.edu	37	4	143352425	143352425	+	5'UTR	SNP	C	A	A	rs138325014	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143352425C>A	uc003iix.3	-	5					INPP4B_uc003iiw.3_5'UTR|INPP4B_uc011chm.1_RNA|INPP4B_uc011cho.1_RNA|INPP4B_uc003iiz.2_RNA	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					TCAACCTTCACAGTTTTAAAA	0.413													7	8	---	---	---	---	PASS
ZNF827	152485	broad.mit.edu	37	4	146824230	146824230	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146824230G>A	uc003ikn.2	-	2	229	c.181C>T	c.(181-183)CAG>TAG	p.Q61*	ZNF827_uc003ikm.2_Nonsense_Mutation_p.Q61*|ZNF827_uc010iox.2_Intron	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	61					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					GACTGCTCCTGGATCCGGTCC	0.567													7	36	---	---	---	---	PASS
TTC29	83894	broad.mit.edu	37	4	147788709	147788709	+	Missense_Mutation	SNP	C	T	T	rs10013280	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147788709C>T	uc003ikw.3	-	8	1053	c.826G>A	c.(826-828)GCC>ACC	p.A276T	TTC29_uc010ipc.2_RNA|TTC29_uc003ikx.3_Missense_Mutation_p.A302T|TTC29_uc010ipd.1_Missense_Mutation_p.A276T	NM_031956	NP_114162	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	276	TPR 3.						binding				0	all_hematologic(180;0.151)					TAGTAAGAGGCTTCCGCTTCC	0.323													2	2	---	---	---	---	PASS
PET112L	5188	broad.mit.edu	37	4	152609826	152609826	+	Silent	SNP	A	C	C	rs62327344	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152609826A>C	uc003iml.2	-	10	1299	c.1287T>G	c.(1285-1287)ACT>ACG	p.T429T		NM_004564	NP_004555	O75879	GATB_HUMAN	PET112-like precursor	429						mitochondrion	ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor|translation factor activity, nucleic acid binding				0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)			L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	AGCCCAGAAAAGTGTTGAGGA	0.443													25	29	---	---	---	---	PASS
TIGD4	201798	broad.mit.edu	37	4	153690842	153690842	+	Missense_Mutation	SNP	T	C	C	rs4696354	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153690842T>C	uc003imy.2	-	2	2097	c.1315A>G	c.(1315-1317)ATA>GTA	p.I439V		NM_145720	NP_663772	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	439					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|DNA binding			ovary(1)	1	all_hematologic(180;0.093)					TTGGTGCATATGGAATCACCA	0.418													20	17	---	---	---	---	PASS
TRIM2	23321	broad.mit.edu	37	4	154216710	154216710	+	Silent	SNP	G	A	A	rs893805	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154216710G>A	uc003ing.2	+	6	1152	c.951G>A	c.(949-951)ACG>ACA	p.T317T	TRIM2_uc003inh.2_Silent_p.T344T	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2	317						cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		ACCTCGGGACGATCTTAACCA	0.622													6	10	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154479430	154479430	+	Silent	SNP	T	C	C	rs6848033	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154479430T>C	uc003inm.3	+	7	622	c.570T>C	c.(568-570)CGT>CGC	p.R190R	KIAA0922_uc010ipp.2_Silent_p.R190R|KIAA0922_uc010ipq.2_Silent_p.R42R	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	190	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				TTGGCACTCGTAGAATCTCTA	0.413													18	18	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154525458	154525458	+	Silent	SNP	C	T	T	rs1063151	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154525458C>T	uc003inm.3	+	25	3343	c.3291C>T	c.(3289-3291)GCC>GCT	p.A1097A	KIAA0922_uc010ipp.2_Silent_p.A1098A|KIAA0922_uc010ipq.2_Silent_p.A866A	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	1097	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				AGAACACAGCCGAGTTCAAGG	0.428													13	12	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155241572	155241572	+	Missense_Mutation	SNP	G	A	A	rs11935573	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155241572G>A	uc003inw.2	-	14	3614	c.3614C>T	c.(3613-3615)TCA>TTA	p.S1205L		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1205	Cadherin 10.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTCATTTCCTGAGAGGATGCT	0.368													29	34	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155256177	155256177	+	Silent	SNP	A	G	G	rs6858157	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155256177A>G	uc003inw.2	-	8	1059	c.1059T>C	c.(1057-1059)GGT>GGC	p.G353G	DCHS2_uc003inx.2_Silent_p.G852G	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	353	Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTGTGAGCCCACCACCGTCTT	0.423													12	17	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155507590	155507590	+	Missense_Mutation	SNP	T	C	C	rs6050	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155507590T>C	uc003iod.1	-	5	1049	c.991A>G	c.(991-993)ACT>GCT	p.T331A	FGA_uc003ioe.1_Missense_Mutation_p.T331A|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	331	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CAGCTTCCAGTACTTCCAGGT	0.572													49	50	---	---	---	---	PASS
FGG	2266	broad.mit.edu	37	4	155525970	155525970	+	3'UTR	SNP	G	A	A	rs1049636	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155525970G>A	uc003ioj.2	-	9					FGG_uc003iog.2_Intron|FGG_uc003ioh.2_Intron|FGG_uc010ipx.2_Intron|FGG_uc010ipy.2_Intron|FGG_uc003ioi.2_3'UTR|FGG_uc003iok.2_3'UTR	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B						platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GTCAATAGAAGTTAGCAGTTA	0.388													25	22	---	---	---	---	PASS
MAP9	79884	broad.mit.edu	37	4	156274377	156274377	+	Missense_Mutation	SNP	T	C	C	rs1058992	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156274377T>C	uc003ios.2	-	11	1760	c.1496A>G	c.(1495-1497)AAG>AGG	p.K499R	MAP9_uc011cin.1_Missense_Mutation_p.K474R|MAP9_uc010iqa.1_RNA|MAP9_uc003iot.1_Missense_Mutation_p.K498R	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein	499	Potential.				cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TTCAGTTTTCTTCTTGTTTTT	0.333													18	17	---	---	---	---	PASS
MAP9	79884	broad.mit.edu	37	4	156297060	156297060	+	5'UTR	SNP	A	G	G	rs17377679	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156297060A>G	uc003ios.2	-	2					MAP9_uc011cin.1_5'UTR|MAP9_uc010iqa.1_RNA|MAP9_uc003iot.1_5'UTR|MAP9_uc010iqb.1_Intron	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein						cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TCAACTTCTGATAGTAGCTGA	0.303													11	13	---	---	---	---	PASS
GUCY1B3	2983	broad.mit.edu	37	4	156721198	156721198	+	Silent	SNP	C	T	T	rs2229202	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156721198C>T	uc003ipc.2	+	9	1314	c.1147C>T	c.(1147-1149)CTG>TTG	p.L383L	GUCY1B3_uc011cio.1_Silent_p.L405L|GUCY1B3_uc011cip.1_Silent_p.L363L|GUCY1B3_uc003ipd.2_Silent_p.L311L|GUCY1B3_uc010iqf.2_Silent_p.L383L|GUCY1B3_uc010iqg.2_Silent_p.L311L|GUCY1B3_uc011ciq.1_Silent_p.L311L	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	383					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		GTTAAGAGCCCTGGAAGATGA	0.398													6	14	---	---	---	---	PASS
ACCN5	51802	broad.mit.edu	37	4	156787340	156787340	+	Silent	SNP	G	A	A	rs6848883	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156787340G>A	uc003ipe.1	-	1	86	c.39C>T	c.(37-39)AAC>AAT	p.N13N		NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,	13	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)		TTTACTCACCGTTCTCAGCAT	0.348													25	30	---	---	---	---	PASS
PDGFC	56034	broad.mit.edu	37	4	157684248	157684248	+	Silent	SNP	T	C	C	rs3815861	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157684248T>C	uc003iph.1	-	6	1523	c.1032A>G	c.(1030-1032)GGA>GGG	p.G344G	PDGFC_uc003ipi.1_Silent_p.G181G|PDGFC_uc011cis.1_Silent_p.G181G|PDGFC_uc011cir.1_Silent_p.G188G	NM_016205	NP_057289	Q9NRA1	PDGFC_HUMAN	platelet-derived growth factor C precursor	344					central nervous system development|platelet-derived growth factor receptor signaling pathway|positive regulation of cell division|positive regulation of DNA replication|positive regulation of fibroblast proliferation|vascular endothelial growth factor receptor signaling pathway	endoplasmic reticulum lumen|extracellular space|Golgi membrane|nucleus	cell surface binding|growth factor activity|platelet-derived growth factor receptor binding|protein homodimerization activity			ovary(1)|lung(1)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		GCGGCTATCCTCCTGTGCTCC	0.542													15	11	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158238830	158238830	+	Silent	SNP	T	C	C	rs4302506	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158238830T>C	uc003ipm.3	+	5	1146	c.687T>C	c.(685-687)CAT>CAC	p.H229H	GRIA2_uc011cit.1_Silent_p.H182H|GRIA2_uc003ipl.3_Silent_p.H229H|GRIA2_uc003ipk.3_Silent_p.H182H|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	229	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	TTGGAAAACATGTTAAAGGGT	0.234													8	11	---	---	---	---	PASS
FNIP2	57600	broad.mit.edu	37	4	159782889	159782889	+	Missense_Mutation	SNP	G	T	T	rs62001915	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159782889G>T	uc003iqe.3	+	12	1609	c.1426G>T	c.(1426-1428)GCC>TCC	p.A476S		NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	476					DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		GAACATGCTGGCCAAAACACA	0.468													22	45	---	---	---	---	PASS
TKTL2	84076	broad.mit.edu	37	4	164393117	164393117	+	Missense_Mutation	SNP	T	A	A	rs11735477	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164393117T>A	uc003iqp.3	-	1	1931	c.1770A>T	c.(1768-1770)CAA>CAT	p.Q590H		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	590						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ACACTGCCAGTTGATGAACAA	0.488													18	28	---	---	---	---	PASS
C4orf43	55319	broad.mit.edu	37	4	164435265	164435265	+	Missense_Mutation	SNP	A	C	C	rs2304802	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164435265A>C	uc003iqq.3	+	4	475	c.194A>C	c.(193-195)CAA>CCA	p.Q65P		NM_018352	NP_060822	Q96EY4	CD043_HUMAN	hypothetical protein LOC55319	65											0						CTTGATCCCCAAAAAAAGAGA	0.358													14	25	---	---	---	---	PASS
MARCH1	55016	broad.mit.edu	37	4	164466824	164466824	+	Silent	SNP	C	T	T	rs13130399	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164466824C>T	uc003iqs.1	-	7	1472	c.495G>A	c.(493-495)GCG>GCA	p.A165A	MARCH1_uc003iqr.1_Silent_p.A148A	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I	165	Helical; (Potential).				antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CACAGGTGATCGCGATTACGT	0.428													22	25	---	---	---	---	PASS
GK3P	2713	broad.mit.edu	37	4	166199345	166199345	+	Missense_Mutation	SNP	C	T	T	rs55806488	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166199345C>T	uc003ird.3	-	1	1831	c.1453G>A	c.(1453-1455)GAG>AAG	p.E485K	KLHL2_uc003irb.2_Intron|KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_000167	NP_000158			glycerol kinase isoform b												0						TCAAACCGCTCCATCGTGACG	0.507													7	6	---	---	---	---	PASS
TLL1	7092	broad.mit.edu	37	4	166929102	166929102	+	Silent	SNP	G	A	A	rs17590218	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166929102G>A	uc003irh.1	+	7	1466	c.819G>A	c.(817-819)GAG>GAA	p.E273E	TLL1_uc011cjn.1_Silent_p.E273E|TLL1_uc011cjo.1_Silent_p.E97E	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	273	Metalloprotease (By similarity).				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TAGGTCAAGAGTACAATTTTC	0.413													20	29	---	---	---	---	PASS
SPOCK3	50859	broad.mit.edu	37	4	167675635	167675635	+	Intron	SNP	G	A	A	rs2305593	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167675635G>A	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron|SPOCK3_uc003irk.3_3'UTR	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		AACTATTTGCGTCTGTAAGGG	0.333													11	14	---	---	---	---	PASS
HAND2	9464	broad.mit.edu	37	4	174449842	174449842	+	Intron	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174449842C>T	uc003ith.1	-						NBLA00301_uc011ckd.1_5'Flank|NBLA00301_uc003itl.3_5'Flank|NBLA00301_uc003itj.2_5'Flank|NBLA00301_uc010irf.2_5'Flank|NBLA00301_uc010irg.2_5'Flank|NBLA00301_uc010irh.2_5'Flank|NBLA00301_uc010iri.2_5'Flank|NBLA00301_uc010irj.2_5'Flank|NBLA00301_uc010irk.2_5'Flank|NBLA00301_uc010irl.2_5'Flank|NBLA00301_uc010irm.2_5'Flank|NBLA00301_uc010irn.2_5'Flank|NBLA00301_uc003itk.2_5'Flank|HAND2_uc003itg.1_Intron|HAND2_uc010ire.1_Missense_Mutation_p.G200E	NM_021973	NP_068808	P61296	HAND2_HUMAN	basic helix-loop-helix transcription factor						adult heart development|angiogenesis|apoptosis|cardiac neural crest cell development involved in outflow tract morphogenesis|heart looping|in utero embryonic development|negative regulation of cardiac muscle cell apoptosis|noradrenergic neuron differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|regulation of secondary heart field cardioblast proliferation|thymus development	nuclear chromatin|transcription factor complex	activating transcription factor binding|protein homodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|transcription coactivator activity			skin(1)	1		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		GCACCAGTTCCCTGACCCCCT	0.567													6	2	---	---	---	---	PASS
FBXO8	26269	broad.mit.edu	37	4	175184199	175184199	+	Silent	SNP	T	C	C	rs150094030	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175184199T>C	uc003itp.2	-	2	895	c.45A>G	c.(43-45)CAA>CAG	p.Q15Q	FBXO8_uc003itq.2_Silent_p.Q15Q	NM_012180	NP_036312	Q9NRD0	FBX8_HUMAN	F-box only protein 8	15					regulation of ARF protein signal transduction|ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ARF guanyl-nucleotide exchange factor activity			breast(2)	2		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		AGCCTTCTTGTTGCAGCTGCT	0.478													20	13	---	---	---	---	PASS
HPGD	3248	broad.mit.edu	37	4	175443156	175443156	+	Silent	SNP	C	T	T	rs1050145	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175443156C>T	uc003itu.2	-	2	346	c.156G>A	c.(154-156)CAG>CAA	p.Q52Q	HPGD_uc003itv.2_Silent_p.Q52Q|HPGD_uc011ckf.1_5'UTR|HPGD_uc010irp.2_Intron|HPGD_uc010irq.2_Silent_p.Q52Q|HPGD_uc011ckg.1_Silent_p.Q52Q|HPGD_uc011ckh.1_5'UTR|HPGD_uc003itw.2_Silent_p.Q52Q|HPGD_uc003itx.2_Silent_p.Q52Q	NM_000860	NP_000851	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	52					female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity				0		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	NADH(DB00157)	GAGGTTCAAACTGCTCATCCA	0.522													46	61	---	---	---	---	PASS
ASB5	140458	broad.mit.edu	37	4	177142611	177142611	+	Silent	SNP	G	A	A	rs35698542	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177142611G>A	uc003iuq.1	-	4	541	c.525C>T	c.(523-525)GCC>GCT	p.A175A	ASB5_uc003iup.1_Silent_p.A122A	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	175	ANK 4.				intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		CTTTACTGGCGGCCTCATGCG	0.498													22	25	---	---	---	---	PASS
SPCS3	60559	broad.mit.edu	37	4	177249533	177249533	+	3'UTR	SNP	A	G	G	rs2278903	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177249533A>G	uc003iur.3	+	5						NM_021928	NP_068747	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3						energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	integral to membrane|microsome|signal peptidase complex	peptidase activity			ovary(1)	1		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		ATTGTATCTCATTAATCTCTT	0.269													2	5	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183674697	183674697	+	Silent	SNP	C	T	T	rs17263582	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183674697C>T	uc003ivd.1	+	20	3994	c.3957C>T	c.(3955-3957)GGC>GGT	p.G1319G	ODZ3_uc003ive.1_Silent_p.G732G	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1319	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CTCTTCTGGGCTCTAACGATT	0.393													16	12	---	---	---	---	PASS
MLF1IP	79682	broad.mit.edu	37	4	185616438	185616438	+	3'UTR	SNP	C	T	T	rs13478	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185616438C>T	uc003iwq.2	-	13					MLF1IP_uc003iwp.2_RNA	NM_024629	NP_078905	Q71F23	CENPU_HUMAN	MLF1 interacting protein						CenH3-containing nucleosome assembly at centromere|interspecies interaction between organisms|mitotic prometaphase|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|condensed chromosome kinetochore|cytosol|nucleoplasm					0		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		GTAGACTGCTCTTCTCATCCC	0.408													19	21	---	---	---	---	PASS
LRP2BP	55805	broad.mit.edu	37	4	186299260	186299260	+	Silent	SNP	A	G	G	rs2030802	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186299260A>G	uc003ixj.1	-	1	893	c.81T>C	c.(79-81)TTT>TTC	p.F27F	LRP2BP_uc003ixk.1_5'UTR|LRP2BP_uc011ckr.1_Silent_p.F27F	NM_018409	NP_060879	Q9P2M1	LR2BP_HUMAN	LRP2 binding protein	27						cytoplasm	protein binding				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)		TCCACTGGAAAAATTTTTGGT	0.378													25	24	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187531022	187531022	+	Missense_Mutation	SNP	A	G	G	rs28647489	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187531022A>G	uc003izf.2	-	15	10189	c.10001T>C	c.(10000-10002)GTG>GCG	p.V3334A		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	3334	Extracellular (Potential).|Cadherin 30.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TTGGCTGAACACAGGGGTATT	0.463										HNSCC(5;0.00058)			7	13	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187542755	187542755	+	Missense_Mutation	SNP	T	C	C	rs28489116	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187542755T>C	uc003izf.2	-	10	5173	c.4985A>G	c.(4984-4986)AAC>AGC	p.N1662S		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1662	Extracellular (Potential).|Cadherin 14.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						CGGAGAGGCGTTGTCAGCAAT	0.408										HNSCC(5;0.00058)			21	16	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187627855	187627855	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187627855C>T	uc003izf.2	-	2	3315	c.3127G>A	c.(3127-3129)GTG>ATG	p.V1043M	FAT1_uc010iso.1_Missense_Mutation_p.V1043M	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1043	Extracellular (Potential).|Cadherin 9.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TCTTCTTTCACTGTCCCCTTT	0.478										HNSCC(5;0.00058)			26	37	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187629896	187629896	+	Silent	SNP	G	A	A	rs11722204	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187629896G>A	uc003izf.2	-	2	1274	c.1086C>T	c.(1084-1086)GCC>GCT	p.A362A	FAT1_uc010iso.1_Silent_p.A362A	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	362	Extracellular (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TGACTGGCCCGGCTTTGAACT	0.448										HNSCC(5;0.00058)			23	22	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189012680	189012680	+	Silent	SNP	G	A	A	rs17881718	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189012680G>A	uc003izl.2	-	7	1047	c.1011C>T	c.(1009-1011)ACC>ACT	p.T337T	TRIML2_uc003izj.1_Silent_p.T165T|TRIML2_uc003izk.1_Silent_p.T145T|TRIML2_uc011cle.1_Silent_p.T412T	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	337	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GGGACATCTCGGTCACATTGT	0.488													31	47	---	---	---	---	PASS
EEF1E1	9521	broad.mit.edu	37	6	8097597	8097597	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8097597G>A	uc003mxz.2	-	2	265	c.191C>T	c.(190-192)ACT>ATT	p.T64I	EEF1E1_uc011dic.1_Missense_Mutation_p.T64I	NM_004280	NP_004271	O43324	MCA3_HUMAN	eukaryotic translation elongation factor 1	64	GST C-terminal.				negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of DNA damage response, signal transduction by p53 class mediator|tRNA aminoacylation for protein translation	cytosol|nucleus					0	Ovarian(93;0.0398)					TTCTTCTGCAGTACTCCCCAG	0.428													7	61	---	---	---	---	PASS
HLA-DRB5	3127	broad.mit.edu	37	6	32521691	32521691	+	Intron	SNP	A	G	G	rs113051760	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32521691A>G	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_RNA|HLA-DRB6_uc003obn.1_RNA	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						GGCCCAGCACAAAGCCCCCGA	0.488													3	5	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66013290	66013290	+	Intron	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66013290C>T	uc011dxu.1	-						uc011dxv.1_Silent_p.G292G	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						TTTCGACAGGCGGTGACAGTG	0.488													3	9	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12428649	12428649	+	Intron	SNP	T	C	C	rs593329		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12428649T>C	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		TGGTGCTGCTTGGAGTACCAA	0.239													3	9	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12428650	12428650	+	Intron	SNP	G	A	A	rs593330		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12428650G>A	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		GGTGCTGCTTGGAGTACCAAA	0.239													3	9	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110439239	110439239	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110439239G>A	uc003yne.2	+	25	2958	c.2854G>A	c.(2854-2856)GCT>ACT	p.A952T		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	952	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGGCCTCCCCGCTGCTGTGTC	0.443										HNSCC(38;0.096)			6	36	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790187	78790187	+	Intron	SNP	G	C	C	rs10118321		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790187G>C	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.W681S|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						ggaatggaatggaatcgaatc	0.119													3	2	---	---	---	---	PASS
SARDH	1757	broad.mit.edu	37	9	136597652	136597652	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136597652G>A	uc004cep.3	-	3	537	c.403C>T	c.(403-405)CGG>TGG	p.R135W	SARDH_uc004ceo.2_Missense_Mutation_p.R135W|SARDH_uc011mdn.1_Missense_Mutation_p.R135W|SARDH_uc011mdo.1_5'UTR	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	135					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		TCCAGCTCCCGGCTCACCACC	0.677													11	41	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1081737	1081737	+	Silent	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1081737C>T	uc001lsx.1	+	13	1692	c.1665C>T	c.(1663-1665)AAC>AAT	p.N555N		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	555	VWFD 2.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCTTTGCCAACACCTGGAAGG	0.652													4	9	---	---	---	---	PASS
ILK	3611	broad.mit.edu	37	11	6630105	6630105	+	Intron	SNP	T	G	G			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6630105T>G	uc001mee.2	+						ILK_uc001mef.2_Intron|ILK_uc010rap.1_Intron|ILK_uc010raq.1_Intron|ILK_uc001meg.2_5'UTR|ILK_uc001meh.2_Intron|ILK_uc001mei.2_5'Flank	NM_001014794	NP_001014794	Q13418	ILK_HUMAN	integrin-linked kinase						cell junction assembly|cell proliferation|cell-matrix adhesion|integrin-mediated signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent	cytosol|focal adhesion	ATP binding|protein serine/threonine kinase activity			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		AGGTTGTTTTTCTTCCCTAGA	0.562													5	42	---	---	---	---	PASS
C11orf83	790955	broad.mit.edu	37	11	62439569	62439569	+	Missense_Mutation	SNP	G	A	A	rs13941	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62439569G>A	uc001nui.3	+	2	357	c.265G>A	c.(265-267)GGC>AGC	p.G89S	C11orf48_uc001nue.2_5'Flank|C11orf48_uc001nuf.2_5'Flank|C11orf48_uc010rmd.1_5'Flank	NM_001085372	NP_001078841	Q6UW78	CK083_HUMAN	hypothetical protein LOC790955 precursor	89				G -> S (in Ref. 1; AAQ89294 and 3; AAH90057).		extracellular region					0						AGGCGGCGCCGGCGGGAGGTC	0.682													8	4	---	---	---	---	PASS
SLC22A10	387775	broad.mit.edu	37	11	63059054	63059054	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63059054C>G	uc009yor.2	+	2	653	c.445C>G	c.(445-447)CAA>GAA	p.Q149E	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_Missense_Mutation_p.Q97E	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	149	Helical; (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						ATCAGTGGTTCAATTCCTACT	0.468													4	23	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128868319	128868319	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128868319T>C	uc009zcp.2	-	11	1048	c.1048A>G	c.(1048-1050)ATG>GTG	p.M350V	ARHGAP32_uc009zcq.1_Missense_Mutation_p.M310V|ARHGAP32_uc009zco.2_5'UTR|ARHGAP32_uc001qez.2_Missense_Mutation_p.M1V|ARHGAP32_uc001qfb.2_Missense_Mutation_p.M135V	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	350					cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						CGAGACTTCATGAATGTTCGT	0.403													14	50	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49430959	49430959	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49430959G>A	uc001rta.3	-	34	10180	c.10180C>T	c.(10180-10182)CAG>TAG	p.Q3394*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3394	Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCCAATTGCTGCGGCTTCATG	0.537			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	17	---	---	---	---	PASS
APOF	319	broad.mit.edu	37	12	56755647	56755647	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56755647C>T	uc001sle.1	-	2	397	c.343G>A	c.(343-345)GGT>AGT	p.G115S		NM_001638	NP_001629	Q13790	APOF_HUMAN	apolipoprotein F precursor	115					cholesterol metabolic process	high-density lipoprotein particle|low-density lipoprotein particle	cholesterol binding|lipid transporter activity|receptor binding				0						TTCACACCACCCTGGCGGTAG	0.557													3	11	---	---	---	---	PASS
SSH1	54434	broad.mit.edu	37	12	109181845	109181845	+	Missense_Mutation	SNP	C	G	G	rs146644569		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109181845C>G	uc001tnm.2	-	15	3156	c.3069G>C	c.(3067-3069)AGG>AGC	p.R1023S	SSH1_uc001tnl.2_Missense_Mutation_p.R711S	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1	1023	Interaction with YWHAG.				actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						CAGCTGGGTCCCTCGGGGTTC	0.572													7	61	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20644585	20644585	+	Intron	SNP	C	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20644585C>T	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron|uc010tyy.1_3'UTR					RecName: Full=Putative HERC2-like protein 3;																		CTCTGAGTGACGGCACTGCAC	0.617													2	0	---	---	---	---	PASS
ANXA2	302	broad.mit.edu	37	15	60690089	60690089	+	Intron	SNP	A	G	G	rs12904657	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60690089A>G	uc002agn.2	-						ANXA2_uc002agk.2_Intron|ANXA2_uc002agl.2_Intron|ANXA2_uc002agm.2_Silent_p.C8C|ANXA2_uc010uhd.1_Intron|ANXA2_uc010bgj.2_Intron	NM_001136015	NP_001129487	P07355	ANXA2_HUMAN	annexin A2 isoform 2						angiogenesis|positive regulation of vesicle fusion|skeletal system development	basement membrane|melanosome|midbody|soluble fraction	calcium ion binding|calcium-dependent phospholipid binding|cytoskeletal protein binding|phospholipase inhibitor activity			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Tenecteplase(DB00031)	CAGCGTCTCCACACCCCGCTA	0.741													3	1	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9858034	9858034	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9858034C>A	uc002czo.3	-	13	3915	c.3367G>T	c.(3367-3369)GAG>TAG	p.E1123*	GRIN2A_uc010uym.1_Nonsense_Mutation_p.E1123*|GRIN2A_uc010uyn.1_Nonsense_Mutation_p.E966*|GRIN2A_uc002czr.3_Nonsense_Mutation_p.E1123*	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1123	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GGCTCCTTCTCACCATCTATA	0.522													10	60	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20554289	20554289	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20554289G>A	uc002dhj.3	-	13	1666	c.1456C>T	c.(1456-1458)CCT>TCT	p.P486S	ACSM2B_uc002dhk.3_Missense_Mutation_p.P486S|ACSM2B_uc010bwf.1_Missense_Mutation_p.P486S	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	486					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding	p.P486S(1)		skin(3)|ovary(1)|central_nervous_system(1)	5						ACCACAGCAGGGTGCTTCATC	0.557													4	36	---	---	---	---	PASS
BLMH	642	broad.mit.edu	37	17	28616489	28616489	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28616489T>C	uc002hez.1	-	3	460	c.223A>G	c.(223-225)ATC>GTC	p.I75V	BLMH_uc010wbn.1_Intron	NM_000386	NP_000377	Q13867	BLMH_HUMAN	bleomycin hydrolase	75					proteolysis	cytoplasm|nucleus	aminopeptidase activity|carboxypeptidase activity|cysteine-type endopeptidase activity|protein binding			ovary(1)	1						CAAGAAAAGATCCAGCATCGC	0.383													2	7	---	---	---	---	PASS
KRT14	3861	broad.mit.edu	37	17	39742898	39742898	+	Silent	SNP	G	A	A	rs11551758	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39742898G>A	uc002hxf.1	-	1	250	c.189C>T	c.(187-189)TAC>TAT	p.Y63Y	JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Silent_p.C63C	NM_000526	NP_000517	P02533	K1C14_HUMAN	keratin 14	63	Head.				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.000307)				CCCCCAGCCCGCAGGCTCCCC	0.527													2	2	---	---	---	---	PASS
SPOP	8405	broad.mit.edu	37	17	47696432	47696432	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47696432A>G	uc010dbk.2	-	6	1023	c.391T>C	c.(391-393)TGG>CGG	p.W131R	SPOP_uc002ipb.2_Missense_Mutation_p.W131R|SPOP_uc002ipc.2_Missense_Mutation_p.W131R|SPOP_uc002ipd.2_Missense_Mutation_p.W131R|SPOP_uc002ipe.2_Missense_Mutation_p.W131R|SPOP_uc002ipf.2_Missense_Mutation_p.W131R|SPOP_uc002ipg.2_Missense_Mutation_p.W131R	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein	131	MATH.|Required for nuclear localization.				mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						TTGAATCCCCAGTCTTTGCCT	0.458										Prostate(2;0.17)			6	62	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62852005	62852005	+	Silent	SNP	G	T	T	rs140806799	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62852005G>T	uc002jey.2	-	13	5343	c.4812C>A	c.(4810-4812)ATC>ATA	p.I1604I	LRRC37A3_uc010wqg.1_Silent_p.I722I|LRRC37A3_uc002jex.1_Silent_p.I581I|LRRC37A3_uc010wqf.1_Silent_p.I642I	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1604	Cytoplasmic (Potential).					integral to membrane					0						GGTGACAACAGATCTGTTTTA	0.284													6	43	---	---	---	---	PASS
GRIN3B	116444	broad.mit.edu	37	19	1003221	1003221	+	Missense_Mutation	SNP	C	A	A	rs35592366	byFrequency	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1003221C>A	uc002lqo.1	+	2	519	c.519C>A	c.(517-519)GAC>GAA	p.D173E		NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	173	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	CCTGGGAAGACGTCGGCCTGG	0.711													2	3	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55341560	55341560	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55341560G>A	uc002qhk.3	+	9	1228	c.1165G>A	c.(1165-1167)GAT>AAT	p.D389N	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.D314N|KIR3DL1_uc010esf.2_Missense_Mutation_p.D294N|KIR3DL1_uc010yfo.1_Missense_Mutation_p.D331N|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	389	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		CCAGGACTCTGATGAACAAGA	0.527													22	112	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	11015012	11015012	+	RNA	SNP	G	A	A			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11015012G>A	uc002yis.1	-	7		c.1434C>T						P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGGAAGATAAGCTTGCACAAG	0.408													3	9	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8421207	8421208	+	Frame_Shift_Ins	INS	-	G	G			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8421207_8421208insG	uc001ape.2	-	19	3169_3170	c.2359_2360insC	c.(2359-2361)CAGfs	p.Q787fs	RERE_uc001apf.2_Frame_Shift_Ins_p.Q787fs|RERE_uc010nzx.1_Frame_Shift_Ins_p.Q519fs|RERE_uc001apd.2_Frame_Shift_Ins_p.Q233fs	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	787	Pro-rich.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		AGCCTGTGGCTGGTTAGGGGCC	0.624													4	3	---	---	---	---	
TCTEX1D1	200132	broad.mit.edu	37	1	67242226	67242227	+	Intron	DEL	AT	-	-	rs72385752		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67242226_67242227delAT	uc001dcv.2	+						TCTEX1D1_uc009wau.2_Intron|TCTEX1D1_uc009wav.2_Intron	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1												0						CATATTCTACATATAtgtgtgt	0.248													4	2	---	---	---	---	
PHGDH	26227	broad.mit.edu	37	1	120283125	120283125	+	Frame_Shift_Del	DEL	C	-	-			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120283125delC	uc001ehz.2	+	9	1289	c.1062delC	c.(1060-1062)ATCfs	p.I354fs	PHGDH_uc009whm.2_Frame_Shift_Del_p.I252fs|PHGDH_uc001eia.2_Frame_Shift_Del_p.I353fs|PHGDH_uc009whn.2_Frame_Shift_Del_p.I354fs|PHGDH_uc001eib.2_Frame_Shift_Del_p.I320fs|PHGDH_uc001eic.2_5'Flank	NM_006623	NP_006614	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	354					brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)	AAGGGACCATCCAGGTGATAA	0.602													4	2	---	---	---	---	
CPSF3	51692	broad.mit.edu	37	2	9597277	9597282	+	Intron	DEL	TGTGTG	-	-			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9597277_9597282delTGTGTG	uc002qzo.1	+						CPSF3_uc010ewx.1_Intron|CPSF3_uc002qzp.1_Intron|CPSF3_uc002qzq.1_Intron	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		GGAAAgtatatgtgtgtgtgtgtgtg	0.209													4	2	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196281881	196281882	+	Intron	INS	-	AGGTAGAATTA	AGGTAGAATTA	rs147559216	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196281881_196281882insAGGTAGAATTA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AGAGTGCGGTTAGGTAGAATTA	0.371													4	2	---	---	---	---	
RNF175	285533	broad.mit.edu	37	4	154633581	154633581	+	Intron	DEL	A	-	-	rs33952548		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154633581delA	uc003int.2	-							NM_173662	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175							integral to membrane	zinc ion binding			ovary(1)|pancreas(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				ATATCCCCAGAAACATTCAAG	0.318													2	4	---	---	---	---	
SLC26A8	116369	broad.mit.edu	37	6	35928440	35928441	+	Intron	INS	-	A	A	rs68027857		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35928440_35928441insA	uc003olm.2	-						SLC26A8_uc010jwa.2_Intron|SLC26A8_uc003olk.2_Intron|SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						actctgtctccaaaaaaaaaaa	0.183													4	2	---	---	---	---	
HACE1	57531	broad.mit.edu	37	6	105300070	105300071	+	Intron	INS	-	TG	TG			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105300070_105300071insTG	uc003pqu.1	-						HACE1_uc010kcy.1_Intron|HACE1_uc010kcz.1_Intron	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		TATGTCCAAACtgtctgtgtgt	0.119													6	3	---	---	---	---	
SLC2A12	154091	broad.mit.edu	37	6	134373388	134373389	+	Intron	INS	-	ACACACAC	ACACACAC	rs150064447		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134373388_134373389insACACACAC	uc003qem.1	-							NM_145176	NP_660159	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity			ovary(1)	1	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		CGCGCGCGcatacacacacaca	0.455													4	2	---	---	---	---	
MYL10	93408	broad.mit.edu	37	7	101266148	101266149	+	Intron	INS	-	G	G			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101266148_101266149insG	uc003uyr.2	-							NM_138403	NP_612412	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory							mitochondrion	calcium ion binding			ovary(1)|breast(1)	2						AGACAGTGGCTGCCTTTACCCT	0.634													4	2	---	---	---	---	
FAM171A1	221061	broad.mit.edu	37	10	15256160	15256160	+	Frame_Shift_Del	DEL	C	-	-			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15256160delC	uc001iob.2	-	8	1434	c.1427delG	c.(1426-1428)GGCfs	p.G476fs		NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor	476	Cytoplasmic (Potential).					integral to membrane				ovary(2)|breast(1)|skin(1)	4						GGACTCGTAGCCTTCTCTTTC	0.483													45	8	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61832387	61832388	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61832387_61832388insT	uc001jky.2	-	37	8443_8444	c.8251_8252insA	c.(8251-8253)ATAfs	p.I2751fs	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	2751					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						GCTCTCCTGTATTTTTTTAACT	0.401													75	8	---	---	---	---	
AMBRA1	55626	broad.mit.edu	37	11	46450139	46450140	+	Intron	INS	-	T	T	rs142253407	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46450139_46450140insT	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		tcttcttcttcttctttttttt	0.376													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129497863	129497864	+	IGR	INS	-	TT	TT	rs10655206		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129497863_129497864insTT								GLT1D1 (28354 upstream) : TMEM132D (58407 downstream)																							TGGCAGAATCCTTTTTTTTTTT	0.371													4	2	---	---	---	---	
PGAM5	192111	broad.mit.edu	37	12	133294826	133294827	+	Intron	INS	-	C	C	rs149250932	by1000genomes	TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133294826_133294827insC	uc009zyv.2	+						PGAM5_uc010tbr.1_Intron|PGAM5_uc001uku.2_Intron	NM_138575	NP_612642	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5							integral to membrane|mitochondrial outer membrane	phosphoprotein phosphatase activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		GGCCTCACCAGCCCCCGGGCGT	0.564													3	3	---	---	---	---	
SEC23A	10484	broad.mit.edu	37	14	39517656	39517656	+	Intron	DEL	A	-	-			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39517656delA	uc001wup.1	-						SEC23A_uc010tqa.1_Intron|SEC23A_uc010tqb.1_Intron	NM_006364	NP_006355	Q15436	SC23A_HUMAN	SEC23-related protein A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|Golgi membrane|smooth endoplasmic reticulum membrane	protein binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		catccctaccaaaaaaaaaaa	0.010													4	2	---	---	---	---	
DECR2	26063	broad.mit.edu	37	16	460579	460579	+	Intron	DEL	T	-	-	rs11315123		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:460579delT	uc002chb.2	+						DECR2_uc002chc.2_Intron|DECR2_uc010bqv.2_Intron|DECR2_uc002chd.2_Intron|DECR2_uc002che.1_Intron	NM_020664	NP_065715	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2							peroxisome	2,4-dienoyl-CoA reductase (NADPH) activity|binding				0		Hepatocellular(16;0.00015)				GGCCTCCCCCTGACGGCCGCC	0.781													4	2	---	---	---	---	
TSC2	7249	broad.mit.edu	37	16	2112113	2112114	+	Intron	INS	-	G	G			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2112113_2112114insG	uc002con.2	+						TSC2_uc010bsd.2_Intron|TSC2_uc002coo.2_Intron|TSC2_uc010uvv.1_Intron|TSC2_uc010uvw.1_Intron|TSC2_uc002cop.2_Intron	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1						cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				AAGGGCCAGGTGGGCGCCTGCT	0.639			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28596110	28596110	+	Intron	DEL	A	-	-			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28596110delA	uc010vct.1	-						CCDC101_uc002dqf.2_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		actccatctcaaaaaaaaaaa	0.239													4	2	---	---	---	---	
CHD9	80205	broad.mit.edu	37	16	53269089	53269089	+	Intron	DEL	C	-	-			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53269089delC	uc002ehb.2	+						CHD9_uc002egy.2_Intron|CHD9_uc002eha.1_Intron|CHD9_uc002ehc.2_Intron|CHD9_uc002ehf.2_5'UTR|CHD9_uc002ehd.2_Intron|CHD9_uc002ehe.1_5'UTR	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				CTTTGTTTTTCCACAAAGGAC	0.358													4	2	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26710061	26710062	+	Intron	INS	-	AGAG	AGAG	rs55746736		TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26710061_26710062insAGAG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						cacacacacacagagagagaga	0.000													4	2	---	---	---	---	
ODZ1	10178	broad.mit.edu	37	X	123838709	123838710	+	Intron	DEL	AA	-	-			TCGA-EJ-5531-01	TCGA-EJ-5531-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123838709_123838710delAA	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GGTTAGGAAGAAAAAAAAAAAA	0.356													5	3	---	---	---	---	
