Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16892547	16892547	+	Intron	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892547G>A	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CGAATTGGCCGGGTGACACAC	0.368													3	38	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974955	16974955	+	RNA	SNP	A	G	G	rs149751487	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974955A>G	uc010och.1	+	7		c.1415A>G			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						GCATGCTTTGATGTCTGGGAC	0.657													3	64	---	---	---	---	PASS
NBPF3	84224	broad.mit.edu	37	1	21806667	21806667	+	Missense_Mutation	SNP	C	G	G	rs12043777	byFrequency	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21806667C>G	uc001ber.2	+	11	1682	c.1332C>G	c.(1330-1332)GAC>GAG	p.D444E	NBPF3_uc001bes.2_Missense_Mutation_p.D388E|NBPF3_uc009vqb.2_Missense_Mutation_p.D432E|NBPF3_uc010odm.1_Missense_Mutation_p.D374E	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	444	NBPF 3.					cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ACAGAAGTGACTTTTACTCAT	0.453													4	21	---	---	---	---	PASS
LDLRAD2	401944	broad.mit.edu	37	1	22150070	22150070	+	3'UTR	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22150070C>T	uc001bfg.1	+	5					HSPG2_uc001bfi.2_Intron|HSPG2_uc001bfj.2_Intron|HSPG2_uc009vqd.2_Intron	NM_001013693	NP_001013715	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain							integral to membrane	receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		AAGGGAGTGCCGTTCCTGCCC	0.687													10	96	---	---	---	---	PASS
NTNG1	22854	broad.mit.edu	37	1	107691217	107691217	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107691217T>C	uc001dvh.3	+	2	720	c.2T>C	c.(1-3)ATG>ACG	p.M1T	NTNG1_uc001dvf.3_Missense_Mutation_p.M1T|NTNG1_uc010out.1_Missense_Mutation_p.M1T|NTNG1_uc001dvc.3_Missense_Mutation_p.M1T|NTNG1_uc001dvd.1_Missense_Mutation_p.M1T	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	1					axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		AATTTAGAGATGTATTTGTCA	0.378													3	106	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612168	120612168	+	5'UTR	SNP	C	T	T	rs11801102	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612168C>T	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAAGCCCAGGCGCAAATGCCT	0.677			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142713944	142713944	+	Intron	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142713944C>T	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		TGATTACCTCCGAAGTTAAAG	0.308													4	27	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144598659	144598659	+	5'UTR	SNP	C	T	T	rs139801602	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144598659C>T	uc010oye.1	+	3					NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc009wif.1_RNA|uc001ele.2_RNA			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						GTGCCACCAACTCCCACTGTC	0.597													6	15	---	---	---	---	PASS
ABCB10	23456	broad.mit.edu	37	1	229666037	229666037	+	Silent	SNP	C	T	T	rs140426197	byFrequency	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229666037C>T	uc001htp.3	-	8	1597	c.1554G>A	c.(1552-1554)CCG>CCA	p.P518P		NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B, member 10	518	Mitochondrial intermembrane (Potential).|ABC transporter.|Mitochondrial matrix (Potential).					integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				CAGATCCTGACGGAATGGAAA	0.507													11	131	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237870322	237870322	+	Silent	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237870322C>T	uc001hyl.1	+	68	9774	c.9654C>T	c.(9652-9654)ATC>ATT	p.I3218I	RYR2_uc010pxz.1_Silent_p.I173I	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3218					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGAAGAAATCGTGGAATTAG	0.453													11	153	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247587215	247587215	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247587215G>A	uc001icr.2	+	5	608	c.470G>A	c.(469-471)CGT>CAT	p.R157H	NLRP3_uc001ics.2_Missense_Mutation_p.R157H|NLRP3_uc001icu.2_Missense_Mutation_p.R157H|NLRP3_uc001icw.2_Missense_Mutation_p.R157H|NLRP3_uc001icv.2_Missense_Mutation_p.R157H|NLRP3_uc010pyw.1_Missense_Mutation_p.R155H|NLRP3_uc001ict.1_Missense_Mutation_p.R155H	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	157					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGGAATGCCCGTCTGGGTGAG	0.522													5	34	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90260172	90260172	+	RNA	SNP	A	G	G			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90260172A>G	uc010fhm.2	+	30		c.4155A>G								Parts of antibodies, mostly variable regions.																		TCTGGGACAGATTTCACTCTC	0.478													26	170	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128377979	128377979	+	Silent	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128377979C>A	uc002top.2	+	26	3438	c.3385C>A	c.(3385-3387)CGG>AGG	p.R1129R	MYO7B_uc002toq.1_5'UTR|MYO7B_uc002tor.1_5'UTR	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1129	MyTH4 1.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CAGCCTGGCCCGGGGCTGGAT	0.587													4	90	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130832500	130832500	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832500T>C	uc010fmh.2	-	17	2945	c.2545A>G	c.(2545-2547)ACT>GCT	p.T849A		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	849	Actin-like.					cell cortex	ATP binding			skin(3)|ovary(2)	5						ACGATGCCAGTAGTACGGCCA	0.602													20	188	---	---	---	---	PASS
FMNL2	114793	broad.mit.edu	37	2	153468107	153468107	+	Silent	SNP	C	T	T	rs35776654	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153468107C>T	uc002tye.2	+	11	1417	c.1050C>T	c.(1048-1050)GAC>GAT	p.D350D		NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2	350	GBD/FH3.				actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						TAGGCCTGGACGAATACTTGG	0.393													4	8	---	---	---	---	PASS
ARPC2	10109	broad.mit.edu	37	2	219082119	219082119	+	Intron	SNP	G	T	T	rs2271541	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219082119G>T	uc002vhd.2	+						ARPC2_uc002vhe.2_5'Flank	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CAGCAGGGCCGCTCCCTCCGT	0.687													3	33	---	---	---	---	PASS
FARSB	10056	broad.mit.edu	37	2	223507640	223507640	+	Missense_Mutation	SNP	C	T	T	rs139085353	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223507640C>T	uc002vne.1	-	3	234	c.199G>A	c.(199-201)GTC>ATC	p.V67I	FARSB_uc010zlq.1_Missense_Mutation_p.V87I|FARSB_uc002vnf.1_5'UTR	NM_005687	NP_005678	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	67					phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|RNA binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	TTGGCAGGGACGTCAATTTTG	0.388													13	27	---	---	---	---	PASS
IL5RA	3568	broad.mit.edu	37	3	3146666	3146666	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3146666C>A	uc011ask.1	-	4	647	c.3G>T	c.(1-3)ATG>ATT	p.M1I	IL5RA_uc010hbq.2_Missense_Mutation_p.M1I|IL5RA_uc010hbr.2_Missense_Mutation_p.M1I|IL5RA_uc010hbs.2_Missense_Mutation_p.M1I|IL5RA_uc011asl.1_Missense_Mutation_p.M1I|IL5RA_uc011asm.1_Missense_Mutation_p.M1I|IL5RA_uc010hbt.2_Missense_Mutation_p.M1I|IL5RA_uc011asn.1_Missense_Mutation_p.M1I|IL5RA_uc010hbu.2_Missense_Mutation_p.M1I	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1	1					cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		CCACGATGATCATATCCTACA	0.383													3	58	---	---	---	---	PASS
CPOX	1371	broad.mit.edu	37	3	98300354	98300354	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98300354A>C	uc003dsx.2	-	6	1267	c.1174T>G	c.(1174-1176)TAT>GAT	p.Y392D		NM_000097	NP_000088	P36551	HEM6_HUMAN	coproporphyrinogen oxidase precursor	392	Important for dimerization.			Missing: Loss for dimerization.		mitochondrial intermembrane space	coproporphyrinogen oxidase activity|protein homodimerization activity				0						AATTCTACATACCTGCCATAA	0.398													10	35	---	---	---	---	PASS
IFT57	55081	broad.mit.edu	37	3	107885800	107885800	+	Silent	SNP	A	G	G	rs143767161		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107885800A>G	uc003dwx.3	-	8	1130	c.882T>C	c.(880-882)ACT>ACC	p.T294T		NM_018010	NP_060480	Q9NWB7	IFT57_HUMAN	estrogen-related receptor beta like 1	294					activation of caspase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cilium|microtubule basal body	DNA binding|protein binding			ovary(1)|skin(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			CCAAAGTCCTAGTAATTTCAT	0.358													9	26	---	---	---	---	PASS
ZNF80	7634	broad.mit.edu	37	3	113955069	113955069	+	3'UTR	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113955069G>A	uc010hqo.2	-	1					ZNF80_uc003ebf.2_RNA	NM_007136	NP_009067	P51504	ZNF80_HUMAN	zinc finger protein 80							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(201;0.0233)|all_neural(597;0.0837)				AAAAAAAAAAGAAAACCCACA	0.428													6	56	---	---	---	---	PASS
C4orf37	285555	broad.mit.edu	37	4	99030364	99030364	+	Silent	SNP	T	C	C			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99030364T>C	uc003htt.1	-	4	570	c.480A>G	c.(478-480)CCA>CCG	p.P160P		NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555	160											0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		CATACTGTCCTGGACCAGGAC	0.333													3	76	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169393855	169393855	+	5'UTR	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169393855G>A	uc003irq.3	-	2					DDX60L_uc003irr.1_5'UTR|DDX60L_uc003irt.1_5'UTR	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		ACCCATCGTTGCTGCTTCTTG	0.338													11	70	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169393856	169393856	+	5'UTR	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169393856C>A	uc003irq.3	-	2					DDX60L_uc003irr.1_5'UTR|DDX60L_uc003irt.1_5'UTR	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CCCATCGTTGCTGCTTCTTGG	0.343													11	68	---	---	---	---	PASS
ZDHHC11	79844	broad.mit.edu	37	5	801252	801252	+	Missense_Mutation	SNP	C	T	T	rs142091140		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:801252C>T	uc011cma.1	-	12	1593	c.1209G>A	c.(1207-1209)ATG>ATA	p.M403I	ZDHHC11_uc010itc.2_RNA|ZDHHC11_uc003jbj.2_RNA	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	403						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			TGTCAGTTTTCATGGGCTCTG	0.413													4	49	---	---	---	---	PASS
ZNF131	7690	broad.mit.edu	37	5	43139402	43139402	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43139402T>G	uc011cpw.1	+	4	398	c.362T>G	c.(361-363)CTT>CGT	p.L121R	ZNF131_uc010ivl.1_Missense_Mutation_p.L121R|ZNF131_uc003jnj.3_5'UTR|ZNF131_uc003jnk.2_Missense_Mutation_p.L121R|ZNF131_uc003jnn.3_Intron|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_RNA	NM_003432	NP_003423	P52739	ZN131_HUMAN	zinc finger protein 131	121						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ATCAAAGCCCTTGAAGTCAGG	0.358													3	67	---	---	---	---	PASS
APBB3	10307	broad.mit.edu	37	5	139939911	139939911	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139939911T>A	uc003lgd.1	-	11	1585	c.1226A>T	c.(1225-1227)CAG>CTG	p.Q409L	SRA1_uc003lfz.2_5'Flank|SRA1_uc010jfm.2_5'Flank|SRA1_uc003lga.2_5'Flank|APBB3_uc003lgb.1_Missense_Mutation_p.Q181L|APBB3_uc003lgc.1_Missense_Mutation_p.Q181L|APBB3_uc003lge.1_Missense_Mutation_p.Q402L|APBB3_uc003lgf.1_RNA|APBB3_uc010jfp.1_RNA|APBB3_uc011czi.1_Missense_Mutation_p.Q181L|APBB3_uc010jfq.1_3'UTR	NM_133172	NP_573418	O95704	APBB3_HUMAN	amyloid beta precursor protein-binding, family	404	PID 2.					actin cytoskeleton|cytoplasm				ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGGCAGCCTGCACAGCTTC	0.612													3	64	---	---	---	---	PASS
PCDHAC1	56135	broad.mit.edu	37	5	140307487	140307487	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140307487C>T	uc003lih.2	+	1	1186	c.1010C>T	c.(1009-1011)GCC>GTC	p.A337V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Missense_Mutation_p.A337V	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	337	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGATCATGCCCCCGAACTG	0.532													5	186	---	---	---	---	PASS
UIMC1	51720	broad.mit.edu	37	5	176396017	176396017	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176396017C>A	uc011dfp.1	-	6	906	c.739G>T	c.(739-741)GTC>TTC	p.V247F	UIMC1_uc003mfc.1_Missense_Mutation_p.V124F|UIMC1_uc003mfd.1_Intron|UIMC1_uc003mfg.1_Intron|UIMC1_uc003mff.1_Intron	NM_016290	NP_057374	Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	247				V -> C (in Ref. 3; AAG59851).	double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding			ovary(3)|skin(1)	4	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTACCCTGGACAGCTTTGAGA	0.527													6	145	---	---	---	---	PASS
EXOC2	55770	broad.mit.edu	37	6	491185	491185	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:491185G>A	uc003mtd.2	-	26	2695	c.2561C>T	c.(2560-2562)GCG>GTG	p.A854V	EXOC2_uc003mte.2_Missense_Mutation_p.A854V|EXOC2_uc011dho.1_Missense_Mutation_p.A449V	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein	854					exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TTCAAGTCTCGCCTGAAAATG	0.393													28	130	---	---	---	---	PASS
TUBB2B	347733	broad.mit.edu	37	6	3226894	3226894	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3226894C>A	uc003mvg.2	-	2	258	c.67G>T	c.(67-69)GTC>TTC	p.V23F	uc003mvi.1_5'Flank|TUBB2B_uc010jnj.2_Missense_Mutation_p.V23F|TUBB2B_uc010jnk.2_Intron|TUBB2B_uc003mvh.2_5'UTR	NM_178012	NP_821080	Q9BVA1	TBB2B_HUMAN	tubulin, beta 2B	23					'de novo' posttranslational protein folding|microtubule-based movement|neuron migration|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			large_intestine(1)	1	Ovarian(93;0.0386)	all_hematologic(90;0.108)				TCACTGATGACCTCCCAAAAC	0.498													15	158	---	---	---	---	PASS
HLA-DRB1	3123	broad.mit.edu	37	6	32546866	32546866	+	3'UTR	SNP	T	C	C	rs9269693	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32546866T>C	uc003obp.3	-	6					HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc011dqb.1_Missense_Mutation_p.M50V	NM_002124	NP_002115	P01911	2B1F_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex				skin(1)	1						GTCATCTGCATTTCAGCTCAG	0.468									Rheumatoid_Arthritis|Sj_gren_syndrome	Multiple Myeloma(14;0.17)			3	14	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38980354	38980354	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38980354C>T	uc003ooe.1	+	89	13604	c.13004C>T	c.(13003-13005)ACG>ATG	p.T4335M		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CAGTTTTCTACGTGGATATTT	0.438													4	196	---	---	---	---	PASS
PGM3	5238	broad.mit.edu	37	6	83898366	83898366	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83898366T>A	uc003pjv.2	-	3	396	c.356A>T	c.(355-357)CAA>CTA	p.Q119L	PGM3_uc003pjw.2_Missense_Mutation_p.Q38L|PGM3_uc011dyz.1_Missense_Mutation_p.Q147L	NM_015599	NP_056414	O95394	AGM1_HUMAN	phosphoglucomutase 3	119					dolichol-linked oligosaccharide biosynthetic process|embryo development ending in birth or egg hatching|glucose 1-phosphate metabolic process|hemopoiesis|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	magnesium ion binding|phosphoacetylglucosamine mutase activity|phosphoglucomutase activity				0		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		AAAGGCATCTTGTTGCAGATT	0.398													5	81	---	---	---	---	PASS
SERINC1	57515	broad.mit.edu	37	6	122792918	122792918	+	5'UTR	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122792918G>A	uc003pyy.1	-	1					PKIB_uc003pyz.2_5'Flank	NM_020755	NP_065806	Q9NRX5	SERC1_HUMAN	serine incorporator 1						phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	L-serine transmembrane transporter activity|protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.126)		ATACAGACAAGATGGAGACAG	0.582													6	105	---	---	---	---	PASS
ITGB8	3696	broad.mit.edu	37	7	20406803	20406803	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20406803C>A	uc003suu.2	+	3	1087	c.382C>A	c.(382-384)CGT>AGT	p.R128S	ITGB8_uc011jyh.1_5'UTR|ITGB8_uc003sut.2_Missense_Mutation_p.R128S	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	128	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						TATCCAGCTGCGTCCAGGTTT	0.323													3	80	---	---	---	---	PASS
ZNF735	730291	broad.mit.edu	37	7	63679782	63679782	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63679782G>A	uc011kdn.1	+	4	353	c.353G>A	c.(352-354)TGT>TAT	p.C118Y		NM_001159524	NP_001152996	P0CB33	ZN735_HUMAN	zinc finger protein 735	118					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TATGGAAAATGTGGACATGAG	0.343													7	99	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81346562	81346562	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81346562C>T	uc003uhl.2	-	11	1556	c.1391G>A	c.(1390-1392)TGC>TAC	p.C464Y	HGF_uc003uhm.2_Missense_Mutation_p.C459Y	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	464	Kringle 4.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						AGAAATAGGGCAATAATCCCA	0.383													8	72	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123142982	123142982	+	Intron	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123142982C>A	uc003vkn.2	-						IQUB_uc003vko.2_Intron|IQUB_uc010lkt.2_Intron|IQUB_uc003vkp.1_Intron|IQUB_uc003vkq.2_3'UTR	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing											ovary(3)|large_intestine(1)	4						CCTAAAGAGACAAATAAAAAC	0.318													3	82	---	---	---	---	PASS
HIPK2	28996	broad.mit.edu	37	7	139268747	139268747	+	Silent	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139268747G>A	uc003vvf.3	-	13	2955	c.2781C>T	c.(2779-2781)TCC>TCT	p.S927S	HIPK2_uc003vvd.3_Silent_p.S900S	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	927	Interaction with TP53 and TP73.|Required for localization to nuclear speckles (By similarity).				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					TGGAGGAGTCGGAGTAGGGGG	0.547													4	87	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141752697	141752697	+	Silent	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141752697C>T	uc003vwy.2	+	26	3126	c.3072C>T	c.(3070-3072)TCC>TCT	p.S1024S		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1024	Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TAAAGTCTTCCGTTTATGCCA	0.468													7	112	---	---	---	---	PASS
SLC4A2	6522	broad.mit.edu	37	7	150773232	150773232	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150773232G>A	uc003wit.3	+	22	3860	c.3604G>A	c.(3604-3606)GTG>ATG	p.V1202M	SLC4A2_uc011kve.1_Missense_Mutation_p.V1193M|SLC4A2_uc003wiu.3_Missense_Mutation_p.V1188M|SLC4A2_uc003wiv.3_Missense_Mutation_p.V396M|uc011kvf.1_Silent_p.H71H	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member	1202	Membrane (anion exchange).				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTCCGCATGGTGGTGCTCAC	0.627													6	137	---	---	---	---	PASS
RPL23AP53	644128	broad.mit.edu	37	8	163191	163191	+	RNA	SNP	C	T	T	rs147223236	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:163191C>T	uc010lra.2	-	4		c.942G>A			RPL23AP53_uc003woq.3_RNA|RPL23AP53_uc010lrb.2_RNA	NR_003572				Homo sapiens cDNA FLJ45055 fis, clone BRAWH3022900.												0						AAACATTATTCTTTTATGGTG	0.219													3	17	---	---	---	---	PASS
LOC642826	642826	broad.mit.edu	37	10	47207813	47207813	+	RNA	SNP	T	C	C			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47207813T>C	uc001jei.2	-	12		c.1586A>G			uc009xnf.2_Missense_Mutation_p.H132R					Homo sapiens cDNA, FLJ99065.												0						TTTACTTACATGGTTTGTACA	0.294													7	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	48968566	48968566	+	RNA	SNP	A	G	G			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48968566A>G	uc001jgc.1	+	3		c.1234A>G								full-length cDNA clone CS0DI009YC01 of Placenta Cot 25-normalized of Homo sapiens (human).																		ACAGGATAACAAACTGGAAAA	0.284													6	24	---	---	---	---	PASS
GPR120	338557	broad.mit.edu	37	10	95326921	95326921	+	Silent	SNP	G	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95326921G>T	uc010qnt.1	+	1	500	c.444G>T	c.(442-444)CGG>CGT	p.R148R	GPR120_uc010qnu.1_Silent_p.R148R	NM_181745	NP_859529	Q5NUL3	O3FA1_HUMAN	G protein-coupled receptor 120	148	Cytoplasmic (Potential).				negative regulation of cytokine secretion|negative regulation of inflammatory response|regulation of glucose transport	integral to membrane|plasma membrane	fatty acid binding				0		Colorectal(252;0.122)				GCGGCGTGCGGGGTCCTGGGC	0.701													4	14	---	---	---	---	PASS
CPXM2	119587	broad.mit.edu	37	10	125530493	125530493	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125530493G>T	uc001lhk.1	-	8	1366	c.1041C>A	c.(1039-1041)AGC>AGA	p.S347R	CPXM2_uc001lhj.2_RNA	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	347					cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GGCCCTGGTGGCTTTTTCCAA	0.458													45	284	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595260	55595260	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595260G>T	uc001nhy.1	+	1	566	c.566G>T	c.(565-567)TGC>TTC	p.C189F		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	189	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				AGTCTTGCTTGCTCTGATGTC	0.448										HNSCC(27;0.073)			54	117	---	---	---	---	PASS
PHLDB1	23187	broad.mit.edu	37	11	118498442	118498442	+	Silent	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118498442C>A	uc001ptr.1	+	7	1256	c.903C>A	c.(901-903)TCC>TCA	p.S301S	PHLDB1_uc010ryh.1_Silent_p.S300S|PHLDB1_uc001pts.2_Silent_p.S301S|PHLDB1_uc001ptt.2_Silent_p.S301S|PHLDB1_uc001ptu.1_RNA|PHLDB1_uc001ptv.1_Silent_p.S101S|PHLDB1_uc001ptw.1_5'Flank	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	301											0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCCCACAGTCCCGCCCAAGTG	0.672													4	73	---	---	---	---	PASS
USP2	9099	broad.mit.edu	37	11	119243942	119243942	+	Silent	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119243942G>A	uc001pwm.3	-	2	544	c.249C>T	c.(247-249)CCC>CCT	p.P83P	USP2_uc001pwn.3_Intron	NM_004205	NP_004196	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2 isoform a	83	Necessary for interaction with MDM4.				cell cycle|muscle organ development|negative regulation of transcription from RNA polymerase II promoter|positive regulation of mitotic cell cycle|protein deubiquitination|protein stabilization|ubiquitin-dependent protein catabolic process	nucleus|perinuclear region of cytoplasm	cyclin binding|cysteine-type endopeptidase activity|metal ion binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity			ovary(2)|urinary_tract(1)|skin(1)	4		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		CAGTGATGTCGGGTCTCAGCA	0.667													6	150	---	---	---	---	PASS
OR6X1	390260	broad.mit.edu	37	11	123624519	123624519	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123624519G>T	uc010rzy.1	-	1	708	c.708C>A	c.(706-708)TTC>TTA	p.F236L		NM_001005188	NP_001005188	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X,	236	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CACAGGTAGAGAAAGTCTTTT	0.458													8	85	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123900524	123900524	+	Silent	SNP	G	C	C	rs140497683	byFrequency	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123900524G>C	uc001pzp.1	+	1	195	c.195G>C	c.(193-195)TCG>TCC	p.S65S		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCAACCTGTCGTTCATTGACA	0.532													3	151	---	---	---	---	PASS
KDM5A	5927	broad.mit.edu	37	12	417035	417035	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:417035C>A	uc001qif.1	-	23	3878	c.3515G>T	c.(3514-3516)GGG>GTG	p.G1172V	KDM5A_uc001qie.1_Missense_Mutation_p.G1172V	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	1172	PHD-type 2.				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TAGCATAAACCCACTGGCTGT	0.463			T 	NUP98	AML								11	137	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9583286	9583286	+	Silent	SNP	A	G	G	rs2429895	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9583286A>G	uc010sgs.1	-	10	1335	c.1140T>C	c.(1138-1140)GCT>GCC	p.A380A		NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						GGATGCCCGCAGCCTGCCGAG	0.672													3	25	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11546799	11546799	+	Silent	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11546799G>A	uc010shk.1	-	3	248	c.213C>T	c.(211-213)CCC>CCT	p.P71P		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GAGGAGGTGGGGGACCTTGAG	0.612													7	358	---	---	---	---	PASS
GEFT	115557	broad.mit.edu	37	12	58004061	58004061	+	5'Flank	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58004061G>A	uc001spb.2	+						GEFT_uc009zpy.2_Missense_Mutation_p.G21D|GEFT_uc001soz.1_5'Flank|GEFT_uc001spa.2_5'Flank	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1						regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					GTCATGGGGGGCATGCTGCGC	0.701													4	29	---	---	---	---	PASS
GLT8D2	83468	broad.mit.edu	37	12	104413438	104413438	+	5'UTR	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104413438C>T	uc001tkh.1	-	3					GLT8D2_uc001tki.1_5'UTR	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2							integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						TGTATTCACGCGGATAAGAAC	0.353													3	30	---	---	---	---	PASS
RFX4	5992	broad.mit.edu	37	12	107075878	107075878	+	Intron	SNP	G	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107075878G>T	uc001tlr.2	+						RFX4_uc010swv.1_Intron|RFX4_uc001tls.2_Intron|RFX4_uc001tlt.2_Intron|RFX4_uc001tlv.2_5'Flank|uc001tlu.3_RNA	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						ACATCTATGGGCCTCGAGACA	0.562													7	75	---	---	---	---	PASS
SLC24A6	80024	broad.mit.edu	37	12	113748079	113748079	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113748079A>C	uc001tvc.2	-	12	1427	c.1217T>G	c.(1216-1218)TTT>TGT	p.F406C	SLC24A6_uc001tuz.2_Missense_Mutation_p.F111C|SLC24A6_uc001tva.2_RNA|SLC24A6_uc001tvb.2_Missense_Mutation_p.F144C	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor	406	Extracellular (Potential).				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						TGTGGCAAAAAAGGTCACTGA	0.587													5	82	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133351742	133351742	+	Silent	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133351742G>A	uc001ukz.1	-	22	4687	c.4128C>T	c.(4126-4128)CGC>CGT	p.R1376R	GOLGA3_uc001ula.1_Silent_p.R1376R	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	1376	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TGGCCGCGCCGCGGCGTAGGT	0.587													6	57	---	---	---	---	PASS
ITGBL1	9358	broad.mit.edu	37	13	102359193	102359193	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102359193C>T	uc001vpb.2	+	9	1439	c.1220C>T	c.(1219-1221)ACG>ATG	p.T407M	ITGBL1_uc010agb.2_Missense_Mutation_p.T358M|ITGBL1_uc001vpc.3_Missense_Mutation_p.T266M	NM_004791	NP_004782	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat	407	VIII.|Cysteine-rich tandem repeats.				cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGTAACATGACGGAAGAACAA	0.517													7	139	---	---	---	---	PASS
GRK1	6011	broad.mit.edu	37	13	114324084	114324084	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114324084C>G	uc010tkf.1	+	2	890	c.782C>G	c.(781-783)GCC>GGC	p.A261G		NM_002929	NP_002920	Q15835	RK_HUMAN	rhodopsin kinase precursor	261	Protein kinase.				regulation of G-protein coupled receptor protein signaling pathway|rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|rhodopsin kinase activity|signal transducer activity			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			GAAACCAAAGCCGACCTCTGT	0.557													4	154	---	---	---	---	PASS
ANG	283	broad.mit.edu	37	14	21161988	21161988	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21161988C>T	uc001vxw.3	+	2	865	c.265C>T	c.(265-267)CAC>TAC	p.H89Y	RNASE4_uc001vxx.3_Intron|RNASE4_uc001vxy.3_Intron|ANG_uc001vxz.2_Missense_Mutation_p.H89Y|RNASE4_uc001vya.2_Intron	NM_001145	NP_001136	P03950	ANGI_HUMAN	angiogenin, ribonuclease, RNase A family, 5	89					actin filament polymerization|activation of phospholipase A2 activity|activation of phospholipase C activity|activation of protein kinase B activity|angiogenesis|cell communication|cell death|cell migration|diacylglycerol biosynthetic process|homeostatic process|negative regulation of smooth muscle cell proliferation|negative regulation of translation|oocyte maturation|ovarian follicle development|placenta development|positive regulation of endothelial cell proliferation|positive regulation of phosphorylation|positive regulation of protein secretion|response to hormone stimulus|response to hypoxia|rRNA transcription	angiogenin-PRI complex|basal lamina|extracellular space|growth cone|neuronal cell body|nucleolus	actin binding|copper ion binding|heparin binding|pancreatic ribonuclease activity|peptide binding|receptor binding|rRNA binding			ovary(1)	1	all_cancers(95;0.00387)	all_cancers(140;0.196)|all_epithelial(140;0.156)	Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	OV - Ovarian serous cystadenocarcinoma(311;3.25e-17)|GBM - Glioblastoma multiforme(265;5.56e-07)		TGGAAACCCTCACAGAGAAAA	0.507													4	65	---	---	---	---	PASS
ITPK1	3705	broad.mit.edu	37	14	93404856	93404856	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93404856C>T	uc001ybe.2	-	11	1206	c.917G>A	c.(916-918)TGC>TAC	p.C306Y		NM_001142594	NP_001136066	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform	Error:Variant_position_missing_in_Q13572_after_alignment					blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TTCTATAAAGCACACTTGGCA	0.527													4	44	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106787447	106787447	+	Splice_Site	SNP	A	G	G			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106787447A>G	uc010tyt.1	-	395		c.14792_splice	c.e395-1							Parts of antibodies, mostly variable regions.												0						GTCTTTGGAGATGGAGAATCT	0.453													3	23	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21938287	21938287	+	RNA	SNP	T	C	C	rs4641705	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21938287T>C	uc010tzj.1	-	1		c.2453A>G				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						cacacatctataaccatctga	0.109													5	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161902	90161902	+	3'UTR	SNP	A	G	G	rs6500471	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161902A>G	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		ATATGTTCCAAGACCCTAAAA	0.537													7	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161926	90161926	+	3'UTR	SNP	T	C	C	rs8061283	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161926T>C	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		CCCACACCCATCTATGGTGAC	0.527													7	39	---	---	---	---	PASS
CLDN7	1366	broad.mit.edu	37	17	7163815	7163815	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7163815A>C	uc002gfm.3	-	4	947	c.514T>G	c.(514-516)TCT>GCT	p.S172A	CLDN7_uc010cmc.2_Silent_p.G143G|CLDN7_uc002gfn.3_Missense_Mutation_p.S172A	NM_001307	NP_001298	O95471	CLD7_HUMAN	claudin 7	172	Helical; (Potential).				calcium-independent cell-cell adhesion	integral to membrane|lateral plasma membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1						ACTAGGGCAGACCCTGCCCAG	0.572													10	19	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10350461	10350461	+	Missense_Mutation	SNP	G	A	A	rs149007526	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10350461G>A	uc002gmn.2	-	35	5149	c.5038C>T	c.(5038-5040)CGC>TGC	p.R1680C	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1680	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TTAGCTCTGCGCTCAACCATT	0.502													39	53	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904194	21904194	+	RNA	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904194C>A	uc002gza.2	+	1		c.133C>A				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						agcctcaggcctgccaggacg	0.000													4	70	---	---	---	---	PASS
SLC6A4	6532	broad.mit.edu	37	17	28548700	28548700	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28548700T>G	uc002hey.3	-	3	821	c.277A>C	c.(277-279)ATT>CTT	p.I93L		NM_001045	NP_001036	P31645	SC6A4_HUMAN	solute carrier family 6 member 4	93	Helical; Name=1; (Potential).				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity			skin(3)|ovary(1)	4					Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)	GCATAGCCAATCACTGAGAGA	0.562													10	118	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60028344	60028344	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60028344G>A	uc002izo.2	-	28	6210	c.6133C>T	c.(6133-6135)CGG>TGG	p.R2045W		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2045					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						GATAGTAGCCGATCAGTACTC	0.383													6	45	---	---	---	---	PASS
ENPP7	339221	broad.mit.edu	37	17	77710932	77710932	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77710932C>A	uc002jxa.2	+	4	1139	c.1119C>A	c.(1117-1119)TTC>TTA	p.F373L		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	373					negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GCCCTAGCTTCAGGGCGGGCC	0.607													4	86	---	---	---	---	PASS
MOCOS	55034	broad.mit.edu	37	18	33767626	33767626	+	Nonsense_Mutation	SNP	G	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33767626G>T	uc002kzq.3	+	1	147	c.124G>T	c.(124-126)GAG>TAG	p.E42*	uc002kzp.2_5'Flank	NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase	42					Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	GCGGGCGCGCGAGTTCAGCCG	0.716													2	5	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43585253	43585253	+	Silent	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43585253C>T	uc002ovi.2	-	2	303	c.210G>A	c.(208-210)GGG>GGA	p.G70G	PSG6_uc010xwk.1_Intron|PSG2_uc002ovr.2_Silent_p.G70G|PSG2_uc002ovq.3_Silent_p.G70G|PSG2_uc010eiq.1_Silent_p.G70G|PSG2_uc002ovs.3_Silent_p.G70G|PSG2_uc002ovt.3_Silent_p.G70G			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;	70	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				CCCTGATTTGCCCTTTGTACC	0.433													6	168	---	---	---	---	PASS
PSG9	5678	broad.mit.edu	37	19	43766113	43766113	+	Missense_Mutation	SNP	T	A	A	rs143377407	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43766113T>A	uc002owd.3	-	3	707	c.608A>T	c.(607-609)TAT>TTT	p.Y203F	PSG9_uc002owe.3_Missense_Mutation_p.Y203F|PSG9_uc010xwm.1_Intron|PSG9_uc002owf.3_Intron|PSG9_uc002owg.2_Missense_Mutation_p.Y203F|PSG9_uc002owh.2_Intron	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	203	Ig-like C2-type 1.			Y -> C (in Ref. 1; CAA35612).	female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				ACCAAATAGATAGAGGGTCCT	0.507													5	333	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50103128	50103128	+	Silent	SNP	C	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50103128C>A	uc002poo.3	+	5	4278	c.4278C>A	c.(4276-4278)CCC>CCA	p.P1426P		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	605	Pro-rich.						DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCTTGGCCCCCGCGGCTGCAG	0.667													3	82	---	---	---	---	PASS
SBK2	646643	broad.mit.edu	37	19	56041233	56041233	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56041233C>T	uc010ygc.1	-	3	914	c.914G>A	c.(913-915)CGG>CAG	p.R305Q		NM_001101401	NP_001094871	P0C263	SBK2_HUMAN	SH3-binding domain kinase family, member 2	305	Protein kinase.						ATP binding|protein serine/threonine kinase activity				0						CAGCAGCCCCCGCAGAAGCGC	0.741													4	26	---	---	---	---	PASS
ZFP28	140612	broad.mit.edu	37	19	57065989	57065989	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57065989C>T	uc002qnj.2	+	8	1906	c.1835C>T	c.(1834-1836)ACT>ATT	p.T612I	uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	612					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		AGGATTCATACTGGGGAGAAG	0.428													9	138	---	---	---	---	PASS
OGFR	11054	broad.mit.edu	37	20	61444845	61444845	+	Silent	SNP	G	A	A	rs112106909		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61444845G>A	uc002ydj.2	+	7	1913	c.1878G>A	c.(1876-1878)CCG>CCA	p.P626P	OGFR_uc002ydk.2_Silent_p.P609P|OGFR_uc002ydl.2_Silent_p.P574P|uc011aam.1_Intron	NM_007346	NP_031372	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	626	6.|7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)					GCCCCCGCCCGGCAGGACCTG	0.746													4	26	---	---	---	---	PASS
RNF160	26046	broad.mit.edu	37	21	30339290	30339290	+	Missense_Mutation	SNP	T	G	G	rs113622445	byFrequency	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30339290T>G	uc002ymr.2	-	10	1674	c.1661A>C	c.(1660-1662)GAT>GCT	p.D554A	RNF160_uc010gll.1_RNA	NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294	508							ligase activity|zinc ion binding				0						GGACTCAACATCAGCTTCTGG	0.393													10	117	---	---	---	---	PASS
TCN2	6948	broad.mit.edu	37	22	31022486	31022486	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31022486A>T	uc003aip.1	+	9	1420	c.1262A>T	c.(1261-1263)GAG>GTG	p.E421V	TCN2_uc003aiq.1_Missense_Mutation_p.E417V|TCN2_uc003air.1_Missense_Mutation_p.E394V	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor	421					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAACCATTGAGCTGAGGCTG	0.567													13	50	---	---	---	---	PASS
SREBF2	6721	broad.mit.edu	37	22	42264696	42264696	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42264696A>T	uc003bbi.2	+	3	789	c.620A>T	c.(619-621)CAG>CTG	p.Q207L	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|SREBF2_uc003bbj.2_5'Flank	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription	207	Cytoplasmic (Potential).|Gln-rich.				cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4						CAGACAGTACAGGCCCAGCGG	0.612													14	28	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	44083353	44083353	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44083353A>T	uc003bdy.1	-	11	1355	c.1140T>A	c.(1138-1140)AAT>AAA	p.N380K	EFCAB6_uc003bdz.1_Missense_Mutation_p.N228K|EFCAB6_uc010gzi.1_Missense_Mutation_p.N228K|EFCAB6_uc010gzk.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Missense_Mutation_p.N377K	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	380					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				TTACATACCTATTTCTTTTTG	0.299													9	31	---	---	---	---	PASS
BEND5	79656	broad.mit.edu	37	1	49201966	49201967	+	Frame_Shift_Ins	INS	-	T	T			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49201966_49201967insT	uc001crx.3	-	5	1096_1097	c.1052_1053insA	c.(1051-1053)AAGfs	p.K351fs	AGBL4_uc001cru.2_Intron|AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crw.3_Frame_Shift_Ins_p.K182fs	NM_024603	NP_078879	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	351	BEN.									skin(1)	1						CTGCATCTTTCTTTTTTTTTGT	0.460													161	8	---	---	---	---	
C1orf194	127003	broad.mit.edu	37	1	109656073	109656074	+	5'Flank	INS	-	GGGAGT	GGGAGT	rs146239424	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109656073_109656074insGGGAGT	uc009wev.2	-						KIAA1324_uc001dwq.2_5'Flank|KIAA1324_uc009wex.1_5'Flank|KIAA1324_uc009wey.2_5'Flank|KIAA1324_uc010ovg.1_5'Flank|C1orf194_uc001dwp.3_5'Flank|C1orf194_uc009wew.2_Intron	NM_001122961	NP_001116433	Q5T5A4	CA194_HUMAN	hypothetical protein LOC127003											ovary(1)	1						agagagagagagagagagagag	0.228													6	3	---	---	---	---	
CEPT1	10390	broad.mit.edu	37	1	111703575	111703576	+	Intron	INS	-	A	A	rs143334479		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111703575_111703576insA	uc001eah.1	+						CEPT1_uc001eag.2_3'UTR|CEPT1_uc001eai.1_Intron|CEPT1_uc001eaj.1_Intron	NM_001007794	NP_001007795	Q9Y6K0	CEPT1_HUMAN	choline/ethanolaminephosphotransferase							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	diacylglycerol cholinephosphotransferase activity|ethanolaminephosphotransferase activity|metal ion binding				0		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	AGTGATTTGGTAAAAAAAAAAA	0.297													5	3	---	---	---	---	
C1orf77	26097	broad.mit.edu	37	1	153608902	153608902	+	Intron	DEL	G	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153608902delG	uc001fcm.1	+						C1orf77_uc001fcn.1_Intron|C1orf77_uc001fco.1_5'Flank|S100A13_uc001fcj.2_5'Flank|C1orf77_uc009woi.1_Intron|C1orf77_uc009woj.1_Intron	NM_015607	NP_056422	Q9Y3Y2	CHTOP_HUMAN	small protein rich in arginine and glycine						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	protein binding|RNA binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			aaaaaaaaaagaaaTTTAAGC	0.189													4	2	---	---	---	---	
TMCC2	9911	broad.mit.edu	37	1	205238670	205238670	+	Frame_Shift_Del	DEL	A	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205238670delA	uc001hbz.1	+	4	1784	c.1340delA	c.(1339-1341)GACfs	p.D447fs	TMCC2_uc010prf.1_Frame_Shift_Del_p.D369fs|TMCC2_uc001hca.2_Frame_Shift_Del_p.D222fs|TMCC2_uc001hcb.1_Frame_Shift_Del_p.D207fs|TMCC2_uc001hcc.1_Frame_Shift_Del_p.D68fs|TMCC2_uc001hcd.2_Frame_Shift_Del_p.D214fs	NM_014858	NP_055673	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	447						integral to membrane	protein binding			pancreas(1)	1	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CACCTGAAGGACCCCCTGGAA	0.642													104	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133020743	133020744	+	IGR	INS	-	T	T	rs137914230		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133020743_133020744insT								NCRNA00164 (5201 upstream) : GPR39 (153403 downstream)																							TTAGATAGCTCTTTATTGTCAT	0.327													4	4	---	---	---	---	
HAT1	8520	broad.mit.edu	37	2	172809273	172809273	+	Intron	DEL	T	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172809273delT	uc002uhi.2	+						HAT1_uc010fqi.2_Intron|HAT1_uc002uhj.2_Intron	NM_003642	NP_003633	O14929	HAT1_HUMAN	histone acetyltransferase 1						chromatin silencing at telomere|DNA packaging	cytoplasm|nuclear matrix|nucleoplasm	histone acetyltransferase activity|protein binding			large_intestine(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.216)			TTATTGTAGATTTTTTTTTTA	0.129													4	2	---	---	---	---	
PSMD1	5707	broad.mit.edu	37	2	231943499	231943499	+	Intron	DEL	C	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231943499delC	uc002vrn.1	+						PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GGTTCAAAATCtttttctttt	0.189													31	7	---	---	---	---	
C3orf63	23272	broad.mit.edu	37	3	56661910	56661912	+	Intron	DEL	AAT	-	-	rs145293853		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56661910_56661912delAAT	uc003did.3	-						C3orf63_uc003dib.3_Intron|C3orf63_uc003dic.3_Intron|C3orf63_uc003die.3_Intron	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b											ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		AAGCCACACAAATAATATTCCCA	0.369													7	6	---	---	---	---	
SYNPR	132204	broad.mit.edu	37	3	63466852	63466852	+	Intron	DEL	A	-	-	rs11349566		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63466852delA	uc003dlq.2	+						SYNPR_uc003dlp.2_Intron|SYNPR_uc011bfk.1_Intron|SYNPR_uc011bfl.1_Intron|SYNPR_uc010hnt.2_Intron|SYNPR_uc011bfm.1_Intron	NM_144642	NP_653243	Q8TBG9	SYNPR_HUMAN	synaptoporin isoform 2							cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		GACTCTCCTCAAAAAAAAAGA	0.413													3	3	---	---	---	---	
MAEA	10296	broad.mit.edu	37	4	1321578	1321589	+	Intron	DEL	CCTGGGACGTCC	-	-	rs76610741		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1321578_1321589delCCTGGGACGTCC	uc003gda.2	+						MAEA_uc010ibs.1_Intron|MAEA_uc003gdb.2_Intron|MAEA_uc011bvb.1_Intron|MAEA_uc003gdc.2_Intron|MAEA_uc003gdd.2_Intron|MAEA_uc011bvc.1_Intron|MAEA_uc011bvd.1_Intron|MAEA_uc010ibt.2_Intron|MAEA_uc010ibu.2_5'Flank	NM_001017405	NP_001017405	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher isoform 1						cell adhesion|cell cycle|cell division|erythrocyte maturation|negative regulation of myeloid cell apoptosis|regulation of mitotic cell cycle	actomyosin contractile ring|integral to plasma membrane|membrane fraction|nuclear matrix|spindle	actin binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0201)			TGGTCTGGGTcctgggacgtcccctgggtcgt	0.552													7	4	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48537632	48537633	+	Intron	DEL	AT	-	-	rs78674320	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48537632_48537633delAT	uc003gyh.1	-						FRYL_uc003gyg.1_Intron|FRYL_uc003gyi.1_Intron|FRYL_uc003gyj.1_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						acacacacacatatatatataG	0.213													9	8	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	55087241	55087242	+	Intron	INS	-	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55087241_55087242insA	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	aactccatctcaaaaaaaaaaa	0.213			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	99877753	99877753	+	IGR	DEL	A	-	-	rs33952764		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99877753delA								EIF4E (25967 upstream) : METAP1 (39035 downstream)																							actctgtctcaaaaaaaaaaa	0.169													4	3	---	---	---	---	
NNT	23530	broad.mit.edu	37	5	43651679	43651680	+	Intron	INS	-	A	A	rs112687077		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43651679_43651680insA	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	gactccatctcaaaaaaaaaaa	0.114													3	3	---	---	---	---	
CRHBP	1393	broad.mit.edu	37	5	76264841	76264842	+	3'UTR	DEL	CA	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76264841_76264842delCA	uc003ker.2	+	7						NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein						female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		CGcacgcgcgcacacacacaca	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177398373	177398396	+	IGR	DEL	AGGACGAAGAGCTGGAGAGCGCCA	-	-	rs145131557		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177398373_177398396delAGGACGAAGAGCTGGAGAGCGCCA								LOC728554 (87106 upstream) : PROP1 (20840 downstream)																							GTCCCCGGGGAGGACGAAGAGCTGGAGAGCGCCAAGGACGACGA	0.531													4	2	---	---	---	---	
TMEM14B	81853	broad.mit.edu	37	6	10756864	10756864	+	3'UTR	DEL	A	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10756864delA	uc003mzk.3	+	6					SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jor.2_3'UTR|TMEM14B_uc010jos.1_Intron	NM_030969	NP_112231	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B isoform a							integral to membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				CATTTTACCTAAAAAAAAAAA	0.368													9	4	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32557375	32557376	+	Intron	INS	-	A	A	rs146962428		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32557375_32557376insA	uc003obk.3	-						HLA-DRB1_uc003obp.3_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AAACTCCCTATTTTCCCCACCC	0.480													70	11	---	---	---	---	
LCA5	167691	broad.mit.edu	37	6	80203201	80203203	+	Intron	DEL	GAT	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80203201_80203203delGAT	uc003pix.2	-						LCA5_uc003piy.2_Intron|LCA5_uc011dyq.1_Intron	NM_001122769	NP_001116241	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5						protein transport	cilium axoneme|microtubule basal body	protein binding				0		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		AAGTGCTAAAGATAATATCAGAA	0.232													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22813177	22813178	+	IGR	INS	-	C	C	rs145036723	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22813177_22813178insC								IL6 (41558 upstream) : TOMM7 (39076 downstream)																							TCCTAGATAAGCCCCTACACTC	0.337													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56699456	56699457	+	IGR	INS	-	A	A	rs78077053		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56699456_56699457insA								DKFZp434L192 (134479 upstream) : ZNF479 (487871 downstream)																							ATTCATAGTCCAAAAAAAAAAT	0.292													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659644	57659644	+	IGR	DEL	G	-	-	rs111399871		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659644delG								ZNF716 (126379 upstream) : None (None downstream)																							CATGTTTTTTGTGTTTTTCTT	0.353													7	6	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144532718	144532719	+	Intron	INS	-	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144532718_144532719insA	uc003weq.2	-						TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	GCCTCTGCATTAAAAAAAAAAA	0.490													6	3	---	---	---	---	
FGL1	2267	broad.mit.edu	37	8	17739342	17739343	+	Intron	INS	-	A	A	rs113353024		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17739342_17739343insA	uc003wxx.2	-						FGL1_uc003wxy.2_Intron|FGL1_uc003wxz.2_Intron|FGL1_uc003wya.2_Intron|FGL1_uc003wyb.2_Intron|FGL1_uc003wyc.2_Intron|FGL1_uc003wyd.2_Intron|FGL1_uc003wye.2_Intron|FGL1_uc003wyf.2_Intron	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor						signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		gactccgcctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
LAPTM4B	55353	broad.mit.edu	37	8	98828551	98828551	+	Intron	DEL	C	-	-	rs2331658	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98828551delC	uc003yia.2	+						LAPTM4B_uc010mbg.2_Intron	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4						transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			tttcttttttcttttttttga	0.169													15	7	---	---	---	---	
FPGS	2356	broad.mit.edu	37	9	130567170	130567170	+	Intron	DEL	T	-	-	rs72030539		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130567170delT	uc004bsg.1	+						FPGS_uc004bsh.1_Intron|FPGS_uc011mal.1_Intron|FPGS_uc004bsi.1_Intron	NM_004957	NP_004948	Q05932	FOLC_HUMAN	folylpolyglutamate synthase isoform a precursor						folic acid metabolic process|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|one-carbon metabolic process	cytosol|mitochondrial matrix	ATP binding|tetrahydrofolylpolyglutamate synthase activity				0					L-Glutamic Acid(DB00142)	CAACCTTTAAttttttttttt	0.209													6	3	---	---	---	---	
C11orf42	160298	broad.mit.edu	37	11	6232087	6232088	+	Intron	INS	-	G	G			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6232087_6232088insG	uc001mcj.2	+							NM_173525	NP_775796	Q8N5U0	CK042_HUMAN	hypothetical protein LOC160298											ovary(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGAAAAGCTAGGGGGGGAAAA	0.594													3	3	---	---	---	---	
MRVI1	10335	broad.mit.edu	37	11	10653693	10653694	+	Intron	INS	-	TTTC	TTTC	rs150017434	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10653693_10653694insTTTC	uc010rcc.1	-						MRVI1_uc001miw.2_Intron|MRVI1_uc010rcb.1_Intron|MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron|MRVI1_uc010rce.1_Intron	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		ttctttttctttttctttcttt	0.173													8	5	---	---	---	---	
NUMA1	4926	broad.mit.edu	37	11	71728543	71728544	+	Intron	INS	-	A	A	rs143789109	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71728543_71728544insA	uc001orl.1	-						NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Intron|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Intron|NUMA1_uc001oro.1_Intron|NUMA1_uc009ysy.1_3'UTR|NUMA1_uc001orp.2_3'UTR|NUMA1_uc001orq.2_3'UTR	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1						G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						ATTGACTGGGGAAAAAAAAAAT	0.228			T	RARA	APL								5	4	---	---	---	---	
ACSM4	341392	broad.mit.edu	37	12	7476751	7476752	+	Intron	INS	-	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7476751_7476752insA	uc001qsx.1	+							NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						gactctgtctcaaaaaaaaaaa	0.168													4	3	---	---	---	---	
SLCO1B3	28234	broad.mit.edu	37	12	21201613	21201616	+	Intron	DEL	TATA	-	-	rs72380267		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21201613_21201616delTATA	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron			Q9NPD5	SO1B3_HUMAN	SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					tgtgtgtgtgtatatatTTACAGC	0.172													3	3	---	---	---	---	
C12orf35	55196	broad.mit.edu	37	12	32140361	32140362	+	Intron	INS	-	T	T	rs111427763		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32140361_32140362insT	uc001rks.2	+						C12orf35_uc001rkt.2_Intron	NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196											ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			TATCCATGTTCTTTTTTTTTTT	0.312													4	2	---	---	---	---	
MON2	23041	broad.mit.edu	37	12	62940903	62940907	+	Intron	DEL	AAATA	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62940903_62940907delAAATA	uc001sre.2	+						MON2_uc009zqj.2_Intron|MON2_uc010ssl.1_Intron|MON2_uc010ssm.1_Intron|MON2_uc010ssn.1_Intron|MON2_uc001srf.2_Intron	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		aataaaatataaataaaataaaatT	0.298													6	5	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94697470	94697470	+	Intron	DEL	T	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94697470delT	uc001tdc.2	+						PLXNC1_uc010sut.1_Intron|PLXNC1_uc009zsv.2_Intron	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						TTCCTCCAtcttttttttttt	0.308													5	4	---	---	---	---	
ALDH1L2	160428	broad.mit.edu	37	12	105454605	105454606	+	Intron	INS	-	AAAA	AAAA	rs138423773		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105454605_105454606insAAAA	uc001tlc.2	-						ALDH1L2_uc009zuo.2_Intron|ALDH1L2_uc009zup.2_Intron	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2						10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						tccatctcaggaaaaaaaaaaa	0.153													3	3	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118505999	118506000	+	Intron	INS	-	T	T	rs71450255		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118505999_118506000insT	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						gctaatttttcttttttttttt	0.000													3	3	---	---	---	---	
A2LD1	87769	broad.mit.edu	37	13	101192070	101192070	+	Intron	DEL	T	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101192070delT	uc001vor.2	-							NM_033110	NP_149101	Q9BVM4	A2LD1_HUMAN	AIG2-like domain 1						cellular modified amino acid catabolic process		acyltransferase activity|gamma-glutamylcyclotransferase activity				0						ggtcctgggcttttttttttt	0.154													3	3	---	---	---	---	
FUT8	2530	broad.mit.edu	37	14	66135889	66135890	+	Intron	INS	-	A	A			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66135889_66135890insA	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron|FUT8_uc001xis.2_5'Flank	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		gatgaaagattaaaaaaaaaaa	0.183													5	3	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40949220	40949220	+	Intron	DEL	T	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40949220delT	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		CTGCttttgcttttttttttc	0.109													4	2	---	---	---	---	
SLC30A4	7782	broad.mit.edu	37	15	45814243	45814246	+	Frame_Shift_Del	DEL	TCTC	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45814243_45814246delTCTC	uc001zvj.2	-	2	619_622	c.307_310delGAGA	c.(307-312)GAGATAfs	p.E103fs	C15orf21_uc010beg.1_Intron|C15orf21_uc010beh.1_Intron|C15orf21_uc010bei.1_Intron|C15orf21_uc010bej.1_Intron|C15orf21_uc001zvm.1_Intron|C15orf21_uc001zvn.1_Intron	NM_013309	NP_037441	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter),	103_104	Cytoplasmic (Potential).				regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity				0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		TGCTTCAGTATCTCTCTCTGTTTG	0.475													159	30	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	54008966	54008967	+	Intron	INS	-	GTGCTGCACTTAAGT	GTGCTGCACTTAAGT	rs139178626	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54008966_54008967insGTGCTGCACTTAAGT	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		GTTTTTCTTTAGCAGCCTGATC	0.371													17	8	---	---	---	---	
RUNDC2A	84127	broad.mit.edu	37	16	12142009	12142009	+	Intron	DEL	T	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12142009delT	uc002dbw.1	+							NM_032167	NP_115543	Q9HA26	RUN2A_HUMAN	RUN domain containing 2A											ovary(1)	1						TCATGGGAGGttttttttttt	0.264			T	CIITA	PMBL|Hodgkin Lymphona|								5	3	---	---	---	---	
NECAB2	54550	broad.mit.edu	37	16	84034564	84034565	+	Intron	INS	-	GGTGGAG	GGTGGAG	rs144191894	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84034564_84034565insGGTGGAG	uc002fhd.2	+						NECAB2_uc002fhe.2_Intron	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2						CAGTAAACCCTGGTGGAGGCAG	0.609													5	3	---	---	---	---	
CA5A	763	broad.mit.edu	37	16	87926752	87926752	+	Intron	DEL	C	-	-	rs7195622	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87926752delC	uc002fkn.1	-							NM_001739	NP_001730	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial precursor						one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0513)		ttctttctttctttttttttt	0.184													4	2	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3013987	3013987	+	Intron	DEL	T	-	-	rs67060467		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3013987delT	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron|TLE2_uc010xhd.1_Intron	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gtaaaatgtattttttttttt	0.124													5	3	---	---	---	---	
ZNF560	147741	broad.mit.edu	37	19	9582180	9582181	+	Intron	INS	-	T	T	rs151172823	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9582180_9582181insT	uc002mlp.1	-						ZNF560_uc010dwr.1_Intron	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						AGAAAGCTAAATTGAACATTTA	0.213													5	3	---	---	---	---	
AKAP8	10270	broad.mit.edu	37	19	15473194	15473195	+	Intron	INS	-	TT	TT	rs12980485		TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15473194_15473195insTT	uc002nav.2	-						AKAP8_uc010dzy.2_Intron|AKAP8_uc010dzz.1_Intron|AKAP8_uc010xog.1_Intron	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8						signal transduction	nuclear matrix				ovary(1)|breast(1)	2						ctctccctctccccacggtctc	0.198													6	4	---	---	---	---	
PRPF6	24148	broad.mit.edu	37	20	62648293	62648293	+	Intron	DEL	T	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62648293delT	uc002yho.2	+						PRPF6_uc002yhp.2_Intron	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					TTTAAAACtcttttttttttt	0.224													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25627898	25627899	+	IGR	INS	-	GA	GA	rs5760929	by1000genomes	TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25627898_25627899insGA								CRYBB2 (62 upstream) : IGLL3 (85989 downstream)																							tgtgtgtgtgtgagagagagag	0.307													4	2	---	---	---	---	
TBL1X	6907	broad.mit.edu	37	X	9622195	9622195	+	Intron	DEL	A	-	-			TCGA-G9-6371-01	TCGA-G9-6371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9622195delA	uc010ndq.2	+						TBL1X_uc004csq.3_Intron|TBL1X_uc010ndr.2_Intron|TBL1X_uc004csr.2_Intron	NM_001139466	NP_001132938	O60907	TBL1X_HUMAN	transducin beta-like 1X isoform a						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Hepatocellular(5;0.000888)				TAGTCATCTCAAAAAAAAAAA	0.308													4	2	---	---	---	---	
