Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
CLCNKB	1188	broad.mit.edu	37	1	16379015	16379016	+	Intron	INS	-	GGGGCTGGGA	GGGGCTGGGA	rs112841009	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16379015_16379016insGGGGCTGGGA	uc001axw.3	+						FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Intron|CLCNKB_uc001axy.3_Intron	NM_000085	NP_000076			chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
NECAP2	55707	broad.mit.edu	37	1	16785155	16785155	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16785155delA	uc001ayo.2	+						NECAP2_uc001ayp.3_Intron|NECAP2_uc010ocd.1_Intron|NECAP2_uc001ayq.2_Intron	NM_018090	NP_060560			NECAP endocytosis associated 2 isoform 1						endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
SF3A3	10946	broad.mit.edu	37	1	38446097	38446098	+	Intron	INS	-	A	A	rs147744511		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38446097_38446098insA	uc001cci.2	-						SF3A3_uc010oik.1_Intron	NM_006802	NP_006793			splicing factor 3a, subunit 3						nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nuclear speck	nucleic acid binding|protein binding|zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
C1orf177	163747	broad.mit.edu	37	1	55279346	55279352	+	Intron	DEL	CCGGCCT	-	-	rs67384270		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55279346_55279352delCCGGCCT	uc001cyb.3	+						C1orf177_uc001cya.3_Intron	NM_001110533	NP_001104003			hypothetical protein LOC163747 isoform 2												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	210438731	210438731	+	IGR	DEL	T	-	-	rs138584592		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210438731delT								SERTAD4 (22293 upstream) : HHAT (62875 downstream)																																			---	---	---	---
EXO1	9156	broad.mit.edu	37	1	242023590	242023591	+	Intron	INS	-	T	T	rs147466857	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242023590_242023591insT	uc001hzh.2	+						EXO1_uc001hzi.2_Intron|EXO1_uc001hzj.2_Intron|EXO1_uc009xgq.2_Intron	NM_130398	NP_569082			exonuclease 1 isoform b						meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)										Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
CEP170	9859	broad.mit.edu	37	1	243327509	243327510	+	Intron	INS	-	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243327509_243327510insT	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron|CEP170_uc001hzv.1_Intron	NM_014812	NP_055627			centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)															---	---	---	---
CEP170	9859	broad.mit.edu	37	1	243332885	243332886	+	Intron	DEL	AG	-	-	rs140816120		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243332885_243332886delAG	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron	NM_014812	NP_055627			centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)															---	---	---	---
C2orf48	348738	broad.mit.edu	37	2	10295167	10295168	+	Intron	INS	-	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10295167_10295168insA	uc002rai.1	+							NM_182626	NP_872432			hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)														---	---	---	---
USP34	9736	broad.mit.edu	37	2	61566975	61566976	+	Intron	INS	-	T	T	rs112162554		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61566975_61566976insT	uc002sbe.2	-							NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	108519282	108519283	+	IGR	INS	-	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108519282_108519283insA								RGPD4 (10283 upstream) : SLC5A7 (83712 downstream)																																			---	---	---	---
DFNB59	494513	broad.mit.edu	37	2	179321040	179321040	+	Intron	DEL	A	-	-	rs11448490		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179321040delA	uc002umi.3	+						DFNB59_uc002umj.3_Intron	NM_001042702	NP_001036167			deafness, autosomal recessive 59						sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	38370374	38370384	+	IGR	DEL	GGGCCTTGGGC	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38370374_38370384delGGGCCTTGGGC								SLC22A14 (10515 upstream) : XYLB (17867 downstream)																																			---	---	---	---
USP4	7375	broad.mit.edu	37	3	49339623	49339623	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49339623delA	uc003cwq.2	-						USP4_uc003cwo.2_Intron|USP4_uc003cwp.2_Intron|USP4_uc003cwr.2_Intron	NM_003363	NP_003354			ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)														---	---	---	---
COPG	22820	broad.mit.edu	37	3	128974023	128974023	+	Intron	DEL	T	-	-	rs63166061		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128974023delT	uc003els.2	+						COPG_uc010htb.2_Intron	NM_016128	NP_057212			coatomer protein complex, subunit gamma 1						COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4																		---	---	---	---
SH3TC1	54436	broad.mit.edu	37	4	8219843	8219844	+	Intron	DEL	AT	-	-	rs1281137	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8219843_8219844delAT	uc003gkv.3	+						SH3TC1_uc003gkw.3_Intron|SH3TC1_uc003gkx.3_Intron	NM_018986	NP_061859			SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3																		---	---	---	---
BST1	683	broad.mit.edu	37	4	15709457	15709458	+	Intron	INS	-	CTCTCTCTCT	CTCTCTCTCT	rs146353876	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15709457_15709458insCTCTCTCTCT	uc003goh.3	+							NM_004334	NP_004325			bone marrow stromal cell antigen 1 precursor						humoral immune response|multicellular organismal development	anchored to membrane|extrinsic to membrane|plasma membrane	binding|NAD+ nucleosidase activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	70267902	70267902	+	IGR	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70267902delA								UGT2B28 (107135 upstream) : UGT2B4 (77982 downstream)																																			---	---	---	---
NHEDC1	150159	broad.mit.edu	37	4	103832838	103832839	+	Intron	DEL	AT	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103832838_103832839delAT	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912			Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)														---	---	---	---
FABP2	2169	broad.mit.edu	37	4	120243417	120243418	+	5'Flank	INS	-	TC	TC	rs144572173	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243417_120243418insTC	uc003icw.2	-							NM_000134	NP_000125			intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	95170388	95170388	+	IGR	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95170388delT								GLRX (11811 upstream) : C5orf27 (17548 downstream)																																			---	---	---	---
ZFP57	346171	broad.mit.edu	37	6	29642978	29642979	+	Intron	INS	-	AACTTGAA	AACTTGAA	rs143499124	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29642978_29642979insAACTTGAA	uc011dlw.1	-						ZFP57_uc003nnl.3_Intron	NM_001109809	NP_001103279			zinc finger protein 57 homolog						DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	57545520	57545537	+	IGR	DEL	CAGGGGCTCTTTGTCCCG	-	-	rs116217858	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57545520_57545537delCAGGGGCTCTTTGTCCCG								ZNF716 (12255 upstream) : None (None downstream)																																			---	---	---	---
COPG2	26958	broad.mit.edu	37	7	130148869	130148870	+	Intron	INS	-	A	A	rs74631784	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130148869_130148870insA	uc003vqh.1	-							NM_012133	NP_036265			coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)																	---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141263210	141263211	+	Intron	DEL	CT	-	-	rs140935423		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141263210_141263211delCT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
FKBP15	23307	broad.mit.edu	37	9	116029810	116029810	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116029810delA	uc010muu.1	-						CDC26_uc004bgw.2_Intron	NM_015258	NP_056073			FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	30978028	30978029	+	IGR	DEL	TG	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30978028_30978029delTG								LYZL2 (59381 upstream) : ZNF438 (155538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	71193238	71193239	+	IGR	INS	-	AC	AC	rs139709581	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71193238_71193239insAC								TACR2 (16564 upstream) : TSPAN15 (17987 downstream)																																			---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95066953	95066953	+	Intron	DEL	G	-	-	rs60442844		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95066953delG	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc009xue.2_Intron	NM_013451	NP_038479			myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650			tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)														---	---	---	---
CARS	833	broad.mit.edu	37	11	3026861	3026861	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3026861delA	uc001lxh.2	-						CARS_uc009ydu.2_Intron|CARS_uc001lxe.2_Intron|CARS_uc001lxf.2_Intron|CARS_uc001lxg.2_Intron|CARS_uc010qxo.1_Intron|CARS_uc010qxp.1_Intron	NM_001751	NP_001742			cysteinyl-tRNA synthetase isoform b						cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)			T	ALK	ALCL								---	---	---	---
NDUFS3	4722	broad.mit.edu	37	11	47602712	47602712	+	Intron	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602712delT	uc001nga.2	+						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_3'UTR	NM_004551	NP_004542			NADH dehydrogenase (ubiquinone) Fe-S protein 3						induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)													---	---	---	---
MYO7A	4647	broad.mit.edu	37	11	76891308	76891309	+	Intron	INS	-	CTGCCAAATTATTTGG	CTGCCAAATTATTTGG	rs140333333	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76891308_76891309insCTGCCAAATTATTTGG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251			myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4																		---	---	---	---
SIDT2	51092	broad.mit.edu	37	11	117054355	117054355	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117054355delA	uc001pqh.1	+						SIDT2_uc010rxe.1_Intron|SIDT2_uc001pqg.2_Intron|SIDT2_uc001pqi.1_Intron	NM_001040455	NP_001035545			SID1 transmembrane family, member 2 precursor							integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)														---	---	---	---
CD3G	917	broad.mit.edu	37	11	118222930	118222931	+	Intron	INS	-	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118222930_118222931insA	uc001psu.2	+						CD3G_uc009zaa.1_Intron	NM_000073	NP_000064			CD3G antigen, gamma polypeptide precursor						establishment or maintenance of cell polarity|protein complex assembly|protein transport|regulation of apoptosis|T cell activation|T cell costimulation|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	protein heterodimerization activity|receptor signaling complex scaffold activity|T cell receptor binding|transmembrane receptor activity				0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)														---	---	---	---
LOC653113	653113	broad.mit.edu	37	12	8384922	8384922	+	RNA	DEL	C	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8384922delC	uc010sgk.1	-	5		c.866delG				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0																		---	---	---	---
BAZ2A	11176	broad.mit.edu	37	12	56999207	56999208	+	Intron	INS	-	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56999207_56999208insT	uc001slq.1	-						BAZ2A_uc001slp.1_Intron|BAZ2A_uc009zov.1_5'Flank|BAZ2A_uc009zow.1_Intron	NM_013449	NP_038477			bromodomain adjacent to zinc finger domain, 2A						chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	69594093	69594102	+	IGR	DEL	AGAAAGAGAT	-	-	rs80081772		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69594093_69594102delAGAAAGAGAT								CPM (237073 upstream) : CPSF6 (39215 downstream)																																			---	---	---	---
PLBD2	196463	broad.mit.edu	37	12	113821802	113821803	+	Intron	DEL	AA	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113821802_113821803delAA	uc001tve.2	+						PLBD2_uc001tvf.2_Intron	NM_173542	NP_775813			phospholipase B domain containing 2 isoform 1						lipid catabolic process	lysosomal lumen	hydrolase activity				0																		---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120574574	120574574	+	Intron	DEL	C	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120574574delC	uc001txo.2	-							NM_006836	NP_006827			GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	23154909	23154909	+	IGR	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23154909delA								ABHD4 (73652 upstream) : OXA1L (80822 downstream)																																			---	---	---	---
DUOX1	53905	broad.mit.edu	37	15	45447768	45447768	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45447768delA	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130			dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)														---	---	---	---
LOC283922	283922	broad.mit.edu	37	16	74394379	74394380	+	Intron	INS	-	A	A	rs142790741	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394379_74394380insA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0																		---	---	---	---
MINK1	50488	broad.mit.edu	37	17	4760455	4760456	+	Intron	INS	-	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4760455_4760456insC	uc010vsl.1	+						MINK1_uc010vsk.1_Intron|MINK1_uc010vsm.1_Intron|MINK1_uc010vsn.1_Intron|MINK1_uc010vso.1_Intron	NM_153827	NP_722549			misshapen-like kinase 1 isoform 3						JNK cascade	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)|skin(1)	6																		---	---	---	---
TMEM49	81671	broad.mit.edu	37	17	57915487	57915487	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57915487delA	uc002ixu.3	+						TMEM49_uc010wog.1_Intron|TMEM49_uc010woh.1_Intron|TMEM49_uc010woi.1_Intron|TMEM49_uc010woj.1_Intron|TMEM49_uc002ixv.2_5'Flank	NM_030938	NP_112200			transmembrane protein 49						autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)															---	---	---	---
ARSG	22901	broad.mit.edu	37	17	66269127	66269127	+	Intron	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66269127delT	uc002jhc.2	+						SLC16A6_uc002jgz.1_Intron|SLC16A6_uc002jha.1_Intron	NM_014960	NP_055775			Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)															---	---	---	---
USP14	9097	broad.mit.edu	37	18	204905	204905	+	Intron	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:204905delT	uc002kkf.1	+						USP14_uc002kkg.1_Intron|USP14_uc010wyr.1_Intron	NM_005151	NP_005142			ubiquitin specific protease 14 isoform a						regulation of chemotaxis|regulation of proteasomal protein catabolic process|ubiquitin-dependent protein catabolic process	cell surface|cytoplasmic membrane-bounded vesicle|plasma membrane|proteasome complex	cysteine-type endopeptidase activity|endopeptidase inhibitor activity|proteasome binding|tRNA guanylyltransferase activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)																---	---	---	---
SYT3	84258	broad.mit.edu	37	19	51132916	51132917	+	Intron	DEL	CC	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51132916_51132917delCC	uc002pst.2	-						SYT3_uc002psv.2_Intron|SYT3_uc010ycd.1_Intron	NM_032298	NP_115674			synaptotagmin III							cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)														---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41306344	41306344	+	Intron	DEL	C	-	-	rs2425514	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41306344delC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
NCOA3	8202	broad.mit.edu	37	20	46268654	46268654	+	Intron	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46268654delT	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron|NCOA3_uc010zyc.1_Intron	NM_181659	NP_858045			nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5																		---	---	---	---
PIGP	51227	broad.mit.edu	37	21	38439272	38439281	+	Intron	DEL	GTGTGTGTGT	-	-	rs112008084		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38439272_38439281delGTGTGTGTGT	uc002yvw.1	-						PIGP_uc002yvy.1_Intron|PIGP_uc002yvx.1_Intron	NM_153681	NP_710148			phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity				0		Myeloproliferative disorder(46;0.0412)																---	---	---	---
GLA	2717	broad.mit.edu	37	X	100654130	100654135	+	Intron	DEL	TTAAAG	-	-	rs3027591		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100654130_100654135delTTAAAG	uc004ehl.1	-							NM_000169	NP_000160			alpha-galactosidase A precursor						glycoside catabolic process|glycosphingolipid catabolic process|glycosylceramide catabolic process|negative regulation of nitric oxide biosynthetic process|negative regulation of nitric-oxide synthase activity|oligosaccharide metabolic process	extracellular region|Golgi apparatus|lysosome	cation binding|protein homodimerization activity|raffinose alpha-galactosidase activity|receptor binding				0					Agalsidase beta(DB00103)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	136030245	136030245	+	Intron	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136030245delT	uc004fai.1	+											Homo sapiens cDNA FLJ31132 fis, clone IMR322000953.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	152871884	152871904	+	IGR	DEL	GTAAAGGGATTTTGTTCACCA	-	-	rs139494223		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152871884_152871904delGTAAAGGGATTTTGTTCACCA								FAM58A (7252 upstream) : DUSP9 (35993 downstream)																																			---	---	---	---
PRAMEF11	440560	broad.mit.edu	37	1	12888267	12888268	+	Intron	INS	-	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12888267_12888268insG	uc001auk.2	-							NM_001146344	NP_001139816			PRAME family member 11												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	100288423	100288431	+	IGR	DEL	CCTCTACCT	-	-	rs71075457		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100288423_100288431delCCTCTACCT								FRRS1 (57074 upstream) : AGL (27209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158165357	158165357	+	IGR	DEL	T	-	-	rs113777930		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158165357delT								CD1D (9143 upstream) : CD1A (58570 downstream)																																			---	---	---	---
F5	2153	broad.mit.edu	37	1	169551549	169551550	+	Intron	INS	-	A	A	rs139372356	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169551549_169551550insA	uc001ggg.1	-						F5_uc010plr.1_Intron	NM_000130	NP_000121			coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)													---	---	---	---
TNFSF4	7292	broad.mit.edu	37	1	173156193	173156194	+	Intron	INS	-	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173156193_173156194insA	uc001giw.2	-						TNFSF4_uc001giv.2_Intron	NM_003326	NP_003317			tumor necrosis factor (ligand) superfamily,						acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity			central_nervous_system(1)	1																		---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237837175	237837175	+	Intron	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237837175delT	uc001hyl.1	+						RYR2_uc010pxz.1_5'Flank	NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	43025348	43025348	+	IGR	DEL	C	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43025348delC								HAAO (5597 upstream) : ZFP36L2 (424194 downstream)																																			---	---	---	---
USP34	9736	broad.mit.edu	37	2	61566975	61566976	+	Intron	INS	-	T	T	rs112162554		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61566975_61566976insT	uc002sbe.2	-							NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170034062	170034062	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170034062delA	uc002ues.2	-							NM_004525	NP_004516			low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
DFNB59	494513	broad.mit.edu	37	2	179321040	179321040	+	Intron	DEL	A	-	-	rs11448490		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179321040delA	uc002umi.3	+						DFNB59_uc002umj.3_Intron	NM_001042702	NP_001036167			deafness, autosomal recessive 59						sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)															---	---	---	---
RAPH1	65059	broad.mit.edu	37	2	204355768	204355768	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204355768delA	uc002vad.2	-						RAPH1_uc002vae.2_Intron|RAPH1_uc002vaf.2_Intron	NM_213589	NP_998754			Ras association and pleckstrin homology domains						cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	38370374	38370384	+	IGR	DEL	GGGCCTTGGGC	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38370374_38370384delGGGCCTTGGGC								SLC22A14 (10515 upstream) : XYLB (17867 downstream)																																			---	---	---	---
COPG	22820	broad.mit.edu	37	3	128974023	128974023	+	Intron	DEL	T	-	-	rs63166061		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128974023delT	uc003els.2	+						COPG_uc010htb.2_Intron	NM_016128	NP_057212			coatomer protein complex, subunit gamma 1						COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4																		---	---	---	---
TFRC	7037	broad.mit.edu	37	3	195792272	195792273	+	Intron	INS	-	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195792272_195792273insA	uc003fvz.3	-						TFRC_uc003fwa.3_Intron|TFRC_uc010hzy.2_Intron|TFRC_uc011btr.1_Intron	NM_003234	NP_003225			transferrin receptor						cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)				T	BCL6	NHL								---	---	---	---
NHEDC1	150159	broad.mit.edu	37	4	103832838	103832839	+	Intron	DEL	AT	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103832838_103832839delAT	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912			Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)														---	---	---	---
GUCY1A3	2982	broad.mit.edu	37	4	156651536	156651539	+	3'UTR	DEL	ATGT	-	-	rs146677644		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156651536_156651539delATGT	uc003iov.2	+	11					GUCY1A3_uc003iow.2_3'UTR|GUCY1A3_uc010iqd.2_3'UTR|GUCY1A3_uc003iox.2_3'UTR|GUCY1A3_uc003ioz.2_3'UTR|GUCY1A3_uc003ioy.2_3'UTR|GUCY1A3_uc010iqe.2_3'UTR|GUCY1A3_uc003ipa.2_RNA|GUCY1A3_uc003ipb.2_3'UTR	NM_000856	NP_000847			guanylate cyclase 1, soluble, alpha 3 isoform A						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)														---	---	---	---
TSPAN17	26262	broad.mit.edu	37	5	176082901	176082902	+	Intron	INS	-	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176082901_176082902insA	uc003met.2	+						TSPAN17_uc003mes.3_Intron|TSPAN17_uc003meu.2_Intron|TSPAN17_uc003mev.2_Intron|TSPAN17_uc003mew.2_Intron	NM_012171	NP_036303			transmembrane 4 superfamily member 17 isoform a							integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	179513203	179513203	+	IGR	DEL	T	-	-	rs146020552		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179513203delT								RNF130 (14094 upstream) : RASGEF1C (14593 downstream)																																			---	---	---	---
GABRR1	2569	broad.mit.edu	37	6	89927156	89927156	+	5'UTR	DEL	A	-	-	rs34012805		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89927156delA	uc003pna.2	-	1					GABRR1_uc011dzv.1_5'UTR|GABRR1_uc011dzw.1_RNA	NM_002042	NP_002033			gamma-aminobutyric acid (GABA) receptor, rho 1						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)													---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168290259	168290260	+	Intron	INS	-	C	C	rs141987779		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168290259_168290260insC	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwf.2_Intron	NM_001040001	NP_001035090			myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
KIAA0415	9907	broad.mit.edu	37	7	4829757	4829758	+	Intron	INS	-	CT	CT	rs150962528	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4829757_4829758insCT	uc003sne.2	+						KIAA0415_uc010ksp.2_Intron|KIAA0415_uc003snf.2_5'UTR	NM_014855	NP_055670			hypothetical protein LOC9907						cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)														---	---	---	---
TRA2A	29896	broad.mit.edu	37	7	23545204	23545205	+	Intron	INS	-	A	A	rs34037907		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23545204_23545205insA	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425			transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	65268568	65268570	+	IGR	DEL	CTT	-	-	rs75342027		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65268568_65268570delCTT								CCT6P1 (39907 upstream) : VKORC1L1 (69687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	30778987	30778987	+	IGR	DEL	A	-	-	rs146807720		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30778987delA								TEX15 (32765 upstream) : PURG (74334 downstream)																																			---	---	---	---
POLB	5423	broad.mit.edu	37	8	42228944	42228944	+	Intron	DEL	T	-	-	rs79893094		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42228944delT	uc003xoz.1	+						POLB_uc003xpa.1_Intron|POLB_uc011lcs.1_Intron	NM_002690	NP_002681			DNA-directed DNA polymerase beta						DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding			ovary(1)|breast(1)	2	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)								DNA_polymerases_(catalytic_subunits)					---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104922219	104922220	+	Intron	DEL	TA	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104922219_104922220delTA	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_5'Flank	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
FKBP15	23307	broad.mit.edu	37	9	116029810	116029810	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116029810delA	uc010muu.1	-						CDC26_uc004bgw.2_Intron	NM_015258	NP_056073			FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	30978028	30978029	+	IGR	DEL	TG	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30978028_30978029delTG								LYZL2 (59381 upstream) : ZNF438 (155538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	94985788	94985789	+	IGR	INS	-	T	T	rs140557797	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94985788_94985789insT								CYP26A1 (148147 upstream) : MYOF (80398 downstream)																																			---	---	---	---
PCGF6	84108	broad.mit.edu	37	10	105063898	105063898	+	Intron	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105063898delT	uc001kwt.2	-						PCGF6_uc001kwu.2_Intron|PCGF6_uc009xxk.2_Intron|PCGF6_uc009xxl.2_Intron|PCGF6_uc009xxm.2_Intron	NM_001011663	NP_001011663			polycomb group ring finger 6 isoform a						negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)														---	---	---	---
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650			tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)														---	---	---	---
C11orf85	283129	broad.mit.edu	37	11	64708307	64708308	+	Intron	INS	-	TTT	TTT	rs56019033		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64708307_64708308insTTT	uc001ocb.1	-						C11orf85_uc001occ.1_Intron|C11orf85_uc001ocd.1_Intron	NM_001037225	NP_001032302			hypothetical protein LOC283129												0																		---	---	---	---
ARHGEF17	9828	broad.mit.edu	37	11	73077165	73077166	+	Intron	DEL	TG	-	-	rs112101560		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73077165_73077166delTG	uc001otu.2	+							NM_014786	NP_055601			Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0																		---	---	---	---
C2CD3	26005	broad.mit.edu	37	11	73796187	73796188	+	Intron	INS	-	T	T	rs74787473		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73796187_73796188insT	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346			C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)																	---	---	---	---
MYO7A	4647	broad.mit.edu	37	11	76891308	76891309	+	Intron	INS	-	CTGCCAAATTATTTGG	CTGCCAAATTATTTGG	rs140333333	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76891308_76891309insCTGCCAAATTATTTGG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251			myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4																		---	---	---	---
SYTL2	54843	broad.mit.edu	37	11	85411365	85411365	+	Intron	DEL	T	-	-	rs72171133		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85411365delT	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc001pav.2_Intron|SYTL2_uc010rte.1_Intron|SYTL2_uc001pax.2_Intron|SYTL2_uc001paz.2_Intron|SYTL2_uc001pba.2_Intron|SYTL2_uc001pay.2_Intron|SYTL2_uc001paw.2_Intron|SYTL2_uc009yvj.2_Intron|SYTL2_uc001pbd.2_Intron|SYTL2_uc001pbb.2_Intron|SYTL2_uc001pbc.2_Intron|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423			synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)														---	---	---	---
GCN1L1	10985	broad.mit.edu	37	12	120574574	120574574	+	Intron	DEL	C	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120574574delC	uc001txo.2	-							NM_006836	NP_006827			GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	23154909	23154909	+	IGR	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23154909delA								ABHD4 (73652 upstream) : OXA1L (80822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22118395	22118396	+	IGR	DEL	AC	-	-	rs139043886		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22118395_22118396delAC								CXADRP2 (101517 upstream) : LOC727924 (159636 downstream)																																			---	---	---	---
AP4E1	23431	broad.mit.edu	37	15	51240537	51240537	+	Intron	DEL	T	-	-	rs71729261		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51240537delT	uc001zyx.1	+							NM_007347	NP_031373			adaptor-related protein complex 4, epsilon 1						intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)														---	---	---	---
GOLGA6L10	647042	broad.mit.edu	37	15	82635398	82635398	+	Intron	DEL	G	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82635398delG	uc002bgx.2	-											Homo sapiens cDNA FLJ40113 fis, clone TESTI2008621.												0																		---	---	---	---
CIRH1A	84916	broad.mit.edu	37	16	69199097	69199098	+	Intron	INS	-	A	A	rs111880969		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69199097_69199098insA	uc002ews.3	+						CIRH1A_uc002ewr.2_Intron|CIRH1A_uc002ewt.3_Intron|CIRH1A_uc010cfi.2_Intron	NM_032830	NP_116219			cirhin							nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	29103592	29103592	+	IGR	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29103592delT								SUZ12P (6525 upstream) : CRLF3 (6111 downstream)																																			---	---	---	---
EFTUD2	9343	broad.mit.edu	37	17	42929595	42929595	+	Intron	DEL	T	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42929595delT	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238			elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)																---	---	---	---
NFE2L1	4779	broad.mit.edu	37	17	46134236	46134237	+	Intron	INS	-	CT	CT	rs140826056	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46134236_46134237insCT	uc002imz.3	+						NFE2L1_uc002ina.3_Intron|NFE2L1_uc002inb.3_Intron|NFE2L1_uc010wle.1_Intron|NFE2L1_uc010wlf.1_Intron	NM_003204	NP_003195			nuclear factor erythroid 2-like 1						anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1																		---	---	---	---
TMEM49	81671	broad.mit.edu	37	17	57915487	57915487	+	Intron	DEL	A	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57915487delA	uc002ixu.3	+						TMEM49_uc010wog.1_Intron|TMEM49_uc010woh.1_Intron|TMEM49_uc010woi.1_Intron|TMEM49_uc010woj.1_Intron|TMEM49_uc002ixv.2_5'Flank	NM_030938	NP_112200			transmembrane protein 49						autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	X	155254926	155254926	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155254926delG	uc004fnx.3	+	9	1136	c.682delG	c.(682-684)GGGfs	p.G228fs		NM_182905	NP_878908			WAS protein family homolog 1																														---	---	---	---
RUNX3	864	broad.mit.edu	37	1	25229007	25229007	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25229007G>A	uc001bjq.2	-	5	1265	c.854C>T	c.(853-855)TCG>TTG	p.S285L	RUNX3_uc010oen.1_Missense_Mutation_p.S232L|RUNX3_uc009vrj.2_Missense_Mutation_p.S299L|RUNX3_uc001bjr.2_Missense_Mutation_p.S299L|RUNX3_uc001bjs.2_RNA	NM_004350	NP_004341	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 2	285	Pro/Ser/Thr-rich.				cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)														---	---	---	---
EIF2C4	192670	broad.mit.edu	37	1	36306902	36306902	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36306902G>A	uc001bzj.1	+	14	2051	c.1861G>A	c.(1861-1863)GTT>ATT	p.V621I		NM_017629	NP_060099	Q9HCK5	AGO4_HUMAN	eukaryotic translation initiation factor 2C, 4	621	Piwi.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
DHCR24	1718	broad.mit.edu	37	1	55349369	55349369	+	Silent	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55349369A>T	uc001cyc.1	-	2	438	c.309T>A	c.(307-309)CGT>CGA	p.R103R	DHCR24_uc010ook.1_Silent_p.R62R	NM_014762	NP_055577	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase precursor	103	FAD-binding PCMH-type.				anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1																		---	---	---	---
LCE2A	353139	broad.mit.edu	37	1	152671655	152671655	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152671655C>A	uc001faj.2	+	2	329	c.278C>A	c.(277-279)TCT>TAT	p.S93Y		NM_178428	NP_848515	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	93	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
ADAM15	8751	broad.mit.edu	37	1	155026661	155026661	+	Silent	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155026661T>C	uc001fgr.1	+	5	479	c.378T>C	c.(376-378)TAT>TAC	p.Y126Y	ADAM15_uc001fgq.1_5'UTR|ADAM15_uc009wpc.1_RNA|ADAM15_uc010pet.1_Silent_p.Y110Y|ADAM15_uc010peu.1_Silent_p.Y143Y|ADAM15_uc001fgt.1_Silent_p.Y126Y|ADAM15_uc010pev.1_Silent_p.Y136Y|ADAM15_uc001fgs.1_Silent_p.Y126Y|ADAM15_uc001fgu.1_Silent_p.Y126Y|ADAM15_uc001fgw.1_Silent_p.Y126Y|ADAM15_uc001fgv.1_Silent_p.Y126Y|ADAM15_uc001fgx.1_Silent_p.Y126Y|ADAM15_uc001fgz.1_RNA|ADAM15_uc001fgy.1_RNA|ADAM15_uc001fha.1_RNA	NM_207197	NP_997080	Q13444	ADA15_HUMAN	a disintegrin and metalloproteinase domain 15	126					angiogenesis|cell-matrix adhesion|collagen catabolic process|proteolysis	acrosomal vesicle|adherens junction|endomembrane system|flagellum|integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			central_nervous_system(3)|skin(2)|ovary(1)	6	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)															---	---	---	---
ARHGAP30	257106	broad.mit.edu	37	1	161018090	161018090	+	Missense_Mutation	SNP	G	T	T	rs137873621		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161018090G>T	uc001fxl.2	-	12	3067	c.2721C>A	c.(2719-2721)GAC>GAA	p.D907E	USF1_uc001fxi.2_5'Flank|USF1_uc001fxj.2_5'Flank|ARHGAP30_uc001fxk.2_Missense_Mutation_p.D696E|ARHGAP30_uc001fxm.2_Missense_Mutation_p.D753E|ARHGAP30_uc009wtx.2_Missense_Mutation_p.D580E	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	907					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
C1orf49	84066	broad.mit.edu	37	1	178489948	178489948	+	Missense_Mutation	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178489948T>G	uc001glt.1	+	7	594	c.482T>G	c.(481-483)ATG>AGG	p.M161R	C1orf49_uc001glu.1_Missense_Mutation_p.M161R|C1orf49_uc001glv.1_RNA|C1orf49_uc001glw.1_Missense_Mutation_p.M169R	NM_032126	NP_115502	Q5T0J7	CA049_HUMAN	hypothetical protein LOC84066	161						microtubule cytoskeleton					0																		---	---	---	---
LAMC2	3918	broad.mit.edu	37	1	183208626	183208626	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183208626C>T	uc001gqa.2	+	20	3311	c.2997C>T	c.(2995-2997)AGC>AGT	p.S999S	LAMC2_uc001gpz.3_Silent_p.S999S|LAMC2_uc010poa.1_Silent_p.S699S	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	999	Potential.|Domain II and I.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3																		---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196249978	196249978	+	Intron	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196249978T>G	uc001gtd.1	-						KCNT2_uc009wyt.1_Intron|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Nonstop_Mutation_p.*950Y|KCNT2_uc001gth.1_Intron	NM_198503	NP_940905			potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216262463	216262463	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216262463T>C	uc001hku.1	-	23	5164	c.4777A>G	c.(4777-4779)ACT>GCT	p.T1593A		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1593	Laminin G-like 1.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
ZP4	57829	broad.mit.edu	37	1	238053244	238053244	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238053244C>A	uc001hym.2	-	3	323	c.323G>T	c.(322-324)GGA>GTA	p.G108V	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	108	Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)															---	---	---	---
C2orf78	388960	broad.mit.edu	37	2	74042660	74042660	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74042660C>T	uc002sjr.1	+	3	1431	c.1310C>T	c.(1309-1311)TCT>TTT	p.S437F		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	437										ovary(2)	2																		---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168100923	168100923	+	Missense_Mutation	SNP	A	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168100923A>C	uc002udx.2	+	8	3039	c.3021A>C	c.(3019-3021)GAA>GAC	p.E1007D	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E832D|XIRP2_uc010fpq.2_Missense_Mutation_p.E785D|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	832					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170042284	170042284	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170042284G>A	uc002ues.2	-	50	9787	c.9574C>T	c.(9574-9576)CGG>TGG	p.R3192W		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3192	EGF-like 12; calcium-binding (Potential).|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
TTLL4	9654	broad.mit.edu	37	2	219610881	219610881	+	Missense_Mutation	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219610881A>G	uc002viy.2	+	8	2271	c.1901A>G	c.(1900-1902)AAC>AGC	p.N634S	TTLL4_uc010zkl.1_Missense_Mutation_p.N469S|TTLL4_uc010fvx.2_Missense_Mutation_p.N634S|TTLL4_uc010zkm.1_5'UTR	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	634	TTL.				protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)														---	---	---	---
LHFPL4	375323	broad.mit.edu	37	3	9547696	9547696	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9547696G>A	uc003bry.2	-	3	884	c.598C>T	c.(598-600)CGG>TGG	p.R200W		NM_198560	NP_940962	Q7Z7J7	LHPL4_HUMAN	lipoma HMGIC fusion partner-like 4	200						integral to membrane				ovary(2)|skin(1)	3	Medulloblastoma(99;0.227)																	---	---	---	---
CCR1	1230	broad.mit.edu	37	3	46245463	46245463	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46245463G>T	uc003cph.1	-	2	413	c.342C>A	c.(340-342)TAC>TAA	p.Y114*	CCR3_uc003cpg.1_Intron	NM_001295	NP_001286	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	114	Helical; Name=3; (Potential).				cell adhesion|cell-cell signaling|cytokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	integral to plasma membrane	C-C chemokine receptor activity			skin(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)														---	---	---	---
GXYLT2	727936	broad.mit.edu	37	3	72957515	72957515	+	Intron	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72957515T>G	uc003dpg.2	+							NM_001080393	NP_001073862			glycosyltransferase 8 domain containing 4						O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0																		---	---	---	---
GPR128	84873	broad.mit.edu	37	3	100356135	100356135	+	Intron	SNP	C	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100356135C>G	uc003duc.2	+						GPR128_uc011bhc.1_Intron	NM_032787	NP_116176			G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4																		---	---	---	---
COL6A6	131873	broad.mit.edu	37	3	130282057	130282057	+	Missense_Mutation	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130282057G>T	uc010htl.2	+	2	241	c.210G>T	c.(208-210)CAG>CAT	p.Q70H		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	70	Nonhelical region.|VWFA 1.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8																		---	---	---	---
MED12L	116931	broad.mit.edu	37	3	150877763	150877763	+	Missense_Mutation	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150877763A>T	uc003eyp.2	+	7	1020	c.982A>T	c.(982-984)AGT>TGT	p.S328C	MED12L_uc011bnz.1_Intron|MED12L_uc003eyn.2_Missense_Mutation_p.S328C|MED12L_uc003eyo.2_Missense_Mutation_p.S328C	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	328					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
PTPN13	5783	broad.mit.edu	37	4	87610306	87610306	+	Missense_Mutation	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87610306A>G	uc003hpz.2	+	5	989	c.509A>G	c.(508-510)AAA>AGA	p.K170R	PTPN13_uc003hpy.2_Missense_Mutation_p.K170R|PTPN13_uc003hqa.2_Missense_Mutation_p.K170R|PTPN13_uc003hqb.2_Missense_Mutation_p.K170R	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	170	KIND.					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)														---	---	---	---
PPA2	27068	broad.mit.edu	37	4	106394798	106394798	+	Intron	SNP	C	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106394798C>G	uc003hxl.2	-						PPA2_uc003hxm.2_Intron|PPA2_uc003hxn.2_Intron|PPA2_uc003hxo.2_Intron|PPA2_uc003hxp.2_Intron|PPA2_uc003hxq.2_Intron|PPA2_uc003hxr.2_Intron|PPA2_uc011cfa.1_Intron|PPA2_uc003hxs.2_RNA	NM_176869	NP_789845			inorganic pyrophosphatase 2 isoform 1 precursor						diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)														---	---	---	---
ZFP42	132625	broad.mit.edu	37	4	188923983	188923983	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188923983C>T	uc003izg.1	+	3	267	c.22C>T	c.(22-24)CGG>TGG	p.R8W	ZFP42_uc003izh.1_Missense_Mutation_p.R8W|ZFP42_uc003izi.1_Missense_Mutation_p.R8W	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	8					female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)														---	---	---	---
FAM81B	153643	broad.mit.edu	37	5	94749724	94749724	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94749724C>T	uc003kla.1	+	4	413	c.367C>T	c.(367-369)CGT>TGT	p.R123C	FAM81B_uc010jbe.1_5'UTR	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	123										ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)														---	---	---	---
TSLP	85480	broad.mit.edu	37	5	110407621	110407621	+	Silent	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110407621A>T	uc003kpb.2	+	1	232	c.33A>T	c.(31-33)TCA>TCT	p.S11S	TSLP_uc003kpa.2_Splice_Site|TSLP_uc010jbt.1_5'Flank	NM_033035	NP_149024	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin isoform 1	11				MFPFALLYVLS -> MKCLGQSKKEE (in Ref. 3; AAH40592).		extracellular space	cytokine activity				0		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
RNF145	153830	broad.mit.edu	37	5	158585955	158585955	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158585955G>A	uc003lxp.2	-	11	2028	c.1715C>T	c.(1714-1716)CCT>CTT	p.P572L	RNF145_uc011ddy.1_Missense_Mutation_p.P586L|RNF145_uc003lxo.1_Missense_Mutation_p.P600L|RNF145_uc011ddz.1_Missense_Mutation_p.P589L|RNF145_uc010jiq.1_Missense_Mutation_p.P602L	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145	572	RING-type; atypical.					integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
ZNF354C	30832	broad.mit.edu	37	5	178506747	178506747	+	Missense_Mutation	SNP	A	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178506747A>C	uc003mju.2	+	5	1429	c.1314A>C	c.(1312-1314)AAA>AAC	p.K438N		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	438					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)														---	---	---	---
HIST1H2AG	8969	broad.mit.edu	37	6	27101031	27101031	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27101031G>A	uc003niw.2	+	1	215	c.181G>A	c.(181-183)GCC>ACC	p.A61T	HIST1H2BJ_uc003niu.1_5'Flank|HIST1H2BJ_uc003niv.2_5'Flank	NM_021064	NP_066408	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	61					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding				0																		---	---	---	---
HIST1H3H	8357	broad.mit.edu	37	6	27776190	27776190	+	5'Flank	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27776190G>A	uc003njm.2	+						HIST1H2BL_uc003njl.2_5'Flank	NM_003536	NP_003527			histone cluster 1, H3h						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1																		---	---	---	---
TNF	7124	broad.mit.edu	37	6	31545010	31545010	+	Missense_Mutation	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31545010T>G	uc003nui.2	+	4	567	c.398T>G	c.(397-399)CTC>CGC	p.L133R	TNF_uc003nuj.2_5'UTR	NM_000594	NP_000585	P01375	TNFA_HUMAN	tumor necrosis factor alpha	133	Extracellular (Potential).				activation of caspase activity|activation of MAPK activity|activation of MAPKKK activity|anti-apoptosis|cellular response to nicotine|chronic inflammatory response to antigenic stimulus|embryonic digestive tract development|induction of apoptosis via death domain receptors|induction of necroptosis by extracellular signals|leukocyte tethering or rolling|necrotic cell death|negative regulation of branching involved in lung morphogenesis|negative regulation of cytokine secretion involved in immune response|negative regulation of fat cell differentiation|negative regulation of interleukin-6 production|negative regulation of lipid catabolic process|negative regulation of lipid storage|negative regulation of viral genome replication|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of chemokine biosynthetic process|positive regulation of chemokine production|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of fever generation|positive regulation of heterotypic cell-cell adhesion|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of membrane protein ectodomain proteolysis|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of NFAT protein import into nucleus|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of podosome assembly|positive regulation of protein complex disassembly|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|receptor biosynthetic process|regulation of insulin secretion|response to glucocorticoid stimulus|response to salt stress|response to virus|sequestering of triglyceride|transformed cell apoptosis|tumor necrosis factor-mediated signaling pathway	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane raft|phagocytic cup|recycling endosome	cytokine activity|identical protein binding|protease binding|transcription regulatory region DNA binding|tumor necrosis factor receptor binding			ovary(1)|pancreas(1)|skin(1)	3		Ovarian(999;0.00556)			Adalimumab(DB00051)|Adenosine(DB00640)|Amrinone(DB01427)|Atorvastatin(DB01076)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Etanercept(DB00005)|Glucosamine(DB01296)|Infliximab(DB00065)|Naltrexone(DB00704)|Pranlukast(DB01411)|Procaterol(DB01366)|Saquinavir(DB01232)|Simvastatin(DB00641)|Thalidomide(DB01041)									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				---	---	---	---
SLC26A8	116369	broad.mit.edu	37	6	35919039	35919039	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35919039G>A	uc003olm.2	-	19	2484	c.2373C>T	c.(2371-2373)GCC>GCT	p.A791A	SLC26A8_uc010jwa.2_RNA|SLC26A8_uc003olk.2_Silent_p.A373A|SLC26A8_uc003oln.2_Silent_p.A791A|SLC26A8_uc003oll.2_Silent_p.A686A	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	791	Interaction with RACGAP1.|STAS.|Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2																		---	---	---	---
SLC26A8	116369	broad.mit.edu	37	6	35987480	35987480	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35987480G>A	uc003olm.2	-	2	116	c.5C>T	c.(4-6)GCA>GTA	p.A2V	SLC26A8_uc003oln.2_Missense_Mutation_p.A2V|SLC26A8_uc003oll.2_Missense_Mutation_p.A2V	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	2	Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2																		---	---	---	---
DEFB112	245915	broad.mit.edu	37	6	50016324	50016324	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50016324T>C	uc011dws.1	-	1	41	c.41A>G	c.(40-42)AAA>AGA	p.K14R		NM_001037498	NP_001032587	Q30KQ8	DB112_HUMAN	beta-defensin 112 precursor	14					defense response to bacterium	extracellular region				central_nervous_system(1)	1	Lung NSC(77;0.042)																	---	---	---	---
USP45	85015	broad.mit.edu	37	6	99894207	99894207	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99894207G>A	uc003ppx.2	-	14	1974	c.1441C>T	c.(1441-1443)CGT>TGT	p.R481C	USP45_uc003ppv.2_Intron|USP45_uc003ppw.2_Missense_Mutation_p.R161C	NM_001080481	NP_001073950	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	481					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|breast(1)	2		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)														---	---	---	---
AIMP2	7965	broad.mit.edu	37	7	6063309	6063309	+	Missense_Mutation	SNP	A	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6063309A>C	uc003spo.2	+	4	1063	c.950A>C	c.(949-951)AAG>ACG	p.K317T	EIF2AK1_uc003spp.2_3'UTR|EIF2AK1_uc003spq.2_3'UTR|EIF2AK1_uc011jwm.1_3'UTR	NM_006303	NP_006294	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting	317	GST C-terminal.				apoptosis|cell differentiation|multicellular organismal development|tRNA aminoacylation for protein translation	cytosol|nucleus	protein binding			ovary(1)	1																		---	---	---	---
PTPN12	5782	broad.mit.edu	37	7	77256920	77256920	+	Missense_Mutation	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77256920A>G	uc003ugh.2	+	13	2015	c.1924A>G	c.(1924-1926)ACT>GCT	p.T642A	PTPN12_uc011kgp.1_Missense_Mutation_p.T523A|PTPN12_uc011kgq.1_Missense_Mutation_p.T512A|PTPN12_uc010lds.2_Missense_Mutation_p.T374A	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type	642						soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3																		---	---	---	---
RGS20	8601	broad.mit.edu	37	8	54791954	54791954	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54791954G>A	uc003xrp.2	+	2	394	c.302G>A	c.(301-303)CGC>CAC	p.R101H	RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron|RGS20_uc003xrr.2_5'Flank|RGS20_uc003xrs.2_5'Flank|RGS20_uc003xrt.2_5'Flank	NM_170587	NP_733466	O76081	RGS20_HUMAN	regulator of G-protein signaling 20 isoform a	101					negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)															---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56015093	56015093	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56015093C>T	uc003xsf.2	+	1	77	c.45C>T	c.(43-45)AGC>AGT	p.S15S		NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related	15						integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)															---	---	---	---
VCPIP1	80124	broad.mit.edu	37	8	67577533	67577533	+	Missense_Mutation	SNP	G	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67577533G>C	uc003xwn.2	-	1	1920	c.1661C>G	c.(1660-1662)TCT>TGT	p.S554C	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	554					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68950535	68950535	+	Intron	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68950535C>A	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
ERMP1	79956	broad.mit.edu	37	9	5805111	5805111	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5805111G>A	uc003zjm.1	-	10	1884	c.1830C>T	c.(1828-1830)CTC>CTT	p.L610L	ERMP1_uc011lme.1_RNA|ERMP1_uc010mhs.1_Silent_p.L224L	NM_024896	NP_079172	Q7Z2K6	ERMP1_HUMAN	aminopeptidase Fxna	610	Extracellular (Potential).				proteolysis	endoplasmic reticulum membrane|integral to membrane	metal ion binding|metallopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)														---	---	---	---
ROR2	4920	broad.mit.edu	37	9	94519612	94519612	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94519612G>A	uc004arj.1	-	3	604	c.405C>T	c.(403-405)TGC>TGT	p.C135C	ROR2_uc004ari.1_5'UTR|ROR2_uc004ark.2_Silent_p.C135C	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	135	Extracellular (Potential).|Ig-like C2-type.				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20																		---	---	---	---
OR1J2	26740	broad.mit.edu	37	9	125273389	125273389	+	Missense_Mutation	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125273389T>G	uc004bmj.1	+	4	1164	c.309T>G	c.(307-309)TTT>TTG	p.F103L	OR1J2_uc011lyv.1_Missense_Mutation_p.F103L	NM_054107	NP_473448	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|pancreas(1)|breast(1)	5																		---	---	---	---
GATA3	2625	broad.mit.edu	37	10	8100408	8100408	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8100408G>A	uc001ika.2	+	3	939	c.382G>A	c.(382-384)GGG>AGG	p.G128R	GATA3_uc001ijz.2_Missense_Mutation_p.G128R	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	128					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22								F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						---	---	---	---
GATA3	2625	broad.mit.edu	37	10	8100563	8100563	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8100563C>T	uc001ika.2	+	3	1094	c.537C>T	c.(535-537)GAC>GAT	p.D179D	GATA3_uc001ijz.2_Silent_p.D179D	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	179					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22								F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16982025	16982025	+	Intron	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16982025A>T	uc001ioo.2	-							NM_001081	NP_001072			cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
NEBL	10529	broad.mit.edu	37	10	21101831	21101831	+	Missense_Mutation	SNP	T	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21101831T>A	uc001iqi.2	-	24	2782	c.2385A>T	c.(2383-2385)AGA>AGT	p.R795S	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Missense_Mutation_p.R132S	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	795	Nebulin 23.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2																		---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55569247	55569247	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55569247T>C	uc010qhu.1	-	36	5008	c.4613A>G	c.(4612-4614)AAG>AGG	p.K1538R	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Silent_p.E1526E|PCDH15_uc010qht.1_Silent_p.E1519E	NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor	Error:Variant_position_missing_in_Q96QU1_after_alignment					equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
ADAMTS14	140766	broad.mit.edu	37	10	72500888	72500888	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72500888C>A	uc001jrh.2	+	12	1894	c.1894C>A	c.(1894-1896)CAC>AAC	p.H632N	ADAMTS14_uc001jrg.2_Missense_Mutation_p.H635N|ADAMTS14_uc001jri.1_Missense_Mutation_p.H155N	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	632	Cys-rich.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---
SEC24C	9632	broad.mit.edu	37	10	75526139	75526139	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75526139G>A	uc001juw.2	+	13	1818	c.1639G>A	c.(1639-1641)GTT>ATT	p.V547I	SEC24C_uc010qkn.1_RNA|SEC24C_uc009xrj.1_Missense_Mutation_p.V405I|SEC24C_uc001jux.2_Missense_Mutation_p.V547I|SEC24C_uc010qko.1_Missense_Mutation_p.V428I|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	NM_004922	NP_004913	P53992	SC24C_HUMAN	SEC24-related protein C	547					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding			skin(2)|central_nervous_system(1)	3	Prostate(51;0.0112)																	---	---	---	---
ZNF518A	9849	broad.mit.edu	37	10	97918089	97918089	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97918089C>A	uc001klp.2	+	6	2867	c.2010C>A	c.(2008-2010)AGC>AGA	p.S670R	ZNF518A_uc001klo.1_Missense_Mutation_p.S140R|ZNF518A_uc001klq.2_Missense_Mutation_p.S670R|ZNF518A_uc001klr.2_Missense_Mutation_p.S670R	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	670					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)														---	---	---	---
TM9SF3	56889	broad.mit.edu	37	10	98319502	98319502	+	Intron	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98319502A>T	uc001kmm.3	-						TM9SF3_uc010qot.1_Intron	NM_020123	NP_064508			transmembrane 9 superfamily member 3 precursor							integral to membrane	binding				0		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)														---	---	---	---
SPON1	10418	broad.mit.edu	37	11	14264896	14264896	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14264896G>A	uc001mle.2	+	8	1382	c.844G>A	c.(844-846)GTC>ATC	p.V282I		NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein	282	Spondin.				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---
MRGPRX4	117196	broad.mit.edu	37	11	18194989	18194989	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18194989C>T	uc001mnv.1	+	1	606	c.186C>T	c.(184-186)TCC>TCT	p.S62S		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	62	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1																		---	---	---	---
TSG101	7251	broad.mit.edu	37	11	18505470	18505470	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18505470T>C	uc001mor.2	-	8	916	c.790A>G	c.(790-792)AAA>GAA	p.K264E		NM_006292	NP_006283	Q99816	TS101_HUMAN	tumor susceptibility gene 101	264	Potential.				cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0																		---	---	---	---
OR5AP2	338675	broad.mit.edu	37	11	56409733	56409733	+	Silent	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56409733G>T	uc001njb.1	-	1	183	c.183C>A	c.(181-183)CTC>CTA	p.L61L		NM_001002925	NP_001002925	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP,	61	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
KLC2	64837	broad.mit.edu	37	11	66026277	66026277	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66026277G>A	uc010rov.1	+	2	455	c.212G>A	c.(211-213)GGG>GAG	p.G71E	KLC2_uc010row.1_Missense_Mutation_p.G71E|KLC2_uc009yra.2_Missense_Mutation_p.G71E|KLC2_uc001ohb.2_Missense_Mutation_p.G71E|KLC2_uc010rox.1_Missense_Mutation_p.G71E|KLC2_uc001ohc.2_Missense_Mutation_p.G71E|KLC2_uc001ohd.2_Missense_Mutation_p.G71E|KLC2_uc001ohe.1_5'Flank	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	71					blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0																OREG0021097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TAF1D	79101	broad.mit.edu	37	11	93469428	93469428	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93469428T>C	uc001ped.2	-	6	938	c.736A>G	c.(736-738)AGT>GGT	p.S246G	SNORA8_uc001pec.2_5'Flank|TAF1D_uc001pdz.2_RNA|TAF1D_uc001pea.1_Intron|SNORD5_uc009ywf.1_5'Flank|SNORA18_uc009ywg.1_5'Flank|MIR1304_hsa-mir-1304|MI0006371_5'Flank|SNORA40_uc009ywh.2_5'Flank	NM_024116	NP_077021	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated	246					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding				0																		---	---	---	---
FAM55D	54827	broad.mit.edu	37	11	114441717	114441717	+	Missense_Mutation	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114441717G>T	uc001ppc.2	-	6	1759	c.1578C>A	c.(1576-1578)CAC>CAA	p.H526Q	FAM55D_uc001ppd.2_Missense_Mutation_p.H242Q	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	526						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)														---	---	---	---
KCNJ5	3762	broad.mit.edu	37	11	128786552	128786552	+	Missense_Mutation	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128786552G>T	uc001qet.2	+	3	1500	c.1186G>T	c.(1186-1188)GCA>TCA	p.A396S	KCNJ5_uc009zck.2_Missense_Mutation_p.A396S|KCNJ5_uc001qew.2_Missense_Mutation_p.A396S	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5	396	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)													---	---	---	---
GPRC5A	9052	broad.mit.edu	37	12	13061792	13061792	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13061792C>T	uc001rba.2	+	2	1259	c.609C>T	c.(607-609)TTC>TTT	p.F203F	GPRC5A_uc001raz.2_Silent_p.F203F	NM_003979	NP_003970	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, family C, group 5,	203	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)													---	---	---	---
PLCZ1	89869	broad.mit.edu	37	12	18848016	18848016	+	Intron	SNP	G	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18848016G>C	uc010sid.1	-						PLCZ1_uc001rdv.3_Intron|PLCZ1_uc001rdw.3_Intron|PLCZ1_uc001rdu.1_Intron|PLCZ1_uc009zil.1_Intron	NM_033123	NP_149114			phospholipase C, zeta 1						intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)																	---	---	---	---
ABCC9	10060	broad.mit.edu	37	12	22012551	22012551	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22012551G>A	uc001rfi.1	-	20	2494	c.2474C>T	c.(2473-2475)GCG>GTG	p.A825V	ABCC9_uc001rfh.2_Missense_Mutation_p.A825V|ABCC9_uc001rfj.1_Missense_Mutation_p.A789V	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	825	Cytoplasmic (Potential).|ABC transporter 1.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	p.A825A(1)		ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
PTPRB	5787	broad.mit.edu	37	12	70956771	70956771	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70956771C>T	uc001swb.3	-	14	3397	c.3367G>A	c.(3367-3369)GAT>AAT	p.D1123N	PTPRB_uc010sto.1_Missense_Mutation_p.D1033N|PTPRB_uc010stp.1_Missense_Mutation_p.D1033N|PTPRB_uc001swc.3_Missense_Mutation_p.D1341N|PTPRB_uc001swa.3_Missense_Mutation_p.D1253N|PTPRB_uc001swd.3_Missense_Mutation_p.D1340N|PTPRB_uc009zrr.1_Missense_Mutation_p.D1220N	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1123	Fibronectin type-III 13.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---
PTPRR	5801	broad.mit.edu	37	12	71054759	71054759	+	Missense_Mutation	SNP	A	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71054759A>C	uc001swi.1	-	12	2143	c.1727T>G	c.(1726-1728)CTT>CGT	p.L576R	PTPRR_uc001swf.1_RNA|PTPRR_uc001swg.1_RNA|PTPRR_uc001swh.1_Missense_Mutation_p.L331R|PTPRR_uc009zrs.2_Missense_Mutation_p.L425R|PTPRR_uc010stq.1_Missense_Mutation_p.L464R|PTPRR_uc010str.1_3'UTR	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	576	Tyrosine-protein phosphatase.|Cytoplasmic (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)														---	---	---	---
HIP1R	9026	broad.mit.edu	37	12	123342783	123342783	+	Silent	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123342783T>C	uc001udj.1	+	19	2009	c.1950T>C	c.(1948-1950)TGT>TGC	p.C650C	HIP1R_uc001udk.1_5'UTR	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	650					receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)														---	---	---	---
PAN3	255967	broad.mit.edu	37	13	28830630	28830630	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28830630C>T	uc001urz.2	+	6	772	c.764C>T	c.(763-765)ACG>ATG	p.T255M	PAN3_uc010tdo.1_Missense_Mutation_p.T401M|PAN3_uc001ury.2_Missense_Mutation_p.T89M|PAN3_uc001urx.2_Missense_Mutation_p.T201M	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	401	Interaction with polyadenylate-binding protein.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)														---	---	---	---
LIG4	3981	broad.mit.edu	37	13	108861879	108861879	+	Missense_Mutation	SNP	G	C	C	rs104894418		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861879G>C	uc001vqn.2	-	2	2011	c.1738C>G	c.(1738-1740)CGA>GGA	p.R580G	LIG4_uc001vqo.2_Missense_Mutation_p.R580G|LIG4_uc010agg.1_Missense_Mutation_p.R513G|LIG4_uc010agf.2_Missense_Mutation_p.R580G|LIG4_uc001vqp.2_Missense_Mutation_p.R580G	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	580					cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)												NHEJ					---	---	---	---
Unknown	0	broad.mit.edu	37	14	22409601	22409601	+	Intron	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22409601A>T	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010ajb.1_RNA|uc001wck.2_Missense_Mutation_p.T31S					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
ADCY4	196883	broad.mit.edu	37	14	24798345	24798345	+	Silent	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24798345C>A	uc001wov.2	-	10	1452	c.1446G>T	c.(1444-1446)CTG>CTT	p.L482L	ADCY4_uc001wow.2_Silent_p.L482L|ADCY4_uc010toh.1_Silent_p.L168L|ADCY4_uc001wox.2_Silent_p.L482L|ADCY4_uc001woy.2_Silent_p.L482L	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	482	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)														---	---	---	---
LGMN	5641	broad.mit.edu	37	14	93178266	93178266	+	Silent	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93178266C>A	uc001yav.2	-	10	971	c.645G>T	c.(643-645)TCG>TCT	p.S215S	LGMN_uc001yat.2_Silent_p.S215S|LGMN_uc001yau.2_Silent_p.S215S|LGMN_uc001yaw.2_Silent_p.S215S|LGMN_uc010aul.2_Silent_p.S96S|LGMN_uc001yax.2_Silent_p.S215S|LGMN_uc001yay.2_Silent_p.S215S	NM_001008530	NP_001008530	Q99538	LGMN_HUMAN	legumain preproprotein	215					hormone biosynthetic process|negative regulation of neuron apoptosis|vitamin D metabolic process	lysosome	cysteine-type endopeptidase activity|protein serine/threonine kinase activity			skin(1)	1		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
ITPK1	3705	broad.mit.edu	37	14	93483134	93483134	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93483134G>A	uc001ybg.2	-	4	422	c.133C>T	c.(133-135)CGG>TGG	p.R45W	ITPK1_uc001ybe.2_Missense_Mutation_p.R45W|ITPK1_uc001ybf.2_5'UTR|ITPK1_uc001ybh.2_Missense_Mutation_p.R45W	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform	45					blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)														---	---	---	---
IL16	3603	broad.mit.edu	37	15	81565490	81565490	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81565490C>T	uc002bgh.3	+	6	1111	c.735C>T	c.(733-735)TAC>TAT	p.Y245Y	IL16_uc002bgc.2_RNA|IL16_uc010blq.1_Silent_p.Y245Y|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Silent_p.Y287Y|IL16_uc002bgg.2_Silent_p.Y245Y	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	245	Interaction with GRIN2A.|PDZ 1.				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	9857896	9857896	+	Silent	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9857896G>T	uc002czo.3	-	13	4053	c.3505C>A	c.(3505-3507)CGG>AGG	p.R1169R	GRIN2A_uc010uym.1_Silent_p.R1169R|GRIN2A_uc010uyn.1_Silent_p.R1012R|GRIN2A_uc002czr.3_Silent_p.R1169R	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1169	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
SLC12A4	6560	broad.mit.edu	37	16	67984928	67984928	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67984928G>A	uc002euz.2	-	10	1474	c.1333C>T	c.(1333-1335)CGT>TGT	p.R445C	SLC12A4_uc010ceu.2_Missense_Mutation_p.R439C|SLC12A4_uc010vkh.1_Missense_Mutation_p.R414C|SLC12A4_uc010vki.1_Missense_Mutation_p.R445C|SLC12A4_uc010vkj.1_Missense_Mutation_p.R447C|SLC12A4_uc002eva.2_Missense_Mutation_p.R445C|SLC12A4_uc002evb.2_Intron	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a	445					cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)													---	---	---	---
ADAT1	23536	broad.mit.edu	37	16	75642762	75642762	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75642762G>A	uc002feo.1	-	8	1270	c.1168C>T	c.(1168-1170)CGA>TGA	p.R390*	ADAT1_uc002fep.1_Nonsense_Mutation_p.R241*	NM_012091	NP_036223	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	390	A to I editase.				tRNA processing		metal ion binding|RNA binding|tRNA-specific adenosine deaminase activity			ovary(1)|skin(1)	2																		---	---	---	---
SLC13A5	284111	broad.mit.edu	37	17	6589668	6589668	+	Intron	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6589668G>A	uc002gdj.2	-						SLC13A5_uc010vtf.1_Intron|SLC13A5_uc010clq.2_Intron|SLC13A5_uc002gdk.2_Intron	NM_177550	NP_808218			solute carrier family 13, member 5 isoform a							integral to membrane	citrate transmembrane transporter activity				0																		---	---	---	---
MYH3	4621	broad.mit.edu	37	17	10538727	10538727	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10538727C>T	uc002gmq.1	-	29	4206	c.4129G>A	c.(4129-4131)GAG>AAG	p.E1377K		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1377	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7																		---	---	---	---
KRT33A	3883	broad.mit.edu	37	17	39502500	39502500	+	Intron	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39502500A>G	uc002hwk.1	-							NM_004138	NP_004129			keratin 33A							intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)																---	---	---	---
ABCA9	10350	broad.mit.edu	37	17	67022510	67022510	+	Intron	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67022510G>A	uc002jhu.2	-						ABCA9_uc010dez.2_Intron	NM_080283	NP_525022			ATP-binding cassette, sub-family A, member 9						transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)																	---	---	---	---
C17orf70	80233	broad.mit.edu	37	17	79517825	79517825	+	Missense_Mutation	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79517825T>G	uc002kaq.2	-	3	750	c.695A>C	c.(694-696)GAT>GCT	p.D232A	C17orf70_uc002kao.1_5'Flank|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Missense_Mutation_p.D81A	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit	232					DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)															---	---	---	---
CETN1	1068	broad.mit.edu	37	18	580882	580882	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:580882C>T	uc002kko.1	+	1	516	c.474C>T	c.(472-474)AAC>AAT	p.N158N		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	158	2 (Probable).|EF-hand 4.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
DCC	1630	broad.mit.edu	37	18	50589747	50589747	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50589747C>A	uc002lfe.1	+	6	1645	c.1058C>A	c.(1057-1059)ACA>AAA	p.T353K	DCC_uc010xdr.1_Missense_Mutation_p.T201K|DCC_uc010dpf.1_Missense_Mutation_p.T8K	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	353	Extracellular (Potential).|Ig-like C2-type 4.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
DCC	1630	broad.mit.edu	37	18	50734199	50734199	+	Intron	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50734199A>G	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
C3	718	broad.mit.edu	37	19	6707247	6707247	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6707247C>A	uc002mfm.2	-	17	2147	c.2085G>T	c.(2083-2085)GAG>GAT	p.E695D		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	695	Anaphylatoxin-like.				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
ICAM4	3386	broad.mit.edu	37	19	10398284	10398284	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10398284C>T	uc002mns.1	+	2	506	c.467C>T	c.(466-468)ACG>ATG	p.T156M	ICAM4_uc002mnr.1_Intron|ICAM4_uc002mnt.1_Missense_Mutation_p.T156M|ICAM5_uc002mnu.3_5'Flank	NM_001544	NP_001535	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 isoform 1	156	Ig-like C2-type 2.|Extracellular (Potential).				cell-cell adhesion|regulation of immune response	extracellular region|integral to membrane|plasma membrane	integrin binding			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)															---	---	---	---
ZNF676	163223	broad.mit.edu	37	19	22364289	22364289	+	Missense_Mutation	SNP	T	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22364289T>A	uc002nqs.1	-	3	548	c.230A>T	c.(229-231)GAG>GTG	p.E77V		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	77					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)																---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42168807	42168807	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42168807C>T	uc010zwh.1	+	20	2170	c.2124C>T	c.(2122-2124)GTC>GTT	p.V708V	L3MBTL_uc002xkl.2_Silent_p.V640V|L3MBTL_uc002xkm.2_Silent_p.V640V|L3MBTL_uc010ggl.2_Silent_p.V645V|L3MBTL_uc002xkn.1_Silent_p.V399V|L3MBTL_uc002xko.2_Silent_p.V292V|L3MBTL_uc002xkp.2_Silent_p.V28V|SGK2_uc002xkq.1_5'UTR	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	640					chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51871800	51871800	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51871800G>A	uc002xwo.2	+	2	2759	c.1803G>A	c.(1801-1803)AAG>AAA	p.K601K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	601					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51871810	51871810	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51871810G>A	uc002xwo.2	+	2	2769	c.1813G>A	c.(1813-1815)GAA>AAA	p.E605K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	605					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51871813	51871813	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51871813G>A	uc002xwo.2	+	2	2772	c.1816G>A	c.(1816-1818)GAC>AAC	p.D606N		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	606					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51871968	51871968	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51871968G>A	uc002xwo.2	+	2	2927	c.1971G>A	c.(1969-1971)CTG>CTA	p.L657L		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	657					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872223	51872223	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872223G>A	uc002xwo.2	+	2	3182	c.2226G>A	c.(2224-2226)TTG>TTA	p.L742L		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	742					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872482	51872482	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872482G>A	uc002xwo.2	+	2	3441	c.2485G>A	c.(2485-2487)GAG>AAG	p.E829K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	829					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872676	51872676	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872676G>A	uc002xwo.2	+	2	3635	c.2679G>A	c.(2677-2679)ATG>ATA	p.M893I		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	893	Homeobox; atypical.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872755	51872755	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872755G>A	uc002xwo.2	+	2	3714	c.2758G>A	c.(2758-2760)GAC>AAC	p.D920N		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	920					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872804	51872804	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872804G>A	uc002xwo.2	+	2	3763	c.2807G>A	c.(2806-2808)AGA>AAA	p.R936K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	936	C2H2-type 4.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872833	51872833	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872833G>A	uc002xwo.2	+	2	3792	c.2836G>A	c.(2836-2838)GAA>AAA	p.E946K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	946	C2H2-type 4.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872931	51872931	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872931G>A	uc002xwo.2	+	2	3890	c.2934G>A	c.(2932-2934)CAG>CAA	p.Q978Q		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	978					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
PHKA2	5256	broad.mit.edu	37	X	18912313	18912313	+	Intron	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18912313C>A	uc004cyv.3	-						uc004cyt.2_RNA|PHKA2_uc004cyu.3_Intron	NM_000292	NP_000283			phosphorylase kinase, alpha 2 (liver)						glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)																	---	---	---	---
MAP7D2	256714	broad.mit.edu	37	X	20081624	20081624	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20081624G>A	uc004czr.1	-	3	299	c.280C>T	c.(280-282)CGA>TGA	p.R94*	MAP7D2_uc011mji.1_Nonsense_Mutation_p.R50*|MAP7D2_uc010nfo.1_Nonsense_Mutation_p.R94*|MAP7D2_uc011mjj.1_Nonsense_Mutation_p.R94*|MAP7D2_uc004czs.1_Nonsense_Mutation_p.R50*	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	94	Potential.									ovary(2)|breast(1)	3																		---	---	---	---
CHST7	56548	broad.mit.edu	37	X	46433894	46433894	+	Missense_Mutation	SNP	C	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46433894C>G	uc004dgt.2	+	1	703	c.528C>G	c.(526-528)GAC>GAG	p.D176E		NM_019886	NP_063939	Q9NS84	CHST7_HUMAN	chondroitin 6-sulfotransferase 7	176	Lumenal (Potential).				chondroitin sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity|N-acetylglucosamine 6-O-sulfotransferase activity			breast(3)	3																		---	---	---	---
ZC4H2	55906	broad.mit.edu	37	X	64137662	64137662	+	3'UTR	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64137662T>C	uc004dvu.2	-	5					ZC4H2_uc004dvv.2_3'UTR|ZC4H2_uc011mov.1_3'UTR|ZC4H2_uc011mow.1_Silent_p.K171K|ZC4H2_uc004dvw.1_3'UTR	NM_018684	NP_061154			zinc finger, C4H2 domain containing								metal ion binding|protein binding			ovary(1)	1																		---	---	---	---
TEX11	56159	broad.mit.edu	37	X	69772062	69772062	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69772062G>A	uc004dyl.2	-	29	2641	c.2479C>T	c.(2479-2481)CCA>TCA	p.P827S	TEX11_uc004dyk.2_Missense_Mutation_p.P502S|TEX11_uc004dym.2_Missense_Mutation_p.P812S	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	827							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)																	---	---	---	---
HNRNPH2	3188	broad.mit.edu	37	X	100667850	100667850	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100667850C>A	uc004ehm.2	+	2	1044	c.874C>A	c.(874-876)CAC>AAC	p.H292N	HNRNPH2_uc004ehn.2_Missense_Mutation_p.H292N	NM_019597	NP_062543	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2	292	RRM 3.|2 X 16 AA Gly-rich approximate repeats.				nuclear mRNA splicing, via spliceosome	actin cytoskeleton|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
IL13RA2	3598	broad.mit.edu	37	X	114239785	114239785	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114239785C>T	uc004epx.2	-	9	1216	c.1091G>A	c.(1090-1092)CGT>CAT	p.R364H	IL13RA2_uc010nqd.1_Missense_Mutation_p.R364H	NM_000640	NP_000631	Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2 precursor	364	Cytoplasmic (Potential).					extracellular space|integral to membrane|soluble fraction	cytokine receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3																		---	---	---	---
DCAF12L1	139170	broad.mit.edu	37	X	125685810	125685810	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125685810C>A	uc004eul.2	-	1	1033	c.782G>T	c.(781-783)AGT>ATT	p.S261I		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	261	WD 3.									skin(3)|ovary(1)	4																		---	---	---	---
CD40LG	959	broad.mit.edu	37	X	135736558	135736558	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135736558G>A	uc004faa.2	+	3	387	c.315G>A	c.(313-315)ACG>ACA	p.T105T	CD40LG_uc010nsd.2_Silent_p.T105T|CD40LG_uc010nse.1_Intron	NM_000074	NP_000065	P29965	CD40L_HUMAN	CD40 ligand	105	Extracellular (Potential).				anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)									Immune_Deficiency_with_Hyper-IgM				---	---	---	---
RUNX3	864	broad.mit.edu	37	1	25229007	25229007	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25229007G>A	uc001bjq.2	-	5	1265	c.854C>T	c.(853-855)TCG>TTG	p.S285L	RUNX3_uc010oen.1_Missense_Mutation_p.S232L|RUNX3_uc009vrj.2_Missense_Mutation_p.S299L|RUNX3_uc001bjr.2_Missense_Mutation_p.S299L|RUNX3_uc001bjs.2_RNA	NM_004350	NP_004341	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 2	285	Pro/Ser/Thr-rich.				cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)														---	---	---	---
EIF2C4	192670	broad.mit.edu	37	1	36306902	36306902	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36306902G>A	uc001bzj.1	+	14	2051	c.1861G>A	c.(1861-1863)GTT>ATT	p.V621I		NM_017629	NP_060099	Q9HCK5	AGO4_HUMAN	eukaryotic translation initiation factor 2C, 4	621	Piwi.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
DHCR24	1718	broad.mit.edu	37	1	55349369	55349369	+	Silent	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55349369A>T	uc001cyc.1	-	2	438	c.309T>A	c.(307-309)CGT>CGA	p.R103R	DHCR24_uc010ook.1_Silent_p.R62R	NM_014762	NP_055577	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase precursor	103	FAD-binding PCMH-type.				anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1																		---	---	---	---
LCE2A	353139	broad.mit.edu	37	1	152671655	152671655	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152671655C>A	uc001faj.2	+	2	329	c.278C>A	c.(277-279)TCT>TAT	p.S93Y		NM_178428	NP_848515	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	93	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
ADAM15	8751	broad.mit.edu	37	1	155026661	155026661	+	Silent	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155026661T>C	uc001fgr.1	+	5	479	c.378T>C	c.(376-378)TAT>TAC	p.Y126Y	ADAM15_uc001fgq.1_5'UTR|ADAM15_uc009wpc.1_RNA|ADAM15_uc010pet.1_Silent_p.Y110Y|ADAM15_uc010peu.1_Silent_p.Y143Y|ADAM15_uc001fgt.1_Silent_p.Y126Y|ADAM15_uc010pev.1_Silent_p.Y136Y|ADAM15_uc001fgs.1_Silent_p.Y126Y|ADAM15_uc001fgu.1_Silent_p.Y126Y|ADAM15_uc001fgw.1_Silent_p.Y126Y|ADAM15_uc001fgv.1_Silent_p.Y126Y|ADAM15_uc001fgx.1_Silent_p.Y126Y|ADAM15_uc001fgz.1_RNA|ADAM15_uc001fgy.1_RNA|ADAM15_uc001fha.1_RNA	NM_207197	NP_997080	Q13444	ADA15_HUMAN	a disintegrin and metalloproteinase domain 15	126					angiogenesis|cell-matrix adhesion|collagen catabolic process|proteolysis	acrosomal vesicle|adherens junction|endomembrane system|flagellum|integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			central_nervous_system(3)|skin(2)|ovary(1)	6	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)															---	---	---	---
ARHGAP30	257106	broad.mit.edu	37	1	161018090	161018090	+	Missense_Mutation	SNP	G	T	T	rs137873621		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161018090G>T	uc001fxl.2	-	12	3067	c.2721C>A	c.(2719-2721)GAC>GAA	p.D907E	USF1_uc001fxi.2_5'Flank|USF1_uc001fxj.2_5'Flank|ARHGAP30_uc001fxk.2_Missense_Mutation_p.D696E|ARHGAP30_uc001fxm.2_Missense_Mutation_p.D753E|ARHGAP30_uc009wtx.2_Missense_Mutation_p.D580E	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	907					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
C1orf49	84066	broad.mit.edu	37	1	178489948	178489948	+	Missense_Mutation	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178489948T>G	uc001glt.1	+	7	594	c.482T>G	c.(481-483)ATG>AGG	p.M161R	C1orf49_uc001glu.1_Missense_Mutation_p.M161R|C1orf49_uc001glv.1_RNA|C1orf49_uc001glw.1_Missense_Mutation_p.M169R	NM_032126	NP_115502	Q5T0J7	CA049_HUMAN	hypothetical protein LOC84066	161						microtubule cytoskeleton					0																		---	---	---	---
LAMC2	3918	broad.mit.edu	37	1	183208626	183208626	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183208626C>T	uc001gqa.2	+	20	3311	c.2997C>T	c.(2995-2997)AGC>AGT	p.S999S	LAMC2_uc001gpz.3_Silent_p.S999S|LAMC2_uc010poa.1_Silent_p.S699S	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	999	Potential.|Domain II and I.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3																		---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196249978	196249978	+	Intron	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196249978T>G	uc001gtd.1	-						KCNT2_uc009wyt.1_Intron|KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Nonstop_Mutation_p.*950Y|KCNT2_uc001gth.1_Intron	NM_198503	NP_940905			potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216262463	216262463	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216262463T>C	uc001hku.1	-	23	5164	c.4777A>G	c.(4777-4779)ACT>GCT	p.T1593A		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1593	Laminin G-like 1.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
ZP4	57829	broad.mit.edu	37	1	238053244	238053244	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238053244C>A	uc001hym.2	-	3	323	c.323G>T	c.(322-324)GGA>GTA	p.G108V	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	108	Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)															---	---	---	---
C2orf78	388960	broad.mit.edu	37	2	74042660	74042660	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74042660C>T	uc002sjr.1	+	3	1431	c.1310C>T	c.(1309-1311)TCT>TTT	p.S437F		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	437										ovary(2)	2																		---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168100923	168100923	+	Missense_Mutation	SNP	A	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168100923A>C	uc002udx.2	+	8	3039	c.3021A>C	c.(3019-3021)GAA>GAC	p.E1007D	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E832D|XIRP2_uc010fpq.2_Missense_Mutation_p.E785D|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	832					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170042284	170042284	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170042284G>A	uc002ues.2	-	50	9787	c.9574C>T	c.(9574-9576)CGG>TGG	p.R3192W		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3192	EGF-like 12; calcium-binding (Potential).|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
TTLL4	9654	broad.mit.edu	37	2	219610881	219610881	+	Missense_Mutation	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219610881A>G	uc002viy.2	+	8	2271	c.1901A>G	c.(1900-1902)AAC>AGC	p.N634S	TTLL4_uc010zkl.1_Missense_Mutation_p.N469S|TTLL4_uc010fvx.2_Missense_Mutation_p.N634S|TTLL4_uc010zkm.1_5'UTR	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	634	TTL.				protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)														---	---	---	---
LHFPL4	375323	broad.mit.edu	37	3	9547696	9547696	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9547696G>A	uc003bry.2	-	3	884	c.598C>T	c.(598-600)CGG>TGG	p.R200W		NM_198560	NP_940962	Q7Z7J7	LHPL4_HUMAN	lipoma HMGIC fusion partner-like 4	200						integral to membrane				ovary(2)|skin(1)	3	Medulloblastoma(99;0.227)																	---	---	---	---
CCR1	1230	broad.mit.edu	37	3	46245463	46245463	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46245463G>T	uc003cph.1	-	2	413	c.342C>A	c.(340-342)TAC>TAA	p.Y114*	CCR3_uc003cpg.1_Intron	NM_001295	NP_001286	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	114	Helical; Name=3; (Potential).				cell adhesion|cell-cell signaling|cytokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	integral to plasma membrane	C-C chemokine receptor activity			skin(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)														---	---	---	---
GXYLT2	727936	broad.mit.edu	37	3	72957515	72957515	+	Intron	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72957515T>G	uc003dpg.2	+							NM_001080393	NP_001073862			glycosyltransferase 8 domain containing 4						O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0																		---	---	---	---
GPR128	84873	broad.mit.edu	37	3	100356135	100356135	+	Intron	SNP	C	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100356135C>G	uc003duc.2	+						GPR128_uc011bhc.1_Intron	NM_032787	NP_116176			G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4																		---	---	---	---
COL6A6	131873	broad.mit.edu	37	3	130282057	130282057	+	Missense_Mutation	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130282057G>T	uc010htl.2	+	2	241	c.210G>T	c.(208-210)CAG>CAT	p.Q70H		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	70	Nonhelical region.|VWFA 1.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8																		---	---	---	---
MED12L	116931	broad.mit.edu	37	3	150877763	150877763	+	Missense_Mutation	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150877763A>T	uc003eyp.2	+	7	1020	c.982A>T	c.(982-984)AGT>TGT	p.S328C	MED12L_uc011bnz.1_Intron|MED12L_uc003eyn.2_Missense_Mutation_p.S328C|MED12L_uc003eyo.2_Missense_Mutation_p.S328C	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	328					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
PTPN13	5783	broad.mit.edu	37	4	87610306	87610306	+	Missense_Mutation	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87610306A>G	uc003hpz.2	+	5	989	c.509A>G	c.(508-510)AAA>AGA	p.K170R	PTPN13_uc003hpy.2_Missense_Mutation_p.K170R|PTPN13_uc003hqa.2_Missense_Mutation_p.K170R|PTPN13_uc003hqb.2_Missense_Mutation_p.K170R	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	170	KIND.					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)														---	---	---	---
PPA2	27068	broad.mit.edu	37	4	106394798	106394798	+	Intron	SNP	C	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106394798C>G	uc003hxl.2	-						PPA2_uc003hxm.2_Intron|PPA2_uc003hxn.2_Intron|PPA2_uc003hxo.2_Intron|PPA2_uc003hxp.2_Intron|PPA2_uc003hxq.2_Intron|PPA2_uc003hxr.2_Intron|PPA2_uc011cfa.1_Intron|PPA2_uc003hxs.2_RNA	NM_176869	NP_789845			inorganic pyrophosphatase 2 isoform 1 precursor						diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)														---	---	---	---
ZFP42	132625	broad.mit.edu	37	4	188923983	188923983	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188923983C>T	uc003izg.1	+	3	267	c.22C>T	c.(22-24)CGG>TGG	p.R8W	ZFP42_uc003izh.1_Missense_Mutation_p.R8W|ZFP42_uc003izi.1_Missense_Mutation_p.R8W	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	8					female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)														---	---	---	---
FAM81B	153643	broad.mit.edu	37	5	94749724	94749724	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94749724C>T	uc003kla.1	+	4	413	c.367C>T	c.(367-369)CGT>TGT	p.R123C	FAM81B_uc010jbe.1_5'UTR	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	123										ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)														---	---	---	---
TSLP	85480	broad.mit.edu	37	5	110407621	110407621	+	Silent	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110407621A>T	uc003kpb.2	+	1	232	c.33A>T	c.(31-33)TCA>TCT	p.S11S	TSLP_uc003kpa.2_Splice_Site|TSLP_uc010jbt.1_5'Flank	NM_033035	NP_149024	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin isoform 1	11				MFPFALLYVLS -> MKCLGQSKKEE (in Ref. 3; AAH40592).		extracellular space	cytokine activity				0		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
RNF145	153830	broad.mit.edu	37	5	158585955	158585955	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158585955G>A	uc003lxp.2	-	11	2028	c.1715C>T	c.(1714-1716)CCT>CTT	p.P572L	RNF145_uc011ddy.1_Missense_Mutation_p.P586L|RNF145_uc003lxo.1_Missense_Mutation_p.P600L|RNF145_uc011ddz.1_Missense_Mutation_p.P589L|RNF145_uc010jiq.1_Missense_Mutation_p.P602L	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145	572	RING-type; atypical.					integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
ZNF354C	30832	broad.mit.edu	37	5	178506747	178506747	+	Missense_Mutation	SNP	A	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178506747A>C	uc003mju.2	+	5	1429	c.1314A>C	c.(1312-1314)AAA>AAC	p.K438N		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	438					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)														---	---	---	---
HIST1H2AG	8969	broad.mit.edu	37	6	27101031	27101031	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27101031G>A	uc003niw.2	+	1	215	c.181G>A	c.(181-183)GCC>ACC	p.A61T	HIST1H2BJ_uc003niu.1_5'Flank|HIST1H2BJ_uc003niv.2_5'Flank	NM_021064	NP_066408	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	61					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding				0																		---	---	---	---
HIST1H3H	8357	broad.mit.edu	37	6	27776190	27776190	+	5'Flank	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27776190G>A	uc003njm.2	+						HIST1H2BL_uc003njl.2_5'Flank	NM_003536	NP_003527			histone cluster 1, H3h						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1																		---	---	---	---
TNF	7124	broad.mit.edu	37	6	31545010	31545010	+	Missense_Mutation	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31545010T>G	uc003nui.2	+	4	567	c.398T>G	c.(397-399)CTC>CGC	p.L133R	TNF_uc003nuj.2_5'UTR	NM_000594	NP_000585	P01375	TNFA_HUMAN	tumor necrosis factor alpha	133	Extracellular (Potential).				activation of caspase activity|activation of MAPK activity|activation of MAPKKK activity|anti-apoptosis|cellular response to nicotine|chronic inflammatory response to antigenic stimulus|embryonic digestive tract development|induction of apoptosis via death domain receptors|induction of necroptosis by extracellular signals|leukocyte tethering or rolling|necrotic cell death|negative regulation of branching involved in lung morphogenesis|negative regulation of cytokine secretion involved in immune response|negative regulation of fat cell differentiation|negative regulation of interleukin-6 production|negative regulation of lipid catabolic process|negative regulation of lipid storage|negative regulation of viral genome replication|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of chemokine biosynthetic process|positive regulation of chemokine production|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of fever generation|positive regulation of heterotypic cell-cell adhesion|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of membrane protein ectodomain proteolysis|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of NFAT protein import into nucleus|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of podosome assembly|positive regulation of protein complex disassembly|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|receptor biosynthetic process|regulation of insulin secretion|response to glucocorticoid stimulus|response to salt stress|response to virus|sequestering of triglyceride|transformed cell apoptosis|tumor necrosis factor-mediated signaling pathway	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane raft|phagocytic cup|recycling endosome	cytokine activity|identical protein binding|protease binding|transcription regulatory region DNA binding|tumor necrosis factor receptor binding			ovary(1)|pancreas(1)|skin(1)	3		Ovarian(999;0.00556)			Adalimumab(DB00051)|Adenosine(DB00640)|Amrinone(DB01427)|Atorvastatin(DB01076)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Etanercept(DB00005)|Glucosamine(DB01296)|Infliximab(DB00065)|Naltrexone(DB00704)|Pranlukast(DB01411)|Procaterol(DB01366)|Saquinavir(DB01232)|Simvastatin(DB00641)|Thalidomide(DB01041)									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				---	---	---	---
SLC26A8	116369	broad.mit.edu	37	6	35919039	35919039	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35919039G>A	uc003olm.2	-	19	2484	c.2373C>T	c.(2371-2373)GCC>GCT	p.A791A	SLC26A8_uc010jwa.2_RNA|SLC26A8_uc003olk.2_Silent_p.A373A|SLC26A8_uc003oln.2_Silent_p.A791A|SLC26A8_uc003oll.2_Silent_p.A686A	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	791	Interaction with RACGAP1.|STAS.|Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2																		---	---	---	---
SLC26A8	116369	broad.mit.edu	37	6	35987480	35987480	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35987480G>A	uc003olm.2	-	2	116	c.5C>T	c.(4-6)GCA>GTA	p.A2V	SLC26A8_uc003oln.2_Missense_Mutation_p.A2V|SLC26A8_uc003oll.2_Missense_Mutation_p.A2V	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	2	Cytoplasmic (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2																		---	---	---	---
DEFB112	245915	broad.mit.edu	37	6	50016324	50016324	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50016324T>C	uc011dws.1	-	1	41	c.41A>G	c.(40-42)AAA>AGA	p.K14R		NM_001037498	NP_001032587	Q30KQ8	DB112_HUMAN	beta-defensin 112 precursor	14					defense response to bacterium	extracellular region				central_nervous_system(1)	1	Lung NSC(77;0.042)																	---	---	---	---
USP45	85015	broad.mit.edu	37	6	99894207	99894207	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99894207G>A	uc003ppx.2	-	14	1974	c.1441C>T	c.(1441-1443)CGT>TGT	p.R481C	USP45_uc003ppv.2_Intron|USP45_uc003ppw.2_Missense_Mutation_p.R161C	NM_001080481	NP_001073950	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	481					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|breast(1)	2		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)														---	---	---	---
AIMP2	7965	broad.mit.edu	37	7	6063309	6063309	+	Missense_Mutation	SNP	A	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6063309A>C	uc003spo.2	+	4	1063	c.950A>C	c.(949-951)AAG>ACG	p.K317T	EIF2AK1_uc003spp.2_3'UTR|EIF2AK1_uc003spq.2_3'UTR|EIF2AK1_uc011jwm.1_3'UTR	NM_006303	NP_006294	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting	317	GST C-terminal.				apoptosis|cell differentiation|multicellular organismal development|tRNA aminoacylation for protein translation	cytosol|nucleus	protein binding			ovary(1)	1																		---	---	---	---
PTPN12	5782	broad.mit.edu	37	7	77256920	77256920	+	Missense_Mutation	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77256920A>G	uc003ugh.2	+	13	2015	c.1924A>G	c.(1924-1926)ACT>GCT	p.T642A	PTPN12_uc011kgp.1_Missense_Mutation_p.T523A|PTPN12_uc011kgq.1_Missense_Mutation_p.T512A|PTPN12_uc010lds.2_Missense_Mutation_p.T374A	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type	642						soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3																		---	---	---	---
RGS20	8601	broad.mit.edu	37	8	54791954	54791954	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54791954G>A	uc003xrp.2	+	2	394	c.302G>A	c.(301-303)CGC>CAC	p.R101H	RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron|RGS20_uc003xrr.2_5'Flank|RGS20_uc003xrs.2_5'Flank|RGS20_uc003xrt.2_5'Flank	NM_170587	NP_733466	O76081	RGS20_HUMAN	regulator of G-protein signaling 20 isoform a	101					negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)															---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56015093	56015093	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56015093C>T	uc003xsf.2	+	1	77	c.45C>T	c.(43-45)AGC>AGT	p.S15S		NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related	15						integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)															---	---	---	---
VCPIP1	80124	broad.mit.edu	37	8	67577533	67577533	+	Missense_Mutation	SNP	G	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67577533G>C	uc003xwn.2	-	1	1920	c.1661C>G	c.(1660-1662)TCT>TGT	p.S554C	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	554					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68950535	68950535	+	Intron	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68950535C>A	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
ERMP1	79956	broad.mit.edu	37	9	5805111	5805111	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5805111G>A	uc003zjm.1	-	10	1884	c.1830C>T	c.(1828-1830)CTC>CTT	p.L610L	ERMP1_uc011lme.1_RNA|ERMP1_uc010mhs.1_Silent_p.L224L	NM_024896	NP_079172	Q7Z2K6	ERMP1_HUMAN	aminopeptidase Fxna	610	Extracellular (Potential).				proteolysis	endoplasmic reticulum membrane|integral to membrane	metal ion binding|metallopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)														---	---	---	---
ROR2	4920	broad.mit.edu	37	9	94519612	94519612	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94519612G>A	uc004arj.1	-	3	604	c.405C>T	c.(403-405)TGC>TGT	p.C135C	ROR2_uc004ari.1_5'UTR|ROR2_uc004ark.2_Silent_p.C135C	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	135	Extracellular (Potential).|Ig-like C2-type.				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20																		---	---	---	---
OR1J2	26740	broad.mit.edu	37	9	125273389	125273389	+	Missense_Mutation	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125273389T>G	uc004bmj.1	+	4	1164	c.309T>G	c.(307-309)TTT>TTG	p.F103L	OR1J2_uc011lyv.1_Missense_Mutation_p.F103L	NM_054107	NP_473448	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|pancreas(1)|breast(1)	5																		---	---	---	---
GATA3	2625	broad.mit.edu	37	10	8100408	8100408	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8100408G>A	uc001ika.2	+	3	939	c.382G>A	c.(382-384)GGG>AGG	p.G128R	GATA3_uc001ijz.2_Missense_Mutation_p.G128R	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	128					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22								F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						---	---	---	---
GATA3	2625	broad.mit.edu	37	10	8100563	8100563	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8100563C>T	uc001ika.2	+	3	1094	c.537C>T	c.(535-537)GAC>GAT	p.D179D	GATA3_uc001ijz.2_Silent_p.D179D	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	179					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22								F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16982025	16982025	+	Intron	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16982025A>T	uc001ioo.2	-							NM_001081	NP_001072			cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
NEBL	10529	broad.mit.edu	37	10	21101831	21101831	+	Missense_Mutation	SNP	T	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21101831T>A	uc001iqi.2	-	24	2782	c.2385A>T	c.(2383-2385)AGA>AGT	p.R795S	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Missense_Mutation_p.R132S	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	795	Nebulin 23.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2																		---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55569247	55569247	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55569247T>C	uc010qhu.1	-	36	5008	c.4613A>G	c.(4612-4614)AAG>AGG	p.K1538R	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Silent_p.E1526E|PCDH15_uc010qht.1_Silent_p.E1519E	NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor	Error:Variant_position_missing_in_Q96QU1_after_alignment					equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
ADAMTS14	140766	broad.mit.edu	37	10	72500888	72500888	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72500888C>A	uc001jrh.2	+	12	1894	c.1894C>A	c.(1894-1896)CAC>AAC	p.H632N	ADAMTS14_uc001jrg.2_Missense_Mutation_p.H635N|ADAMTS14_uc001jri.1_Missense_Mutation_p.H155N	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	632	Cys-rich.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---
SEC24C	9632	broad.mit.edu	37	10	75526139	75526139	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75526139G>A	uc001juw.2	+	13	1818	c.1639G>A	c.(1639-1641)GTT>ATT	p.V547I	SEC24C_uc010qkn.1_RNA|SEC24C_uc009xrj.1_Missense_Mutation_p.V405I|SEC24C_uc001jux.2_Missense_Mutation_p.V547I|SEC24C_uc010qko.1_Missense_Mutation_p.V428I|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron	NM_004922	NP_004913	P53992	SC24C_HUMAN	SEC24-related protein C	547					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding			skin(2)|central_nervous_system(1)	3	Prostate(51;0.0112)																	---	---	---	---
ZNF518A	9849	broad.mit.edu	37	10	97918089	97918089	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97918089C>A	uc001klp.2	+	6	2867	c.2010C>A	c.(2008-2010)AGC>AGA	p.S670R	ZNF518A_uc001klo.1_Missense_Mutation_p.S140R|ZNF518A_uc001klq.2_Missense_Mutation_p.S670R|ZNF518A_uc001klr.2_Missense_Mutation_p.S670R	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	670					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)														---	---	---	---
TM9SF3	56889	broad.mit.edu	37	10	98319502	98319502	+	Intron	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98319502A>T	uc001kmm.3	-						TM9SF3_uc010qot.1_Intron	NM_020123	NP_064508			transmembrane 9 superfamily member 3 precursor							integral to membrane	binding				0		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)														---	---	---	---
SPON1	10418	broad.mit.edu	37	11	14264896	14264896	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14264896G>A	uc001mle.2	+	8	1382	c.844G>A	c.(844-846)GTC>ATC	p.V282I		NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein	282	Spondin.				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---
MRGPRX4	117196	broad.mit.edu	37	11	18194989	18194989	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18194989C>T	uc001mnv.1	+	1	606	c.186C>T	c.(184-186)TCC>TCT	p.S62S		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	62	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1																		---	---	---	---
TSG101	7251	broad.mit.edu	37	11	18505470	18505470	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18505470T>C	uc001mor.2	-	8	916	c.790A>G	c.(790-792)AAA>GAA	p.K264E		NM_006292	NP_006283	Q99816	TS101_HUMAN	tumor susceptibility gene 101	264	Potential.				cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0																		---	---	---	---
OR5AP2	338675	broad.mit.edu	37	11	56409733	56409733	+	Silent	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56409733G>T	uc001njb.1	-	1	183	c.183C>A	c.(181-183)CTC>CTA	p.L61L		NM_001002925	NP_001002925	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP,	61	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
KLC2	64837	broad.mit.edu	37	11	66026277	66026277	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66026277G>A	uc010rov.1	+	2	455	c.212G>A	c.(211-213)GGG>GAG	p.G71E	KLC2_uc010row.1_Missense_Mutation_p.G71E|KLC2_uc009yra.2_Missense_Mutation_p.G71E|KLC2_uc001ohb.2_Missense_Mutation_p.G71E|KLC2_uc010rox.1_Missense_Mutation_p.G71E|KLC2_uc001ohc.2_Missense_Mutation_p.G71E|KLC2_uc001ohd.2_Missense_Mutation_p.G71E|KLC2_uc001ohe.1_5'Flank	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	71					blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0																OREG0021097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TAF1D	79101	broad.mit.edu	37	11	93469428	93469428	+	Missense_Mutation	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93469428T>C	uc001ped.2	-	6	938	c.736A>G	c.(736-738)AGT>GGT	p.S246G	SNORA8_uc001pec.2_5'Flank|TAF1D_uc001pdz.2_RNA|TAF1D_uc001pea.1_Intron|SNORD5_uc009ywf.1_5'Flank|SNORA18_uc009ywg.1_5'Flank|MIR1304_hsa-mir-1304|MI0006371_5'Flank|SNORA40_uc009ywh.2_5'Flank	NM_024116	NP_077021	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated	246					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding				0																		---	---	---	---
FAM55D	54827	broad.mit.edu	37	11	114441717	114441717	+	Missense_Mutation	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114441717G>T	uc001ppc.2	-	6	1759	c.1578C>A	c.(1576-1578)CAC>CAA	p.H526Q	FAM55D_uc001ppd.2_Missense_Mutation_p.H242Q	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	526						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)														---	---	---	---
KCNJ5	3762	broad.mit.edu	37	11	128786552	128786552	+	Missense_Mutation	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128786552G>T	uc001qet.2	+	3	1500	c.1186G>T	c.(1186-1188)GCA>TCA	p.A396S	KCNJ5_uc009zck.2_Missense_Mutation_p.A396S|KCNJ5_uc001qew.2_Missense_Mutation_p.A396S	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5	396	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)													---	---	---	---
GPRC5A	9052	broad.mit.edu	37	12	13061792	13061792	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13061792C>T	uc001rba.2	+	2	1259	c.609C>T	c.(607-609)TTC>TTT	p.F203F	GPRC5A_uc001raz.2_Silent_p.F203F	NM_003979	NP_003970	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, family C, group 5,	203	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)													---	---	---	---
PLCZ1	89869	broad.mit.edu	37	12	18848016	18848016	+	Intron	SNP	G	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18848016G>C	uc010sid.1	-						PLCZ1_uc001rdv.3_Intron|PLCZ1_uc001rdw.3_Intron|PLCZ1_uc001rdu.1_Intron|PLCZ1_uc009zil.1_Intron	NM_033123	NP_149114			phospholipase C, zeta 1						intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)																	---	---	---	---
ABCC9	10060	broad.mit.edu	37	12	22012551	22012551	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22012551G>A	uc001rfi.1	-	20	2494	c.2474C>T	c.(2473-2475)GCG>GTG	p.A825V	ABCC9_uc001rfh.2_Missense_Mutation_p.A825V|ABCC9_uc001rfj.1_Missense_Mutation_p.A789V	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	825	Cytoplasmic (Potential).|ABC transporter 1.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity	p.A825A(1)		ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
PTPRB	5787	broad.mit.edu	37	12	70956771	70956771	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70956771C>T	uc001swb.3	-	14	3397	c.3367G>A	c.(3367-3369)GAT>AAT	p.D1123N	PTPRB_uc010sto.1_Missense_Mutation_p.D1033N|PTPRB_uc010stp.1_Missense_Mutation_p.D1033N|PTPRB_uc001swc.3_Missense_Mutation_p.D1341N|PTPRB_uc001swa.3_Missense_Mutation_p.D1253N|PTPRB_uc001swd.3_Missense_Mutation_p.D1340N|PTPRB_uc009zrr.1_Missense_Mutation_p.D1220N	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1123	Fibronectin type-III 13.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---
PTPRR	5801	broad.mit.edu	37	12	71054759	71054759	+	Missense_Mutation	SNP	A	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71054759A>C	uc001swi.1	-	12	2143	c.1727T>G	c.(1726-1728)CTT>CGT	p.L576R	PTPRR_uc001swf.1_RNA|PTPRR_uc001swg.1_RNA|PTPRR_uc001swh.1_Missense_Mutation_p.L331R|PTPRR_uc009zrs.2_Missense_Mutation_p.L425R|PTPRR_uc010stq.1_Missense_Mutation_p.L464R|PTPRR_uc010str.1_3'UTR	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	576	Tyrosine-protein phosphatase.|Cytoplasmic (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)														---	---	---	---
HIP1R	9026	broad.mit.edu	37	12	123342783	123342783	+	Silent	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123342783T>C	uc001udj.1	+	19	2009	c.1950T>C	c.(1948-1950)TGT>TGC	p.C650C	HIP1R_uc001udk.1_5'UTR	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	650					receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)														---	---	---	---
PAN3	255967	broad.mit.edu	37	13	28830630	28830630	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28830630C>T	uc001urz.2	+	6	772	c.764C>T	c.(763-765)ACG>ATG	p.T255M	PAN3_uc010tdo.1_Missense_Mutation_p.T401M|PAN3_uc001ury.2_Missense_Mutation_p.T89M|PAN3_uc001urx.2_Missense_Mutation_p.T201M	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	401	Interaction with polyadenylate-binding protein.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)														---	---	---	---
LIG4	3981	broad.mit.edu	37	13	108861879	108861879	+	Missense_Mutation	SNP	G	C	C	rs104894418		TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861879G>C	uc001vqn.2	-	2	2011	c.1738C>G	c.(1738-1740)CGA>GGA	p.R580G	LIG4_uc001vqo.2_Missense_Mutation_p.R580G|LIG4_uc010agg.1_Missense_Mutation_p.R513G|LIG4_uc010agf.2_Missense_Mutation_p.R580G|LIG4_uc001vqp.2_Missense_Mutation_p.R580G	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	580					cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)												NHEJ					---	---	---	---
Unknown	0	broad.mit.edu	37	14	22409601	22409601	+	Intron	SNP	A	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22409601A>T	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010ajb.1_RNA|uc001wck.2_Missense_Mutation_p.T31S					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
ADCY4	196883	broad.mit.edu	37	14	24798345	24798345	+	Silent	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24798345C>A	uc001wov.2	-	10	1452	c.1446G>T	c.(1444-1446)CTG>CTT	p.L482L	ADCY4_uc001wow.2_Silent_p.L482L|ADCY4_uc010toh.1_Silent_p.L168L|ADCY4_uc001wox.2_Silent_p.L482L|ADCY4_uc001woy.2_Silent_p.L482L	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	482	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)														---	---	---	---
LGMN	5641	broad.mit.edu	37	14	93178266	93178266	+	Silent	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93178266C>A	uc001yav.2	-	10	971	c.645G>T	c.(643-645)TCG>TCT	p.S215S	LGMN_uc001yat.2_Silent_p.S215S|LGMN_uc001yau.2_Silent_p.S215S|LGMN_uc001yaw.2_Silent_p.S215S|LGMN_uc010aul.2_Silent_p.S96S|LGMN_uc001yax.2_Silent_p.S215S|LGMN_uc001yay.2_Silent_p.S215S	NM_001008530	NP_001008530	Q99538	LGMN_HUMAN	legumain preproprotein	215					hormone biosynthetic process|negative regulation of neuron apoptosis|vitamin D metabolic process	lysosome	cysteine-type endopeptidase activity|protein serine/threonine kinase activity			skin(1)	1		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
ITPK1	3705	broad.mit.edu	37	14	93483134	93483134	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93483134G>A	uc001ybg.2	-	4	422	c.133C>T	c.(133-135)CGG>TGG	p.R45W	ITPK1_uc001ybe.2_Missense_Mutation_p.R45W|ITPK1_uc001ybf.2_5'UTR|ITPK1_uc001ybh.2_Missense_Mutation_p.R45W	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform	45					blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)														---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106110904	106110904	+	RNA	SNP	T	C	C	rs142679899	by1000genomes	TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106110904T>C	uc010tyt.1	-	3640		c.60857A>G			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_RNA					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
IL16	3603	broad.mit.edu	37	15	81565490	81565490	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81565490C>T	uc002bgh.3	+	6	1111	c.735C>T	c.(733-735)TAC>TAT	p.Y245Y	IL16_uc002bgc.2_RNA|IL16_uc010blq.1_Silent_p.Y245Y|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Silent_p.Y287Y|IL16_uc002bgg.2_Silent_p.Y245Y	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	245	Interaction with GRIN2A.|PDZ 1.				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	9857896	9857896	+	Silent	SNP	G	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9857896G>T	uc002czo.3	-	13	4053	c.3505C>A	c.(3505-3507)CGG>AGG	p.R1169R	GRIN2A_uc010uym.1_Silent_p.R1169R|GRIN2A_uc010uyn.1_Silent_p.R1012R|GRIN2A_uc002czr.3_Silent_p.R1169R	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1169	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
SLC12A4	6560	broad.mit.edu	37	16	67984928	67984928	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67984928G>A	uc002euz.2	-	10	1474	c.1333C>T	c.(1333-1335)CGT>TGT	p.R445C	SLC12A4_uc010ceu.2_Missense_Mutation_p.R439C|SLC12A4_uc010vkh.1_Missense_Mutation_p.R414C|SLC12A4_uc010vki.1_Missense_Mutation_p.R445C|SLC12A4_uc010vkj.1_Missense_Mutation_p.R447C|SLC12A4_uc002eva.2_Missense_Mutation_p.R445C|SLC12A4_uc002evb.2_Intron	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a	445					cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)													---	---	---	---
ADAT1	23536	broad.mit.edu	37	16	75642762	75642762	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75642762G>A	uc002feo.1	-	8	1270	c.1168C>T	c.(1168-1170)CGA>TGA	p.R390*	ADAT1_uc002fep.1_Nonsense_Mutation_p.R241*	NM_012091	NP_036223	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	390	A to I editase.				tRNA processing		metal ion binding|RNA binding|tRNA-specific adenosine deaminase activity			ovary(1)|skin(1)	2																		---	---	---	---
SLC13A5	284111	broad.mit.edu	37	17	6589668	6589668	+	Intron	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6589668G>A	uc002gdj.2	-						SLC13A5_uc010vtf.1_Intron|SLC13A5_uc010clq.2_Intron|SLC13A5_uc002gdk.2_Intron	NM_177550	NP_808218			solute carrier family 13, member 5 isoform a							integral to membrane	citrate transmembrane transporter activity				0																		---	---	---	---
MYH3	4621	broad.mit.edu	37	17	10538727	10538727	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10538727C>T	uc002gmq.1	-	29	4206	c.4129G>A	c.(4129-4131)GAG>AAG	p.E1377K		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1377	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7																		---	---	---	---
KRT33A	3883	broad.mit.edu	37	17	39502500	39502500	+	Intron	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39502500A>G	uc002hwk.1	-							NM_004138	NP_004129			keratin 33A							intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)																---	---	---	---
ABCA9	10350	broad.mit.edu	37	17	67022510	67022510	+	Intron	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67022510G>A	uc002jhu.2	-						ABCA9_uc010dez.2_Intron	NM_080283	NP_525022			ATP-binding cassette, sub-family A, member 9						transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)																	---	---	---	---
C17orf70	80233	broad.mit.edu	37	17	79517825	79517825	+	Missense_Mutation	SNP	T	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79517825T>G	uc002kaq.2	-	3	750	c.695A>C	c.(694-696)GAT>GCT	p.D232A	C17orf70_uc002kao.1_5'Flank|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Missense_Mutation_p.D81A	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit	232					DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)															---	---	---	---
CETN1	1068	broad.mit.edu	37	18	580882	580882	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:580882C>T	uc002kko.1	+	1	516	c.474C>T	c.(472-474)AAC>AAT	p.N158N		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	158	2 (Probable).|EF-hand 4.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
DCC	1630	broad.mit.edu	37	18	50589747	50589747	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50589747C>A	uc002lfe.1	+	6	1645	c.1058C>A	c.(1057-1059)ACA>AAA	p.T353K	DCC_uc010xdr.1_Missense_Mutation_p.T201K|DCC_uc010dpf.1_Missense_Mutation_p.T8K	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	353	Extracellular (Potential).|Ig-like C2-type 4.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
DCC	1630	broad.mit.edu	37	18	50734199	50734199	+	Intron	SNP	A	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50734199A>G	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
C3	718	broad.mit.edu	37	19	6707247	6707247	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6707247C>A	uc002mfm.2	-	17	2147	c.2085G>T	c.(2083-2085)GAG>GAT	p.E695D		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	695	Anaphylatoxin-like.				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
ICAM4	3386	broad.mit.edu	37	19	10398284	10398284	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10398284C>T	uc002mns.1	+	2	506	c.467C>T	c.(466-468)ACG>ATG	p.T156M	ICAM4_uc002mnr.1_Intron|ICAM4_uc002mnt.1_Missense_Mutation_p.T156M|ICAM5_uc002mnu.3_5'Flank	NM_001544	NP_001535	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 isoform 1	156	Ig-like C2-type 2.|Extracellular (Potential).				cell-cell adhesion|regulation of immune response	extracellular region|integral to membrane|plasma membrane	integrin binding			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)															---	---	---	---
ZNF676	163223	broad.mit.edu	37	19	22364289	22364289	+	Missense_Mutation	SNP	T	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22364289T>A	uc002nqs.1	-	3	548	c.230A>T	c.(229-231)GAG>GTG	p.E77V		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	77					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)																---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42168807	42168807	+	Silent	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42168807C>T	uc010zwh.1	+	20	2170	c.2124C>T	c.(2122-2124)GTC>GTT	p.V708V	L3MBTL_uc002xkl.2_Silent_p.V640V|L3MBTL_uc002xkm.2_Silent_p.V640V|L3MBTL_uc010ggl.2_Silent_p.V645V|L3MBTL_uc002xkn.1_Silent_p.V399V|L3MBTL_uc002xko.2_Silent_p.V292V|L3MBTL_uc002xkp.2_Silent_p.V28V|SGK2_uc002xkq.1_5'UTR	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	640					chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51871800	51871800	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51871800G>A	uc002xwo.2	+	2	2759	c.1803G>A	c.(1801-1803)AAG>AAA	p.K601K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	601					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51871810	51871810	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51871810G>A	uc002xwo.2	+	2	2769	c.1813G>A	c.(1813-1815)GAA>AAA	p.E605K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	605					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51871813	51871813	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51871813G>A	uc002xwo.2	+	2	2772	c.1816G>A	c.(1816-1818)GAC>AAC	p.D606N		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	606					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51871968	51871968	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51871968G>A	uc002xwo.2	+	2	2927	c.1971G>A	c.(1969-1971)CTG>CTA	p.L657L		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	657					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872223	51872223	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872223G>A	uc002xwo.2	+	2	3182	c.2226G>A	c.(2224-2226)TTG>TTA	p.L742L		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	742					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872482	51872482	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872482G>A	uc002xwo.2	+	2	3441	c.2485G>A	c.(2485-2487)GAG>AAG	p.E829K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	829					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872676	51872676	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872676G>A	uc002xwo.2	+	2	3635	c.2679G>A	c.(2677-2679)ATG>ATA	p.M893I		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	893	Homeobox; atypical.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872755	51872755	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872755G>A	uc002xwo.2	+	2	3714	c.2758G>A	c.(2758-2760)GAC>AAC	p.D920N		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	920					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872804	51872804	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872804G>A	uc002xwo.2	+	2	3763	c.2807G>A	c.(2806-2808)AGA>AAA	p.R936K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	936	C2H2-type 4.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872833	51872833	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872833G>A	uc002xwo.2	+	2	3792	c.2836G>A	c.(2836-2838)GAA>AAA	p.E946K		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	946	C2H2-type 4.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872931	51872931	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872931G>A	uc002xwo.2	+	2	3890	c.2934G>A	c.(2932-2934)CAG>CAA	p.Q978Q		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	978					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51872968	51872968	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51872968G>A	uc002xwo.2	+	2	3927	c.2971G>A	c.(2971-2973)GAC>AAC	p.D991N		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	991					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
PHKA2	5256	broad.mit.edu	37	X	18912313	18912313	+	Intron	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18912313C>A	uc004cyv.3	-						uc004cyt.2_RNA|PHKA2_uc004cyu.3_Intron	NM_000292	NP_000283			phosphorylase kinase, alpha 2 (liver)						glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)																	---	---	---	---
MAP7D2	256714	broad.mit.edu	37	X	20081624	20081624	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20081624G>A	uc004czr.1	-	3	299	c.280C>T	c.(280-282)CGA>TGA	p.R94*	MAP7D2_uc011mji.1_Nonsense_Mutation_p.R50*|MAP7D2_uc010nfo.1_Nonsense_Mutation_p.R94*|MAP7D2_uc011mjj.1_Nonsense_Mutation_p.R94*|MAP7D2_uc004czs.1_Nonsense_Mutation_p.R50*	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	94	Potential.									ovary(2)|breast(1)	3																		---	---	---	---
CHST7	56548	broad.mit.edu	37	X	46433894	46433894	+	Missense_Mutation	SNP	C	G	G			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46433894C>G	uc004dgt.2	+	1	703	c.528C>G	c.(526-528)GAC>GAG	p.D176E		NM_019886	NP_063939	Q9NS84	CHST7_HUMAN	chondroitin 6-sulfotransferase 7	176	Lumenal (Potential).				chondroitin sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity|N-acetylglucosamine 6-O-sulfotransferase activity			breast(3)	3																		---	---	---	---
ZC4H2	55906	broad.mit.edu	37	X	64137662	64137662	+	3'UTR	SNP	T	C	C			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64137662T>C	uc004dvu.2	-	5					ZC4H2_uc004dvv.2_3'UTR|ZC4H2_uc011mov.1_3'UTR|ZC4H2_uc011mow.1_Silent_p.K171K|ZC4H2_uc004dvw.1_3'UTR	NM_018684	NP_061154			zinc finger, C4H2 domain containing								metal ion binding|protein binding			ovary(1)	1																		---	---	---	---
TEX11	56159	broad.mit.edu	37	X	69772062	69772062	+	Missense_Mutation	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69772062G>A	uc004dyl.2	-	29	2641	c.2479C>T	c.(2479-2481)CCA>TCA	p.P827S	TEX11_uc004dyk.2_Missense_Mutation_p.P502S|TEX11_uc004dym.2_Missense_Mutation_p.P812S	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	827							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)																	---	---	---	---
HNRNPH2	3188	broad.mit.edu	37	X	100667850	100667850	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100667850C>A	uc004ehm.2	+	2	1044	c.874C>A	c.(874-876)CAC>AAC	p.H292N	HNRNPH2_uc004ehn.2_Missense_Mutation_p.H292N	NM_019597	NP_062543	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2	292	RRM 3.|2 X 16 AA Gly-rich approximate repeats.				nuclear mRNA splicing, via spliceosome	actin cytoskeleton|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
IL13RA2	3598	broad.mit.edu	37	X	114239785	114239785	+	Missense_Mutation	SNP	C	T	T			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114239785C>T	uc004epx.2	-	9	1216	c.1091G>A	c.(1090-1092)CGT>CAT	p.R364H	IL13RA2_uc010nqd.1_Missense_Mutation_p.R364H	NM_000640	NP_000631	Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2 precursor	364	Cytoplasmic (Potential).					extracellular space|integral to membrane|soluble fraction	cytokine receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3																		---	---	---	---
DCAF12L1	139170	broad.mit.edu	37	X	125685810	125685810	+	Missense_Mutation	SNP	C	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125685810C>A	uc004eul.2	-	1	1033	c.782G>T	c.(781-783)AGT>ATT	p.S261I		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	261	WD 3.									skin(3)|ovary(1)	4																		---	---	---	---
CD40LG	959	broad.mit.edu	37	X	135736558	135736558	+	Silent	SNP	G	A	A			TCGA-EQ-5647-01	TCGA-EQ-5647-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135736558G>A	uc004faa.2	+	3	387	c.315G>A	c.(313-315)ACG>ACA	p.T105T	CD40LG_uc010nsd.2_Silent_p.T105T|CD40LG_uc010nse.1_Intron	NM_000074	NP_000065	P29965	CD40L_HUMAN	CD40 ligand	105	Extracellular (Potential).				anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)									Immune_Deficiency_with_Hyper-IgM				---	---	---	---
