Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AADACL4	343066	broad.mit.edu	37	1	12726317	12726317	+	Silent	SNP	C	T	T	rs58218425	byFrequency	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12726317C>T	uc001auf.2	+	4	795	c.795C>T	c.(793-795)GAC>GAT	p.D265D		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	265	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CCTGGCGTGACGCCATCTTGA	0.502													12	279	---	---	---	---	PASS
FAM189B	10712	broad.mit.edu	37	1	155218031	155218031	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155218031G>A	uc001fjm.2	-	11	2249	c.1643C>T	c.(1642-1644)GCC>GTC	p.A548V	RAG1AP1_uc010pey.1_Intron|FAM189B_uc009wql.2_Missense_Mutation_p.A350V|FAM189B_uc001fjn.2_Missense_Mutation_p.A452V|FAM189B_uc001fjo.2_Missense_Mutation_p.A530V|FAM189B_uc001fjp.2_RNA	NM_006589	NP_006580	P81408	F189B_HUMAN	hypothetical protein LOC10712 isoform a	548						integral to membrane	WW domain binding			ovary(1)|breast(1)	2						GGCTGACCGGGCACGTAGCAA	0.627													3	48	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176762740	176762740	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176762740G>A	uc001gkz.2	+	20	6229	c.5065G>A	c.(5065-5067)GTG>ATG	p.V1689M	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1689	Sushi 5.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CAGTGACCCCGTGATGCTACC	0.473													4	133	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181725167	181725167	+	Silent	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181725167C>T	uc001gow.2	+	29	4230	c.4065C>T	c.(4063-4065)TAC>TAT	p.Y1355Y	CACNA1E_uc009wxs.2_Silent_p.Y1243Y|CACNA1E_uc001gox.1_Silent_p.Y581Y|CACNA1E_uc009wxt.2_Silent_p.Y581Y	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1355	Extracellular (Potential).|III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						AATTCCACTACGACAACATTA	0.493													18	56	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197313415	197313415	+	Silent	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197313415A>G	uc001gtz.2	+	3	792	c.657A>G	c.(655-657)GTA>GTG	p.V219V	CRB1_uc010poz.1_Silent_p.V150V|CRB1_uc001gty.1_Silent_p.V219V|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Intron|CRB1_uc010ppb.1_Silent_p.V219V|CRB1_uc010ppc.1_RNA	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	219	Extracellular (Potential).|EGF-like 5; calcium-binding (Potential).				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						TAAAAGGTGTAAACTGTGAAT	0.398													6	398	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55561490	55561490	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55561490C>A	uc002ryv.2	-	15	3309	c.2467G>T	c.(2467-2469)GAG>TAG	p.E823*	CCDC88A_uc010yoz.1_Nonsense_Mutation_p.E823*|CCDC88A_uc010ypa.1_Nonsense_Mutation_p.E823*|CCDC88A_uc010ypb.1_Nonsense_Mutation_p.E725*|CCDC88A_uc002ryu.2_Nonsense_Mutation_p.E106*|CCDC88A_uc002ryw.2_Nonsense_Mutation_p.E106*	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	823	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						TGAGAAGTCTCTTGCTCTAAT	0.318													5	301	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60773250	60773250	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60773250C>T	uc002sae.1	-	2	469	c.241G>A	c.(241-243)GTG>ATG	p.V81M	BCL11A_uc002sab.2_Missense_Mutation_p.V81M|BCL11A_uc002sac.2_Missense_Mutation_p.V81M|BCL11A_uc010ypi.1_Translation_Start_Site|BCL11A_uc010ypj.1_Missense_Mutation_p.V81M|BCL11A_uc002saf.1_Missense_Mutation_p.V81M|BCL11A_uc010fcg.2_Missense_Mutation_p.V81M	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	81	Required for nuclear body formation and for SUMO1 recruitment (By similarity).				negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GGCTTATCCACAGCTTTTTCT	0.483			T	IGH@	B-CLL								5	133	---	---	---	---	PASS
RGPD5	84220	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113127775G>C	uc002ths.1	-	23	5355	c.5278C>G	c.(5278-5280)CCT>GCT	p.P1760A	RGPD8_uc010fkk.1_Missense_Mutation_p.P1620A	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform	1760					intracellular transport	cytoplasm	binding				0						GAACGGGAAGGATTTTCTTCC	0.308													4	57	---	---	---	---	PASS
CCDC93	54520	broad.mit.edu	37	2	118694259	118694259	+	Intron	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118694259G>A	uc002tlj.2	-						CCDC93_uc010fld.1_3'UTR	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93											large_intestine(1)|ovary(1)	2						TAGTGGGAAGGAGGACTGACA	0.423													37	164	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141473639	141473639	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141473639A>C	uc002tvj.1	-	37	6898	c.5926T>G	c.(5926-5928)TTA>GTA	p.L1976V		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1976	Extracellular (Potential).|LDL-receptor class B 20.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACTTCAATTAAGTTGAAACCA	0.343										TSP Lung(27;0.18)			92	216	---	---	---	---	PASS
CUL3	8452	broad.mit.edu	37	2	225379456	225379456	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225379456T>C	uc002vny.2	-	4	796	c.412A>G	c.(412-414)AAC>GAC	p.N138D	CUL3_uc010zls.1_Missense_Mutation_p.N72D|CUL3_uc010fwy.1_Missense_Mutation_p.N144D	NM_003590	NP_003581	Q13618	CUL3_HUMAN	cullin 3	138					cell cycle arrest|cell migration|cyclin catabolic process|cytokinesis|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|mitotic anaphase|negative regulation of Rho protein signal transduction|positive regulation of cell proliferation|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|Golgi apparatus|nucleus|polar microtubule	ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|kidney(1)	4		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TTGTAGACGTTCTCCACATTA	0.338													27	79	---	---	---	---	PASS
RNPEPL1	57140	broad.mit.edu	37	2	241516387	241516387	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241516387C>T	uc002vzi.2	+	10	1764	c.1171C>T	c.(1171-1173)CGG>TGG	p.R391W	RNPEPL1_uc010fzf.2_Missense_Mutation_p.R297W|RNPEPL1_uc002vzj.2_Missense_Mutation_p.R39W	NM_018226	NP_060696	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like	391					leukotriene biosynthetic process|proteolysis		aminopeptidase activity|metallopeptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		CCACAGGGTGCGGCGCTTCCT	0.647													4	111	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51101986	51101986	+	Silent	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51101986G>A	uc011bds.1	+	6	446	c.423G>A	c.(421-423)GAG>GAA	p.E141E		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	141						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AGGTGCGGGAGGTTAAGCGGC	0.453													18	122	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51102013	51102013	+	Silent	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51102013G>A	uc011bds.1	+	6	473	c.450G>A	c.(448-450)CTG>CTA	p.L150L		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	150						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CCGTGCGCCTGGACTGGGGTA	0.463													17	123	---	---	---	---	PASS
RYBP	23429	broad.mit.edu	37	3	72428496	72428496	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72428496T>C	uc003dpe.2	-	2	328	c.211A>G	c.(211-213)AAG>GAG	p.K71E		NM_012234	NP_036366	Q8N488	RYBP_HUMAN	RING1 and YY1 binding protein	81	Lys-rich.				apoptosis|histone H2A monoubiquitination|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleoplasm	DNA binding|protein binding|transcription corepressor activity|zinc ion binding				0		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;0.000197)|Epithelial(33;0.00068)|LUSC - Lung squamous cell carcinoma(21;0.00228)|Lung(16;0.00677)|KIRC - Kidney renal clear cell carcinoma(39;0.198)|Kidney(39;0.232)		ACTTTCTCCTTCTTCTCCTTT	0.408													65	193	---	---	---	---	PASS
OR5H14	403273	broad.mit.edu	37	3	97869007	97869007	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97869007A>G	uc003dsg.1	+	1	778	c.778A>G	c.(778-780)ATG>GTG	p.M260V		NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H,	260	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTTCATGTATATGGGCTCTGC	0.433													4	101	---	---	---	---	PASS
PLCXD2	257068	broad.mit.edu	37	3	111426940	111426940	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111426940C>T	uc003dya.2	+	2	917	c.331C>T	c.(331-333)CGC>TGC	p.R111C	PLCXD2_uc003dyb.2_Missense_Mutation_p.R111C|PLCXD2_uc003dxz.2_Missense_Mutation_p.R111C	NM_001134478	NP_001127950	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X	111	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(1)	1						AGCTGGGATCCGCTACTTTGA	0.512													31	147	---	---	---	---	PASS
BOC	91653	broad.mit.edu	37	3	112993397	112993397	+	Silent	SNP	T	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112993397T>C	uc003dzx.2	+	9	2031	c.1410T>C	c.(1408-1410)GCT>GCC	p.A470A	BOC_uc003dzy.2_Silent_p.A470A|BOC_uc003dzz.2_Silent_p.A470A|BOC_uc003eab.2_Silent_p.A171A	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	470	Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			GGCAGGGGGCTCCCGCCGAGG	0.687													5	29	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130189738	130189738	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130189738G>A	uc010htj.1	+	39	7995	c.7501G>A	c.(7501-7503)GAA>AAA	p.E2501K	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.E540K	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2501	Nonhelical region.				axon guidance|cell adhesion	collagen					0						ATATCCCACCGAAGATATGAA	0.428													10	39	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	256573	256573	+	3'UTR	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:256573A>G	uc003jao.3	+	15					SDHA_uc011clw.1_3'UTR|SDHA_uc003jap.3_3'UTR|SDHA_uc003jaq.3_3'UTR|SDHA_uc003jar.3_3'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CAGCTTTTGTAATTATGTATA	0.463									Familial_Paragangliomas				5	94	---	---	---	---	PASS
TMEM167A	153339	broad.mit.edu	37	5	82373245	82373245	+	5'UTR	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82373245G>A	uc003khx.3	-	1					XRCC4_uc003kia.1_5'Flank|XRCC4_uc003kib.2_5'Flank|XRCC4_uc003kid.2_5'Flank|XRCC4_uc003kic.2_5'Flank|XRCC4_uc003kie.2_5'Flank	NM_174909	NP_777569	Q8TBQ9	KISHA_HUMAN	transmembrane protein 167A precursor							Golgi membrane|integral to membrane					0						CGTCCGGTTGGGCTTGTCACG	0.657													14	64	---	---	---	---	PASS
CDKL3	51265	broad.mit.edu	37	5	133634385	133634385	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133634385C>T	uc003kzf.3	-	13	1855	c.1736G>A	c.(1735-1737)TGC>TAC	p.C579Y	CDKL3_uc011cxm.1_Intron|CDKL3_uc011cxn.1_Intron|CDKL3_uc010jdw.2_Intron|CDKL3_uc011cxo.1_Intron|CDKL3_uc011cxp.1_Intron|CDKL3_uc011cxq.1_3'UTR	NM_001113575	NP_001107047	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3 isoform 1	579						cytoplasm	ATP binding|cyclin-dependent protein kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTTCCCCTCGCAATGGCCATC	0.348													37	126	---	---	---	---	PASS
FAM53C	51307	broad.mit.edu	37	5	137681219	137681219	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137681219G>A	uc003lcv.2	+	4	1312	c.842G>A	c.(841-843)CGC>CAC	p.R281H	FAM53C_uc003lcw.2_Missense_Mutation_p.R281H|FAM53C_uc011cyq.1_RNA|FAM53C_uc011cyr.1_Missense_Mutation_p.A97T	NM_001135647	NP_001129119	Q9NYF3	FA53C_HUMAN	hypothetical protein LOC51307	281										ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CTGGATGCCCGCAAAACTGGG	0.642													4	171	---	---	---	---	PASS
PSD2	84249	broad.mit.edu	37	5	139189047	139189047	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139189047T>C	uc003leu.1	+	2	227	c.22T>C	c.(22-24)TCT>CCT	p.S8P		NM_032289	NP_115665	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	8					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGCTCTTATCTGCAGTGCC	0.627													3	21	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153078545	153078545	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153078545G>A	uc003lva.3	+	10	1729	c.1364G>A	c.(1363-1365)CGT>CAT	p.R455H	GRIA1_uc003luy.3_Missense_Mutation_p.R455H|GRIA1_uc003luz.3_Missense_Mutation_p.R360H|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.R375H|GRIA1_uc011dcx.1_Missense_Mutation_p.R386H|GRIA1_uc011dcy.1_Missense_Mutation_p.R465H|GRIA1_uc011dcz.1_Missense_Mutation_p.R465H|GRIA1_uc010jia.1_Missense_Mutation_p.R435H	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	455	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TACTCCTACCGTCTGGAGATT	0.542													33	75	---	---	---	---	PASS
ATP10B	23120	broad.mit.edu	37	5	159992774	159992774	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159992774C>G	uc003lym.1	-	26	4919	c.4072G>C	c.(4072-4074)GTC>CTC	p.V1358L	ATP10B_uc010jit.1_Missense_Mutation_p.V608L	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1358	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTTCGGGGACAGGGGCAGGC	0.517													58	235	---	---	---	---	PASS
HLA-G	3135	broad.mit.edu	37	6	29797406	29797406	+	Silent	SNP	G	A	A	rs79264452		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29797406G>A	uc003nnw.2	+	5	1009	c.831G>A	c.(829-831)GAG>GAA	p.E277E	HLA-G_uc011dmb.1_Silent_p.E249E|HLA-G_uc003raj.3_Silent_p.E282E|HLA-G_uc003nnz.3_Silent_p.E185E|HLA-G_uc010jrn.2_Intron|HLA-G_uc003nny.3_RNA|HLA-G_uc003ran.1_5'Flank	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	277	Extracellular (Potential).|Ig-like C1-type.|Alpha-3.				antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						CTTCTGGAGAGGAGCAGAGAT	0.607													7	187	---	---	---	---	PASS
HLA-G	3135	broad.mit.edu	37	6	29797436	29797436	+	Silent	SNP	T	C	C	rs74547057		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29797436T>C	uc003nnw.2	+	5	1039	c.861T>C	c.(859-861)CAT>CAC	p.H287H	HLA-G_uc011dmb.1_Silent_p.H259H|HLA-G_uc003raj.3_Silent_p.H292H|HLA-G_uc003nnz.3_Silent_p.H195H|HLA-G_uc010jrn.2_Intron|HLA-G_uc003nny.3_RNA|HLA-G_uc003ran.1_5'Flank	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	287	Extracellular (Potential).|Ig-like C1-type.|Alpha-3.				antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						ATGTGCAGCATGAGGGGCTGC	0.577													6	179	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100345786	100345786	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100345786G>T	uc003uwj.2	+	10	1215	c.1050G>T	c.(1048-1050)AAG>AAT	p.K350N	ZAN_uc003uwk.2_Missense_Mutation_p.K350N|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	350	MAM 2.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TTTTTGGAAAGACCCCAGAGC	0.597													12	59	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25745360	25745360	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25745360C>T	uc003xes.1	-	9	897	c.880G>A	c.(880-882)GAG>AAG	p.E294K	PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	294	IPT/TIG.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		CTGCTTACCTCGCTCCATACA	0.463													37	58	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62491335	62491335	+	Intron	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62491335A>G	uc011leg.1	-						ASPH_uc003xuj.2_Intron|ASPH_uc003xuo.2_Intron|uc003xuk.2_Missense_Mutation_p.H127R	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	ATCAATAAGCATACAGAGATG	0.498													4	115	---	---	---	---	PASS
C8orf46	254778	broad.mit.edu	37	8	67428303	67428303	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67428303G>T	uc003xwg.2	+	6	1009	c.616G>T	c.(616-618)GCC>TCC	p.A206S	C8orf46_uc003xwh.2_RNA|C8orf46_uc011let.1_3'UTR|C8orf46_uc003xwi.2_Missense_Mutation_p.A71S	NM_152765	NP_689978	Q8TAG6	CH046_HUMAN	hypothetical protein LOC254778	206										skin(2)	2			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CGCCTTTGAGGCCGACTAAAG	0.557													6	44	---	---	---	---	PASS
KDM4C	23081	broad.mit.edu	37	9	7169914	7169914	+	Intron	SNP	G	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7169914G>C	uc003zkh.2	+						KDM4C_uc003zkg.2_Missense_Mutation_p.L1006F|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						GATGCCACTTGGGGACCTGCC	0.448													12	53	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32632378	32632378	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32632378G>A	uc003zrg.1	-	1	3290	c.3200C>T	c.(3199-3201)GCC>GTC	p.A1067V	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1067					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGATCCACGGGCAAATTTACT	0.468													5	306	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77427337	77427337	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77427337C>T	uc004ajl.1	-	12	1559	c.1321G>A	c.(1321-1323)GAA>AAA	p.E441K	TRPM6_uc004ajk.1_Missense_Mutation_p.E436K|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.E441K|TRPM6_uc010mpd.1_Missense_Mutation_p.E441K|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	441	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						ATTGCTTGTTCCAGGGCATCA	0.363													51	91	---	---	---	---	PASS
IKBKAP	8518	broad.mit.edu	37	9	111662626	111662626	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111662626C>T	uc004bdm.3	-	19	2564	c.2044G>A	c.(2044-2046)GTG>ATG	p.V682M	IKBKAP_uc004bdl.2_Missense_Mutation_p.V333M|IKBKAP_uc011lwc.1_Missense_Mutation_p.V568M|IKBKAP_uc010mtq.2_Missense_Mutation_p.V333M	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	682					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						CCATGGGACACATGATTGCTG	0.458													22	108	---	---	---	---	PASS
DFNB31	25861	broad.mit.edu	37	9	117164896	117164896	+	3'UTR	SNP	G	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117164896G>T	uc004biz.3	-	12					DFNB31_uc004bix.2_3'UTR|DFNB31_uc004biy.3_3'UTR|DFNB31_uc004bja.3_3'UTR	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1						inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6						GGTCCAGTGGGCTGGGATGGA	0.612													9	24	---	---	---	---	PASS
WDR38	401551	broad.mit.edu	37	9	127618187	127618187	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127618187C>A	uc004box.2	+	4	411	c.355C>A	c.(355-357)CAG>AAG	p.Q119K	WDR38_uc011lzn.1_Missense_Mutation_p.Q108K|WDR38_uc011lzo.1_Missense_Mutation_p.Q119K|WDR38_uc011lzp.1_Missense_Mutation_p.Q70K	NM_001045476	NP_001038941	Q5JTN6	WDR38_HUMAN	WD repeat domain 38	119	WD 3.										0						TGACTCGAGACAGCTGGCATC	0.622											OREG0019485	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	138	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127790688C>A	uc004bpe.2	-	5	477	c.396G>T	c.(394-396)CAG>CAT	p.Q132H	SCAI_uc004bpd.2_Missense_Mutation_p.Q155H|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	132	Required for interaction with MKL1 (By similarity).|Necessary to inhibit MKL1-induced SRF transcriptional activity (By similarity).				negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						GATAGTATAGCTGCCCAATCT	0.338													10	139	---	---	---	---	PASS
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	Missense_Mutation	SNP	A	G	G	rs2257765		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38654432A>G	uc010qex.1	+	5	599	c.524A>G	c.(523-525)AAT>AGT	p.N175S	HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N173S					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0						TCATCTCGCAATGCAAGGAAA	0.453													7	122	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1213124	1213124	+	Intron	SNP	C	T	T	rs76521741	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1213124C>T	uc009ycr.1	+						uc001lsz.2_RNA	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACAACCAGCACGACCTCTGGT	0.557													7	96	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57077492	57077492	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57077492G>A	uc001njr.2	-	5	3005	c.2693C>T	c.(2692-2694)GCC>GTC	p.A898V	TNKS1BP1_uc001njs.2_Missense_Mutation_p.A898V|TNKS1BP1_uc009ymd.1_Missense_Mutation_p.A349V	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	898	Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				ATCTTGGCTGGCATAAGCACC	0.532													6	414	---	---	---	---	PASS
NCAM1	4684	broad.mit.edu	37	11	113105824	113105824	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113105824C>T	uc009yyq.1	+	15	2181	c.1487C>T	c.(1486-1488)GCG>GTG	p.A496V		NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3	588	Extracellular (Potential).|Fibronectin type-III 1.				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		AGGCTGGCGGCGCTCAATGGC	0.587													9	15	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118343971	118343971	+	Silent	SNP	T	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118343971T>C	uc001pta.2	+	3	2120	c.2097T>C	c.(2095-2097)GCT>GCC	p.A699A	MLL_uc001ptb.2_Silent_p.A699A|MLL_uc001psz.1_Silent_p.A732A|MLL_uc001ptd.1_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	699					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TTCTGAGAGCTCCAAGATTTA	0.453			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								33	124	---	---	---	---	PASS
OR10G9	219870	broad.mit.edu	37	11	123893785	123893785	+	Silent	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123893785C>T	uc010sad.1	+	1	66	c.66C>T	c.(64-66)GAC>GAT	p.D22D		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CAGGGCTGGACGCCCCACTCT	0.587													18	413	---	---	---	---	PASS
OR10G7	390265	broad.mit.edu	37	11	123909643	123909643	+	Silent	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123909643G>A	uc001pzq.1	-	1	66	c.66C>T	c.(64-66)GAC>GAT	p.D22D		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AGAGGGGGGCGTCCAGCCCTG	0.562													8	126	---	---	---	---	PASS
BARX2	8538	broad.mit.edu	37	11	129312807	129312807	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129312807A>G	uc001qfc.3	+	3	616	c.566A>G	c.(565-567)AAG>AGG	p.K189R		NM_003658	NP_003649	Q9UMQ3	BARX2_HUMAN	BarH-like homeobox 2	189	Homeobox.										0	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		ATGAAATGGAAGAAAATGGTA	0.498													7	125	---	---	---	---	PASS
GALNT8	26290	broad.mit.edu	37	12	4830000	4830000	+	Missense_Mutation	SNP	T	G	G	rs10849133	byFrequency	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4830000T>G	uc001qne.1	+	1	249	c.157T>G	c.(157-159)TAC>GAC	p.Y53D		NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	53	Lumenal (Potential).		Y -> N.			Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4						GAATAAACGCTACGGGGCAGT	0.468													3	150	---	---	---	---	PASS
ACCN2	41	broad.mit.edu	37	12	50474350	50474350	+	Silent	SNP	C	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50474350C>A	uc001rvw.2	+	9	1504	c.1275C>A	c.(1273-1275)GCC>GCA	p.A425A	ACCN2_uc001rvv.2_Silent_p.A425A|ACCN2_uc009zln.2_Silent_p.A216A|ACCN2_uc009zlo.2_Silent_p.A425A	NM_001095	NP_001086	P78348	ACCN2_HUMAN	amiloride-sensitive cation channel 2, neuronal	425	Extracellular (By similarity).				calcium ion transport|response to pH|signal transduction	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(1)	1					Amiloride(DB00594)	AGAAGAAGGCCTATGAGATTG	0.448													3	92	---	---	---	---	PASS
NAP1L1	4673	broad.mit.edu	37	12	76446996	76446996	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76446996G>A	uc001sxw.2	-	10	1317	c.905C>T	c.(904-906)GCC>GTC	p.A302V	NAP1L1_uc001sxv.2_Missense_Mutation_p.A260V|NAP1L1_uc001sxz.2_Missense_Mutation_p.A233V|NAP1L1_uc001sxx.2_Missense_Mutation_p.A302V|NAP1L1_uc001sxy.2_Missense_Mutation_p.A239V|NAP1L1_uc010sty.1_Missense_Mutation_p.A259V|NAP1L1_uc010stz.1_Missense_Mutation_p.A119V|NAP1L1_uc010sua.1_Missense_Mutation_p.A302V|NAP1L1_uc001syb.2_Missense_Mutation_p.A302V|NAP1L1_uc001sya.2_Missense_Mutation_p.A260V|NAP1L1_uc001syc.2_Missense_Mutation_p.A313V	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	302					DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				TTCAGGAGGGGCAAAAAAGTT	0.328													5	197	---	---	---	---	PASS
SPIC	121599	broad.mit.edu	37	12	101876611	101876611	+	Silent	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101876611A>G	uc001tid.2	+	5	411	c.252A>G	c.(250-252)CAA>CAG	p.Q84Q	SPIC_uc009zua.2_5'UTR|SPIC_uc010svp.1_Silent_p.Q83Q	NM_152323	NP_689536	Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	84						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						ATATTCATCAATCTCTGCAGA	0.299													130	333	---	---	---	---	PASS
USP30	84749	broad.mit.edu	37	12	109520388	109520388	+	Intron	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109520388A>G	uc010sxi.1	+						USP30_uc001tnu.3_Intron|USP30_uc001tnw.3_5'UTR	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						GTGTGCCGCTATAACACCACT	0.438													7	17	---	---	---	---	PASS
FGF9	2254	broad.mit.edu	37	13	22275633	22275633	+	3'UTR	SNP	G	A	A	rs17840929		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22275633G>A	uc001uog.2	+	3						NM_002010	NP_002001	P31371	FGF9_HUMAN	fibroblast growth factor 9 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|male gonad development|positive regulation of cell division	extracellular space	growth factor activity|heparin binding				0		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		GGTTTCACGCGGTGGGTTCTT	0.408													24	58	---	---	---	---	PASS
LOC374491	374491	broad.mit.edu	37	13	25169937	25169937	+	RNA	SNP	A	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25169937A>C	uc001upm.2	+	11		c.1184A>C			LOC374491_uc001upn.2_RNA|LOC374491_uc001upo.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0						AATCTTCCTAAATACTATGAC	0.264													3	18	---	---	---	---	PASS
FERMT2	10979	broad.mit.edu	37	14	53385917	53385917	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53385917G>T	uc001xad.2	-	3	370	c.315C>A	c.(313-315)AAC>AAA	p.N105K	FERMT2_uc001xac.2_Missense_Mutation_p.N105K|FERMT2_uc001xae.2_Missense_Mutation_p.N105K|FERMT2_uc001xaf.2_Missense_Mutation_p.N105K	NM_006832	NP_006823	Q96AC1	FERM2_HUMAN	fermitin family homolog 2 isoform 1	105					actin cytoskeleton organization|cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytosol|focal adhesion|stress fiber	binding				0	Breast(41;0.0342)					CATACTTCATGTTGGGAAGCT	0.398													6	287	---	---	---	---	PASS
EML1	2009	broad.mit.edu	37	14	100405575	100405575	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100405575G>A	uc001ygs.2	+	21	2302	c.2233G>A	c.(2233-2235)GTC>ATC	p.V745I	EML1_uc010tww.1_Missense_Mutation_p.V733I|EML1_uc001ygr.2_Missense_Mutation_p.V764I	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	745	WD 10.					cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)				CATCAATGCCGTCTGTCGGGC	0.562													36	99	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107035002	107035002	+	RNA	SNP	A	G	G	rs72686845	byFrequency	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107035002A>G	uc010tyt.1	-	154		c.7231T>C			uc001ysz.2_Silent_p.S26S					Parts of antibodies, mostly variable regions.												0						CCTCTGCTCCAGACTGCACCA	0.567													5	32	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42145484	42145484	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42145484A>C	uc001zos.2	-	59	10370	c.10037T>G	c.(10036-10038)GTG>GGG	p.V3346G		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3381	Spectrin 30.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCTGTTGTCCACCAGCTGCTG	0.637													7	19	---	---	---	---	PASS
ZNF434	54925	broad.mit.edu	37	16	3440104	3440104	+	Silent	SNP	T	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3440104T>A	uc002cuz.2	-	4	823	c.21A>T	c.(19-21)GTA>GTT	p.V7V	ZNF434_uc002cux.3_Silent_p.V218V|ZNF434_uc010uwx.1_Intron|ZNF434_uc002cuy.3_Intron|ZNF434_uc010uwy.1_Intron|ZNF434_uc010uwz.1_Silent_p.V218V|ZNF434_uc010uxa.1_Silent_p.V7V	NM_017810	NP_060280	Q9NX65	ZN434_HUMAN	zinc finger protein 434	7	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GACAGAGGGATACAGCTCTGT	0.582													13	39	---	---	---	---	PASS
FAM86A	196483	broad.mit.edu	37	16	5140130	5140130	+	Missense_Mutation	SNP	C	T	T	rs112774542		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5140130C>T	uc002cyo.2	-	6	746	c.697G>A	c.(697-699)GTC>ATC	p.V233I	FAM86A_uc002cyp.2_Missense_Mutation_p.V199I	NM_201400	NP_958802	Q96G04	FA86A_HUMAN	hypothetical protein LOC196483 isoform 1	233											0						AGCTGATGGACCGTCGCGACG	0.592													5	106	---	---	---	---	PASS
FAM86A	196483	broad.mit.edu	37	16	5140136	5140136	+	Missense_Mutation	SNP	C	T	T	rs74684799		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5140136C>T	uc002cyo.2	-	6	740	c.691G>A	c.(691-693)GCG>ACG	p.A231T	FAM86A_uc002cyp.2_Missense_Mutation_p.A197T	NM_201400	NP_958802	Q96G04	FA86A_HUMAN	hypothetical protein LOC196483 isoform 1	231											0						TGGACCGTCGCGACGTCCCAG	0.597													4	119	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7734055	7734055	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7734055G>A	uc002giu.1	+	78	12139	c.12125G>A	c.(12124-12126)GGC>GAC	p.G4042D	DNAH2_uc010cnm.1_Missense_Mutation_p.G980D	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	4042					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTCATTGCCGGCATCAACTAT	0.507													4	142	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26961608	26961608	+	Silent	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26961608A>G	uc002hbu.2	-	16	3096	c.2997T>C	c.(2995-2997)CCT>CCC	p.P999P		NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	999						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					CAGGGGGAAAAGGGCTGCCTG	0.493													4	223	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5768180	5768180	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5768180A>C	uc002mda.2	+	18	1622	c.1561A>C	c.(1561-1563)AAA>CAA	p.K521Q	TMEM146_uc010duj.1_Missense_Mutation_p.K179Q	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	521	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						TGCTTGCAGCAAAGTTTCCGC	0.463													39	104	---	---	---	---	PASS
LDLR	3949	broad.mit.edu	37	19	11227612	11227612	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11227612C>T	uc002mqk.3	+	12	1951	c.1783C>T	c.(1783-1785)CGG>TGG	p.R595W	LDLR_uc010xlk.1_Missense_Mutation_p.R595W|LDLR_uc010xll.1_Missense_Mutation_p.R554W|LDLR_uc010xlm.1_Missense_Mutation_p.R448W|LDLR_uc010xln.1_Missense_Mutation_p.R468W|LDLR_uc010xlo.1_Missense_Mutation_p.R427W	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	595	LDL-receptor class B 5.|Extracellular (Potential).				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	CGGGGGCAACCGGAAGACCAT	0.542													72	342	---	---	---	---	PASS
JAK3	3718	broad.mit.edu	37	19	17950419	17950419	+	Silent	SNP	T	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17950419T>A	uc002nhn.3	-	10	1408	c.1308A>T	c.(1306-1308)GGA>GGT	p.G436G	JAK3_uc010ebh.2_RNA|JAK3_uc002nho.2_Silent_p.G436G|JAK3_uc010xpx.1_Silent_p.G436G	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	436	SH2; atypical.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						GAAGGAAGGTTCCTGTGGGGC	0.612		2	Mis		acute megakaryocytic leukemia|								5	30	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533038	41533038	+	Intron	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533038C>T	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CGAAGGTGGCCTGCTCGCCTC	0.667													4	73	---	---	---	---	PASS
TSKS	60385	broad.mit.edu	37	19	50248602	50248602	+	Silent	SNP	C	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50248602C>T	uc002ppm.2	-	7	1055	c.1044G>A	c.(1042-1044)GTG>GTA	p.V348V		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	348							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		GGGCTTCCTGCACCGCCCCCT	0.706													3	8	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51363416	51363416	+	3'UTR	SNP	T	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51363416T>A	uc002pts.1	+	5					KLK3_uc010ycj.1_3'UTR|KLK3_uc002ptr.1_3'UTR|KLK3_uc010eof.1_RNA	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3						negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		GTAGTAAACTTGGAACCTTGG	0.517													14	77	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51363418	51363418	+	3'UTR	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51363418G>A	uc002pts.1	+	5					KLK3_uc010ycj.1_3'UTR|KLK3_uc002ptr.1_3'UTR|KLK3_uc010eof.1_RNA	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3						negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		AGTAAACTTGGAACCTTGGAA	0.517													14	76	---	---	---	---	PASS
ZNF83	55769	broad.mit.edu	37	19	53117461	53117461	+	Silent	SNP	C	T	T	rs77404321	byFrequency	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53117461C>T	uc002pzu.3	-	2	1601	c.357G>A	c.(355-357)ACG>ACA	p.T119T	ZNF83_uc002pzv.3_Silent_p.T119T|ZNF83_uc010eps.2_Silent_p.T119T|ZNF83_uc010ept.2_Silent_p.T119T|ZNF83_uc010epu.2_Silent_p.T119T|ZNF83_uc010epv.2_Silent_p.T119T|ZNF83_uc010epw.2_Silent_p.T119T|ZNF83_uc010epx.2_Silent_p.T119T|ZNF83_uc010epy.2_Silent_p.T119T|ZNF83_uc010epz.2_Silent_p.T119T|ZNF83_uc010eqb.1_Silent_p.T119T	NM_018300	NP_060770	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform a	119						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		ATTTAAATTGCGTCTCTTTAG	0.338													56	146	---	---	---	---	PASS
ZSCAN1	284312	broad.mit.edu	37	19	58565060	58565060	+	Silent	SNP	C	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58565060C>A	uc002qrc.1	+	6	1115	c.868C>A	c.(868-870)CGG>AGG	p.R290R		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	290					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCGAGGTGGGCGGCCCTTCCA	0.652													4	100	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659512	24659512	+	RNA	SNP	A	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659512A>G	uc002zzs.3	+	7		c.3244A>G			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						TGCCTGGGCCATGGAGCACTC	0.473													3	27	---	---	---	---	PASS
SNX12	29934	broad.mit.edu	37	X	70280884	70280884	+	Silent	SNP	C	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70280884C>A	uc004dyr.1	-	4	546	c.471G>T	c.(469-471)CCG>CCT	p.P157P	SNX12_uc004dyp.1_RNA|uc004dyq.2_5'Flank	NM_013346	NP_037478	Q9UMY4	SNX12_HUMAN	sorting nexin 12	157					cell communication|protein transport	membrane	phosphatidylinositol binding|protein binding				0	Renal(35;0.156)					GCACCTTCCCCGGGACGTAGT	0.512													3	22	---	---	---	---	PASS
ARL13A	392509	broad.mit.edu	37	X	100243476	100243476	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100243476C>G	uc004ego.2	+	8	970	c.854C>G	c.(853-855)ACG>AGG	p.T285R	ARL13A_uc011mrf.1_Missense_Mutation_p.T285R|ARL13A_uc010nng.2_Intron	NM_001012990	NP_001013008	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13 isoform a	285							GTP binding			ovary(1)	1						CAGAATACTACGAAGCTTTGC	0.378													3	9	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	7026	7026	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:7026G>A	uc011mfh.1	+	1	1173	c.125G>A	c.(124-126)AGC>AAC	p.S42N	uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		ACTACGTTGTAGCTCACTTCC	0.448													4	2	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17185383	17185384	+	Intron	INS	-	C	C	rs143082557	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17185383_17185384insC	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ACTAAATTTTTAGTGCAATAAT	0.203													4	2	---	---	---	---	
EIF2C4	192670	broad.mit.edu	37	1	36298020	36298020	+	Intron	DEL	T	-	-	rs111531043		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36298020delT	uc001bzj.1	+							NM_017629	NP_060099	Q9HCK5	AGO4_HUMAN	eukaryotic translation initiation factor 2C, 4						mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				cttcttcttcttttttttttt	0.284													66	7	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	65915367	65915368	+	Intron	INS	-	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65915367_65915368insT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		gcctatttatcttttttttttt	0.223													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	153215795	153215797	+	IGR	DEL	GGT	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153215795_153215797delGGT								LELP1 (38201 upstream) : LOR (16382 downstream)																							aggtggtggaggtggtggtggtg	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	234786389	234786390	+	Intron	DEL	CA	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234786389_234786390delCA	uc001hwh.2	+											Homo sapiens cDNA clone IMAGE:4825891.																		cacacacacgcacacacacaca	0.064													4	2	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236572369	236572369	+	Intron	DEL	A	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236572369delA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			cctatttcttaaaaaaaaaaa	0.144													9	5	---	---	---	---	
AGBL5	60509	broad.mit.edu	37	2	27279864	27279865	+	Intron	INS	-	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27279864_27279865insA	uc002rie.2	+						AGBL5_uc002rid.2_Intron|AGBL5_uc002rif.2_Intron	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1						protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					aactccgtctcaaaaaaaaaac	0.173													4	2	---	---	---	---	
RBKS	64080	broad.mit.edu	37	2	28065746	28065746	+	Intron	DEL	T	-	-	rs78190424		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28065746delT	uc002rlo.1	-						RBKS_uc010ezi.1_Intron|RBKS_uc010ymg.1_Intron	NM_022128	NP_071411	Q9H477	RBSK_HUMAN	ribokinase						D-ribose metabolic process		ATP binding|ribokinase activity			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					GCTACTCATGTTTTTTTTTTT	0.303													4	2	---	---	---	---	
MEIS1	4211	broad.mit.edu	37	2	66667200	66667201	+	Intron	INS	-	ACACACACACACACAC	ACACACACACACACAC	rs144159761	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66667200_66667201insACACACACACACACAC	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_5'Flank	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0						cgcgcgcgcgaacacacacaca	0.347													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89278729	89278731	+	Intron	DEL	CTC	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89278729_89278731delCTC	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GAGTGTAGAACTCCTCCCTTGTG	0.473													3	3	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113147931	113147933	+	Intron	DEL	ATG	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113147931_113147933delATG	uc002ths.1	-						RGPD8_uc010fkk.1_Intron|RGPD5_uc002tht.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						gttaacaataatgatgatgatga	0.123													7	6	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187503359	187503360	+	Intron	DEL	GT	-	-	rs71946663		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187503359_187503360delGT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		tcttttgagcgtgtgtgtgtgt	0.000													6	4	---	---	---	---	
ITPR1	3708	broad.mit.edu	37	3	4759021	4759022	+	Intron	DEL	TC	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4759021_4759022delTC	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Intron	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		AACATTTCCTTCTCTCTCTCTC	0.376													413	9	---	---	---	---	
VPRBP	9730	broad.mit.edu	37	3	51505206	51505206	+	Intron	DEL	T	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51505206delT	uc003dbe.1	-						VPRBP_uc003dbg.1_Intron	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		AAACTCAttcttttttttttt	0.139													4	4	---	---	---	---	
MBD4	8930	broad.mit.edu	37	3	129152182	129152182	+	Intron	DEL	T	-	-	rs72112332		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129152182delT	uc003emh.1	-						MBD4_uc003emi.1_Intron|MBD4_uc003emj.1_Intron|MBD4_uc003emk.1_Intron|MBD4_uc011bkw.1_Intron	NM_003925	NP_003916	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4						depyrimidination	nucleoplasm	DNA N-glycosylase activity|endodeoxyribonuclease activity|protein binding|satellite DNA binding			ovary(1)|lung(1)	2						ATCCAGAGGGTTTTTTTTTTT	0.353								BER_DNA_glycosylases					40	7	---	---	---	---	
DBR1	51163	broad.mit.edu	37	3	137880741	137880743	+	In_Frame_Del	DEL	TCG	-	-	rs150114751	byFrequency	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137880741_137880743delTCG	uc003erv.2	-	8	1759_1761	c.1623_1625delCGA	c.(1621-1626)GATGAT>GAT	p.541_542DD>D	DBR1_uc003eru.2_In_Frame_Del_p.490_491DD>D|DBR1_uc003ert.2_In_Frame_Del_p.309_310DD>D	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1	541_542						nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						TTAAGCTGCATCGTCATCATCAT	0.251													297	7	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180381458	180381458	+	Intron	DEL	A	-	-	rs113125291		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180381458delA	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			acttcatctcaaaaaaaaaaa	0.139													3	3	---	---	---	---	
EIF4G1	1981	broad.mit.edu	37	3	184043926	184043927	+	Intron	DEL	AC	-	-	rs112208190		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184043926_184043927delAC	uc003fnp.2	+						EIF4G1_uc003fnt.2_Intron|EIF4G1_uc003fnq.2_Intron|EIF4G1_uc003fnr.2_Intron|EIF4G1_uc010hxx.2_Intron|EIF4G1_uc003fns.2_Intron|EIF4G1_uc010hxy.2_Intron|EIF4G1_uc003fnv.3_Intron|EIF4G1_uc003fnu.3_Intron|EIF4G1_uc003fnw.2_Intron|EIF4G1_uc003fnx.2_Intron|EIF4G1_uc003fny.3_Intron|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4						insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGTTTGGCAAacacacacacac	0.252													4	3	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184561140	184561141	+	Intron	INS	-	A	A	rs144501206	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184561140_184561141insA	uc003fpb.1	+						VPS8_uc010hyd.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AATGCTTATTGAAAAAAACCCA	0.168													2	4	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39827205	39827205	+	Intron	DEL	T	-	-	rs72009420		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39827205delT	uc003guv.3	-						PDS5A_uc010ifo.2_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						ATCTAAAATCttttttttttt	0.149													6	3	---	---	---	---	
NMU	10874	broad.mit.edu	37	4	56475551	56475552	+	Intron	INS	-	A	A	rs35666427		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56475551_56475552insA	uc003hbc.2	-						NMU_uc003hbd.1_Intron|NMU_uc010igv.1_Intron|NMU_uc010igw.1_Intron|NMU_uc010igx.1_Intron	NM_006681	NP_006672	P48645	NMU_HUMAN	neuromedin U precursor						neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		CTTCTAACCAGAAAAAAAAAAA	0.342													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	105918246	105918247	+	IGR	INS	-	TT	TT	rs145057012		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105918246_105918247insTT								CXXC4 (502188 upstream) : TET2 (149696 downstream)																							tttttttttccttttttttttt	0.183													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2681753	2681754	+	IGR	INS	-	GGAA	GGAA	rs10687039		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2681753_2681754insGGAA								IRX4 (798873 upstream) : IRX2 (64527 downstream)																							gaaggaaggaagaaaaggaaag	0.005													4	2	---	---	---	---	
ITGA1	3672	broad.mit.edu	37	5	52161834	52161835	+	Intron	INS	-	TTTTTTC	TTTTTTC	rs143046695	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52161834_52161835insTTTTTTC	uc003jou.2	+						ITGA1_uc003jov.2_Intron	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor						axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TTATTTTCTATttttttctttt	0.114													5	3	---	---	---	---	
RHOBTB3	22836	broad.mit.edu	37	5	95119286	95119290	+	Intron	DEL	AAAAG	-	-	rs3079940		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95119286_95119290delAAAAG	uc003klm.2	+							NM_014899	NP_055714	O94955	RHBT3_HUMAN	rho-related BTB domain containing 3						retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		aaaaaaaaaaaaaagaagaagaaga	0.141													3	3	---	---	---	---	
AFF4	27125	broad.mit.edu	37	5	132280658	132280659	+	Intron	INS	-	A	A	rs142291614	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132280658_132280659insA	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron|AFF4_uc003kyf.3_Intron	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTTTTTTAATTAAAAAAACAAA	0.213													4	2	---	---	---	---	
BAT3	7917	broad.mit.edu	37	6	31615794	31615794	+	Intron	DEL	T	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31615794delT	uc003nvg.3	-						BAT3_uc003nvf.3_Intron|BAT3_uc003nvh.3_Intron|BAT3_uc003nvi.3_Intron|BAT3_uc011dnw.1_Intron|BAT3_uc011dnx.1_Intron|BAT3_uc003nvj.1_Intron	NM_004639	NP_004630	P46379	BAG6_HUMAN	HLA-B associated transcript-3 isoform a						apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0						gcatctgtAAttttttttttt	0.010													3	3	---	---	---	---	
MGC87042	256227	broad.mit.edu	37	7	22532527	22532528	+	Intron	INS	-	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22532527_22532528insT	uc003svh.2	-						MGC87042_uc010kum.1_Intron			Q6NZ63	STEAL_HUMAN	SubName: Full=cDNA FLJ60218, highly similar to Six transmembrane epithelial antigen ofprostate 1;							integral to membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0						GGAGCTATCACTTTTTTTCTTG	0.312													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150311028	150311029	+	IGR	INS	-	CTCTAT	CTCTAT	rs141505392	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150311028_150311029insCTCTAT								GIMAP4 (39988 upstream) : GIMAP6 (11437 downstream)																							tctctatttacctctatctcta	0.094													4	2	---	---	---	---	
SLC7A2	6542	broad.mit.edu	37	8	17412801	17412801	+	Intron	DEL	T	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17412801delT	uc011kyc.1	+						SLC7A2_uc011kyd.1_Intron|SLC7A2_uc011kye.1_Intron|SLC7A2_uc011kyf.1_Intron	NM_001008539	NP_001008539	P52569	CTR2_HUMAN	solute carrier family 7, member 2 isoform 2						cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	CCCTTTGGGATTTTTTTTTTA	0.294													5	3	---	---	---	---	
ZBTB10	65986	broad.mit.edu	37	8	81430889	81430890	+	Intron	INS	-	T	T	rs140340413	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81430889_81430890insT	uc003ybx.3	+						ZBTB10_uc003ybv.3_Intron|ZBTB10_uc003ybw.3_Intron|ZBTB10_uc010lzt.2_Intron	NM_001105539	NP_001099009	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10 isoform						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			lung(1)	1	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			CATGTTCTGCATTTTTTAAAAA	0.302													4	4	---	---	---	---	
PABPC1	26986	broad.mit.edu	37	8	101727375	101727388	+	Intron	DEL	ACACACACACACAT	-	-	rs10551908		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101727375_101727388delACACACACACACAT	uc003yjs.1	-						PABPC1_uc011lhc.1_Intron|PABPC1_uc011lhd.1_Intron|PABPC1_uc003yjt.1_Intron|PABPC1_uc003yju.2_Intron	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			acacacacacacacacacacacaTATATATCTCC	0.276													4	2	---	---	---	---	
GRHL2	79977	broad.mit.edu	37	8	102632112	102632113	+	Intron	DEL	TT	-	-	rs35192018		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102632112_102632113delTT	uc010mbu.2	+							NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3							cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			CAGTCAACtatttttttttttt	0.223													4	2	---	---	---	---	
FANCC	2176	broad.mit.edu	37	9	98009492	98009493	+	Intron	DEL	CG	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98009492_98009493delCG	uc004avh.2	-						FANCC_uc004avi.3_Intron|FANCC_uc010mrm.1_Intron|FANCC_uc011lul.1_Intron	NM_000136	NP_000127	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)				Ggtgcgtgcacgcgtgtgtgtg	0.292			D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	4	---	---	---	---	
MIR606	693191	broad.mit.edu	37	10	77312184	77312184	+	5'Flank	DEL	C	-	-	rs1367290		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77312184delC	hsa-mir-606|MI0003619	+																							0						ttttttttttcccccccctct	0.000													6	3	---	---	---	---	
ATE1	11101	broad.mit.edu	37	10	123673111	123673112	+	Intron	INS	-	AGAA	AGAA	rs143762121	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123673111_123673112insAGAA	uc001lfp.2	-						ATE1_uc001lfq.2_Intron|ATE1_uc010qtr.1_Intron|ATE1_uc010qts.1_Intron|ATE1_uc010qtt.1_Intron|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972	O95260	ATE1_HUMAN	arginyltransferase 1 isoform 2						protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				ACGCTAAACTCTTCTGATATAT	0.376													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130689354	130689365	+	IGR	DEL	GTGTGTGTGTGT	-	-	rs66667678		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130689354_130689365delGTGTGTGTGTGT								MKI67 (764886 upstream) : MGMT (576089 downstream)																							ggaaagcaGCgtgtgtgtgtgtgtgtgtgtgt	0.132													4	2	---	---	---	---	
C11orf40	143501	broad.mit.edu	37	11	4593180	4593181	+	Intron	INS	-	A	A	rs150576957	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4593180_4593181insA	uc010qyg.1	-							NM_144663	NP_653264	Q8WZ69	CK040_HUMAN	hypothetical protein LOC143501											ovary(2)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		CACAAGAGACCAAAAAAATCAA	0.386													5	3	---	---	---	---	
ACCSL	390110	broad.mit.edu	37	11	44072390	44072390	+	Intron	DEL	C	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44072390delC	uc001mxw.1	+						ACCSL_uc009ykr.2_Intron	NM_001031854	NP_001027025	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase								1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(5)	5						GGCCTGAGttctttttttttt	0.194													4	2	---	---	---	---	
MBD6	114785	broad.mit.edu	37	12	57920425	57920425	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57920425delG	uc001soj.1	+	7	1721	c.1497delG	c.(1495-1497)CTGfs	p.L499fs	MBD6_uc001sok.1_Frame_Shift_Del_p.L366fs|MBD6_uc001sol.1_RNA	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	499	Pro-rich.					chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4						CCGAAGGACTGGGGATGGGGG	0.647													217	51	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77054216	77054216	+	IGR	DEL	C	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77054216delC								OSBPL8 (100627 upstream) : ZDHHC17 (103638 downstream)																							AGGAGAGGCACCCCATATATG	0.378													74	19	---	---	---	---	
IFT81	28981	broad.mit.edu	37	12	110566592	110566593	+	Intron	DEL	AA	-	-	rs140214635		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110566592_110566593delAA	uc001tqi.2	+						IFT81_uc001tqh.2_Intron|IFT81_uc001tqj.2_Intron|IFT81_uc001tqg.2_Intron	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1						cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1						accctgtctcaaaaaaaaaaaa	0.114													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120706716	120706717	+	IGR	INS	-	A	A			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120706716_120706717insA								PXN (3153 upstream) : NME2P1 (13223 downstream)																							gagactctgtcaaaaaaaaaaa	0.030													4	2	---	---	---	---	
COG6	57511	broad.mit.edu	37	13	40233445	40233445	+	Intron	DEL	T	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40233445delT	uc001uxh.2	+						COG6_uc001uxi.2_Intron|COG6_uc010acb.2_Intron	NM_020751	NP_065802	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6 isoform						protein transport	Golgi membrane|Golgi transport complex				kidney(1)|skin(1)	2		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		TGTCTTGAGATTTGAAACCAT	0.294													44	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22694511	22694520	+	Intron	DEL	TGTGTCCGTG	-	-	rs113321665		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22694511_22694520delTGTGTCCGTG	uc001wbw.2	+						uc010aiv.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		Agtgtgtgtctgtgtccgtgtgtgtgcatg	0.338													4	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106993939	106993941	+	RNA	DEL	TAC	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106993939_106993941delTAC	uc010tyt.1	-	187		c.8506_8508delGTA								Parts of antibodies, mostly variable regions.												0						TAGTATATGGTACTACTACTACT	0.502													547	7	---	---	---	---	
ARIH1	25820	broad.mit.edu	37	15	72836954	72836955	+	Intron	DEL	AT	-	-	rs111299421		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72836954_72836955delAT	uc002aut.3	+							NM_005744	NP_005735	Q9Y4X5	ARI1_HUMAN	ariadne ubiquitin-conjugating enzyme E2 binding						ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding				0						GCTGTTTGCAATATATATATAT	0.252													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84911363	84911363	+	5'Flank	DEL	A	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84911363delA	uc010uov.1	-						uc010uow.1_5'Flank					DQ594729																		CAAGGAATTGAAAAAAAAAAA	0.378													43	7	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58528737	58528737	+	Intron	DEL	A	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58528737delA	uc002enm.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc010vif.1_Intron	NM_001130487	NP_001123959	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 2						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						ccctgtctctaaaaaaaaaaa	0.224													3	4	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8408461	8408461	+	Intron	DEL	C	-	-	rs67610561		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8408461delC	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						tagattccagccccagccccc	0.234													3	4	---	---	---	---	
ACLY	47	broad.mit.edu	37	17	40034197	40034198	+	Intron	DEL	TA	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40034197_40034198delTA	uc002hyg.2	-						ACLY_uc002hyh.2_Intron|ACLY_uc002hyi.2_Intron|ACLY_uc010wfx.1_Intron|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				aactctcctttatatatatata	0.124													4	2	---	---	---	---	
HOXB5	3215	broad.mit.edu	37	17	46671172	46671173	+	5'Flank	INS	-	G	G			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46671172_46671173insG	uc002inr.2	-							NM_002147	NP_002138	P09067	HXB5_HUMAN	homeobox B5							nucleus	sequence-specific DNA binding				0						CGGCCAAATATGGGGGGGGGGT	0.470											OREG0024519	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
TOM1L1	10040	broad.mit.edu	37	17	53016156	53016157	+	Intron	DEL	TT	-	-	rs71361741		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53016156_53016157delTT	uc002iud.2	+						TOM1L1_uc010dca.1_Intron|TOM1L1_uc010wnb.1_Intron|TOM1L1_uc010wnc.1_Intron|TOM1L1_uc010dbz.2_Intron|TOM1L1_uc010wnd.1_Intron|TOM1L1_uc010dcb.1_Intron	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1						intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						AATTAATCTCTTTTATTTGGTG	0.243													6	4	---	---	---	---	
TUBD1	51174	broad.mit.edu	37	17	57963684	57963684	+	Intron	DEL	A	-	-	rs113094238		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57963684delA	uc002ixw.1	-						TUBD1_uc010ddf.1_Intron|TUBD1_uc010ddg.1_Intron|TUBD1_uc010ddh.1_Intron|TUBD1_uc010wok.1_Intron|TUBD1_uc002ixx.1_Intron|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin						cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			GTCCAAATCCAAAAAAAAAAA	0.373													13	6	---	---	---	---	
NUP85	79902	broad.mit.edu	37	17	73204555	73204558	+	Intron	DEL	AAAG	-	-	rs137871424		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73204555_73204558delAAAG	uc002jng.1	+						NUP85_uc010dgd.1_Intron|NUP85_uc010wrv.1_Intron	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			aaaaaaaaaaaaagaaTGGAACAA	0.157													249	7	---	---	---	---	
B4GALT6	9331	broad.mit.edu	37	18	29218516	29218533	+	Intron	DEL	TACCTTATTAATCCTAAA	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29218516_29218533delTACCTTATTAATCCTAAA	uc002kwz.3	-						B4GALT6_uc010dma.2_Intron|B4GALT6_uc010dmb.2_Intron	NM_004775	NP_004766	Q9UBX8	B4GT6_HUMAN	beta-1,4-galactosyltransferase 6						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding				0			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			GAATCAGACTTACCTTATTAATCCTAAATATGTTTAAT	0.183													53	15	---	---	---	---	
HAPLN4	404037	broad.mit.edu	37	19	19379017	19379018	+	Intron	INS	-	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19379017_19379018insT	uc002nmc.2	-						TM6SF2_uc002nmd.1_Intron	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4						cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			tttcttttttcttttttttttt	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22551675	22551675	+	IGR	DEL	C	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22551675delC								ZNF676 (171922 upstream) : ZNF98 (22224 downstream)																							AATTCTATTACCAGGGGTTCG	0.478													86	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31443058	31443059	+	IGR	INS	-	CTCC	CTCC	rs144141390	by1000genomes	TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31443058_31443059insCTCC								ZNF536 (394093 upstream) : DKFZp566F0947 (197724 downstream)																							tccctccctctctccctccctc	0.005													3	3	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15843206	15843207	+	Intron	DEL	CA	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15843206_15843207delCA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				Tacacacacgcacacacacaca	0.287													5	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29614360	29614361	+	Intron	INS	-	T	T			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29614360_29614361insT	uc010ztk.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron					RecName: Full=Protein FRG1B;												0						ATTCTGAAAAAAGTTAACATTT	0.233													66	7	---	---	---	---	
CHRNA4	1137	broad.mit.edu	37	20	61982520	61982521	+	Intron	INS	-	C	C			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61982520_61982521insC	uc002yes.2	-						CHRNA4_uc002yet.1_Intron|CHRNA4_uc011aaw.1_Intron|CHRNA4_uc010gke.1_Intron|CHRNA4_uc002yev.1_Intron|CHRNA4_uc010gkf.1_Intron	NM_000744	NP_000735	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 subunit						B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)	cacatccacgtccacgcccaca	0.010													4	2	---	---	---	---	
PCNT	5116	broad.mit.edu	37	21	47864578	47864578	+	Intron	DEL	C	-	-	rs73909523		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47864578delC	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					TTTTTTTTTTCTTCTCTTGGT	0.463													170	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16915280	16915281	+	IGR	INS	-	T	T	rs148711386		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16915280_16915281insT								OR11H1 (465476 upstream) : CCT8L2 (156367 downstream)																							CTCCCTCACCAttttttttttt	0.129													2	4	---	---	---	---	
TNRC6B	23112	broad.mit.edu	37	22	40502242	40502242	+	Intron	DEL	T	-	-			TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40502242delT	uc003aym.2	+							NM_001024843	NP_001020014	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 3						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						CGAGGTTGTCTTTTTTTTTTT	0.234													3	4	---	---	---	---	
PRDX4	10549	broad.mit.edu	37	X	23702003	23702004	+	Intron	INS	-	A	A	rs34374279		TCGA-CH-5744-01	TCGA-CH-5744-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23702003_23702004insA	uc004dam.2	+							NM_006406	NP_006397	Q13162	PRDX4_HUMAN	peroxiredoxin 4						cell redox homeostasis|I-kappaB phosphorylation		thioredoxin peroxidase activity			upper_aerodigestive_tract(1)	1						tactaaaatacaaaaaaaaaaa	0.000													7	6	---	---	---	---	
