Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIF1B	23095	broad.mit.edu	37	1	10363477	10363477	+	Intron	SNP	A	T	T			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10363477A>T	uc001aqx.3	+						KIF1B_uc001aqv.3_Missense_Mutation_p.Y745F|KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GAGATTTGCTATGAGGTTGCT	0.438													6	71	---	---	---	---	PASS
AKIRIN1	79647	broad.mit.edu	37	1	39466670	39466670	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39466670C>A	uc001ccw.2	+	3	525	c.388C>A	c.(388-390)CCC>ACC	p.P130T	AKIRIN1_uc010oip.1_Intron|AKIRIN1_uc010oiq.1_Missense_Mutation_p.P83T	NM_024595	NP_078871	Q9H9L7	AKIR1_HUMAN	akirin 1 isoform 1	130						nucleus					0						GAAGGACCAGCCCACATTTAC	0.323													8	130	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152326999	152326999	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152326999C>T	uc001ezw.3	-	3	3336	c.3263G>A	c.(3262-3264)GGC>GAC	p.G1088D	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1088	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGACCATAGCCAGATGATTG	0.498													11	381	---	---	---	---	PASS
GPR37L1	9283	broad.mit.edu	37	1	202092707	202092707	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202092707G>A	uc001gxj.2	+	1	679	c.616G>A	c.(616-618)GTG>ATG	p.V206M		NM_004767	NP_004758	O60883	ETBR2_HUMAN	G-protein coupled receptor 37 like 1 precursor	206	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2						TTGTCGTGCCGTGCCCTTCAT	0.522													6	150	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228481211	228481211	+	Silent	SNP	C	T	T			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228481211C>T	uc009xez.1	+	41	11069	c.11025C>T	c.(11023-11025)GAC>GAT	p.D3675D	OBSCN_uc001hsn.2_Silent_p.D3675D|OBSCN_uc001hsq.1_Silent_p.D931D	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	3675	Ig-like 37.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				TGAGGCAGGACGGGGCCAGGT	0.652													4	81	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685655	248685655	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685655G>C	uc001ien.1	+	1	708	c.708G>C	c.(706-708)AAG>AAC	p.K236N		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCCGCCAAAAGGCCTTTGGGA	0.458													17	65	---	---	---	---	PASS
DDX11L2	84771	broad.mit.edu	37	2	114357543	114357543	+	3'UTR	SNP	T	A	A	rs114684815	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114357543T>A	uc010yxx.1	-	3										SubName: Full=DEAD/H box polypeptide 11 like 2;												0						CCTGTCAGGATGAGGCCTACT	0.572													4	16	---	---	---	---	PASS
DDX11L2	84771	broad.mit.edu	37	2	114357557	114357557	+	Nonstop_Mutation	SNP	A	G	G	rs115341812	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114357557A>G	uc010yxx.1	-	3	709	c.382T>C	c.(382-384)TAG>CAG	p.*128Q						SubName: Full=DEAD/H box polypeptide 11 like 2;												0						GCCTACTTCTAGTGAAACTGG	0.567													4	17	---	---	---	---	PASS
PRICKLE2	166336	broad.mit.edu	37	3	64084858	64084858	+	Nonsense_Mutation	SNP	G	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64084858G>A	uc003dmf.2	-	8	2990	c.2404C>T	c.(2404-2406)CGA>TGA	p.R802*		NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN	prickle-like 2	802						cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GTGACGTATCGCAGGCGCGCT	0.552													4	91	---	---	---	---	PASS
NR1I2	8856	broad.mit.edu	37	3	119531666	119531666	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119531666A>G	uc003edj.2	+	5	2492	c.653A>G	c.(652-654)GAG>GGG	p.E218G	NR1I2_uc003edi.2_Missense_Mutation_p.E181G|NR1I2_uc003edk.2_Missense_Mutation_p.E257G|NR1I2_uc003edl.2_Missense_Mutation_p.E106G	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	218	Ligand-binding.				drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	CTGCGGGGGGAGGATGGCAGT	0.582													3	88	---	---	---	---	PASS
AMBN	258	broad.mit.edu	37	4	71472192	71472192	+	Silent	SNP	C	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71472192C>A	uc003hfl.2	+	13	1164	c.1089C>A	c.(1087-1089)GGC>GGA	p.G363G		NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor	363					bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			ACATTCCCGGCCTGCCAAGGA	0.557													3	37	---	---	---	---	PASS
PCDHGB7	56099	broad.mit.edu	37	5	140798766	140798766	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140798766A>G	uc003lkn.1	+	1	1485	c.1340A>G	c.(1339-1341)GAC>GGC	p.D447G	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.D447G|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	447	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGTCAATGACAACGCGCCG	0.572													7	54	---	---	---	---	PASS
HIST1H2BK	85236	broad.mit.edu	37	6	27114573	27114573	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27114573G>A	uc003nix.1	-	1	47	c.5C>T	c.(4-6)CCG>CTG	p.P2L	HIST1H2AH_uc003niz.2_5'Flank|hsa-mir-3143|MI0014167_5'Flank	NM_080593	NP_542160	O60814	H2B1K_HUMAN	histone cluster 1, H2bk	2					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding				0						CGCTGGTTCCGGCATGTTGAA	0.567													3	76	---	---	---	---	PASS
NOTCH4	4855	broad.mit.edu	37	6	32163814	32163814	+	Silent	SNP	C	T	T			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32163814C>T	uc003obb.2	-	30	5551	c.5412G>A	c.(5410-5412)GCG>GCA	p.A1804A	GPSM3_uc003oaz.2_5'Flank|NOTCH4_uc011dpt.1_Missense_Mutation_p.G181R|NOTCH4_uc003oba.2_Silent_p.A464A|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA|NOTCH4_uc011dpw.1_3'UTR	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	1804	Cytoplasmic (Potential).				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						GAGCGACGTCCGCCGGCGCTA	0.701													3	11	---	---	---	---	PASS
TTBK1	84630	broad.mit.edu	37	6	43251485	43251485	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43251485C>G	uc003ouq.1	+	14	3286	c.3007C>G	c.(3007-3009)CGG>GGG	p.R1003G		NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	1003						cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TGGGGCCCCCCGGGAAACCCC	0.697													3	39	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87943091	87943091	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87943091T>A	uc003plm.3	+	5	628	c.587T>A	c.(586-588)ATT>AAT	p.I196N		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	196					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GATATGAGAATTAAACATCTA	0.313													3	69	---	---	---	---	PASS
TGS1	96764	broad.mit.edu	37	8	56686143	56686143	+	5'UTR	SNP	G	C	C			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56686143G>C	uc003xsj.3	+	1					TMEM68_uc003xsh.1_5'Flank|TMEM68_uc003xsi.1_5'Flank|TGS1_uc010lyh.2_5'UTR	NM_024831	NP_079107	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase homolog						cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity			ovary(1)|lung(1)|breast(1)	3		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			CGCGACCCGGGCTGCGTACGT	0.617													8	31	---	---	---	---	PASS
SMU1	55234	broad.mit.edu	37	9	33056918	33056918	+	Silent	SNP	C	T	T			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33056918C>T	uc003zsf.1	-	8	1020	c.912G>A	c.(910-912)AGG>AGA	p.R304R	SMU1_uc010mjo.1_Silent_p.R304R|SMU1_uc010mjp.1_Silent_p.R304R|SMU1_uc011lnu.1_Silent_p.R143R	NM_018225	NP_060695	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog	304						cytoplasm|nucleus				ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		TACTGTGTGCCCTCTCAAATC	0.353													12	174	---	---	---	---	PASS
APBB1	322	broad.mit.edu	37	11	6432291	6432291	+	Missense_Mutation	SNP	G	A	A	rs138898127	byFrequency	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6432291G>A	uc001mdb.1	-	2	387	c.287C>T	c.(286-288)GCG>GTG	p.A96V	APBB1_uc001mdc.1_Missense_Mutation_p.A96V|APBB1_uc010rah.1_Intron	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	96					apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		GGCCTCCTCCGCCAAGGTCAA	0.632													10	308	---	---	---	---	PASS
PRKAG1	5571	broad.mit.edu	37	12	49398646	49398646	+	Intron	SNP	C	G	G			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49398646C>G	uc001rsy.2	-						uc001rsw.2_Intron|PRKAG1_uc010smd.1_Intron|PRKAG1_uc001rsx.2_Intron|PRKAG1_uc001rsz.2_Intron|PRKAG1_uc009zlb.2_Intron|PRKAG1_uc010sme.1_3'UTR	NM_002733	NP_002724	P54619	AAKG1_HUMAN	AMP-activated protein kinase, noncatalytic						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|positive regulation of protein kinase activity|regulation of fatty acid oxidation|regulation of glycolysis|spermatogenesis	cytosol	cAMP-dependent protein kinase activity|cAMP-dependent protein kinase regulator activity|protein kinase binding			kidney(1)	1						gtgtgtgtgtCTTTTCTCTCT	0.244													5	50	---	---	---	---	PASS
SPATS2	65244	broad.mit.edu	37	12	49918663	49918663	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49918663A>C	uc001rud.2	+	13	2299	c.1310A>C	c.(1309-1311)TAC>TCC	p.Y437S	SPATS2_uc001rue.2_RNA|SPATS2_uc009zli.1_Missense_Mutation_p.Y437S|SPATS2_uc001ruf.2_Missense_Mutation_p.Y437S|SPATS2_uc001rug.2_Missense_Mutation_p.Y437S	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	437						cytoplasm				breast(1)	1						GGCCAGCCCTACCAGCCACTT	0.488													6	44	---	---	---	---	PASS
CTDSP2	10106	broad.mit.edu	37	12	58223322	58223322	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58223322A>G	uc001sqm.2	-	2	651	c.122T>C	c.(121-123)CTT>CCT	p.L41P	CTDSP2_uc009zqf.2_5'UTR|CTDSP2_uc009zqg.2_Intron	NM_005730	NP_005721	O14595	CTDS2_HUMAN	nuclear LIM interactor-interacting factor 2	41					protein dephosphorylation	nucleus|soluble fraction	CTD phosphatase activity|metal ion binding			central_nervous_system(1)	1	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					ACAGCAGAAAAGGGCCTTGAA	0.532													3	123	---	---	---	---	PASS
LGR5	8549	broad.mit.edu	37	12	71977709	71977709	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71977709T>C	uc001swl.2	+	18	1967	c.1919T>C	c.(1918-1920)ATT>ACT	p.I640T	LGR5_uc001swm.2_Missense_Mutation_p.I616T|LGR5_uc001swn.1_Intron	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	640	Helical; Name=3; (Potential).					integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						TGCCATGTCATTGGTTTTTTG	0.493													21	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22392250	22392250	+	Intron	SNP	C	T	T	rs17182937	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22392250C>T	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_5'Flank|uc010aiz.2_5'UTR					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CCAGGTTCACCTCACAGTACA	0.438													3	5	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	58896079	58896079	+	Splice_Site	SNP	A	G	G			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58896079A>G	uc001xdv.3	+	2	473	c.200_splice	c.e2-2	p.G67_splice	KIAA0586_uc010trr.1_Splice_Site_p.G67_splice|KIAA0586_uc001xdt.3_Splice_Site|KIAA0586_uc001xdu.3_Splice_Site_p.G52_splice|KIAA0586_uc010trs.1_Splice_Site|TIMM9_uc010aph.2_5'Flank|TIMM9_uc001xds.2_5'Flank|TIMM9_uc010api.2_5'Flank	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein											ovary(1)	1						TTGTTTTGTTAGGTTCATCAG	0.323													3	106	---	---	---	---	PASS
MNS1	55329	broad.mit.edu	37	15	56757215	56757215	+	5'UTR	SNP	A	C	C			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56757215A>C	uc002adr.2	-	1					MNS1_uc010bfo.2_5'Flank	NM_018365	NP_060835	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1						meiosis					ovary(1)	1				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		CGCGGCCACCACCTCCCGCCG	0.602													6	31	---	---	---	---	PASS
ANXA2	302	broad.mit.edu	37	15	60643411	60643411	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60643411C>A	uc002agn.2	-	12	978	c.818G>T	c.(817-819)CGG>CTG	p.R273L	ANXA2_uc002agk.2_Missense_Mutation_p.R273L|ANXA2_uc002agl.2_Missense_Mutation_p.R273L|ANXA2_uc002agm.2_Missense_Mutation_p.R291L|ANXA2_uc010uhd.1_Intron	NM_001136015	NP_001129487	P07355	ANXA2_HUMAN	annexin A2 isoform 2	273					angiogenesis|positive regulation of vesicle fusion|skeletal system development	basement membrane|melanosome|midbody|soluble fraction	calcium ion binding|calcium-dependent phospholipid binding|cytoskeletal protein binding|phospholipase inhibitor activity			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Tenecteplase(DB00031)	GTCATACAGCCGATCAGCAAA	0.498													3	84	---	---	---	---	PASS
GOLGA6B	55889	broad.mit.edu	37	15	72954595	72954595	+	Missense_Mutation	SNP	A	G	G	rs143576794	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72954595A>G	uc010uks.1	+	11	891	c.850A>G	c.(850-852)AAG>GAG	p.K284E		NM_018652	NP_061122	A6NDN3	GOG6B_HUMAN	golgi autoantigen, golgin subfamily a, 6B	284	Potential.										0						TTTCTCAGCTAAGCCCCCATC	0.522													3	95	---	---	---	---	PASS
SLC7A5P2	387254	broad.mit.edu	37	16	21531111	21531111	+	Silent	SNP	T	C	C	rs7197243	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21531111T>C	uc002djd.2	-	1	655	c.576A>G	c.(574-576)GTA>GTG	p.V192V	uc002diq.3_Intron|LOC100271836_uc002dja.2_Intron|LOC100271836_uc002djb.2_Intron	NR_002594				RecName: Full=Putative L-type amino acid transporter 1-like protein MLAS; AltName: Full=hLAT1 3-transmembrane protein MLAS;          Short=hLAT1 3TM MLAS;												0						ACCCAGGGACTACGACCTCCC	0.652													3	14	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904114	21904114	+	RNA	SNP	A	G	G	rs75848292		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904114A>G	uc002gza.2	+	1		c.53A>G				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						tccggctgccaggagtcgcaa	0.000													4	33	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630962	44630962	+	3'UTR	SNP	G	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630962G>A	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						tcagcctcccgagtagctggg	0.040													4	2	---	---	---	---	PASS
NFE2L1	4779	broad.mit.edu	37	17	46128887	46128887	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46128887C>A	uc002imz.3	+	2	1058	c.407C>A	c.(406-408)CCA>CAA	p.P136Q	NFE2L1_uc002ina.3_Missense_Mutation_p.P136Q|NFE2L1_uc002inb.3_Missense_Mutation_p.P136Q|NFE2L1_uc002inc.1_Missense_Mutation_p.P136Q	NM_003204	NP_003195	Q14494	NF2L1_HUMAN	nuclear factor erythroid 2-like 1	136	Asp/Glu-rich (acidic).				anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1						GTGACAGGCCCAGACAACGGG	0.592													4	88	---	---	---	---	PASS
MAP2K2	5605	broad.mit.edu	37	19	4102449	4102449	+	Silent	SNP	G	A	A	rs17851657	byFrequency	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4102449G>A	uc002lzk.2	-	4	707	c.453C>T	c.(451-453)GAC>GAT	p.D151D	MAP2K2_uc002lzj.2_Translation_Start_Site	NM_030662	NP_109587	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	151	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|extracellular region	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGAGCCGCCGTCCTAGAGGG	0.662									Cardiofaciocutaneous_syndrome				3	8	---	---	---	---	PASS
ZNF562	54811	broad.mit.edu	37	19	9771402	9771402	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9771402A>T	uc010xks.1	-	2	182	c.19T>A	c.(19-21)TCC>ACC	p.S7T	ZNF562_uc002mly.2_Missense_Mutation_p.S7T|ZNF562_uc002mlx.2_Missense_Mutation_p.S7T|ZNF562_uc010xkt.1_5'UTR|ZNF562_uc010xku.1_Intron|ZNF562_uc010xkv.1_Missense_Mutation_p.S7T|ZNF562_uc010xkw.1_5'UTR	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a	7					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTACCATGGGACATATCAAAG	0.488													5	213	---	---	---	---	PASS
CCDC105	126402	broad.mit.edu	37	19	15131324	15131324	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15131324C>A	uc002nae.2	+	3	826	c.727C>A	c.(727-729)CAA>AAA	p.Q243K		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	243					microtubule cytoskeleton organization	microtubule				ovary(1)	1						GGAGCGGCTCCAAGCCGTGGA	0.617													4	39	---	---	---	---	PASS
LSR	51599	broad.mit.edu	37	19	35739708	35739708	+	5'UTR	SNP	T	G	G			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35739708T>G	uc002nyl.2	+	1					LSR_uc002nym.2_5'UTR|LSR_uc002nyn.2_5'UTR|LSR_uc002nyo.2_5'UTR|LSR_uc010xsr.1_5'UTR|LSR_uc002nyp.2_5'Flank	NM_205834	NP_991403	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor						embryo development|liver development	chylomicron|integral to membrane|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle	receptor activity				0	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCGCGGCGGGTCAAGCACCTT	0.602													4	12	---	---	---	---	PASS
ZNF766	90321	broad.mit.edu	37	19	52793389	52793389	+	Silent	SNP	G	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52793389G>A	uc002pyr.1	+	4	388	c.345G>A	c.(343-345)CAG>CAA	p.Q115Q	ZNF766_uc002pys.1_3'UTR|ZNF766_uc002pyt.1_Silent_p.Q130Q	NM_001010851	NP_001010851	Q5HY98	ZN766_HUMAN	zinc finger protein 766	115					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		TAACCTTTCAGTTACCTCTGC	0.398													4	67	---	---	---	---	PASS
C20orf114	92747	broad.mit.edu	37	20	31873852	31873852	+	5'UTR	SNP	C	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31873852C>A	uc002wyw.1	+	2					C20orf114_uc010gej.1_5'UTR	NM_033197	NP_149974	Q8TDL5	LPLC1_HUMAN	LPLUNC1 protein precursor							extracellular space	lipid binding			central_nervous_system(2)|skin(2)	4						TGGCATCCTGCACTTGCTGCC	0.647													3	31	---	---	---	---	PASS
ASPHD2	57168	broad.mit.edu	37	22	26829759	26829759	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26829759G>A	uc003acg.2	+	2	575	c.178G>A	c.(178-180)GCT>ACT	p.A60T		NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	60	Helical; (Potential).				peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						CGACACCACCGCTGTCATCAC	0.647													4	91	---	---	---	---	PASS
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	A	A	rs143435240	byFrequency	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51076024G>A	uc004dph.2	+	2	427	c.207G>A	c.(205-207)GAG>GAA	p.E69E	NUDT10_uc004dpi.3_Silent_p.E69E	NM_153183	NP_694853	Q8NFP7	NUD10_HUMAN	nudix-type motif 10	69	Nudix box.|Nudix hydrolase.	Magnesium 1 (By similarity).				cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657													3	33	---	---	---	---	PASS
ASAP3	55616	broad.mit.edu	37	1	23758498	23758498	+	Intron	DEL	T	-	-	rs143586833		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23758498delT	uc001bha.2	-						ASAP3_uc001bgy.1_Intron|ASAP3_uc001bgz.1_Intron|ASAP3_uc010odz.1_Intron|ASAP3_uc010oea.1_Intron|ASAP3_uc001bhb.2_Intron	NM_017707	NP_060177	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	cytoplasm	ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						GCCTCTAGGAttttttttttt	0.214													4	2	---	---	---	---	
NFIA	4774	broad.mit.edu	37	1	61921199	61921199	+	3'UTR	DEL	A	-	-	rs74089375		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61921199delA	uc001czw.2	+	11					NFIA_uc001czy.2_3'UTR|NFIA_uc010oos.1_3'UTR|NFIA_uc001czv.2_3'UTR|NFIA_uc001czx.2_3'UTR|NFIA_uc009wae.2_RNA	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						TTTTTTTTTTAAAATACTTTA	0.378													4	2	---	---	---	---	
SNX27	81609	broad.mit.edu	37	1	151664882	151664883	+	Intron	INS	-	T	T	rs71740107		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151664882_151664883insT	uc001eyn.1	+						SNX27_uc001eyo.2_Intron|SNX27_uc001eyp.2_Intron	NM_030918	NP_112180	Q96L92	SNX27_HUMAN	sorting nexin family member 27						cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTTCTCCTTCCttttttttttt	0.366													8	4	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153790790	153790790	+	Intron	DEL	C	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790790delC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCAAGGttttctttttttttt	0.189													2	5	---	---	---	---	
C1orf55	163859	broad.mit.edu	37	1	226180816	226180817	+	Intron	INS	-	T	T	rs66975923		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226180816_226180817insT	uc001hpu.3	-						C1orf55_uc001hpv.2_Intron	NM_152608	NP_689821	Q6IQ49	CA055_HUMAN	hypothetical protein LOC163859											lung(1)	1	Breast(184;0.197)					TACTTTCTTTCTTTTTTTTTTT	0.302													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237819091	237819091	+	Intron	DEL	T	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237819091delT	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CATATAGTAATTTTTTTTTTT	0.418													6	3	---	---	---	---	
OR2L13	284521	broad.mit.edu	37	1	248167485	248167486	+	Intron	INS	-	A	A			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248167485_248167486insA	uc001ids.2	+							NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			ATCAACAGAAGAAAAAAAAATC	0.297													4	2	---	---	---	---	
USP37	57695	broad.mit.edu	37	2	219352921	219352921	+	Intron	DEL	G	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219352921delG	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		aaaaaaaaaagaaaagaaAAG	0.104													9	7	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CATGTGTGGAGTTTTATAACTC	0.589													4	4	---	---	---	---	
CPB1	1360	broad.mit.edu	37	3	148562682	148562682	+	Intron	DEL	A	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148562682delA	uc003ewl.2	+							NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTCTAAAAGCACCAAAAAAAA	0.144													4	2	---	---	---	---	
FAM194A	131831	broad.mit.edu	37	3	150403420	150403420	+	Intron	DEL	T	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150403420delT	uc003eyg.2	-						FAM194A_uc003eyh.2_Intron	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN	hypothetical protein LOC131831											skin(2)|ovary(1)	3						GCTCTTTGGCTTTTTTTTTTT	0.184													4	4	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123159136	123159137	+	Intron	INS	-	A	A	rs11455945		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123159136_123159137insA	uc003ieh.2	+						KIAA1109_uc003iei.1_Intron|KIAA1109_uc010ins.1_Intron|KIAA1109_uc003iek.2_5'Flank	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						gactccatctcaaaaaaaaaaa	0.124													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	70422906	70422906	+	Intron	DEL	T	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70422906delT	uc010iyn.2	-											Homo sapiens cDNA FLJ78390 complete cds.																		ATTATCTGACttttttttttt	0.189													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32523362	32523363	+	Intron	INS	-	GATA	GATA	rs142676080	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32523362_32523363insGATA	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron|HLA-DRB6_uc003obo.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AAAGCAATGTGGATAAAGGGAC	0.431													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65226569	65226569	+	Intron	DEL	T	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226569delT	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		gcccggccCCttttttttttt	0.149													3	3	---	---	---	---	
ASZ1	136991	broad.mit.edu	37	7	117020837	117020838	+	Intron	INS	-	AAAAAC	AAAAAC	rs147516910	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117020837_117020838insAAAAAC	uc003vjb.2	-						ASZ1_uc011kno.1_Intron|ASZ1_uc011knp.1_Intron	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper						cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			GACAATCTGAAAAAAACAAAAA	0.282													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	43998495	43998495	+	IGR	DEL	C	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43998495delC								FAM75A6 (367765 upstream) : FAM27C (991741 downstream)																							GCTCCCGGGACCCAGCGGCAC	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99258675	99258676	+	IGR	INS	-	ACC	ACC	rs142356622	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99258675_99258676insACC								HABP4 (5058 upstream) : CDC14B (3721 downstream)																							GCGCTGTACTTaccaccaccac	0.515													16	7	---	---	---	---	
COL27A1	85301	broad.mit.edu	37	9	117067079	117067080	+	Intron	DEL	GG	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117067079_117067080delGG	uc011lxl.1	+						COL27A1_uc004bii.2_Intron|COL27A1_uc011lxn.1_5'Flank	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor						cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						TGGTCTTGGTGGCATCTCGCAT	0.342													2	6	---	---	---	---	
STAM	8027	broad.mit.edu	37	10	17747904	17747905	+	Intron	INS	-	A	A	rs147657165		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17747904_17747905insA	uc001ipj.1	+						STAM_uc009xjw.1_Intron	NM_003473	NP_003464	Q92783	STAM1_HUMAN	signal transducing adaptor molecule 1						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity			large_intestine(1)|ovary(1)	2						ctgtctctaccaaaaaaaaaaa	0.000													5	3	---	---	---	---	
ZNF365	22891	broad.mit.edu	37	10	64425757	64425757	+	Intron	DEL	A	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64425757delA	uc001jmd.1	+						ZNF365_uc001jmc.2_Intron|ZNF365_uc001jme.1_Intron|ZNF365_uc001jmf.1_Intron|ZNF365_uc009xpg.1_Intron	NM_199452	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform D											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					TATTCCCTCGaaaaaaaaaag	0.318													4	2	---	---	---	---	
ASCC1	51008	broad.mit.edu	37	10	73949582	73949582	+	Intron	DEL	G	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73949582delG	uc001jst.1	-						ASCC1_uc001jsr.1_Intron|ASCC1_uc001jss.1_Intron|ASCC1_uc001jsu.1_Intron|ASCC1_uc010qju.1_Intron			Q8N9N2	ASCC1_HUMAN	RecName: Full=Activating signal cointegrator 1 complex subunit 1; AltName: Full=ASC-1 complex subunit p50; AltName: Full=Trip4 complex subunit p50;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	RNA binding				0						aaaaaaaaaagaaCCAAAGAC	0.179													5	3	---	---	---	---	
PNLIP	5406	broad.mit.edu	37	10	118307590	118307591	+	Intron	DEL	CA	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118307590_118307591delCA	uc001lcm.2	+							NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	Tacacacacgcacacacacaca	0.144													4	2	---	---	---	---	
VAX1	11023	broad.mit.edu	37	10	118897632	118897632	+	5'UTR	DEL	C	-	-	rs56950787		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118897632delC	uc009xyx.2	-	1					VAX1_uc001ldb.1_5'UTR	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)		GGGGGGGGGGCGGAGAAGGAA	0.438													4	2	---	---	---	---	
KIAA0652	9776	broad.mit.edu	37	11	46666872	46666873	+	Intron	INS	-	T	T			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46666872_46666873insT	uc009yld.2	+						KIAA0652_uc001nda.2_Intron|KIAA0652_uc001ndb.2_Intron|KIAA0652_uc001ncz.2_Intron|KIAA0652_uc001ndc.2_Intron|KIAA0652_uc010rgv.1_Intron	NM_001142673	NP_001136145	O75143	ATG13_HUMAN	autophagy-related protein 13 isoform 1						autophagic vacuole assembly	cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding				0				GBM - Glioblastoma multiforme(35;0.226)		TTTCTTTTGTGTTTTTTTTTTC	0.386													50	8	---	---	---	---	
INTS4	92105	broad.mit.edu	37	11	77633293	77633293	+	Intron	DEL	G	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77633293delG	uc001oys.2	-						INTS4_uc001oyt.2_Intron	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			aaaaaaaaaagaaagaaaaGC	0.219													4	2	---	---	---	---	
RPS25	6230	broad.mit.edu	37	11	118887969	118887969	+	Intron	DEL	T	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118887969delT	uc001pun.2	-						TRAPPC4_uc010ryn.1_5'Flank|TRAPPC4_uc010ryo.1_5'Flank|TRAPPC4_uc010ryp.1_5'Flank|TRAPPC4_uc001pup.2_5'Flank|TRAPPC4_uc010ryq.1_5'Flank	NM_001028	NP_001019	P62851	RS25_HUMAN	ribosomal protein S25						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		CAAGCCACGCTTTTTTTTTTT	0.328													7	4	---	---	---	---	
MDM1	56890	broad.mit.edu	37	12	68714952	68714953	+	Intron	INS	-	A	A	rs147010270	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68714952_68714953insA	uc001stz.2	-						MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_Intron	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1							nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		CCAGTGGCATTAAAAAAAATGA	0.252													3	3	---	---	---	---	
PLCG2	5336	broad.mit.edu	37	16	81954997	81954997	+	Intron	DEL	T	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81954997delT	uc002fgt.2	+						PLCG2_uc010chg.1_Frame_Shift_Del_p.N810fs	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2						intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						GCCaaaataattttttttttt	0.368													3	4	---	---	---	---	
HSBP1	3281	broad.mit.edu	37	16	83843057	83843057	+	Intron	DEL	C	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83843057delC	uc002fgy.1	+							NM_001537	NP_001528	O75506	HSBP1_HUMAN	heat shock factor binding protein 1						negative regulation of transcription from RNA polymerase II promoter	nucleus	transcription corepressor activity				0		all_cancers(2;0.00573)|all_epithelial(2;0.0309)		BRCA - Breast invasive adenocarcinoma(80;0.0404)		ttttttttttcttttcttttc	0.229													4	2	---	---	---	---	
ABCA8	10351	broad.mit.edu	37	17	66872445	66872446	+	Intron	INS	-	T	T	rs4148026		TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66872445_66872446insT	uc002jhp.2	-						ABCA8_uc002jhq.2_Intron|ABCA8_uc010wqq.1_Intron	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					AGGGAAAGATCTTTTTTTTTTG	0.332													4	2	---	---	---	---	
AFG3L2	10939	broad.mit.edu	37	18	12337643	12337645	+	Intron	DEL	CAG	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12337643_12337645delCAG	uc002kqz.1	-							NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2						cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	TCTGTGTAGCcagcagcagcagc	0.384													6	3	---	---	---	---	
NOTCH3	4854	broad.mit.edu	37	19	15277008	15277010	+	Intron	DEL	ACA	-	-	rs67064330	by1000genomes	TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15277008_15277010delACA	uc002nan.2	-							NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor						Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TGGAAAAATGACAATTAGCAGAT	0.310													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085531	11085533	+	Intron	DEL	AAA	-	-			TCGA-G9-6385-01	TCGA-G9-6385-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085531_11085533delAAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		caccaccactaaaaccacgacca	0.000													4	2	---	---	---	---	
