Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NECAP2	55707	broad.mit.edu	37	1	16778446	16778446	+	Silent	SNP	T	C	C			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16778446T>C	uc001ayo.2	+	6	693	c.603T>C	c.(601-603)CCT>CCC	p.P201P	NECAP2_uc001ayp.3_RNA|NECAP2_uc010ocd.1_Silent_p.P175P|NECAP2_uc001ayq.2_Silent_p.P201P	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1	201					endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTGATCCCTCCCCCTGGGG	0.647													3	83	---	---	---	---	PASS
APOA1BP	128240	broad.mit.edu	37	1	156562120	156562120	+	Intron	SNP	T	C	C			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156562120T>C	uc001fph.2	+						APOA1BP_uc001fpg.2_Intron|APOA1BP_uc001fpi.2_Intron|APOA1BP_uc001fpj.2_Intron|APOA1BP_uc001fpk.2_5'UTR|APOA1BP_uc010php.1_5'UTR	NM_144772	NP_658985	Q8NCW5	AIBP_HUMAN	apolipoprotein A-I binding protein precursor							extracellular region	protein binding			central_nervous_system(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TATTACCGCCTGAAACCCCGC	0.627													3	41	---	---	---	---	PASS
FIGLA	344018	broad.mit.edu	37	2	71004492	71004492	+	3'UTR	SNP	T	C	C	rs56316086	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71004492T>C	uc002she.1	-	5						NM_001004311	NP_001004311	Q6QHK4	FIGLA_HUMAN	factor in the germline alpha						multicellular organismal development|oocyte development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcription factor complex	DNA binding|transcription factor binding				0						CTGGGCCTTTTCATTTTTCAT	0.174													4	5	---	---	---	---	PASS
FIGLA	344018	broad.mit.edu	37	2	71004494	71004494	+	3'UTR	SNP	A	T	T	rs56135050	byFrequency	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71004494A>T	uc002she.1	-	5						NM_001004311	NP_001004311	Q6QHK4	FIGLA_HUMAN	factor in the germline alpha						multicellular organismal development|oocyte development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcription factor complex	DNA binding|transcription factor binding				0						GGGCCTTTTCATTTTTCATAC	0.174													4	6	---	---	---	---	PASS
DDX11L2	84771	broad.mit.edu	37	2	114357543	114357543	+	3'UTR	SNP	T	A	A	rs114684815	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114357543T>A	uc010yxx.1	-	3										SubName: Full=DEAD/H box polypeptide 11 like 2;												0						CCTGTCAGGATGAGGCCTACT	0.572													3	17	---	---	---	---	PASS
DDX11L2	84771	broad.mit.edu	37	2	114357557	114357557	+	Nonstop_Mutation	SNP	A	G	G	rs115341812	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114357557A>G	uc010yxx.1	-	3	709	c.382T>C	c.(382-384)TAG>CAG	p.*128Q						SubName: Full=DEAD/H box polypeptide 11 like 2;												0						GCCTACTTCTAGTGAAACTGG	0.567													3	19	---	---	---	---	PASS
IL1RAP	3556	broad.mit.edu	37	3	190345113	190345113	+	Silent	SNP	A	G	G			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190345113A>G	uc003fsm.1	+	8	983	c.777A>G	c.(775-777)GGA>GGG	p.G259G	IL1RAP_uc003fsk.2_Silent_p.G259G|IL1RAP_uc003fsl.2_Silent_p.G259G|IL1RAP_uc010hzf.2_Silent_p.G118G|IL1RAP_uc010hzg.1_Silent_p.G259G|IL1RAP_uc003fsn.1_RNA|IL1RAP_uc003fso.1_Silent_p.G259G|IL1RAP_uc003fsp.1_RNA|IL1RAP_uc003fsq.2_Silent_p.G259G	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform	259	Extracellular (Potential).|Ig-like C2-type 3.				inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		tttttTCAGGAGAGGAGCTAC	0.274													3	44	---	---	---	---	PASS
HERC5	51191	broad.mit.edu	37	4	89415467	89415467	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89415467G>T	uc003hrt.2	+	18	2582	c.2429G>T	c.(2428-2430)AGT>ATT	p.S810I	HERC5_uc011cdm.1_Missense_Mutation_p.S448I	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5	810	HECT.				innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		AAAGAACTCAGTCCTGATTTG	0.383													3	60	---	---	---	---	PASS
FRG1	2483	broad.mit.edu	37	4	190883030	190883030	+	Missense_Mutation	SNP	G	T	T	rs112946446		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190883030G>T	uc003izs.2	+	8	874	c.683G>T	c.(682-684)AGT>ATT	p.S228I		NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	228					rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AAAGAAGACAGTAAAATTCTT	0.318													6	234	---	---	---	---	PASS
LECT2	3950	broad.mit.edu	37	5	135287029	135287029	+	Missense_Mutation	SNP	T	C	C	rs31517	byFrequency	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135287029T>C	uc003lbe.1	-	3	373	c.172A>G	c.(172-174)ATC>GTC	p.I58V	FBXL21_uc003lbc.2_RNA	NM_002302	NP_002293	O14960	LECT2_HUMAN	leukocyte cell-derived chemotaxin 2 precursor	58					chemotaxis|skeletal system development	cytoplasm|extracellular space				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAGCACAAGATGTCCACACCC	0.468													5	80	---	---	---	---	PASS
HOXA3	3200	broad.mit.edu	37	7	27147490	27147490	+	3'UTR	SNP	T	G	G			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27147490T>G	uc011jzl.1	-	3					HOXA3_uc011jzk.1_3'UTR|HOXA3_uc003syk.2_3'UTR	NM_030661	NP_109377	O43365	HXA3_HUMAN	homeobox A3 isoform a						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2						agaaaaaaGGTGGGTGGGGGG	0.493													9	56	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38393403	38393403	+	Intron	SNP	G	A	A	rs2017501	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38393403G>A	uc003tgp.1	+											Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		TTGTGCTTCCGTAAGTATCAT	0.483													4	35	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124387092	124387092	+	Silent	SNP	C	G	G	rs3735270	byFrequency	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124387092C>G	uc003vli.2	-	2	1980	c.1329G>C	c.(1327-1329)CTG>CTC	p.L443L		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	443	Extracellular (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						AATACCACCACAGTCTCGCAC	0.483													3	92	---	---	---	---	PASS
ABCB8	11194	broad.mit.edu	37	7	150738257	150738257	+	Silent	SNP	C	A	A			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150738257C>A	uc003wil.3	+	14	1699	c.1606C>A	c.(1606-1608)CGG>AGG	p.R536R	ABCB8_uc010lpw.1_Missense_Mutation_p.A411E|ABCB8_uc010lpx.2_Silent_p.R519R|ABCB8_uc011kvd.1_Silent_p.R431R|ABCB8_uc003wim.3_Silent_p.R314R|ABCB8_uc003wik.3_Silent_p.R519R	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8	536	ABC transporter.					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGGATGGGCGGGACCTGCG	0.677													3	91	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385852	33385852	+	Missense_Mutation	SNP	C	T	T	rs114393005	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385852C>T	uc003zst.2	-	7	710	c.538G>A	c.(538-540)GGG>AGG	p.G180R	SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Missense_Mutation_p.G123R|AQP7_uc010mjs.2_Missense_Mutation_p.G88R|AQP7_uc010mjt.2_Missense_Mutation_p.G88R|AQP7_uc011lnx.1_Missense_Mutation_p.G180R|AQP7_uc011lny.1_Missense_Mutation_p.G179R|AQP7_uc003zss.3_Missense_Mutation_p.G88R|AQP7_uc011lnz.1_Missense_Mutation_p.G88R|AQP7_uc011loa.1_Missense_Mutation_p.R48Q	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7	180	Helical; (Potential).				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TGGAGCATCCCGGTCAGCCAC	0.637													5	50	---	---	---	---	PASS
RABGAP1	23637	broad.mit.edu	37	9	125860018	125860018	+	Splice_Site	SNP	A	G	G			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125860018A>G	uc011lzh.1	+	22	2763	c.2629_splice	c.e22-2	p.A877_splice	RABGAP1_uc004bnl.3_Splice_Site|RABGAP1_uc011lzj.1_Splice_Site_p.A216_splice	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						TAAATGTTTCAGGCTGAGGAA	0.259													3	73	---	---	---	---	PASS
SLC2A6	11182	broad.mit.edu	37	9	136340607	136340607	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136340607G>T	uc004cee.2	-	5	784	c.689C>A	c.(688-690)GCC>GAC	p.A230D	SLC2A6_uc004cef.2_Missense_Mutation_p.A230D|SLC2A6_uc004ceg.2_Missense_Mutation_p.A207D|SLC2A6_uc011mdj.1_3'UTR	NM_017585	NP_060055	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose	230	Cytoplasmic (Potential).					integral to membrane|plasma membrane	D-glucose transmembrane transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CGCCCGCAGGGCCTCTTCGTC	0.667													5	27	---	---	---	---	PASS
RPL13AP6	644511	broad.mit.edu	37	10	112696573	112696573	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112696573T>C	uc010qrh.1	-	1	441	c.419A>G	c.(418-420)CAC>CGC	p.H140R	SHOC2_uc001kzl.3_Intron|SHOC2_uc009xxx.2_Intron|SHOC2_uc010qrg.1_Intron	NR_026715				SubName: Full=cDNA FLJ51256, highly similar to 60S ribosomal protein L13a;												0						GTGAGCCAGGTGCCCCAGATA	0.537													2	10	---	---	---	---	PASS
PRKAG1	5571	broad.mit.edu	37	12	49398646	49398646	+	Intron	SNP	C	G	G			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49398646C>G	uc001rsy.2	-						uc001rsw.2_Intron|PRKAG1_uc010smd.1_Intron|PRKAG1_uc001rsx.2_Intron|PRKAG1_uc001rsz.2_Intron|PRKAG1_uc009zlb.2_Intron|PRKAG1_uc010sme.1_3'UTR	NM_002733	NP_002724	P54619	AAKG1_HUMAN	AMP-activated protein kinase, noncatalytic						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|positive regulation of protein kinase activity|regulation of fatty acid oxidation|regulation of glycolysis|spermatogenesis	cytosol	cAMP-dependent protein kinase activity|cAMP-dependent protein kinase regulator activity|protein kinase binding			kidney(1)	1						gtgtgtgtgtCTTTTCTCTCT	0.244													6	34	---	---	---	---	PASS
OR10P1	121130	broad.mit.edu	37	12	56031094	56031094	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56031094G>A	uc010spq.1	+	1	419	c.419G>A	c.(418-420)CGG>CAG	p.R140Q		NM_206899	NP_996782	Q8NGE3	O10P1_HUMAN	olfactory receptor, family 10, subfamily P,	140	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2						TTGAGCCCACGGGCCTGCATG	0.617													7	69	---	---	---	---	PASS
GALNT4	8693	broad.mit.edu	37	12	89916811	89916811	+	Missense_Mutation	SNP	C	T	T	rs2230283	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89916811C>T	uc001tbd.2	-	1	1725	c.1516G>A	c.(1516-1518)GTA>ATA	p.V506I	POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Missense_Mutation_p.V503I|GALNT4_uc010suo.1_Missense_Mutation_p.V198I	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	506	Ricin B-type lectin.|Lumenal (Potential).				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0						TGCTCAGGTACCTCTGCACAT	0.363													3	31	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20066994	20066994	+	Missense_Mutation	SNP	T	C	C	rs78472618	byFrequency	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20066994T>C	uc001umd.2	-	4	326	c.115A>G	c.(115-117)AAA>GAA	p.K39E	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.K39E|TPTE2_uc001ume.2_Missense_Mutation_p.K39E|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	39						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ACTCACCTTTTACTGATAGGT	0.388													3	59	---	---	---	---	PASS
LACTB	114294	broad.mit.edu	37	15	63421818	63421818	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63421818G>A	uc002alw.2	+	5	1126	c.1087G>A	c.(1087-1089)GAA>AAA	p.E363K	LACTB_uc002alv.2_Missense_Mutation_p.E363K	NM_032857	NP_116246	P83111	LACTB_HUMAN	lactamase, beta isoform a	363						mitochondrion	hydrolase activity				0						TGTGCAGGAAGAAAACGAGCC	0.373													4	60	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102516373	102516373	+	Silent	SNP	C	T	T			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102516373C>T	uc002cdi.2	+	11	2119	c.699C>T	c.(697-699)CCC>CCT	p.P233P	WASH3P_uc002cdl.2_Silent_p.P233P|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Silent_p.P233P|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						GTGAGGGGCCCGGAGGAGCCT	0.662													3	9	---	---	---	---	PASS
AMAC1L3	643664	broad.mit.edu	37	17	7386272	7386272	+	Silent	SNP	C	T	T	rs138300600	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7386272C>T	uc010cmj.1	+	2	1084	c.969C>T	c.(967-969)ATC>ATT	p.I323I	ZBTB4_uc002ghd.3_Intron|POLR2A_uc002ghe.2_5'Flank|POLR2A_uc002ghf.3_5'Flank	NM_001102614	NP_001096084	P0C7Q6	AMCL3_HUMAN	acyl-malonyl condensing enzyme 1-like 3	323	DUF6 2.|Helical; (Potential).					integral to membrane					0		Prostate(122;0.173)				TTGCCATCATCACAGCCTGGA	0.557													6	86	---	---	---	---	PASS
KRTAP4-7	100132476	broad.mit.edu	37	17	39240794	39240794	+	Silent	SNP	C	A	A	rs9894106		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39240794C>A	uc010wfn.1	+	1	336	c.336C>A	c.(334-336)CCC>CCA	p.P112P		NM_033061	NP_149050			keratin associated protein 4-7												0						gctgccgccccagctgctgcc	0.234													3	9	---	---	---	---	PASS
KRTAP4-7	100132476	broad.mit.edu	37	17	39240795	39240795	+	Missense_Mutation	SNP	A	T	T	rs9894966	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39240795A>T	uc010wfn.1	+	1	337	c.337A>T	c.(337-339)AGC>TGC	p.S113C		NM_033061	NP_149050			keratin associated protein 4-7												0						ctgccgccccagctgctgccg	0.239													3	9	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22662940	22662940	+	Intron	SNP	T	C	C	rs11702949	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22662940T>C	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						CAGATGGTCTTTCTTGTTTTT	0.303													2	12	---	---	---	---	PASS
EIF3I	8668	broad.mit.edu	37	1	32691629	32691629	+	Intron	DEL	A	-	-	rs74686229		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32691629delA	uc001bur.3	+						EIF3I_uc009vuc.2_Intron|EIF3I_uc001bus.2_Intron	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				ctcaaaaaagaaaaaaaaaaa	0.174													6	3	---	---	---	---	
KIF2C	11004	broad.mit.edu	37	1	45219630	45219630	+	Intron	DEL	C	-	-	rs9326140		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45219630delC	uc001cmg.3	+						KIF2C_uc010olb.1_Intron|KIF2C_uc010olc.1_Intron|KIF2C_uc001cmh.3_Intron	NM_006845	NP_006836	Q99661	KIF2C_HUMAN	kinesin family member 2C						blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					GGCCCCAAttctttttttttt	0.254													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	82617156	82617163	+	IGR	DEL	AAGAAAGA	-	-	rs36191171	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82617156_82617163delAAGAAAGA								LPHN2 (159050 upstream) : None (None downstream)																							ggaaggaaggaagaaagaaagaaagaaa	0.000													4	3	---	---	---	---	
ABCA4	24	broad.mit.edu	37	1	94512658	94512658	+	Intron	DEL	A	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94512658delA	uc001dqh.2	-						ABCA4_uc010otn.1_Intron	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GTCTTGGAGGAAAAAAAATGA	0.498													139	7	---	---	---	---	
ITGA10	8515	broad.mit.edu	37	1	145535549	145535550	+	Intron	INS	-	A	A	rs111746738		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145535549_145535550insA	uc001eoa.2	+						NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Intron|ITGA10_uc009wiw.2_Intron|ITGA10_uc010oyw.1_Intron	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor						cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					aactccatctcaaaaaaaaaaa	0.193													8	4	---	---	---	---	
GGCX	2677	broad.mit.edu	37	2	85787730	85787730	+	Intron	DEL	A	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85787730delA	uc002sps.2	-						GGCX_uc010yss.1_5'Flank|GGCX_uc010yst.1_Intron	NM_000821	NP_000812	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase isoform 1						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification	endoplasmic reticulum membrane|integral to membrane|membrane fraction	gamma-glutamyl carboxylase activity			ovary(1)	1					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|L-Glutamic Acid(DB00142)|Menadione(DB00170)|Phytonadione(DB01022)	ccgtctaaggaaaaaaaaaaa	0.174													4	2	---	---	---	---	
RANBP2	5903	broad.mit.edu	37	2	109369249	109369249	+	Intron	DEL	A	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109369249delA	uc002tem.3	+							NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						actctgtctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
PLA2R1	22925	broad.mit.edu	37	2	160879052	160879052	+	Intron	DEL	C	-	-	rs137921233		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160879052delC	uc002ube.1	-						PLA2R1_uc010zcp.1_Intron|PLA2R1_uc002ubf.2_Intron	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor						endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						CATTTAGAAACTTTAAATATA	0.239													9	5	---	---	---	---	
PPP2R2C	5522	broad.mit.edu	37	4	6513547	6513567	+	Intron	DEL	TGGTGGTGGTGGTGGTGATGG	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6513547_6513567delTGGTGGTGGTGGTGGTGATGG	uc011bwd.1	-						PPP2R2C_uc011bwe.1_Intron	NM_181876	NP_870991	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						gtggtggtgatggtggtggtggtggtgatggtggtggtggt	0.000													7	5	---	---	---	---	
MTRR	4552	broad.mit.edu	37	5	7885675	7885676	+	Intron	INS	-	T	T			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7885675_7885676insT	uc003jed.2	+						MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ACAATTGTGTGTTTTTTTTTTT	0.252													4	6	---	---	---	---	
RNF145	153830	broad.mit.edu	37	5	158634513	158634513	+	Intron	DEL	A	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158634513delA	uc003lxp.2	-						RNF145_uc011ddy.1_5'UTR|RNF145_uc003lxo.1_Intron|RNF145_uc011ddz.1_Intron|RNF145_uc010jiq.1_Intron|RNF145_uc011dea.1_Intron	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145							integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCAACCAGTTAAAAAAAAAAA	0.333													4	2	---	---	---	---	
EFHC1	114327	broad.mit.edu	37	6	52369240	52369240	+	Intron	DEL	G	-	-	rs3842510		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52369240delG	uc011dwv.1	+						TRAM2_uc003paq.2_Intron			Q5JVL4	EFHC1_HUMAN	SubName: Full=cDNA FLJ51667, highly similar to EF-hand domain-containing protein 1;							axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding			ovary(2)|skin(1)	3	Lung NSC(77;0.109)					CAGGGAGCTAGGAGCCCCAGC	0.672													5	5	---	---	---	---	
TRA2A	29896	broad.mit.edu	37	7	23546893	23546893	+	Intron	DEL	T	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23546893delT	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425	Q13595	TRA2A_HUMAN	transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1						tgattttttatttttttttag	0.085													4	2	---	---	---	---	
NSMAF	8439	broad.mit.edu	37	8	59500894	59500894	+	Intron	DEL	T	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59500894delT	uc003xtt.2	-						NSMAF_uc011lee.1_Intron	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				tgacattttCTTTTTTTTTTT	0.179													10	5	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63502435	63502448	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs72423486		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63502435_63502448delTGTGTGTGTGTGTG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				ATAGGTATATtgtgtgtgtgtgtgtgtgtgtgtg	0.248													6	3	---	---	---	---	
GALT	2592	broad.mit.edu	37	9	34650279	34650280	+	Intron	INS	-	A	A	rs56121779		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34650279_34650280insA	uc003zve.2	+						GALT_uc003zvf.2_Intron|GALT_uc003zvg.2_Intron|GALT_uc003zvh.2_Intron|IL11RA_uc003zvi.2_5'Flank|IL11RA_uc011loq.1_5'Flank	NM_000155	NP_000146	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase						galactose catabolic process	cytosol	UDP-glucose:hexose-1-phosphate uridylyltransferase activity|zinc ion binding				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		gacctcgtctcaaaaaaaaaaa	0.223									Galactosemia				5	4	---	---	---	---	
PAX5	5079	broad.mit.edu	37	9	37034095	37034095	+	5'UTR	DEL	C	-	-	rs143723948		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37034095delC	uc003zzo.1	-	1					PAX5_uc011lpw.1_5'UTR|PAX5_uc011lpx.1_5'UTR|PAX5_uc011lpy.1_5'UTR|PAX5_uc010mls.1_5'UTR|PAX5_uc011lpz.1_5'UTR|PAX5_uc011lqa.1_5'UTR|PAX5_uc010mlq.1_RNA|PAX5_uc011lqb.1_RNA|PAX5_uc010mlo.1_5'UTR|PAX5_uc010mlp.1_5'UTR|PAX5_uc011lqc.1_5'UTR|PAX5_uc010mlr.1_5'UTR	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5						cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding		PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		Ctttttttttctttttttttt	0.408			T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								10	5	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	95055581	95055585	+	Intron	DEL	AATAA	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95055581_95055585delAATAA	uc004art.1	-						IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron|IARS_uc010mqt.2_Intron|SNORA84_uc010mqv.2_5'Flank	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	acggtacatcaataaaataagtatc	0.078													4	5	---	---	---	---	
GTPBP4	23560	broad.mit.edu	37	10	1061538	1061570	+	Intron	DEL	CTGGGGTCCTGAGCGCTGAGCCTGGGAGTGGAC	-	-	rs71731536	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1061538_1061570delCTGGGGTCCTGAGCGCTGAGCCTGGGAGTGGAC	uc001ift.2	+						GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		gggagcggggctggggtcctgagcgctgagcctgggagtggacctggggtcct	0.039													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467360	52467361	+	IGR	DEL	CA	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467360_52467361delCA								SGMS1 (82437 upstream) : ASAH2B (32335 downstream)																							AGCTGATATCcacacacacaca	0.342													8	4	---	---	---	---	
PHRF1	57661	broad.mit.edu	37	11	601429	601429	+	Intron	DEL	A	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:601429delA	uc001lqe.2	+						PHRF1_uc010qwc.1_Intron|PHRF1_uc010qwd.1_Intron|PHRF1_uc010qwe.1_Intron|PHRF1_uc009ybz.1_Intron	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1								RNA polymerase binding|zinc ion binding				0						atcctgtctcaaaaaaaaaaa	0.274													11	6	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													6	3	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124315343	124315343	+	Intron	DEL	T	-	-	rs7976816		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124315343delT	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		aaaaaaaaaattagctgagcg	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45903012	45903012	+	IGR	DEL	T	-	-			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45903012delT								PLDN (1104 upstream) : SQRDL (20334 downstream)																							TGAGAGATGCttttttttttt	0.244													5	3	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48058474	48058475	+	Intron	INS	-	T	T	rs147678407	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058474_48058475insT	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TACTACTTTTCTTTTTTTTTGT	0.361													5	3	---	---	---	---	
SERPINF1	5176	broad.mit.edu	37	17	1674545	1674545	+	Intron	DEL	T	-	-	rs71375537		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1674545delT	uc002ftl.2	+						SERPINF1_uc010cjw.2_Intron	NM_002615	NP_002606	P36955	PEDF_HUMAN	serine (or cysteine) proteinase inhibitor, clade						cell proliferation|negative regulation of angiogenesis|positive regulation of neurogenesis|regulation of proteolysis	extracellular space|melanosome	serine-type endopeptidase inhibitor activity			ovary(1)	1						TGGGGGGGTCttttttttttt	0.303													2	4	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80141907	80141908	+	Intron	INS	-	CA	CA	rs12953056	by1000genomes	TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80141907_80141908insCA	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron|CCDC57_uc010dik.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GCGCGCGCGCGcacacacacac	0.381													4	2	---	---	---	---	
DOK6	220164	broad.mit.edu	37	18	67068606	67068606	+	Intron	DEL	G	-	-	rs34997416		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67068606delG	uc002lkl.2	+							NM_152721	NP_689934	Q6PKX4	DOK6_HUMAN	docking protein 6								insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				CTGGCTGCCTGGGGGGGGGGC	0.697													2	4	---	---	---	---	
CSNK1G2	1455	broad.mit.edu	37	19	1953013	1953014	+	Intron	INS	-	A	A	rs77965237		TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1953013_1953014insA	uc002lul.3	+						C19orf34_uc002lum.2_Intron	NM_001319	NP_001310	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						sphingolipid metabolic process|Wnt receptor signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity			stomach(1)	1		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gactccgtctgaaaaaaaaaac	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58889825	58889826	+	Intron	INS	-	CCAT	CCAT			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58889825_58889826insCCAT	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		catccatcctcccatcctccca	0.000													4	2	---	---	---	---	
SOX10	6663	broad.mit.edu	37	22	38370364	38370365	+	Intron	INS	-	T	T			TCGA-G9-6370-01	TCGA-G9-6370-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38370364_38370365insT	uc003aun.1	-						POLR2F_uc003aum.2_Intron|SOX10_uc003auo.1_Intron	NM_006941	NP_008872	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10							cytoplasm|nucleus	DNA binding|identical protein binding|transcription coactivator activity				0	Melanoma(58;0.045)					Gtttttttttgttttttttttt	0.248													4	2	---	---	---	---	
