Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MIB2	142678	broad.mit.edu	37	1	1562677	1562677	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1562677T>G	uc001agg.2	+	12	1677	c.1550T>G	c.(1549-1551)GTG>GGG	p.V517G	MIB2_uc001agh.2_Missense_Mutation_p.V503G|MIB2_uc001agi.2_Missense_Mutation_p.V513G|MIB2_uc001agj.2_Missense_Mutation_p.V358G|MIB2_uc001agk.2_Missense_Mutation_p.V452G|MIB2_uc001agl.1_Missense_Mutation_p.V473G|MIB2_uc001agm.2_Missense_Mutation_p.V394G|MIB2_uc010nyq.1_Missense_Mutation_p.V473G|MIB2_uc009vkh.2_Missense_Mutation_p.V323G|MIB2_uc001agn.2_Missense_Mutation_p.V149G|MIB2_uc001ago.2_5'Flank	NM_080875	NP_543151	Q96AX9	MIB2_HUMAN	mindbomb homolog 2	517					Notch signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade	endosome	actin binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TCTTGGCAGGTGGACACCAAG	0.647													8	32	---	---	---	---	PASS
LCE2A	353139	broad.mit.edu	37	1	152671370	152671370	+	5'UTR	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152671370G>A	uc001faj.2	+	2						NM_178428	NP_848515	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A						keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAAAAAGTCGCACTGAGATG	0.473													37	98	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158617396	158617396	+	Missense_Mutation	SNP	G	A	A	rs143642542	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158617396G>A	uc001fst.1	-	27	4028	c.3829C>T	c.(3829-3831)CGT>TGT	p.R1277C		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1277	Spectrin 12.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCCTTTGTACGCCCCTGCAGG	0.562													14	208	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186094769	186094769	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186094769A>G	uc001grq.1	+	82	12762	c.12533A>G	c.(12532-12534)TAC>TGC	p.Y4178C	HMCN1_uc001grs.1_5'Flank	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4178	Ig-like C2-type 41.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GAAGGACACTACACGGTCAAT	0.388													5	98	---	---	---	---	PASS
UGP2	7360	broad.mit.edu	37	2	64114692	64114692	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64114692A>T	uc002scm.2	+	8	1534	c.1228A>T	c.(1228-1230)AGT>TGT	p.S410C	UGP2_uc002scl.2_Missense_Mutation_p.S399C|UGP2_uc010ypx.1_Missense_Mutation_p.S419C	NM_006759	NP_006750	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2 isoform a	410					glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0						AAACCTCTATAGTCTTAATGC	0.403													8	246	---	---	---	---	PASS
LOXL3	84695	broad.mit.edu	37	2	74763166	74763166	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74763166G>A	uc002smp.1	-	7	1277	c.1205C>T	c.(1204-1206)GCC>GTC	p.A402V	LOXL3_uc002smo.1_Missense_Mutation_p.A41V|LOXL3_uc010ffm.1_Missense_Mutation_p.A402V|LOXL3_uc002smq.1_Missense_Mutation_p.A257V|LOXL3_uc010ffn.1_Missense_Mutation_p.A257V	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	402	SRCR 3.					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						CCGGACCCCGGCATCCTGGCT	0.552													5	162	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133540002	133540002	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133540002G>A	uc002ttp.2	-	14	4756	c.4382C>T	c.(4381-4383)GCT>GTT	p.A1461V	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1461							protein binding				0						TGAACTCACAGCATCAGTCGC	0.502													19	68	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209212747	209212747	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209212747G>A	uc002vcz.2	+	35	5532	c.5374G>A	c.(5374-5376)GAT>AAT	p.D1792N		NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	1792	PIPK.				cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TGAGCCTCAAGGTGTGTTAAA	0.408													5	172	---	---	---	---	PASS
PRR21	643905	broad.mit.edu	37	2	240982173	240982173	+	Missense_Mutation	SNP	A	G	G	rs73107451	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240982173A>G	uc010zod.1	-	1	227	c.227T>C	c.(226-228)ATG>ACG	p.M76T		NM_001080835	NP_001074304	Q8WXC7	PRR21_HUMAN	proline rich 21	76	Pro-rich.									ovary(1)|skin(1)	2						ATGAAGGGACATGGGTGAAGA	0.612													3	64	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66463350	66463350	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66463350T>G	uc003dmx.2	-	6	750	c.736A>C	c.(736-738)AAC>CAC	p.N246H	LRIG1_uc010hnz.2_5'UTR|LRIG1_uc010hoa.2_Missense_Mutation_p.N246H	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	246	Extracellular (Potential).|LRR 8.					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TTGCTGATGTTGTTTCGCTGA	0.532													16	60	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184104857	184104857	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184104857A>G	uc003fov.2	+	18	2555	c.2309A>G	c.(2308-2310)GAC>GGC	p.D770G	CHRD_uc003fow.2_Missense_Mutation_p.D400G|CHRD_uc003fox.2_Missense_Mutation_p.D770G|CHRD_uc003foy.2_Missense_Mutation_p.D400G|CHRD_uc010hyc.2_Missense_Mutation_p.D360G|CHRD_uc011brr.1_Missense_Mutation_p.D312G	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	770					BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GATGTCAGAGACTTGCCAGGG	0.592													20	78	---	---	---	---	PASS
FYTTD1	84248	broad.mit.edu	37	3	197497068	197497068	+	Silent	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197497068G>A	uc003fyi.2	+	4	669	c.450G>A	c.(448-450)CAG>CAA	p.Q150Q	FYTTD1_uc011bui.1_Silent_p.Q124Q|FYTTD1_uc011buj.1_Intron|FYTTD1_uc011buk.1_Silent_p.Q83Q	NM_032288	NP_115664	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1 isoform 1	150					mRNA export from nucleus	nuclear speck	mRNA binding|protein binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		ATGAAGGGCAGAGGAAACCAG	0.348													4	21	---	---	---	---	PASS
TDO2	6999	broad.mit.edu	37	4	156835562	156835562	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156835562C>T	uc003ipf.1	+	8	878	c.814C>T	c.(814-816)CGT>TGT	p.R272C		NM_005651	NP_005642	P48775	T23O_HUMAN	tryptophan 2,3-dioxygenase	272					tryptophan catabolic process to kynurenine	cytosol	tryptophan 2,3-dioxygenase activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)	L-Tryptophan(DB00150)	TGATGAGAAACGTCATGAACA	0.348													17	46	---	---	---	---	PASS
PCDHGA2	56113	broad.mit.edu	37	5	140720334	140720334	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140720334G>T	uc003ljk.1	+	1	1981	c.1796G>T	c.(1795-1797)GGC>GTC	p.G599V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.G599V	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	599	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGACTCGGGCCAGAACGCC	0.697													10	113	---	---	---	---	PASS
TRIM41	90933	broad.mit.edu	37	5	180651243	180651243	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180651243T>G	uc003mne.1	+	1	938	c.244T>G	c.(244-246)TGG>GGG	p.W82G	uc003mnb.1_3'UTR|TRIM41_uc003mnc.1_Missense_Mutation_p.W82G|TRIM41_uc003mnd.1_Missense_Mutation_p.W82G|TRIM41_uc003mnf.1_RNA	NM_033549	NP_291027	Q8WV44	TRI41_HUMAN	tripartite motif-containing 41 isoform 1	82	Glu-rich.					cytoplasm|nucleus	ligase activity|protein binding|zinc ion binding				0	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCGCGGGGTGGGACACCCC	0.493													8	82	---	---	---	---	PASS
FAM50B	26240	broad.mit.edu	37	6	3850735	3850735	+	Silent	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3850735C>T	uc003mvu.2	+	2	802	c.690C>T	c.(688-690)GCC>GCT	p.A230A		NM_012135	NP_036267	Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	230						nucleus				pancreas(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				TGCGCTCCGCCGGCGTGGAGC	0.652													3	66	---	---	---	---	PASS
CYP21A2	1589	broad.mit.edu	37	6	31975463	31975463	+	3'UTR	SNP	T	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31975463T>C	uc010jtp.2	+	10					CYP21A2_uc011dpb.1_3'UTR			P08686	CP21A_HUMAN	SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2; SubName: Full=Cytochrome P450 21-hydroxylase; SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2, isoform CRA_b; SubName: Full=DJ34F7.3 (Cytochrome P450, subfamily XXIA (Steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21, P450c21B)); SubName: Full=cDNA, FLJ95495, Homo sapiens cytochrome P450, family 21, subfamily A, polypeptide 2(CYP21A2), mRNA;						glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						GCAGCGACTGTAGGAGGAGCT	0.657													3	25	---	---	---	---	PASS
MIR550-2	693134	broad.mit.edu	37	7	32772646	32772646	+	RNA	SNP	C	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32772646C>A	hsa-mir-550-2|MI0003601	+			c.54C>A			AVL9_uc011kai.1_Intron|LOC441208_uc003tcy.3_Intron																	0						CTGTTGTTGTCAGATAGTGTC	0.493													4	87	---	---	---	---	PASS
PMS2L11	441263	broad.mit.edu	37	7	76669240	76669240	+	Intron	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76669240C>T	uc011kgn.1	+						LOC100132832_uc003ufy.2_RNA					Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						TGAATACTTGCTTTGTTTCTT	0.353													6	237	---	---	---	---	PASS
COPG2	26958	broad.mit.edu	37	7	130290651	130290651	+	Intron	SNP	C	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130290651C>A	uc003vqh.1	-							NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)					agcactccaccaacatcttca	0.000													3	55	---	---	---	---	PASS
ZC3HAV1	56829	broad.mit.edu	37	7	138764546	138764546	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138764546G>C	uc003vun.2	-	4	1529	c.1141C>G	c.(1141-1143)CTA>GTA	p.L381V	ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Missense_Mutation_p.L381V	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	381					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						GCGGCAGGTAGCGTGGGAGAA	0.532													68	201	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144995013	144995013	+	Silent	SNP	G	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144995013G>T	uc003zaf.1	-	32	9557	c.9387C>A	c.(9385-9387)ATC>ATA	p.I3129I	PLEC_uc003zab.1_Silent_p.I2992I|PLEC_uc003zac.1_Silent_p.I2996I|PLEC_uc003zad.2_Silent_p.I2992I|PLEC_uc003zae.1_Silent_p.I2960I|PLEC_uc003zag.1_Silent_p.I2970I|PLEC_uc003zah.2_Silent_p.I2978I|PLEC_uc003zaj.2_Silent_p.I3019I	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3129	Plectin 6.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GCTCGCGGTCGATGACCCTGC	0.672													3	32	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385458	33385458	+	Intron	SNP	C	T	T	rs78260530	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385458C>T	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		ACAGCGTTGACACTCAGTGCA	0.607													4	34	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84202844	84202844	+	Intron	SNP	T	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84202844T>C	uc004aly.2	-						TLE1_uc004alz.2_Intron|TLE1_uc011lsr.1_Intron|TLE1_uc004ama.1_3'UTR	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1						negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						tgtgtgtgtgtgtgtgtgtgt	0.368													2	5	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84202845	84202845	+	Intron	SNP	G	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84202845G>C	uc004aly.2	-						TLE1_uc004alz.2_Intron|TLE1_uc011lsr.1_Intron|TLE1_uc004ama.1_3'UTR	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1						negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						gtgtgtgtgtgtgtgtgtgtg	0.368													2	5	---	---	---	---	PASS
ZNF782	158431	broad.mit.edu	37	9	99580381	99580381	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99580381C>T	uc004awp.1	-	6	2205	c.1924G>A	c.(1924-1926)GGG>AGG	p.G642R	ZNF782_uc011lup.1_Missense_Mutation_p.G510R	NM_001001662	NP_001001662	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	642					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				GGTTTCTCCCCGGTGTGAGTT	0.433													7	233	---	---	---	---	PASS
RPP38	10557	broad.mit.edu	37	10	15146203	15146203	+	3'UTR	SNP	G	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15146203G>C	uc001iny.3	+	3					RPP38_uc009xjm.2_3'UTR|RPP38_uc001inx.3_3'UTR	NM_183005	NP_892117	P78345	RPP38_HUMAN	ribonuclease P/MRP 38 subunit						tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity			ovary(1)	1						GTTTGTGAAAGGACACCTTGT	0.333													28	67	---	---	---	---	PASS
PANK1	53354	broad.mit.edu	37	10	91359112	91359112	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91359112A>T	uc001kgp.1	-	3	1363	c.1207T>A	c.(1207-1209)TGC>AGC	p.C403S	PANK1_uc001kgn.1_Missense_Mutation_p.C178S|PANK1_uc001kgo.1_Missense_Mutation_p.C178S|PANK1_uc009xtu.1_Missense_Mutation_p.C205S	NM_148977	NP_683878	Q8TE04	PANK1_HUMAN	pantothenate kinase 1 isoform alpha	403					coenzyme A biosynthetic process|pantothenate metabolic process	cytosol|nucleus	ATP binding|pantothenate kinase activity				0					Bezafibrate(DB01393)	TTATCAAGGCAGTACGGCTTT	0.448													38	338	---	---	---	---	PASS
C10orf81	79949	broad.mit.edu	37	10	115527188	115527188	+	Silent	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115527188C>T	uc001lat.1	+	4	853	c.291C>T	c.(289-291)GTC>GTT	p.V97V	C10orf81_uc001lar.1_Silent_p.V103V|C10orf81_uc009xyc.1_Silent_p.V15V|C10orf81_uc001las.1_Silent_p.V15V	NM_024889	NP_079165	Q5SXH7	CJ081_HUMAN	hypothetical protein LOC79949	97	PH.									central_nervous_system(1)	1		Colorectal(252;0.175)		Epithelial(162;0.0181)|all cancers(201;0.0204)		CTGATGAGGTCATGTCCATCA	0.403													25	73	---	---	---	---	PASS
HBG2	3048	broad.mit.edu	37	11	5275542	5275542	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5275542C>T	uc001mai.1	-	2	732	c.295G>A	c.(295-297)GTG>ATG	p.V99M	HBG2_uc001mak.1_RNA|HBG2_uc001maj.1_Missense_Mutation_p.V99M	NM_000559	NP_000550	P69892	HBG2_HUMAN	A-gamma globin	99					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCAGGATCCACATGCAGCTTG	0.498													46	276	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606429	55606429	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606429C>A	uc010rio.1	+	1	202	c.202C>A	c.(202-204)CTC>ATC	p.L68I		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				CCTCAACCACCTCTCCTTTGT	0.433													77	475	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88583140	88583140	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88583140G>A	uc001pcq.2	-	2	1045	c.845C>T	c.(844-846)ACG>ATG	p.T282M	GRM5_uc009yvm.2_Missense_Mutation_p.T282M	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	282	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	ACCTCTCACCGTCATGCCCTC	0.522													53	112	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15731856	15731856	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15731856C>T	uc001rcv.1	+	20	3073	c.2899C>T	c.(2899-2901)CGT>TGT	p.R967C	PTPRO_uc001rcw.1_Missense_Mutation_p.R939C|PTPRO_uc001rcx.1_Missense_Mutation_p.R156C|PTPRO_uc001rcy.1_Missense_Mutation_p.R156C|PTPRO_uc001rcz.1_Missense_Mutation_p.R128C|PTPRO_uc001rda.1_Missense_Mutation_p.R128C	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	967	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				ATGTAAAAACCGTTACACAAA	0.393													21	129	---	---	---	---	PASS
C12orf48	55010	broad.mit.edu	37	12	102558544	102558544	+	Intron	SNP	G	C	C	rs937954	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102558544G>C	uc001tjf.2	+						C12orf48_uc001tje.2_3'UTR|C12orf48_uc001tjg.2_Intron|C12orf48_uc010swa.1_Intron|C12orf48_uc001tjh.2_Intron|C12orf48_uc010swb.1_Intron|C12orf48_uc009zuc.2_Intron|C12orf48_uc001tjj.2_Intron|C12orf48_uc001tjk.2_Intron|C12orf48_uc009zud.2_Intron	NM_017915	NP_060385	Q9NWS1	PR1BP_HUMAN	hypothetical protein LOC55010						response to DNA damage stimulus	cytoplasm|nucleus	DNA binding				0						TTACCATATCGTTCAAGTTTG	0.308													16	5	---	---	---	---	PASS
UBC	7316	broad.mit.edu	37	12	125397358	125397358	+	Silent	SNP	T	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125397358T>C	uc001ugs.3	-	2	1408	c.960A>G	c.(958-960)GAA>GAG	p.E320E	UBC_uc001ugr.2_RNA|UBC_uc001ugu.1_Silent_p.E320E|UBC_uc001ugt.2_Silent_p.E320E|UBC_uc001ugv.2_Intron|UBC_uc001ugw.2_Silent_p.E168E	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	320	Ubiquitin-like 5.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TCGGCTCCACTTCGAGAGTGA	0.522													7	346	---	---	---	---	PASS
CCNA1	8900	broad.mit.edu	37	13	37006834	37006834	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37006834G>A	uc001uvr.3	+	1	426	c.76G>A	c.(76-78)GAA>AAA	p.E26K	CCNA1_uc010teo.1_Intron|CCNA1_uc010abq.2_Intron|CCNA1_uc010abp.2_Intron|CCNA1_uc001uvs.3_Missense_Mutation_p.E26K|CCNA1_uc010abr.2_RNA	NM_003914	NP_003905	P78396	CCNA1_HUMAN	cyclin A1 isoform a	26					cell division|G2/M transition of mitotic cell cycle|male meiosis I|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|spermatogenesis	cytosol|microtubule cytoskeleton|nucleoplasm	protein kinase binding			lung(2)|skin(2)|ovary(1)	5		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		TCTCAGCTGGGAAGGACCGGG	0.552													11	41	---	---	---	---	PASS
COMMD6	170622	broad.mit.edu	37	13	76112056	76112056	+	5'Flank	SNP	G	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76112056G>T	uc001vjo.1	-						COMMD6_uc001vjn.1_5'Flank|COMMD6_uc010aet.1_5'Flank|COMMD6_uc001vjp.1_RNA	NM_203495	NP_987091	Q7Z4G1	COMD6_HUMAN	COMM domain containing 6 isoform b							cytoplasm|nucleus	protein binding				0		Breast(118;0.0979)|Prostate(6;0.122)		GBM - Glioblastoma multiforme(99;0.0104)		AGCAGGGGAAGCTGAAAAAAG	0.488													11	37	---	---	---	---	PASS
GOLGA5	9950	broad.mit.edu	37	14	93264023	93264023	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93264023A>C	uc001yaz.1	+	2	423	c.241A>C	c.(241-243)ACT>CCT	p.T81P		NM_005113	NP_005104	Q8TBA6	GOGA5_HUMAN	Golgi autoantigen, golgin subfamily a, 5	81	Cytoplasmic (Potential).				Golgi organization	cis-Golgi network|integral to membrane	ATP binding|protein homodimerization activity|protein tyrosine kinase activity|Rab GTPase binding			ovary(2)|lung(1)	3		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		CTTAGCTGGCACTGCAAATGT	0.413			T	RET	papillary thyroid								10	175	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105411091	105411091	+	Missense_Mutation	SNP	G	A	A	rs143814844	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105411091G>A	uc010axc.1	-	7	10817	c.10697C>T	c.(10696-10698)ACG>ATG	p.T3566M	AHNAK2_uc001ypx.2_Missense_Mutation_p.T3466M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3566						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CACTTTGGGCGTCTTTAAACT	0.612													93	235	---	---	---	---	PASS
INO80	54617	broad.mit.edu	37	15	41384239	41384239	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41384239T>G	uc001zni.2	-	5	736	c.523A>C	c.(523-525)AGT>CGT	p.S175R	INO80_uc010ucu.1_RNA	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1	175	Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.				cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						TTGTCTTTACTATACTTATTT	0.328													57	184	---	---	---	---	PASS
EXD1	161829	broad.mit.edu	37	15	41482425	41482425	+	Intron	SNP	C	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41482425C>A	uc001znk.2	-						EXD1_uc001znj.2_5'UTR|EXD1_uc010ucv.1_Intron	NM_152596	NP_689809	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1						gtaatcccagcactctgggag	0.100													5	16	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63125610	63125610	+	Intron	SNP	T	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63125610T>G	uc002alb.3	+						TLN2_uc002alc.3_Intron|TLN2_uc010uic.1_Intron|uc002ale.1_RNA	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						AATAGGCAGGTGAAGAGCCAG	0.438													17	88	---	---	---	---	PASS
PARP16	54956	broad.mit.edu	37	15	65559013	65559013	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65559013C>T	uc002aoo.2	-	3	660	c.406G>A	c.(406-408)GCC>ACC	p.A136T	PARP16_uc002aop.2_Intron|PARP16_uc002aoq.2_Missense_Mutation_p.A136T	NM_017851	NP_060321	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16	136	PARP catalytic.					integral to membrane	NAD+ ADP-ribosyltransferase activity			lung(2)	2						TAAAATTTGGCGTTGGCTGGG	0.458													4	86	---	---	---	---	PASS
TXNDC11	51061	broad.mit.edu	37	16	11785489	11785489	+	Silent	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11785489G>A	uc010buu.1	-	9	1700	c.1638C>T	c.(1636-1638)TTC>TTT	p.F546F	TXNDC11_uc002dbg.1_Silent_p.F519F	NM_015914	NP_056998	Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	546					cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0						CAGAGTCGATGAAGCCTGACA	0.468													98	205	---	---	---	---	PASS
VWA3A	146177	broad.mit.edu	37	16	22120821	22120821	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22120821G>A	uc010vbq.1	+	7	598	c.502G>A	c.(502-504)GGG>AGG	p.G168R	VWA3A_uc010bxc.2_Missense_Mutation_p.G155R	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	168						extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		CCTCATCAAAGGGGCCAGAGT	0.512													9	16	---	---	---	---	PASS
PRKCB	5579	broad.mit.edu	37	16	24231486	24231486	+	3'UTR	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24231486G>A	uc002dmd.2	+	17					PRKCB_uc002dme.2_3'UTR	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	CAAGCCAAGCGTATGTATCAA	0.433													4	116	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27782957	27782957	+	Silent	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27782957G>A	uc002dow.2	+	22	4206	c.4182G>A	c.(4180-4182)CCG>CCA	p.P1394P		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	1394										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						ACGAGGCACCGCTGATGCCCT	0.607													7	134	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74425461	74425461	+	Missense_Mutation	SNP	A	G	G	rs2868593		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74425461A>G	uc010vmt.1	+	6	633	c.632A>G	c.(631-633)CAT>CGT	p.H211R						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		TGTCTCCTTCATCCCCTTCCA	0.493													8	244	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74444645	74444645	+	Intron	SNP	C	T	T	rs144170380	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74444645C>T	uc002fct.2	-						CLEC18B_uc002fcu.2_Intron|CLEC18B_uc010vmu.1_3'UTR	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region	sugar binding				0						CCTGGGCCCTCCCCGGGAAAG	0.682													3	37	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161164	90161164	+	Intron	SNP	G	A	A	rs8049480	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161164G>A	uc002fqp.2	+						uc002fqq.2_Missense_Mutation_p.V132I					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		ACACCCTCCTGTCCTCCGAGT	0.617													3	9	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161168	90161168	+	Intron	SNP	T	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161168T>G	uc002fqp.2	+						uc002fqq.2_Missense_Mutation_p.L133R					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		CCTCCTGTCCTCCGAGTCGAG	0.622													3	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161578	90161578	+	Silent	SNP	G	A	A	rs13337896	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161578G>A	uc002fqp.2	+	3	931	c.453G>A	c.(451-453)ACG>ACA	p.T151T	uc002fqq.2_Silent_p.T168T					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		GCCAAGGGACGCTACACCGAA	0.587													5	54	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10430104	10430104	+	Silent	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10430104G>A	uc010coi.2	-	30	4127	c.3999C>T	c.(3997-3999)AAC>AAT	p.N1333N	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.N1333N|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1333	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GCGCCAGGGCGTTCTTGGCCT	0.498													5	151	---	---	---	---	PASS
PGAP3	93210	broad.mit.edu	37	17	37830251	37830251	+	Silent	SNP	G	A	A	rs147768703	byFrequency	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37830251G>A	uc002hsj.2	-	5	595	c.552C>T	c.(550-552)TGC>TGT	p.C184C	PGAP3_uc010cvy.2_RNA|PGAP3_uc010wej.1_Silent_p.C163C|PGAP3_uc002hsk.2_Silent_p.C133C|PGAP3_uc010cvz.2_Intron	NM_033419	NP_219487	Q96FM1	PGAP3_HUMAN	per1-like domain containing 1 precursor	184	Helical; (Potential).				GPI anchor biosynthetic process	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	hydrolase activity, acting on ester bonds			upper_aerodigestive_tract(1)	1						CTCACCTGACGCAGCACAGGT	0.587													20	36	---	---	---	---	PASS
WNK4	65266	broad.mit.edu	37	17	40934857	40934857	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40934857G>A	uc002ibj.2	+	2	721	c.700G>A	c.(700-702)GTC>ATC	p.V234I	WNK4_uc010wgx.1_5'UTR|WNK4_uc002ibk.1_5'Flank|WNK4_uc010wgy.1_5'Flank	NM_032387	NP_115763	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	234	Protein kinase.				intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCCCAACATCGTCCGCTTCTA	0.602													24	60	---	---	---	---	PASS
NMT1	4836	broad.mit.edu	37	17	43138780	43138780	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43138780A>T	uc002ihz.2	+	1	101	c.83A>T	c.(82-84)GAG>GTG	p.E28V	DCAKD_uc010dab.1_5'Flank|NMT1_uc010dac.1_RNA|NMT1_uc002iia.2_RNA	NM_021079	NP_066565	P30419	NMT1_HUMAN	N-myristoyltransferase 1	28					activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|N-terminal protein myristoylation|protein lipoylation	actin cytoskeleton|cell junction|cytosol	glycylpeptide N-tetradecanoyltransferase activity				0		Prostate(33;0.155)				AACGGCCATGAGCACTGCAGC	0.602													3	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76497504	76497504	+	RNA	SNP	C	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76497504C>A	uc002jvt.1	+	2		c.2963C>A								Homo sapiens cDNA FLJ45552 fis, clone BRTHA2038279.																		AGCATGCCTCCAAGGCCGGTC	0.612													3	37	---	---	---	---	PASS
SLC1A6	6511	broad.mit.edu	37	19	15067354	15067354	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15067354C>T	uc002naa.1	-	6	1111	c.1103G>A	c.(1102-1104)CGG>CAG	p.R368Q	SLC1A6_uc010dzu.1_Intron|SLC1A6_uc010xod.1_Missense_Mutation_p.R304Q	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	368					synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	GAAGGGGTTCCGGTGAGTGAC	0.607													3	59	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	23159308	23159308	+	RNA	SNP	A	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23159308A>T	uc002nqy.1	-	3		c.842T>A			uc002nqz.1_Missense_Mutation_p.S213R					Homo sapiens zinc finger protein 117, mRNA (cDNA clone IMAGE:40112371).																		CTCCAGCATGACTTCTCTTAT	0.418													4	131	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	A	A	rs145250945		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385748G>A	uc002qqo.2	-	3	1282	c.1010C>T	c.(1009-1011)GCT>GTT	p.A337V	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337	C2H2-type 5.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						ACTGAAGCTAGCATATTTGCT	0.353													5	11	---	---	---	---	PASS
BANF2	140836	broad.mit.edu	37	20	17705710	17705710	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17705710G>A	uc002wpz.2	+	3	314	c.40G>A	c.(40-42)GAA>AAA	p.E14K	BANF2_uc010zrs.1_Missense_Mutation_p.E21K|BANF2_uc002wqa.2_Missense_Mutation_p.E14K	NM_178477	NP_848572	Q9H503	BAFL_HUMAN	barrier to autointegration factor 2 isoform 1	14						cytoplasm|nucleus	DNA binding			skin(1)	1						CTTCCTCTCCGAACCCATTGG	0.502													42	161	---	---	---	---	PASS
OGFR	11054	broad.mit.edu	37	20	61444845	61444845	+	Silent	SNP	G	A	A	rs112106909		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61444845G>A	uc002ydj.2	+	7	1913	c.1878G>A	c.(1876-1878)CCG>CCA	p.P626P	OGFR_uc002ydk.2_Silent_p.P609P|OGFR_uc002ydl.2_Silent_p.P574P|uc011aam.1_Intron	NM_007346	NP_031372	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	626	6.|7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)					GCCCCCGCCCGGCAGGACCTG	0.746													5	45	---	---	---	---	PASS
RTEL1	51750	broad.mit.edu	37	20	62321336	62321336	+	Intron	SNP	G	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62321336G>A	uc002yfu.1	+						RTEL1_uc011abc.1_Intron|RTEL1_uc002yft.1_Intron|RTEL1_uc011abd.1_Intron|RTEL1_uc011abe.1_Intron|RTEL1_uc002yfw.2_Intron|RTEL1_uc002yfx.1_5'UTR	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1						DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CCGGCTACTCGGGGTCAGCGT	0.692													17	41	---	---	---	---	PASS
C21orf29	54084	broad.mit.edu	37	21	46011149	46011149	+	Intron	SNP	T	C	C	rs62220886	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46011149T>C	uc002zfe.1	-						C21orf29_uc010gpv.1_Intron	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor						cell adhesion	extracellular region	structural molecule activity				0						TCCTGGTCCCTAAGACAAAGA	0.612													3	5	---	---	---	---	PASS
TSSK2	23617	broad.mit.edu	37	22	19119550	19119550	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19119550C>A	uc002zow.2	+	1	1230	c.638C>A	c.(637-639)TCC>TAC	p.S213Y	DGCR14_uc002zot.2_3'UTR|DGCR14_uc002zou.2_3'UTR|DGCR14_uc002zov.2_RNA	NM_053006	NP_443732	Q96PF2	TSSK2_HUMAN	testis-specific serine kinase 2	213	Protein kinase.				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)	1	Colorectal(54;0.0993)					GTCTGCGGCTCCATGCCCTAT	0.592													87	144	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22662971	22662971	+	Intron	SNP	A	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22662971A>G	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						TGTAAGTAAAATTCACTTTGG	0.323													3	31	---	---	---	---	PASS
EMID1	129080	broad.mit.edu	37	22	29628247	29628247	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29628247C>A	uc003aen.2	+	8	748	c.673C>A	c.(673-675)CCA>ACA	p.P225T	EMID1_uc003aem.2_Missense_Mutation_p.P227T|EMID1_uc003aeo.2_Missense_Mutation_p.P227T|EMID1_uc003aep.2_Missense_Mutation_p.P227T	NM_133455	NP_597712	Q96A84	EMID1_HUMAN	EMI domain containing 1	225	Collagen-like.					collagen					0						CATTGCAGGTCCACAGGGCCC	0.687													46	94	---	---	---	---	PASS
EIF3D	8664	broad.mit.edu	37	22	36906970	36906970	+	3'UTR	SNP	C	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36906970C>T	uc003apq.2	-	15					EIF3D_uc011amr.1_3'UTR|EIF3D_uc003apr.2_3'UTR|EIF3D_uc011ams.1_3'UTR|EIF3D_uc011amt.1_3'UTR	NM_003753	NP_003744	O15371	EIF3D_HUMAN	eukaryotic translation initiation factor 3							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			pancreas(1)	1						ACACACATTCCACTAAGCATC	0.403											OREG0026522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	84	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70344181	70344181	+	Silent	SNP	T	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70344181T>C	uc004dyy.2	+	13	2116	c.1917T>C	c.(1915-1917)GAT>GAC	p.D639D	MED12_uc011mpq.1_Silent_p.D639D|MED12_uc004dyz.2_Silent_p.D639D|MED12_uc004dza.2_Silent_p.D486D	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	639					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					CCTTTGATGATCCTGCCGATG	0.542													4	8	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129155089	129155089	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129155089C>A	uc004evb.1	+	5	3685	c.3571C>A	c.(3571-3573)CAG>AAG	p.Q1191K	BCORL1_uc010nrd.1_Missense_Mutation_p.Q1093K	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	1191					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						GCCGGAGTCCCAGTCTCCAGG	0.622													3	23	---	---	---	---	PASS
RENBP	5973	broad.mit.edu	37	X	153200994	153200994	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153200994G>T	uc004fjo.1	-	10	1283	c.1113C>A	c.(1111-1113)TAC>TAA	p.Y371*	NAA10_uc004fjm.1_5'Flank|NAA10_uc004fjn.1_5'Flank|NAA10_uc011mzg.1_5'Flank	NM_002910	NP_002901	P51606	RENBP_HUMAN	renin binding protein	371					mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity			ovary(1)|pancreas(1)	2	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	CTCGGCTCAGGTAGCCAAACC	0.542													7	76	---	---	---	---	PASS
WDR8	49856	broad.mit.edu	37	1	3566626	3566633	+	5'UTR	DEL	GCAGGCTG	-	-	rs3831025		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3566626_3566633delGCAGGCTG	uc001ako.2	-	1					WDR8_uc001akn.3_5'UTR|WDR8_uc010nzi.1_5'UTR|TP73_uc001akq.2_5'Flank|TP73_uc001akp.2_5'Flank	NM_017818	NP_060288	Q9P2S5	WRP73_HUMAN	WD repeat domain 8							centrosome	protein binding				0	all_cancers(77;0.0128)|all_epithelial(69;0.00526)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;4.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.16e-22)|GBM - Glioblastoma multiforme(42;1.05e-14)|Colorectal(212;1.19e-05)|BRCA - Breast invasive adenocarcinoma(365;2.67e-05)|COAD - Colon adenocarcinoma(227;5.82e-05)|Kidney(185;0.000364)|KIRC - Kidney renal clear cell carcinoma(229;0.00223)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TGGGCGCGCAGCAGGCTGCAACAGCCGA	0.683													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37568561	37568566	+	IGR	DEL	GAAGAA	-	-	rs849947		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37568561_37568566delGAAGAA								GRIK3 (68717 upstream) : ZC3H12A (371553 downstream)																							agaggaggaggaagaagaggaagagg	0.000													4	2	---	---	---	---	
EPS15	2060	broad.mit.edu	37	1	51822189	51822189	+	3'UTR	DEL	A	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51822189delA	uc001csq.1	-	25					EPS15_uc009vyz.1_3'UTR|EPS15_uc001csp.3_3'UTR	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway						cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						CTTTTATAAGAAAAAAAAAAA	0.348			T	MLL	ALL								5	3	---	---	---	---	
PTPN22	26191	broad.mit.edu	37	1	114381126	114381136	+	Intron	DEL	CACAATTAGTC	-	-	rs72483512		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114381126_114381136delCACAATTAGTC	uc001eds.2	-						PTPN22_uc009wgq.2_Intron|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Intron|PTPN22_uc009wgs.2_Intron|PTPN22_uc001edu.2_Intron	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type						negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATCTCCCAGACACAATTAGTCAACATTTAGA	0.370													148	30	---	---	---	---	
FMO5	2330	broad.mit.edu	37	1	146674694	146674695	+	Intron	INS	-	TT	TT	rs34383844		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146674694_146674695insTT	uc001epi.2	-						FMO5_uc001eph.3_Intron|FMO5_uc001epj.2_Intron	NM_001461	NP_001452	P49326	FMO5_HUMAN	flavin containing monooxygenase 5 isoform 1							integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			ovary(3)	3	all_hematologic(923;0.0487)					CAAAGGTTTTCTTTTTTTTTTT	0.213													1	5	---	---	---	---	
GAS5	60674	broad.mit.edu	37	1	173834333	173834333	+	Intron	DEL	A	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173834333delA	uc001gji.2	-						GAS5_uc001gjj.2_Intron|GAS5_uc001gjk.2_RNA|SNORD81_uc009wwi.1_5'Flank|SNORD47_uc001gjl.2_5'Flank|SNORD80_uc009wwj.1_5'Flank|ZBTB37_uc001gjp.1_5'Flank					Homo sapiens mRNA; cDNA DKFZp564D0164 (from clone DKFZp564D0164).												0						actcttgtctaaaaaaaaaaa	0.169													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	216260189	216260189	+	Intron	DEL	C	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216260189delC	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GAGAAATACACCTTCACCAGG	0.318										HNSCC(13;0.011)			51	15	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234458397	234458400	+	Intron	DEL	GTGT	-	-	rs71576415		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234458397_234458400delGTGT	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			ggtcaaAtgcgtgtgtgtgtgtgt	0.113													4	2	---	---	---	---	
RRM2	6241	broad.mit.edu	37	2	10264236	10264237	+	Intron	DEL	TT	-	-	rs71391192		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10264236_10264237delTT	uc002rah.2	+							NM_001034	NP_001025	P31350	RIR2_HUMAN	ribonucleotide reductase M2 polypeptide isoform						deoxyribonucleoside diphosphate metabolic process|deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol	ribonucleoside-diphosphate reductase activity|transition metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)		CTGCCCCCTCtttttttttttt	0.223													4	2	---	---	---	---	
MATN3	4148	broad.mit.edu	37	2	20201952	20201953	+	Intron	INS	-	ACACACAG	ACACACAG	rs147407955	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20201952_20201953insACACACAG	uc002rdl.2	-						MATN3_uc010exu.1_Intron	NM_002381	NP_002372	O15232	MATN3_HUMAN	matrilin 3 precursor						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					cacacacacacaGAGCTAATGA	0.173													4	2	---	---	---	---	
PUM2	23369	broad.mit.edu	37	2	20453929	20453929	+	Intron	DEL	T	-	-	rs149877577		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20453929delT	uc002rds.1	-						PUM2_uc002rdq.1_Intron|PUM2_uc002rdt.1_Intron|PUM2_uc002rdr.2_Intron|PUM2_uc010yjy.1_Intron|PUM2_uc002rdu.1_Intron|PUM2_uc010yjz.1_Intron	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2						regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					tattttgttcttttttttttt	0.134													5	5	---	---	---	---	
PNPT1	87178	broad.mit.edu	37	2	55894349	55894349	+	Intron	DEL	A	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55894349delA	uc002rzf.2	-						PNPT1_uc002rzg.2_Intron	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1						mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			gtggaactttaaaaaataata	0.104													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102177224	102177233	+	IGR	DEL	ACACACACAT	-	-	rs70946654	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102177224_102177233delACACACACAT								RFX8 (86059 upstream) : MAP4K4 (137255 downstream)																							acacacacacacacacacatgcaggacact	0.000													4	2	---	---	---	---	
CCDC93	54520	broad.mit.edu	37	2	118743736	118743737	+	Intron	INS	-	T	T	rs67284435		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118743736_118743737insT	uc002tlj.2	-						CCDC93_uc010fld.1_Intron	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93											large_intestine(1)|ovary(1)	2						GGTATAttctcttttttttttt	0.248													59	7	---	---	---	---	
GALNT5	11227	broad.mit.edu	37	2	158165415	158165416	+	Intron	INS	-	T	T	rs140945706	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158165415_158165416insT	uc002tzg.2	+						GALNT5_uc010zci.1_Intron	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5						glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						TTGACAAGTCCtttttttttta	0.307													4	2	---	---	---	---	
IL5RA	3568	broad.mit.edu	37	3	3118006	3118007	+	Intron	DEL	TG	-	-	rs3217673		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3118006_3118007delTG	uc011ask.1	-						IL5RA_uc010hbq.2_Intron|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Intron|IL5RA_uc011asl.1_Intron|IL5RA_uc010hbp.2_Intron	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1						cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		AGGGCTGCATTGTGTGCTCTGT	0.441													5	4	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10077771	10077771	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10077771delT	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc003buv.2_Intron	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TATACAtttcttttttttttt	0.154			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
ITGA9	3680	broad.mit.edu	37	3	37512670	37512671	+	Intron	DEL	TA	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37512670_37512671delTA	uc003chd.2	+						ITGA9_uc003chc.2_Intron	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TCTGTACCCTTATACCTTGCTC	0.391													113	53	---	---	---	---	
SEPT11	55752	broad.mit.edu	37	4	77935815	77935815	+	Intron	DEL	A	-	-	rs35467273		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77935815delA	uc003hkj.2	+						SEPT11_uc010ijh.1_Intron|SEPT11_uc011cca.1_Intron|SEPT11_uc003hkk.1_5'Flank	NM_018243	NP_060713	Q9NVA2	SEP11_HUMAN	septin 11						cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0						TCTCTACCCCAAAAAAAAAAA	0.199													3	4	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170345692	170345692	+	Intron	DEL	C	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170345692delC	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGTTTTTAAGCCTTTCTTTTT	0.338			T	TRD@	ALL								108	32	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	499431	499438	+	Intron	DEL	ACACACAC	-	-	rs4061197		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:499431_499438delACACACAC	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TCACAGTTAAacacacacacacacacac	0.274													5	3	---	---	---	---	
HCG22	285834	broad.mit.edu	37	6	31023076	31023078	+	RNA	DEL	GAG	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31023076_31023078delGAG	uc010jsi.1	+	1		c.1093_1095delGAG			HCG22_uc003nsj.1_Intron	NR_003948				Homo sapiens HLA complex group 22 (HCG22), non-coding RNA.												0						aaaaaaaaaaGAGAGAGAGAGAG	0.177													4	5	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36580193	36580194	+	Intron	DEL	CA	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36580193_36580194delCA	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						cacacatacgcacacacacaca	0.158													33	8	---	---	---	---	
WBSCR27	155368	broad.mit.edu	37	7	73249451	73249456	+	Intron	DEL	CTCTCC	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73249451_73249456delCTCTCC	uc003tzj.2	-						RFC2_uc011kfa.1_Intron	NM_152559	NP_689772	Q8N6F8	WBS27_HUMAN	Williams-Beuren syndrome chromosome region 27											central_nervous_system(1)	1		Lung NSC(55;0.159)				TGGGGACGCTctctccctctccctct	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	101977896	101977896	+	IGR	DEL	C	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101977896delC								SH2B2 (15719 upstream) : SPDYE6 (8297 downstream)																							TTGGGAAACGCAAAAACAGTT	0.343													86	27	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141036751	141036752	+	IGR	INS	-	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141036751_141036752insA								MRPS33 (321970 upstream) : AGK (214326 downstream)																							accatcaccaccaccaccatca	0.000													4	3	---	---	---	---	
SGK223	157285	broad.mit.edu	37	8	8186101	8186102	+	Intron	INS	-	TTTCTA	TTTCTA	rs143704562	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8186101_8186102insTTTCTA	uc003wsh.3	-							NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin								ATP binding|non-membrane spanning protein tyrosine kinase activity				0						ATGTTACTTCTTTTCTATTTCT	0.351													4	2	---	---	---	---	
NKX3-1	4824	broad.mit.edu	37	8	23539135	23539135	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23539135delA	uc011kzx.1	-	2	352	c.304delT	c.(304-306)TATfs	p.Y102fs	NKX3-1_uc003xdv.1_Intron	NM_006167	NP_006158	Q99801	NKX31_HUMAN	NK3 homeobox 1	102					negative regulation of estrogen receptor binding|negative regulation of transcription, DNA-dependent|positive regulation of cell division|positive regulation of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter	nucleus	estrogen receptor activity|estrogen receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region sequence-specific DNA binding				0		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		TCCAACAGATAAGACCCCAAG	0.527													178	55	---	---	---	---	
ZNF395	55893	broad.mit.edu	37	8	28209153	28209154	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28209153_28209154insA	uc003xgq.2	-	7	1179_1180	c.1091_1092insT	c.(1090-1092)CTGfs	p.L364fs	ZNF395_uc003xgt.2_Frame_Shift_Ins_p.L364fs|ZNF395_uc003xgr.2_Frame_Shift_Ins_p.L364fs|ZNF395_uc003xgs.2_Frame_Shift_Ins_p.L364fs	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	364					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GAAGAGCAGACAGAGGCAGGCC	0.564													257	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	32943960	32943960	+	IGR	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32943960delT								NRG1 (321402 upstream) : FUT10 (284386 downstream)																							AACTGGGTGCTTGTGGAGGGT	0.498													4	2	---	---	---	---	
BEYLA	497634	broad.mit.edu	37	8	47752236	47752237	+	5'Flank	INS	-	AA	AA	rs141101713	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47752236_47752237insAA	uc010lxr.1	+						BEYLA_uc003xqb.1_5'Flank	NR_027013				Homo sapiens cDNA FLJ40156 fis, clone TESTI2014385.												0						gccctgcacttacagtgcattg	0.000													4	4	---	---	---	---	
GGH	8836	broad.mit.edu	37	8	63928200	63928201	+	Intron	INS	-	AA	AA			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63928200_63928201insAA	uc003xuw.2	-							NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor						glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)	acttactttcCAAAAAAAAAAA	0.248													4	4	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110479117	110479117	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110479117delT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AACATTTATATTAGAGTCCAA	0.284										HNSCC(38;0.096)			4	2	---	---	---	---	
HAUS6	54801	broad.mit.edu	37	9	19086616	19086616	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19086616delT	uc003znk.2	-						HAUS6_uc003znl.1_Intron	NM_017645	NP_060115	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2						agactccaactccaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45362789	45362791	+	IGR	DEL	TTC	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45362789_45362791delTTC								FAM27C (371298 upstream) : FAM27A (364238 downstream)																							CTTCAGCCTGTTCTTCTTCAGTC	0.468													5	3	---	---	---	---	
NXNL2	158046	broad.mit.edu	37	9	91150746	91150747	+	Intron	INS	-	C	C	rs150222723	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91150746_91150747insC	uc011ltj.1	+						NXNL2_uc004aqa.2_Intron	NM_001161625	NP_001155097	Q5VZ03	NXNL2_HUMAN	nucleoredoxin-like 2 isoform 1												0						TCTTTATGACGCCCCCCCCCAA	0.559													7	4	---	---	---	---	
TACC2	10579	broad.mit.edu	37	10	123984580	123984580	+	Intron	DEL	A	-	-	rs141557836		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123984580delA	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron|TACC2_uc001lfx.2_Intron|TACC2_uc001lfy.2_Intron|TACC2_uc001lfz.2_Intron|TACC2_uc001lga.2_Intron|TACC2_uc009xzy.2_Intron|TACC2_uc001lgb.2_Intron|TACC2_uc010qtw.1_Intron	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AGATTTCTTTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	9652949	9652950	+	IGR	INS	-	T	T			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9652949_9652950insT								WEE1 (41638 upstream) : SWAP70 (32678 downstream)																							GTTGTAtttccttttttttttt	0.173													4	2	---	---	---	---	
ARFGAP2	84364	broad.mit.edu	37	11	47189416	47189417	+	Intron	INS	-	A	A	rs34204386		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47189416_47189417insA	uc001ndt.2	-						ARFGAP2_uc010rha.1_Intron|ARFGAP2_uc010rhb.1_Intron|ARFGAP2_uc001ndu.2_Intron|ARFGAP2_uc010rhc.1_Intron	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating						protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						TCAGCTTGTTTaaaaaaaaaaa	0.243													5	6	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42693022	42693024	+	Intron	DEL	AAG	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42693022_42693024delAAG	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		aaaaaagaaaaagaaggaaggaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54282976	54282977	+	IGR	INS	-	C	C			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54282976_54282977insC								CALCOCO1 (161669 upstream) : HOXC13 (49599 downstream)																							tcctttcctttcttccttcctt	0.000													3	3	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100774908	100774915	+	Intron	DEL	CATCTCAG	-	-	rs68046331		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774908_100774915delCATCTCAG	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TAGCTCCTCCcatctcagcatctcagca	0.221													6	3	---	---	---	---	
TCTN2	79867	broad.mit.edu	37	12	124171487	124171488	+	Frame_Shift_Ins	INS	-	ACGAC	ACGAC			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124171487_124171488insACGAC	uc001ufp.2	+	6	797_798	c.669_670insACGAC	c.(667-672)ACGACGfs	p.T223fs	TCTN2_uc009zya.2_Frame_Shift_Ins_p.T222fs	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	223_224	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CTGCTGGGACGACGACACGTGG	0.525													799	7	---	---	---	---	
JAG2	3714	broad.mit.edu	37	14	105608921	105608922	+	3'UTR	INS	-	T	T	rs145952626	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105608921_105608922insT	uc001yqg.2	-	26					JAG2_uc010axf.2_Frame_Shift_Ins_p.T100fs|JAG2_uc001yqf.2_3'UTR|JAG2_uc001yqh.2_3'UTR	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor						auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GTTTTTGGTGGTTTTTTTACAC	0.460													4	2	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27777594	27777594	+	Intron	DEL	G	-	-	rs78224205		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27777594delG	uc001zbg.1	+							NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		AAAAAAAAAAGACCAACTCTC	0.259													4	2	---	---	---	---	
FMN1	342184	broad.mit.edu	37	15	33256124	33256125	+	Intron	INS	-	CA	CA	rs138573790	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33256124_33256125insCA	uc001zhf.3	-							NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		TTCCTATGAATcacacacacac	0.302													17	7	---	---	---	---	
HAUS2	55142	broad.mit.edu	37	15	42851335	42851335	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42851335delT	uc001zqe.2	+						HAUS2_uc010udi.1_Intron|HAUS2_uc001zqf.2_Intron	NM_018097	NP_060567	Q9NVX0	HAUS2_HUMAN	centrosomal protein 27kDa isoform 1						cell division|centrosome organization|G2/M transition of mitotic cell cycle|mitosis|spindle assembly	centrosome|cytosol|HAUS complex|microtubule|spindle					0						CCCTGGACTCttttttttttt	0.109													3	3	---	---	---	---	
AAGAB	79719	broad.mit.edu	37	15	67496224	67496224	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67496224delT	uc002aqk.3	-						AAGAB_uc002aql.2_Intron|AAGAB_uc010uju.1_Intron	NM_024666	NP_078942	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin-binding protein p34						protein transport	cytoplasm					0						CCCCAGGGAATTTTTTTTTTT	0.363													4	2	---	---	---	---	
PRSS21	10942	broad.mit.edu	37	16	2867531	2867531	+	Intron	DEL	A	-	-	rs111876704		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2867531delA	uc002crt.2	+						PRSS21_uc002crs.2_Intron|PRSS21_uc002crr.2_Intron	NM_006799	NP_006790	Q9Y6M0	TEST_HUMAN	testisin isoform 1						proteolysis	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	serine-type endopeptidase activity			ovary(1)|skin(1)	2						GAGGGGGTAGAGGGGGGCCTT	0.697													4	5	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25031511	25031512	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs7498498	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25031511_25031512insGGAAGGAA								ARHGAP17 (4836 upstream) : LCMT1 (91535 downstream)																							gaaggaaggacggaaggaagga	0.144													4	2	---	---	---	---	
ATXN2L	11273	broad.mit.edu	37	16	28845028	28845035	+	Intron	DEL	GATCAGGG	-	-	rs141681863		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28845028_28845035delGATCAGGG	uc002drc.2	+						uc010vct.1_Intron|ATXN2L_uc002drb.2_Intron|ATXN2L_uc002dqy.2_Intron|ATXN2L_uc002dra.2_Intron|ATXN2L_uc002dqz.2_Intron|ATXN2L_uc010vdb.1_Intron|ATXN2L_uc002dre.2_Intron|ATXN2L_uc002drf.2_Intron|ATXN2L_uc002drg.2_5'Flank	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A							membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AGGTTTGGGTGATCAGGGGATCAGGGAT	0.423													3	3	---	---	---	---	
SETD1A	9739	broad.mit.edu	37	16	30978990	30978991	+	Intron	INS	-	G	G			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30978990_30978991insG	uc002ead.1	+							NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						TGAAGGGGTCAGGTCGTCCTGA	0.559													21	7	---	---	---	---	
ELAC2	60528	broad.mit.edu	37	17	12908601	12908606	+	Intron	DEL	GTAACT	-	-	rs10532461		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12908601_12908606delGTAACT	uc002gnz.3	-						ELAC2_uc002gnv.3_5'Flank|ELAC2_uc002gnw.3_5'Flank|ELAC2_uc002gnx.3_Intron|ELAC2_uc010vvo.1_Intron|ELAC2_uc010vvp.1_Intron|ELAC2_uc010vvq.1_Intron|ELAC2_uc010vvr.1_Intron	NM_018127	NP_060597	Q9BQ52	RNZ2_HUMAN	elaC homolog 2 isoform 1						tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0						ACCTAAACAGGTAACTGTCAGGTTGA	0.466									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
CDC6	990	broad.mit.edu	37	17	38450980	38450980	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38450980delT	uc002huj.1	+							NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein						cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						ACCCAAGCGCttttttttttt	0.194													7	4	---	---	---	---	
KRT33B	3884	broad.mit.edu	37	17	39523970	39523970	+	Intron	DEL	A	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39523970delA	uc002hwl.2	-							NM_002279	NP_002270	Q14525	KT33B_HUMAN	type I hair keratin 3B							intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				taaaaaaattaaaaaaaaaaa	0.005													4	2	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49353083	49353083	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49353083delT	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			TTGTTTTTTGTTTTTTTTTTT	0.289													11	5	---	---	---	---	
TMEM49	81671	broad.mit.edu	37	17	57886365	57886365	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57886365delT	uc002ixu.3	+						TMEM49_uc010wog.1_Intron|TMEM49_uc010woh.1_Intron|TMEM49_uc010woi.1_Intron|TMEM49_uc010woj.1_Intron	NM_030938	NP_112200	Q96GC9	VMP1_HUMAN	transmembrane protein 49						autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)			ATCATTCACCttttttttttt	0.144													9	4	---	---	---	---	
KIF19	124602	broad.mit.edu	37	17	72324649	72324650	+	Intron	INS	-	C	C	rs143135995	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72324649_72324650insC	uc002jkm.3	+						KIF19_uc002jkj.2_Intron|KIF19_uc002jkk.2_Intron|KIF19_uc002jkl.2_Intron	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						GAGCAGGTATGCAGGGCTCTGC	0.629													10	7	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78796595	78796596	+	Intron	INS	-	GTGT	GTGT	rs142092009	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78796595_78796596insGTGT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						tatgtgtgtgcgtgtatttgtg	0.119													3	3	---	---	---	---	
C19orf10	56005	broad.mit.edu	37	19	4668862	4668862	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4668862delT	uc002may.2	-							NM_019107	NP_061980	Q969H8	CS010_HUMAN	hypothetical protein LOC56005 precursor							ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		acccgactaattttttttttt	0.000													4	3	---	---	---	---	
MAP3K10	4294	broad.mit.edu	37	19	40715309	40715309	+	Intron	DEL	T	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40715309delT	uc002ona.2	+						MAP3K10_uc002onb.2_Intron	NM_002446	NP_002437	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity			ovary(2)|lung(2)|skin(1)|pancreas(1)	6						ggataatttcttttttttttt	0.000													7	4	---	---	---	---	
HNRNPUL1	11100	broad.mit.edu	37	19	41797899	41797899	+	Intron	DEL	C	-	-	rs66916970		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41797899delC	uc002oqb.3	+						CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Intron|HNRNPUL1_uc002oqa.3_Intron|HNRNPUL1_uc010ehm.2_Intron|HNRNPUL1_uc002oqc.3_Intron|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Intron|HNRNPUL1_uc010ehn.2_Intron|HNRNPUL1_uc010eho.2_Intron|HNRNPUL1_uc010xvy.1_Intron|HNRNPUL1_uc010ehp.2_Intron|HNRNPUL1_uc010ehl.1_Intron	NM_007040	NP_008971	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1						nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2						aaaaaaaaaacaaaaaaaaaa	0.204													3	5	---	---	---	---	
HSD17B14	51171	broad.mit.edu	37	19	49337709	49337709	+	Intron	DEL	G	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49337709delG	uc002pkv.1	-						HSD17B14_uc010emk.1_Intron	NM_016246	NP_057330	Q9BPX1	DHB14_HUMAN	dehydrogenase/reductase (SDR family) member 10						steroid catabolic process	centrosome|cytosol	estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NADP+) activity				0		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		aggaggtgctgggggcctgga	0.000													6	3	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50764079	50764080	+	Intron	INS	-	GT	GT	rs140241247	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50764079_50764080insGT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		tgtgtgtgcaagtgtgtgtgca	0.094													9	7	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074492	62074494	+	Intron	DEL	CAC	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074492_62074494delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaccatcatcaccaccaccatc	0.000													3	3	---	---	---	---	
RBM11	54033	broad.mit.edu	37	21	15585613	15585616	+	5'Flank	DEL	TTCC	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15585613_15585616delTTCC	uc002yjo.3	+						RBM11_uc002yjn.3_5'Flank|RBM11_uc002yjp.3_5'Flank	NM_144770	NP_658983	P57052	RBM11_HUMAN	RNA binding motif protein 11								nucleotide binding|RNA binding				0				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		CCAAcctcctttccttccttcctt	0.137													6	3	---	---	---	---	
RAB36	9609	broad.mit.edu	37	22	23498332	23498333	+	Intron	INS	-	AA	AA	rs56254210		TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23498332_23498333insAA	uc002zwv.1	+						RAB36_uc010gtw.1_Intron	NM_004914	NP_004905	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		TGTCCTCCAAGACCCACTGAGA	0.594													6	3	---	---	---	---	
EIF2S3	1968	broad.mit.edu	37	X	24095041	24095043	+	3'UTR	DEL	CTC	-	-	rs5949273	by1000genomes	TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24095041_24095043delCTC	uc004dbc.2	+	12						NM_001415	NP_001406	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2,							cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			lung(1)	1						TAAGGTTAttctctttttttttt	0.286													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9368302	9368303	+	IGR	DEL	TG	-	-			TCGA-CH-5745-01	TCGA-CH-5745-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9368302_9368303delTG								TSPY1 (20913 upstream) : RBMY3AP (80027 downstream)																							ACTCtgtgtctgtgtgtgtgtg	0.262													5	3	---	---	---	---	
