Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC9A1	6548	broad.mit.edu	37	1	27480528	27480528	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27480528G>A	uc001bnm.2	-	1	924	c.298C>T	c.(298-300)CGC>TGC	p.R100C	SLC9A1_uc010ofk.1_5'UTR|SLC9A1_uc001bnn.2_Missense_Mutation_p.R100C	NM_003047	NP_003038	P19634	SL9A1_HUMAN	solute carrier family 9, isoform A1	100	Extracellular (Potential).				regulation of pH	integral to membrane	sodium:hydrogen antiporter activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	AAGGGGGTGCGCACGTGTGTG	0.592													4	134	---	---	---	---	PASS
AK2	204	broad.mit.edu	37	1	33476292	33476292	+	3'UTR	SNP	A	G	G	rs74066439		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33476292A>G	uc001bwo.1	-	7					uc001bwn.2_Intron|AK2_uc010ohq.1_3'UTR|AK2_uc009vud.1_3'UTR	NM_013411	NP_037543	P54819	KAD2_HUMAN	adenylate kinase 2 isoform b						nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TGTTGTTCCAAGTATTCCTCT	0.473													6	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803363	142803363	+	Intron	SNP	T	C	C	rs61814263		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803363T>C	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		tagagtcttattatgtttccc	0.095													2	9	---	---	---	---	PASS
LOC728989	728989	broad.mit.edu	37	1	146494538	146494538	+	Missense_Mutation	SNP	G	A	A	rs141949470	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146494538G>A	uc001epd.2	-	4	535	c.461C>T	c.(460-462)GCG>GTG	p.A154V		NR_024442				SubName: Full=cDNA FLJ59595, highly similar to Homo sapiens phosphodiesterase 4D interacting protein, transcript variant 1, mRNA;												0						TGGCAGGGCCGCTCTCCAGAA	0.572													5	38	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148176199	148176199	+	Intron	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148176199C>T	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_RNA|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						CAAGTGGTTTCGGAAGTGATC	0.413													2	2	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158626393	158626393	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158626393G>C	uc001fst.1	-	20	3058	c.2859C>G	c.(2857-2859)GAC>GAG	p.D953E		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	953	Spectrin 10.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTTTCATACTGTCTCCAAATG	0.413													71	181	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	177001717	177001717	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177001717G>C	uc001glc.2	-	3	952	c.740C>G	c.(739-741)ACT>AGT	p.T247S	ASTN1_uc001glb.1_Missense_Mutation_p.T247S|ASTN1_uc001gld.1_Missense_Mutation_p.T247S|ASTN1_uc009wwx.1_Missense_Mutation_p.T247S|ASTN1_uc001gle.3_RNA	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	247					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GCGCAGATCAGTGATGTCATA	0.622													18	106	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216371806	216371806	+	Missense_Mutation	SNP	G	A	A	rs79279902		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216371806G>A	uc001hku.1	-	18	4319	c.3932C>T	c.(3931-3933)TCG>TTG	p.S1311L	USH2A_uc001hkv.2_Missense_Mutation_p.S1311L	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1311	Fibronectin type-III 3.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTCATTGGCCGATTCTACAAA	0.413										HNSCC(13;0.011)			53	121	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220142002	220142002	+	3'UTR	SNP	T	G	G			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220142002T>G	uc001hly.1	-	32						NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase						glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	CACTGTTAACTTAGGCATAAG	0.274													3	9	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240371504	240371504	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371504C>T	uc010pyd.1	+	5	3617	c.3392C>T	c.(3391-3393)CCT>CTT	p.P1131L	FMN2_uc010pye.1_Missense_Mutation_p.P1135L	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1131	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGCATACCCCCTCCTCCCCCT	0.716													3	6	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240371526	240371526	+	Silent	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371526G>A	uc010pyd.1	+	5	3639	c.3414G>A	c.(3412-3414)GCG>GCA	p.A1138A	FMN2_uc010pye.1_Silent_p.A1142A	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1138	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTCCCGGAGCGGGCATACCTC	0.716													3	8	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240371601	240371601	+	Silent	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371601C>T	uc010pyd.1	+	5	3714	c.3489C>T	c.(3487-3489)CCC>CCT	p.P1163P	FMN2_uc010pye.1_Silent_p.P1167P	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1163	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CGGGCATACCCCCACCTCCCC	0.692													2	1	---	---	---	---	PASS
TFB2M	64216	broad.mit.edu	37	1	246729332	246729332	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246729332G>A	uc001ibn.2	-	1	234	c.109C>T	c.(109-111)CCG>TCG	p.P37S	CNST_uc001ibo.3_5'Flank|CNST_uc001ibp.2_5'Flank|TFB2M_uc010pys.1_RNA	NM_022366	NP_071761	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	37					positive regulation of transcription, DNA-dependent|transcription initiation from mitochondrial promoter	mitochondrial nucleoid	protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity|transcription cofactor activity			ovary(1)	1	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			TTCCTCGCCGGCAAATGCTTT	0.627													4	101	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27457443	27457443	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27457443G>A	uc002rji.2	+	23	3838	c.3676G>A	c.(3676-3678)GTT>ATT	p.V1226I	CAD_uc010eyw.2_Missense_Mutation_p.V1163I	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1226	CPSase B.|ATP-grasp 2.|CPSase (Carbamoyl-phosphate synthase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CTTCCCCTTCGTTTCCAAGAC	0.507													48	99	---	---	---	---	PASS
HTRA2	27429	broad.mit.edu	37	2	74758721	74758721	+	Intron	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74758721C>T	uc002smi.1	+						AUP1_uc002smf.2_5'Flank|AUP1_uc002smg.2_5'Flank|AUP1_uc002smh.2_5'Flank|AUP1_uc010yrx.1_5'Flank|AUP1_uc010yry.1_5'Flank|HTRA2_uc002smj.1_Intron|HTRA2_uc002smk.1_Nonsense_Mutation_p.Q323*|HTRA2_uc002sml.1_Intron|HTRA2_uc002smm.1_Intron|HTRA2_uc002smn.1_Intron|HTRA2_uc010ffl.2_3'UTR	NM_013247	NP_037379	O43464	HTRA2_HUMAN	HtrA serine peptidase 2 isoform 1 preproprotein						apoptosis|proteolysis|response to stress	CD40 receptor complex|endoplasmic reticulum membrane|internal side of plasma membrane|mitochondrial intermembrane space|mitochondrial membrane|nucleus	serine-type endopeptidase activity|unfolded protein binding			ovary(1)	1						TGTATCCCTGCAGGATGGGGA	0.522													19	42	---	---	---	---	PASS
UQCRC1	7384	broad.mit.edu	37	3	48638151	48638151	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48638151C>T	uc003cub.1	-	9	1134	c.1089G>A	c.(1087-1089)ATG>ATA	p.M363I	UQCRC1_uc003cua.1_Missense_Mutation_p.M248I|UQCRC1_uc003cuc.1_Missense_Mutation_p.M364I|UQCRC1_uc003cud.1_Missense_Mutation_p.M362I	NM_003365	NP_003356	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I	363					aerobic respiration|proteolysis		metalloendopeptidase activity|ubiquinol-cytochrome-c reductase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	Atovaquone(DB01117)	CATCGATTTTCATTCGGTCAC	0.542													14	92	---	---	---	---	PASS
SLC41A3	54946	broad.mit.edu	37	3	125725761	125725761	+	Intron	SNP	T	G	G			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125725761T>G	uc003eij.2	-						SLC41A3_uc003eii.2_3'UTR|SLC41A3_uc003eil.2_3'UTR|SLC41A3_uc003eik.2_Intron|SLC41A3_uc011bkh.1_3'UTR	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3 isoform 1							integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(114;0.167)		GAGGCAGGGGTCAACCATCCC	0.522													7	22	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154557748	154557748	+	3'UTR	SNP	C	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154557748C>A	uc003inm.3	+	35					KIAA0922_uc010ipp.2_3'UTR|KIAA0922_uc010ipq.2_3'UTR	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				GATTTTTAAACAATGTGAATA	0.343													7	75	---	---	---	---	PASS
GZMA	3001	broad.mit.edu	37	5	54405924	54405924	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54405924G>A	uc003jpm.2	+	5	740	c.703G>A	c.(703-705)GGA>AGA	p.G235R		NM_006144	NP_006135	P12544	GRAA_HUMAN	granzyme A precursor	235	Peptidase S1.				cleavage of lamin|cytolysis|immune response|negative regulation of DNA binding|negative regulation of endodeoxyribonuclease activity|negative regulation of oxidoreductase activity|positive regulation of apoptosis	extracellular region|immunological synapse|nucleus	protein homodimerization activity|serine-type endopeptidase activity	p.G235A(1)		ovary(2)|pancreas(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				AAATAAATGCGGAGACCCTCG	0.468													35	106	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149212486	149212486	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149212486A>T	uc003lrc.2	+	5	892	c.850A>T	c.(850-852)ATG>TTG	p.M284L	PPARGC1B_uc003lrb.1_Missense_Mutation_p.M284L|PPARGC1B_uc003lrd.2_Missense_Mutation_p.M245L|PPARGC1B_uc003lrf.2_Missense_Mutation_p.M263L|PPARGC1B_uc003lre.1_Missense_Mutation_p.M263L	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	284					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CCAGGAAGACATGCAGGCGAT	0.672													31	87	---	---	---	---	PASS
SLC26A2	1836	broad.mit.edu	37	5	149360521	149360521	+	Silent	SNP	T	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149360521T>A	uc003lrh.2	+	3	1633	c.1365T>A	c.(1363-1365)CTT>CTA	p.L455L		NM_000112	NP_000103	P50443	S26A2_HUMAN	solute carrier family 26 member 2	455	Helical; (Potential).					integral to plasma membrane|membrane fraction	secondary active sulfate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ATACTCAGCTTTCTGGTGTGG	0.418													39	92	---	---	---	---	PASS
NKAPL	222698	broad.mit.edu	37	6	28227527	28227527	+	Silent	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28227527G>A	uc003nkt.2	+	1	430	c.378G>A	c.(376-378)GAG>GAA	p.E126E	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	126										upper_aerodigestive_tract(1)|ovary(1)	2						AGGAGAGAGAGAGGATTGGGG	0.542													38	73	---	---	---	---	PASS
MAS1L	116511	broad.mit.edu	37	6	29454710	29454710	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29454710T>C	uc011dlq.1	-	1	970	c.970A>G	c.(970-972)AGG>GGG	p.R324G		NM_052967	NP_443199	P35410	MAS1L_HUMAN	MAS1 oncogene-like	324	Cytoplasmic (Potential).					cytoplasm|integral to membrane|nucleus|plasma membrane	G-protein coupled receptor activity			ovary(7)|lung(2)	9						TCCTTCAGCCTTTTCTTTCTG	0.463													5	220	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112486397	112486397	+	Missense_Mutation	SNP	G	A	A	rs138153075	byFrequency	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112486397G>A	uc003pvu.2	-	13	1942	c.1633C>T	c.(1633-1635)CGT>TGT	p.R545C	LAMA4_uc003pvv.2_Missense_Mutation_p.R538C|LAMA4_uc003pvt.2_Missense_Mutation_p.R538C	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	545	Domain II and I.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AGAGTTAGACGAGGTGTTGTC	0.448													35	83	---	---	---	---	PASS
TIAM2	26230	broad.mit.edu	37	6	155578396	155578396	+	3'UTR	SNP	T	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155578396T>A	uc003qqb.2	+	29					TIAM2_uc003qqe.2_3'UTR|TIAM2_uc010kjj.2_3'UTR|TIAM2_uc003qqf.2_3'UTR|TIAM2_uc003qqg.2_3'UTR|TIAM2_uc003qqh.2_3'UTR|uc003qqi.1_5'Flank	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		AAAATGGTTGTAAAGATTTAA	0.294													2	4	---	---	---	---	PASS
TMEM60	85025	broad.mit.edu	37	7	77423241	77423241	+	3'UTR	SNP	A	C	C			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77423241A>C	uc003ugn.2	-	2						NM_032936	NP_116325	Q9H2L4	TMM60_HUMAN	transmembrane protein 60							integral to membrane					0						GAACACTTTAATGGTAACTTG	0.363													18	28	---	---	---	---	PASS
WNT2	7472	broad.mit.edu	37	7	116937778	116937778	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116937778G>C	uc003viz.2	-	4	1041	c.741C>G	c.(739-741)AAC>AAG	p.N247K	WNT2_uc003vja.2_Missense_Mutation_p.N151K	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	247					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		TGCCATCCTGGTTCATGACCA	0.498													61	120	---	---	---	---	PASS
TRYX3	136541	broad.mit.edu	37	7	141955370	141955370	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141955370G>A	uc003vxb.2	-	2	484	c.164C>T	c.(163-165)GCA>GTA	p.A55V	TRYX3_uc003vxc.3_Missense_Mutation_p.A55V	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN	trypsin X3 precursor	55	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0	Melanoma(164;0.0272)					ATTGCAGTGTGCAGCTGTGAT	0.522													33	78	---	---	---	---	PASS
C10orf71	118461	broad.mit.edu	37	10	50531524	50531524	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50531524C>A	uc010qgp.1	+	3	1273	c.934C>A	c.(934-936)CTA>ATA	p.L312I		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	312											0						CACGACCTTGCTAAGAGAACC	0.577													3	65	---	---	---	---	PASS
OIT3	170392	broad.mit.edu	37	10	74653450	74653450	+	5'UTR	SNP	G	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74653450G>T	uc001jte.1	+	1					OIT3_uc009xqs.1_RNA	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor							nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					AGTCTTTCTCGTGAGAGCCTA	0.478													9	20	---	---	---	---	PASS
TACC2	10579	broad.mit.edu	37	10	123954657	123954657	+	Silent	SNP	C	T	T	rs138045107	byFrequency	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123954657C>T	uc001lfv.2	+	8	6297	c.5937C>T	c.(5935-5937)CCC>CCT	p.P1979P	TACC2_uc001lfw.2_Silent_p.P125P|TACC2_uc009xzx.2_Silent_p.P1934P|TACC2_uc010qtv.1_Silent_p.P1983P|TACC2_uc001lfx.2_5'UTR|TACC2_uc001lfy.2_5'UTR|TACC2_uc001lfz.2_Silent_p.P57P|TACC2_uc001lga.2_Silent_p.P57P|TACC2_uc009xzy.2_Silent_p.P57P|TACC2_uc010qtw.1_Silent_p.P74P	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	1979	Pro-rich.					microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TCCCAGAACCCGAGGTCAGCA	0.622													26	53	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124358388	124358388	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124358388G>A	uc001lgk.1	+	26	3161	c.3055G>A	c.(3055-3057)GAT>AAT	p.D1019N	DMBT1_uc001lgl.1_Missense_Mutation_p.D1009N|DMBT1_uc001lgm.1_Missense_Mutation_p.D520N|DMBT1_uc009xzz.1_Missense_Mutation_p.D1019N|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_5'UTR	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1019	SRCR 8.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CACCGTGTGCGATGACAGCTG	0.602													219	349	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974537	49974537	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974537C>T	uc010rhz.1	+	1	563	c.563C>T	c.(562-564)ACT>ATT	p.T188I		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	188	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						CTTGCCTGCACTAATACCCAC	0.438													73	202	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76868351	76868351	+	Silent	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76868351G>A	uc001oyb.2	+	8	1034	c.762G>A	c.(760-762)GTG>GTA	p.V254V	MYO7A_uc010rsl.1_Silent_p.V254V|MYO7A_uc010rsm.1_Silent_p.V243V|MYO7A_uc001oyc.2_Silent_p.V254V	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1	254	Myosin head-like.				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						ACTACCACGTGTTCTACTGCA	0.582													11	14	---	---	---	---	PASS
JAM3	83700	broad.mit.edu	37	11	134019099	134019099	+	3'UTR	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134019099G>A	uc001qhb.1	+	9					JAM3_uc009zcz.1_3'UTR	NM_032801	NP_116190	Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3 precursor						angiogenesis|blood coagulation|regulation of neutrophil chemotaxis	cell-cell contact zone|desmosome|extracellular space|integral to membrane	integrin binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		GGCTGAGAGCGCACAGAGCGC	0.547													3	55	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	1988135	1988135	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1988135G>A	uc001qjp.2	-	15	1862	c.1631C>T	c.(1630-1632)GCG>GTG	p.A544V	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Missense_Mutation_p.A432V	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	544	Cache.|Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GTACCGGGGCGCCAGCTTCAT	0.622													8	24	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6172165	6172165	+	Silent	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6172165C>T	uc001qnn.1	-	13	1738	c.1488G>A	c.(1486-1488)GAG>GAA	p.E496E	VWF_uc010set.1_Silent_p.E496E	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	496	VWFD 2.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TCTGCAGGTCCTCCCCGTAGC	0.657											OREG0021618	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	21	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112516059	112516059	+	Silent	SNP	A	G	G			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112516059A>G	uc001ttm.2	-	7	617	c.597T>C	c.(595-597)TAT>TAC	p.Y199Y	NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Silent_p.Y171Y|NAA25_uc009zwa.1_Silent_p.Y199Y	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	199						cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						GGATCATATAATAAAGTTCAA	0.299													7	163	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29600584	29600584	+	Silent	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29600584G>A	uc001usl.3	+	1	1837	c.1779G>A	c.(1777-1779)ACG>ACA	p.T593T		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	583						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						TGTTGAACACGTCCCCCAAAG	0.552													22	68	---	---	---	---	PASS
MDP1	145553	broad.mit.edu	37	14	24682478	24682478	+	3'UTR	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24682478G>A	uc001wnk.1	-	4					TM9SF1_uc010tob.1_Intron|CHMP4A_uc001wni.2_Intron|CHMP4A_uc010toc.1_Intron|CHMP4A_uc001wnj.2_Intron			Q86V88	MGDP1_HUMAN	RecName: Full=Magnesium-dependent phosphatase 1;          Short=MDP-1;          EC=3.1.3.-;          EC=3.1.3.48;								metal ion binding|protein tyrosine phosphatase activity				0						GCCATCGGCCGCCGGGGTTTT	0.677													2	1	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	54997173	54997173	+	Intron	SNP	T	C	C			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54997173T>C	uc001xay.2	+						CGRRF1_uc010tra.1_Intron|CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1						cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						AGACTTCTTATGGATAAAGTG	0.358													4	51	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107095199	107095199	+	RNA	SNP	G	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107095199G>T	uc010tyt.1	-	101		c.4888C>A								Parts of antibodies, mostly variable regions.												0						GTTCTTGGACGTGTCTACTGA	0.552													4	129	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20644830	20644830	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20644830T>C	uc001ytg.2	-	21	3137	c.2428A>G	c.(2428-2430)ATG>GTG	p.M810V	uc010tyx.1_RNA|uc001yth.3_Missense_Mutation_p.M810V|uc010tyy.1_Missense_Mutation_p.M810V					RecName: Full=Putative HERC2-like protein 3;																		AGCTTCTCCATGAGGCATTTC	0.498													3	72	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48736776	48736776	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48736776C>A	uc001zwx.1	-	49	6327	c.5999G>T	c.(5998-6000)TGC>TTC	p.C2000F	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2000	EGF-like 34; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TCCAGGTGGGCAAATGCATCT	0.433													58	118	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51855614	51855614	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51855614C>T	uc002abf.2	-	6	756	c.531G>A	c.(529-531)TGG>TGA	p.W177*	DMXL2_uc010ufy.1_Nonsense_Mutation_p.W177*|DMXL2_uc010bfa.2_Nonsense_Mutation_p.W177*	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	177	WD 2.					cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		CATCAGGAGACCATTCCATCA	0.308													3	72	---	---	---	---	PASS
RUNDC2A	84127	broad.mit.edu	37	16	12136839	12136839	+	Silent	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12136839C>T	uc002dbw.1	+	5	395	c.333C>T	c.(331-333)GAC>GAT	p.D111D		NM_032167	NP_115543	Q9HA26	RUN2A_HUMAN	RUN domain containing 2A	111	RUN.									ovary(1)	1						TCGCCTCAGACGTGGGCCGGG	0.652			T	CIITA	PMBL|Hodgkin Lymphona|								3	34	---	---	---	---	PASS
RUNDC2C	440352	broad.mit.edu	37	16	29376056	29376056	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29376056T>A	uc002dsj.1	+	5	795	c.398T>A	c.(397-399)ATC>AAC	p.I133N	uc010vct.1_Intron|RUNDC2C_uc010bys.1_RNA|RUNDC2C_uc010vdo.1_Missense_Mutation_p.I114N	NM_001012391	NP_001012391			RecName: Full=RUN domain-containing protein 2A;												0						ACCAACATTATCTCATTTGAT	0.393													5	85	---	---	---	---	PASS
USP22	23326	broad.mit.edu	37	17	20910262	20910262	+	Silent	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20910262G>A	uc002gym.3	-	10	1473	c.1269C>T	c.(1267-1269)ACC>ACT	p.T423T	USP22_uc002gyn.3_Silent_p.T411T|USP22_uc002gyl.3_Silent_p.T318T	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	423					cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						ACACATACGTGGTGATCTTCC	0.547													4	25	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21320025	21320025	+	3'UTR	SNP	C	T	T	rs5021702	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21320025C>T	uc002gyv.1	+	3						NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TCAGGGGCCCCGGGTTTGAGC	0.617										Prostate(3;0.18)			2	5	---	---	---	---	PASS
ST6GALNAC2	10610	broad.mit.edu	37	17	74562331	74562331	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74562331G>A	uc002jsg.3	-	9	1235	c.980C>T	c.(979-981)ACA>ATA	p.T327I		NM_006456	NP_006447	Q9UJ37	SIA7B_HUMAN	sialyltransferase 7B	327	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity				0						GTAGTTGCTTGTGATGAATCC	0.448													78	155	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14513675	14513675	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14513675T>C	uc010dln.2	-	10	1973	c.1519A>G	c.(1519-1521)AAA>GAA	p.K507E	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	507	Potential.									skin(3)	3						GAATTCATTTTCTTTTCAGCC	0.284													3	110	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8604860	8604860	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8604860G>A	uc002mkg.2	-	16	1777	c.1663C>T	c.(1663-1665)CGC>TGC	p.R555C		NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	555	Myosin head-like.					unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						GTGCTGGGGCGCCCCTTCTTG	0.637													20	46	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44891202	44891202	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44891202C>G	uc002ozd.3	-	4	1292	c.1205G>C	c.(1204-1206)TGC>TCC	p.C402S	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Missense_Mutation_p.C409S	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	402	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						ACACTCACTGCATTTGTAGGG	0.478													3	93	---	---	---	---	PASS
SIGLEC12	89858	broad.mit.edu	37	19	52003566	52003566	+	Intron	SNP	C	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52003566C>T	uc002pwx.1	-						SIGLEC12_uc002pww.1_Missense_Mutation_p.R21H|SIGLEC12_uc010eoy.1_Intron	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like						cell adhesion	integral to membrane	sugar binding			ovary(3)|skin(2)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGTGGAGAAACGAGGGTCAGC	0.607													16	38	---	---	---	---	PASS
JPH2	57158	broad.mit.edu	37	20	42806555	42806555	+	Intron	SNP	G	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42806555G>T	uc002xli.1	-						JPH2_uc002xlj.2_3'UTR	NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			gatgctcagtgcttcattgtc	0.119													81	100	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10906858	10906858	+	3'UTR	SNP	T	G	G			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10906858T>G	uc002yip.1	-	24					TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_3'UTR|TPTE_uc002yir.1_3'UTR|TPTE_uc010gkv.1_3'UTR	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGTGGCAGGGTTGGAAAGAAC	0.303													10	58	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42524924	42524924	+	Silent	SNP	A	G	G	rs111606937	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42524924A>G	uc003bce.2	-	4	618	c.528T>C	c.(526-528)GGT>GGC	p.G176G	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_5'UTR|CYP2D6_uc003bcf.2_Silent_p.G125G	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	176							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						TGTCCAAGAGACCGTTGGGGC	0.667													3	9	---	---	---	---	PASS
STS	412	broad.mit.edu	37	X	7223203	7223203	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7223203G>A	uc004cry.3	+	7	1320	c.1075G>A	c.(1075-1077)GGA>AGA	p.G359R		NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor	359	Lumenal.				female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	AATTCATGGCGGAAGTAATGG	0.458									Ichthyosis				3	70	---	---	---	---	PASS
PRAMEF2	65122	broad.mit.edu	37	1	12920822	12920823	+	Intron	INS	-	A	A	rs151087650	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12920822_12920823insA	uc001aum.1	+							NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2												0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCTAAAAGATGAAAAACAAAAA	0.470													5	3	---	---	---	---	
SPATA21	374955	broad.mit.edu	37	1	16729987	16729987	+	Intron	DEL	C	-	-	rs57948110		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16729987delC	uc001ayn.2	-						SPATA21_uc001ayl.1_Intron|SPATA21_uc010occ.1_Intron	NM_198546	NP_940948	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21								calcium ion binding			ovary(2)|breast(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		tcttttttttctttttttttt	0.010													5	3	---	---	---	---	
PUM1	9698	broad.mit.edu	37	1	31406163	31406163	+	Frame_Shift_Del	DEL	A	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31406163delA	uc001bsi.1	-	22	3569	c.3456delT	c.(3454-3456)CGTfs	p.R1152fs	PUM1_uc001bsf.1_Frame_Shift_Del_p.R820fs|PUM1_uc001bsg.1_Frame_Shift_Del_p.R886fs|PUM1_uc001bsh.1_Frame_Shift_Del_p.R1154fs|PUM1_uc001bsj.1_Frame_Shift_Del_p.R1128fs|PUM1_uc010oga.1_Frame_Shift_Del_p.R1010fs|PUM1_uc001bsk.1_Frame_Shift_Del_p.R1190fs|PUM1_uc010ogb.1_Frame_Shift_Del_p.R1093fs	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	1152	PUM-HD.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		AGGTGTACTTACGAAGAGTTG	0.532													165	68	---	---	---	---	
ELAVL4	1996	broad.mit.edu	37	1	50572177	50572178	+	5'Flank	INS	-	A	A	rs79810783		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50572177_50572178insA	uc001csb.2	+						ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Intron|ELAVL4_uc001csc.3_5'Flank	NM_021952	NP_068771	P26378	ELAV4_HUMAN	ELAV-like 4 isoform 1						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2						GATTGTGGCAGAAAAAAAAAAT	0.450													4	2	---	---	---	---	
STXBP3	6814	broad.mit.edu	37	1	109349880	109349892	+	Intron	DEL	AAAAAAAAAAAAA	-	-	rs71913282		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109349880_109349892delAAAAAAAAAAAAA	uc001dvy.2	+						STXBP3_uc001dvz.2_Intron	NM_007269	NP_009200	O00186	STXB3_HUMAN	syntaxin binding protein 3						negative regulation of calcium ion-dependent exocytosis|neutrophil degranulation|platelet aggregation|protein transport|vesicle docking involved in exocytosis	cytosol|nucleus|platelet alpha granule|specific granule|tertiary granule	syntaxin-2 binding			ovary(3)|central_nervous_system(1)	4		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		actccacctcaaaaaaaaaaaaaaaaaaaaaaa	0.136													3	3	---	---	---	---	
CDC42SE1	56882	broad.mit.edu	37	1	151027766	151027768	+	Intron	DEL	AAC	-	-	rs142658599		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151027766_151027768delAAC	uc001ewo.2	-						CDC42SE1_uc001ewp.2_Intron	NM_001038707	NP_001033796	Q9NRR8	C42S1_HUMAN	CDC42 small effector 1						phagocytosis|regulation of cell shape|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase inhibitor activity				0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCAAAGCTGGAACAACAAAAGCA	0.473													4	2	---	---	---	---	
FLG2	388698	broad.mit.edu	37	1	152329411	152329415	+	Frame_Shift_Del	DEL	TTGCT	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152329411_152329415delTTGCT	uc001ezw.3	-	3	920_924	c.847_851delAGCAA	c.(847-852)AGCAATfs	p.S283fs	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	283_284	Ser-rich.|Filaggrin 1.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCACTTGAATTGCTATAACCACAT	0.429													272	78	---	---	---	---	
SRBD1	55133	broad.mit.edu	37	2	45645816	45645816	+	Intron	DEL	A	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45645816delA	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AAGGGAGTTTaaaaaaaaaaa	0.199													3	6	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133014674	133014674	+	Intron	DEL	C	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133014674delC	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						GCCTCATGAGCCCCAGGTCCC	0.672													6	3	---	---	---	---	
FARSB	10056	broad.mit.edu	37	2	223512162	223512163	+	Intron	INS	-	A	A	rs147059558	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223512162_223512163insA	uc002vne.1	-						FARSB_uc010zlq.1_Intron|FARSB_uc002vnf.1_Intron|FARSB_uc002vng.1_Intron	NM_005687	NP_005678	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit						phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|RNA binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	GACCAGCTTTCAGTTTTACTGA	0.450													3	4	---	---	---	---	
EPHA3	2042	broad.mit.edu	37	3	89448278	89448278	+	Intron	DEL	A	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89448278delA	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		gactttgtctaaaaaaaaaaa	0.109										TSP Lung(6;0.00050)			6	3	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	172080402	172080402	+	Intron	DEL	T	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172080402delT	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		ATTGTCTGTATTTTTTTTTTC	0.343													141	8	---	---	---	---	
PI4K2B	55300	broad.mit.edu	37	4	25262264	25262267	+	Intron	DEL	ACAC	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25262264_25262267delACAC	uc003grk.2	+						PI4K2B_uc011bxs.1_Intron	NM_018323	NP_060793	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta							cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)				atatatatatacacacacacacac	0.137													4	2	---	---	---	---	
ATP10D	57205	broad.mit.edu	37	4	47538279	47538280	+	Intron	DEL	AG	-	-	rs111273743		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47538279_47538280delAG	uc003gxk.1	+						ATP10D_uc003gxl.1_5'Flank|ATP10D_uc003gxj.3_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						ACTTAAagaaagagagagagag	0.292													23	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190818970	190818974	+	Intron	DEL	AGGAA	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190818970_190818974delAGGAA	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		agggagagcgaggaaaggaaaggaa	0.000													5	6	---	---	---	---	
DST	667	broad.mit.edu	37	6	56497993	56497994	+	Intron	INS	-	T	T	rs60599813		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56497993_56497994insT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Intron|DST_uc003pdd.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATTTTAGGTGGTTTTTTTTTGT	0.213													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100608467	100608468	+	Intron	INS	-	T	T	rs139602002	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100608467_100608468insT	uc003uxl.1	+						uc003uxm.1_RNA|uc003uxn.1_RNA|uc010lhn.1_5'Flank					SubName: Full=Intestinal mucin; Flags: Fragment;																		AGGGAGAGACCTTTGCGGGAGG	0.624													3	7	---	---	---	---	
HBP1	26959	broad.mit.edu	37	7	106836196	106836196	+	Intron	DEL	T	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106836196delT	uc003vdy.2	+						HBP1_uc011klv.1_Intron|HBP1_uc003vdz.2_Intron|HBP1_uc003vea.2_Intron|HBP1_uc003veb.1_Intron	NM_012257	NP_036389	O60381	HBP1_HUMAN	HMG-box transcription factor 1						cell cycle arrest|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	DNA binding			skin(1)	1						AGATGTTTTCTTTTTTTTTTT	0.259													4	2	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128312704	128312704	+	Intron	DEL	G	-	-	rs10265601		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128312704delG	uc003vnk.3	+						FAM71F2_uc010llm.1_Intron|FAM71F2_uc003vnl.2_Intron|FAM71F2_uc010lln.1_Intron	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						CCCTGGGGGAGGGGGGGGCGG	0.552											OREG0018296	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
NUP205	23165	broad.mit.edu	37	7	135287859	135287860	+	Intron	DEL	AC	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135287859_135287860delAC	uc003vsw.2	+							NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						GCCTCAttttactttttttttt	0.153													6	3	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386733	33386734	+	Intron	INS	-	A	A	rs144694820	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386733_33386734insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		gaggaacacagaggcgatggct	0.158													4	2	---	---	---	---	
FANCC	2176	broad.mit.edu	37	9	98009494	98009495	+	Intron	INS	-	GT	GT	rs71498956		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98009494_98009495insGT	uc004avh.2	-						FANCC_uc004avi.3_Intron|FANCC_uc010mrm.1_Intron|FANCC_uc011lul.1_Intron	NM_000136	NP_000127	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)				tgcgtgcacgcgtgtgtgtgtg	0.292			D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	4	---	---	---	---	
MKX	283078	broad.mit.edu	37	10	28023797	28023798	+	Intron	INS	-	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28023797_28023798insA	uc001ity.3	-						MKX_uc001itx.3_Intron	NM_173576	NP_775847	Q8IYA7	MKX_HUMAN	mohawk homeobox						muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ATTTAATCCttaaaaatatata	0.307													17	8	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72245965	72245966	+	Intron	INS	-	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72245965_72245966insT	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						AAGTCAATATCTTTTTTTTTTT	0.426													4	2	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97081966	97081967	+	Intron	INS	-	A	A			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97081966_97081967insA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AACATGGGGACAAAAAAAAAAG	0.396													4	2	---	---	---	---	
BTRC	8945	broad.mit.edu	37	10	103238966	103238968	+	Intron	DEL	CCT	-	-	rs67537209		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103238966_103238968delCCT	uc001kta.2	+						BTRC_uc001ksz.1_Intron|BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CTATCTTTGCCCTCCTCCTTTTC	0.384													1	5	---	---	---	---	
HEPHL1	341208	broad.mit.edu	37	11	93839459	93839459	+	Intron	DEL	C	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93839459delC	uc001pep.2	+						uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor						copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TAtttcttttctttttttttt	0.179													9	4	---	---	---	---	
MPZL2	10205	broad.mit.edu	37	11	118130540	118130541	+	Intron	INS	-	C	C	rs148472266	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118130540_118130541insC	uc001psn.2	-						MPZL2_uc001pso.2_Intron|MPZL2_uc001psp.1_3'UTR	NM_005797	NP_005788	O60487	MPZL2_HUMAN	myelin protein zero-like 2 precursor						anatomical structure morphogenesis|homophilic cell adhesion	cytoskeleton|integral to membrane				skin(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		TGTAAAATCAACCCCCCCACAT	0.327													5	6	---	---	---	---	
WNK1	65125	broad.mit.edu	37	12	991367	991368	+	Intron	INS	-	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:991367_991368insT	uc001qio.3	+						WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_Intron	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GTGACAGATAAttttttttttt	0.079													5	3	---	---	---	---	
USP5	8078	broad.mit.edu	37	12	6975122	6975123	+	Intron	INS	-	TTT	TTT			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6975122_6975123insTTT	uc001qri.3	+						USP5_uc001qrh.3_Intron|TPI1_uc001qrk.2_5'Flank|TPI1_uc010sfo.1_5'Flank	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			lung(2)|breast(1)|skin(1)	4						TTTGTTCATCCTTTTCTGTTTT	0.520													54	11	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104140727	104140727	+	Intron	DEL	C	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104140727delC	uc001tjw.2	+						STAB2_uc009zug.2_Intron	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GTTTTTCtttctttttttttt	0.095													4	2	---	---	---	---	
MIR620	693205	broad.mit.edu	37	12	116586415	116586418	+	RNA	DEL	TATA	-	-	rs10549054		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116586415_116586418delTATA	hsa-mir-620|MI0003634	-			c.42_45delTATA			MED13L_uc001tvw.2_Intron																	0						tggagatatctatatatatatata	0.196													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95516588	95516610	+	IGR	DEL	GGAAGGAAGGAAGGAAAGAAGAA	-	-	rs36211516		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95516588_95516610delGGAAGGAAGGAAGGAAAGAAGAA								GSC (280089 upstream) : DICER1 (35955 downstream)																							aagaaggaagggaaggaaggaaggaaagaagaaggaaggaagg	0.063													6	3	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	34117924	34117924	+	Intron	DEL	C	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34117924delC	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGATTAAAATCtttttttttt	0.214													43	9	---	---	---	---	
RNF111	54778	broad.mit.edu	37	15	59359441	59359441	+	Intron	DEL	T	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59359441delT	uc002afv.2	+						RNF111_uc002afs.2_Intron|RNF111_uc002aft.2_Intron|RNF111_uc002afu.2_Intron|RNF111_uc002afw.2_Intron|RNF111_uc002afx.2_Intron	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111						multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		ctccgtttccttttttttttt	0.075													4	3	---	---	---	---	
SMAD3	4088	broad.mit.edu	37	15	67378206	67378207	+	Intron	INS	-	CA	CA	rs78357581		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67378206_67378207insCA	uc002aqj.2	+							NM_005902	NP_005893	P84022	SMAD3_HUMAN	mothers against decapentaplegic homolog 3						activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		AAAAAAGCGTGcacacacacac	0.342													3	5	---	---	---	---	
RAB11FIP3	9727	broad.mit.edu	37	16	538711	538712	+	Intron	INS	-	TT	TT	rs3079539		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:538711_538712insTT	uc002chf.2	+						RAB11FIP3_uc010uuf.1_Intron|RAB11FIP3_uc010uug.1_Intron	NM_014700	NP_055515	O75154	RFIP3_HUMAN	rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)				atccagccCACTTTTTTTTTTT	0.272													4	2	---	---	---	---	
PTX4	390667	broad.mit.edu	37	16	1537177	1537177	+	Intron	DEL	C	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1537177delC	uc010uvf.1	-							NM_001013658	NP_001013680	Q96A99	PTX4_HUMAN	neuronal pentraxin II-like							extracellular region	metal ion binding				0						cggtgggccaccccccccgat	0.100													5	3	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18848055	18848056	+	Intron	INS	-	C	C	rs142565154	by1000genomes	TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18848055_18848056insC	uc002dfm.2	-						SMG1_uc010bwb.2_Intron|SMG1_uc010bwa.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TTTAATTAAAActgccacatct	0.243													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88226611	88226611	+	IGR	DEL	G	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88226611delG								BANP (115688 upstream) : ZNF469 (267268 downstream)																							tggtggtgatggtggtgatgg	0.000													4	3	---	---	---	---	
SGSM2	9905	broad.mit.edu	37	17	2265725	2265726	+	Intron	INS	-	C	C	rs2447101		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2265725_2265726insC	uc002fun.3	+						SGSM2_uc002fum.3_Intron|SGSM2_uc010vqw.1_Intron	NM_001098509	NP_001091979	O43147	SGSM2_HUMAN	RUN and TBC1 domain containing 1 isoform 2							intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		ACCGCCCCGTTCCCAAAAACTG	0.624													4	2	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16612678	16612678	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16612678delT	uc002gqk.1	+	5	1383	c.1307delT	c.(1306-1308)GTTfs	p.V436fs	CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_5'Flank	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	436											0						CCAGAAGTGGTTATGGTTGAA	0.353													47	27	---	---	---	---	
MMD	23531	broad.mit.edu	37	17	53498972	53498973	+	Intron	INS	-	G	G			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53498972_53498973insG	uc002iui.2	-							NM_012329	NP_036461	Q15546	PAQRB_HUMAN	monocyte to macrophage						cytolysis	integral to plasma membrane|late endosome membrane|lysosomal membrane|membrane fraction	receptor activity				0						CGCTTAACGGCGGGATTTGGGA	0.634													108	8	---	---	---	---	
IMPA2	3613	broad.mit.edu	37	18	12029105	12029107	+	Intron	DEL	CTG	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12029105_12029107delCTG	uc002kqp.1	+						IMPA2_uc002kqo.1_Intron|IMPA2_uc002kqq.1_Intron	NM_014214	NP_055029	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2						inositol phosphate dephosphorylation|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(2)	2					Lithium(DB01356)	CCCAGAGTttctgtttttttttt	0.266													6	3	---	---	---	---	
KDM4B	23030	broad.mit.edu	37	19	5138150	5138150	+	Intron	DEL	C	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5138150delC	uc002mbq.3	+						KDM4B_uc010xim.1_Intron|KDM4B_uc002mbr.3_Intron	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						CGGCTCCCCACCTGCGCGATC	0.652													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27738491	27738491	+	IGR	DEL	T	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27738491delT								None (None upstream) : LOC148189 (542911 downstream)																							tggaaacgggtttttttcatg	0.000													242	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499424	40499424	+	IGR	DEL	G	-	-	rs2410102		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499424delG								ETS2 (302548 upstream) : PSMG1 (47966 downstream)																							gttttgttttgttttttttgC	0.313													6	4	---	---	---	---	
CBS	875	broad.mit.edu	37	21	44474239	44474240	+	Intron	INS	-	T	T			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44474239_44474240insT	uc002zcu.2	-						CBS_uc002zcs.1_Intron|CBS_uc002zct.2_Intron|CBS_uc002zcw.3_Intron|CBS_uc002zcv.2_Intron	NM_000071	NP_000062	P35520	CBS_HUMAN	cystathionine-beta-synthase						cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	GGCTGTGttccttttttttttt	0.356													3	3	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	31985765	31985768	+	Intron	DEL	TTTA	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31985765_31985768delTTTA	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron|SFI1_uc010gwi.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TTTGTCCATCTTTATTTATTTATT	0.333													5	3	---	---	---	---	
PNPLA3	80339	broad.mit.edu	37	22	44335671	44335672	+	Intron	DEL	GG	-	-	rs35514853		TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44335671_44335672delGG	uc003bei.1	+						PNPLA3_uc010gzm.1_Intron	NM_025225	NP_079501	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3						triglyceride biosynthetic process|triglyceride catabolic process	integral to membrane	diolein transacylation activity|mono-olein transacylation activity|phospholipase A2 activity|triglyceride lipase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)				actccagcctgggggcaacaag	0.178													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49467094	49467096	+	IGR	DEL	TCC	-	-			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49467094_49467096delTCC								FAM19A5 (319352 upstream) : C22orf34 (341080 downstream)																							cttccttccttccttcttccttc	0.074													4	2	---	---	---	---	
P2RY8	286530	broad.mit.edu	37	X	1585603	1585604	+	Intron	INS	-	CCTC	CCTC			TCGA-EJ-5532-01	TCGA-EJ-5532-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1585603_1585604insCCTC	uc004cpz.2	-							NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCTGCTGTCtcctccctccct	0.356			T	CRLF2	B-ALL|Downs associated ALL								4	4	---	---	---	---	
