Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCC	9696	broad.mit.edu	37	1	17272075	17272075	+	Missense_Mutation	SNP	G	A	A	rs2781608	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17272075G>A	uc001azt.2	+	15	2179	c.2110G>A	c.(2110-2112)GCC>ACC	p.A704T	CROCC_uc009voz.1_Missense_Mutation_p.A467T|CROCC_uc001azu.2_Missense_Mutation_p.A7T	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	704	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GGCCGAGAAGGCCGAGGTGGC	0.657													5	34	---	---	---	---	PASS
TXLNA	200081	broad.mit.edu	37	1	32657918	32657918	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32657918G>C	uc001bui.2	+	7	1035	c.970G>C	c.(970-972)GAC>CAC	p.D324H	TXLNA_uc001buj.2_Missense_Mutation_p.D324H	NM_175852	NP_787048	P40222	TXLNA_HUMAN	taxilin	324	Potential.				cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GCAGCATATCGACAAAGTCTT	0.587													12	128	---	---	---	---	PASS
TMEM61	199964	broad.mit.edu	37	1	55457539	55457539	+	Silent	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55457539C>T	uc001cyd.2	+	3	670	c.396C>T	c.(394-396)TAC>TAT	p.Y132Y		NM_182532	NP_872338	Q8N0U2	TMM61_HUMAN	transmembrane protein 61	132						integral to membrane					0						TCCCCACTTACGAGGAAGCCG	0.627													10	140	---	---	---	---	PASS
CACHD1	57685	broad.mit.edu	37	1	65147750	65147750	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65147750C>T	uc001dbo.1	+	26	3499	c.3394C>T	c.(3394-3396)CGC>TGC	p.R1132C	CACHD1_uc001dbp.1_Missense_Mutation_p.R887C|CACHD1_uc001dbq.1_Missense_Mutation_p.R887C|CACHD1_uc010opa.1_Missense_Mutation_p.R376C	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1	1183	Cytoplasmic (Potential).				calcium ion transport	integral to membrane				ovary(2)	2						AGAAAGAAGGCGCCGCTACTG	0.493													4	59	---	---	---	---	PASS
DEPDC1	55635	broad.mit.edu	37	1	68948183	68948183	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68948183C>G	uc001dem.3	-	8	1425	c.1308G>C	c.(1306-1308)GAG>GAC	p.E436D	DEPDC1_uc001dej.3_5'Flank|DEPDC1_uc001dek.3_Intron|DEPDC1_uc001del.3_Intron	NM_001114120	NP_001107592	Q5TB30	DEP1A_HUMAN	DEP domain containing 1 isoform a	436					intracellular signal transduction|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	GTPase activator activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		CACTGGATGCCTCTTTACTTG	0.373													9	227	---	---	---	---	PASS
CA14	23632	broad.mit.edu	37	1	150235768	150235768	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150235768G>C	uc001etx.2	+	8	1100	c.791G>C	c.(790-792)CGA>CCA	p.R264P		NM_012113	NP_036245	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV precursor	264	Extracellular (Potential).					integral to membrane	carbonate dehydratase activity|metal ion binding			ovary(1)	1	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGAACTACCGAGCCCTTCAG	0.522													11	112	---	---	---	---	PASS
ZBTB7B	51043	broad.mit.edu	37	1	154988116	154988116	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154988116C>A	uc001fgk.3	+	3	1138	c.980C>A	c.(979-981)GCA>GAA	p.A327E	ZBTB7B_uc009wpa.2_Missense_Mutation_p.A327E|ZBTB7B_uc001fgj.3_Missense_Mutation_p.A361E|ZBTB7B_uc010peq.1_Missense_Mutation_p.A361E|ZBTB7B_uc001fgl.3_Missense_Mutation_p.A327E	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	327					cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GACAACCTGGCACCAGGCCTG	0.632													8	76	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181724376	181724376	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181724376G>A	uc001gow.2	+	28	3997	c.3832G>A	c.(3832-3834)GTC>ATC	p.V1278I	CACNA1E_uc009wxs.2_Missense_Mutation_p.V1166I|CACNA1E_uc001gox.1_Missense_Mutation_p.V504I|CACNA1E_uc009wxt.2_Missense_Mutation_p.V504I	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1278	Cytoplasmic (Potential).|III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TCCACAGGCCGTCTTCGACTG	0.517													4	90	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214656762	214656762	+	Intron	SNP	T	G	G	rs77163514	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214656762T>G	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|uc010ptz.1_RNA	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TGGGCACTGGTGGCCAGGGCG	0.607													3	11	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242253152	242253152	+	3'UTR	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242253152C>T	uc001hzn.1	-	10					PLD5_uc001hzl.3_3'UTR|PLD5_uc001hzm.3_3'UTR|PLD5_uc001hzo.1_3'UTR			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			GTTTCTTCATCATGTTATACG	0.413													51	267	---	---	---	---	PASS
HNRPLL	92906	broad.mit.edu	37	2	38818746	38818746	+	Silent	SNP	G	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38818746G>C	uc002rqw.2	-	2	644	c.234C>G	c.(232-234)GTC>GTG	p.V78V	HNRPLL_uc002rqx.2_Silent_p.V73V	NM_138394	NP_612403	Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	78	RRM 1.				mRNA processing|positive regulation of RNA splicing	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding			skin(1)	1		all_hematologic(82;0.248)				CTCGAACATGGACGACGGGTG	0.388													17	123	---	---	---	---	PASS
MRPL30	51263	broad.mit.edu	37	2	99812070	99812070	+	Missense_Mutation	SNP	G	A	A	rs1044575	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99812070G>A	uc002szu.2	+	6	550	c.388G>A	c.(388-390)GCA>ACA	p.A130T	MRPL30_uc002szl.1_RNA|MRPL30_uc002szt.1_RNA|MRPL30_uc002szv.2_Missense_Mutation_p.A130T	NM_145213	NP_660214	Q8TCC3	RM30_HUMAN	RecName: Full=39S ribosomal protein L30, mitochondrial;          Short=L30mt; AltName: Full=MRP-L30; AltName: Full=MRP-L28; Flags: Precursor;	130					translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1						AGGACTTCCAGCAGAGGAGAA	0.373													6	197	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109381816	109381816	+	Silent	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109381816G>A	uc002tem.3	+	20	4947	c.4821G>A	c.(4819-4821)GAG>GAA	p.E1607E		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1607	RanBP2-type 5.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						CTAAGAAGGAGGGACAGTGGG	0.433													5	124	---	---	---	---	PASS
TMEFF2	23671	broad.mit.edu	37	2	193056699	193056699	+	Silent	SNP	T	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193056699T>C	uc002utc.2	-	2	583	c.189A>G	c.(187-189)GAA>GAG	p.E63E	TMEFF2_uc002utd.1_Silent_p.E63E	NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two	63	Extracellular (Potential).			E -> G (in Ref. 6; BAC11030).		extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			AGAGATCATTTTCTCTGTCAT	0.348													7	58	---	---	---	---	PASS
PTMA	5757	broad.mit.edu	37	2	232577519	232577519	+	Silent	SNP	C	T	T	rs115998635	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232577519C>T	uc002vsc.3	+	5	476	c.294C>T	c.(292-294)GAC>GAT	p.D98D	PTMA_uc002vsb.3_Silent_p.D97D|PTMA_uc010zmf.1_RNA|MIR1244_hsa-mir-1244-1|MI0006379_5'Flank	NM_001099285	NP_001092755	P06454	PTMA_HUMAN	prothymosin, alpha isoform 1	98	Asp/Glu-rich (acidic).				transcription, DNA-dependent	nucleus					0		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		CTTAGGATGACGATGTCGATA	0.512													3	2	---	---	---	---	PASS
C3orf38	285237	broad.mit.edu	37	3	88202584	88202584	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88202584C>T	uc003dqw.2	+	3	649	c.338C>T	c.(337-339)CCA>CTA	p.P113L		NM_173824	NP_776185	Q5JPI3	CC038_HUMAN	hypothetical protein LOC285237	113					apoptosis						0		Lung NSC(201;0.17)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		ACGCCAGAGCCAGTTACAAAG	0.368													5	71	---	---	---	---	PASS
GRK7	131890	broad.mit.edu	37	3	141497117	141497117	+	Translation_Start_Site	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141497117G>A	uc011bnd.1	+	1	75	c.-9G>A	c.(-11--7)CCGTG>CCATG			NM_139209	NP_631948	Q8WTQ7	GRK7_HUMAN	G-protein-coupled receptor kinase 7 precursor						visual perception	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						AGTGCGCCCCGTGCTCAGCCA	0.632													11	112	---	---	---	---	PASS
DHX36	170506	broad.mit.edu	37	3	154042071	154042071	+	Silent	SNP	A	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154042071A>C	uc003ezy.3	-	1	216	c.135T>G	c.(133-135)GGT>GGG	p.G45G	DHX36_uc010hvq.2_Silent_p.G45G|DHX36_uc003ezz.3_Silent_p.G45G	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	45	Gly-rich.					cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CGCCTCGACCACCCCCTCCGC	0.692													6	32	---	---	---	---	PASS
SH3TC1	54436	broad.mit.edu	37	4	8235132	8235132	+	Silent	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8235132G>A	uc003gkv.3	+	14	3275	c.3174G>A	c.(3172-3174)GGG>GGA	p.G1058G	SH3TC1_uc003gkw.3_Silent_p.G982G|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_RNA	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	1058	TPR 7.						binding			large_intestine(2)|pancreas(1)	3						GAAGTCTGGGGATTTTCATTG	0.537													6	34	---	---	---	---	PASS
C4orf23	152992	broad.mit.edu	37	4	8467202	8467202	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8467202G>C	uc003glg.1	+	8	909	c.721G>C	c.(721-723)GAA>CAA	p.E241Q	C4orf23_uc003glf.1_Missense_Mutation_p.E229Q|C4orf23_uc003glh.1_Missense_Mutation_p.E78Q	NM_152544	NP_689757	Q8IYL2	TRM44_HUMAN	hypothetical protein LOC152992 isoform 2	470					tRNA processing	cytoplasm	methyltransferase activity|nucleic acid binding|zinc ion binding				0						TCAGTACCGGGAATACCTTGA	0.473													5	126	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	48994016	48994016	+	Silent	SNP	T	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48994016T>C	uc003gyv.2	+	4	602	c.420T>C	c.(418-420)TAT>TAC	p.Y140Y	CWH43_uc011bzl.1_Silent_p.Y113Y	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	140	Helical; (Potential).				GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						GCATATGGTATACTTCACTAA	0.368													13	111	---	---	---	---	PASS
RAP1GDS1	5910	broad.mit.edu	37	4	99363278	99363278	+	3'UTR	SNP	G	T	T	rs79017338	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99363278G>T	uc003htx.3	+	15					RAP1GDS1_uc003htw.3_3'UTR|RAP1GDS1_uc003htv.3_3'UTR|RAP1GDS1_uc003htz.3_3'UTR|RAP1GDS1_uc003hty.3_3'UTR|RAP1GDS1_uc003hua.3_3'UTR	NM_001100427	NP_001093897	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1 isoform								binding|GTPase activator activity			ovary(1)|lung(1)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		AGAACTGCCCGATACACGGCA	0.498			T	NUP98	T-ALL								4	36	---	---	---	---	PASS
PCDH18	54510	broad.mit.edu	37	4	138451489	138451489	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138451489G>A	uc003ihe.3	-	1	2141	c.1754C>T	c.(1753-1755)ACG>ATG	p.T585M	PCDH18_uc003ihf.3_Missense_Mutation_p.T578M|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Missense_Mutation_p.T365M|PCDH18_uc011cha.1_Intron	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	585	Cadherin 6.|Extracellular (Potential).				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					GATTTCTGCCGTATTATTACG	0.468													9	425	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23526987	23526987	+	Missense_Mutation	SNP	C	G	G	rs74710141		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23526987C>G	uc003jgo.2	+	11	1972	c.1790C>G	c.(1789-1791)ACT>AGT	p.T597S		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	597	C2H2-type 4.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GTCCTCCTCACTCACCAGAGG	0.592										HNSCC(3;0.000094)			6	83	---	---	---	---	PASS
SNX18	112574	broad.mit.edu	37	5	53814839	53814839	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53814839A>T	uc003jpj.3	+	1	1247	c.1057A>T	c.(1057-1059)AGG>TGG	p.R353W	SNX18_uc011cqg.1_Missense_Mutation_p.R353W|SNX18_uc003jpi.3_Missense_Mutation_p.R353W	NM_052870	NP_443102	Q96RF0	SNX18_HUMAN	sorting nexin 18 isoform b	353	PX.				cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding				0		Lung NSC(810;3.46e-05)|Breast(144;0.102)				CTCTAAGCGCAGGAAGGGCCT	0.652													7	64	---	---	---	---	PASS
TTC37	9652	broad.mit.edu	37	5	94857934	94857934	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94857934C>G	uc003klb.2	-	19	2105	c.1835G>C	c.(1834-1836)GGA>GCA	p.G612A	TTC37_uc010jbf.1_Missense_Mutation_p.G564A	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	612	TPR 10.						binding			ovary(3)|pancreas(1)	4						TGTGTAGCCTCCTCTGCTTAA	0.413													19	137	---	---	---	---	PASS
HSD17B4	3295	broad.mit.edu	37	5	118861713	118861713	+	Missense_Mutation	SNP	A	G	G	rs11205	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118861713A>G	uc003ksj.2	+	19	1798	c.1675A>G	c.(1675-1677)ATT>GTT	p.I559V	HSD17B4_uc011cwg.1_Missense_Mutation_p.I535V|HSD17B4_uc011cwh.1_Missense_Mutation_p.I541V|HSD17B4_uc011cwi.1_Missense_Mutation_p.I584V|HSD17B4_uc003ksk.3_Missense_Mutation_p.I412V|HSD17B4_uc011cwj.1_Missense_Mutation_p.I412V|HSD17B4_uc010jcn.1_Missense_Mutation_p.I297V|HSD17B4_uc010jco.1_Silent_p.Q27Q	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	559	MaoC-like.|Enoyl-CoA hydratase 2.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	ATTCAAGGCAATTAAGGTAAA	0.313													5	134	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140559493	140559493	+	Silent	SNP	C	T	T	rs34866056		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559493C>T	uc011dai.1	+	1	2064	c.1878C>T	c.(1876-1878)CGC>CGT	p.R626R	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	626	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGAGGTGCGCACCGCCAGGC	0.701													5	116	---	---	---	---	PASS
SLC25A2	83884	broad.mit.edu	37	5	140682861	140682861	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140682861T>C	uc003ljf.2	-	1	752	c.572A>G	c.(571-573)TAT>TGT	p.Y191C		NM_031947	NP_114153	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 member 2	191	Solcar 2.				mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity			ovary(1)	1		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	GCTCAGTTCATAGCCACCAAA	0.458													12	122	---	---	---	---	PASS
MUC21	394263	broad.mit.edu	37	6	30954414	30954414	+	Missense_Mutation	SNP	C	G	G	rs138015704	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30954414C>G	uc003nsh.2	+	2	713	c.462C>G	c.(460-462)GAC>GAG	p.D154E	MUC21_uc003nsi.1_RNA	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor	154	Ser-rich.|28 X 15 AA approximate tandem repeats.|9.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CCAACTCTGACTCCAGCACAA	0.612													10	156	---	---	---	---	PASS
HLA-B	3106	broad.mit.edu	37	6	31323495	31323495	+	Intron	SNP	A	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31323495A>G	uc003nth.2	-						HLA-C_uc003ntb.2_5'Flank|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_Intron|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_Intron|HLA-B_uc010jso.2_3'UTR	NM_005514	NP_005505	P01889	1B07_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						GAACCCAGACACCAGCCTGGA	0.572									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				3	36	---	---	---	---	PASS
HLA-B	3106	broad.mit.edu	37	6	31324496	31324496	+	Missense_Mutation	SNP	G	T	T	rs2308559		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31324496G>T	uc003nth.2	-	2	366	c.312C>A	c.(310-312)AAC>AAA	p.N104K	HLA-C_uc003ntb.2_5'Flank|HLA-C_uc003ntc.1_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_Missense_Mutation_p.N104K|HLA-B_uc003ntg.1_5'Flank|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_5'Flank|HLA-B_uc010jso.2_Missense_Mutation_p.N76K	NM_005514	NP_005505	P01889	1B07_HUMAN	major histocompatibility complex, class I, B	104	Alpha-1.|Extracellular (Potential).				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						AGCCGCGCAGGTTCCGCAGGC	0.692									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				3	15	---	---	---	---	PASS
TNFRSF21	27242	broad.mit.edu	37	6	47200396	47200396	+	3'UTR	SNP	A	C	C	rs143094975	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47200396A>C	uc003oyv.2	-	6						NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,						cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)			cacacacacaaacacacacac	0.259													6	18	---	---	---	---	PASS
HTR1E	3354	broad.mit.edu	37	6	87725481	87725481	+	Silent	SNP	C	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87725481C>A	uc003pli.2	+	2	1132	c.429C>A	c.(427-429)ATC>ATA	p.I143I		NM_000865	NP_000856	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E	143	Helical; Name=4; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)	CGCTGATGATCCTTACCGTCT	0.582													12	83	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72419145	72419145	+	3'UTR	SNP	A	G	G	rs7051	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72419145A>G	uc010lam.1	+	16					NSUN5P2_uc003twl.2_Intron|NSUN5P2_uc003twm.2_Intron|NSUN5P2_uc003twn.2_Intron|NSUN5P2_uc003two.2_Intron|NSUN5P2_uc003twq.2_3'UTR|NSUN5P2_uc010lan.1_3'UTR|NSUN5P2_uc003twp.2_3'UTR	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				AGCTAGAGAAATGTAGATGTT	0.547													4	125	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100675944	100675944	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100675944T>A	uc003uxp.1	+	3	1300	c.1247T>A	c.(1246-1248)ATT>AAT	p.I416N	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	416	Extracellular (Potential).|59 X approximate tandem repeats.|4.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTTCAACAATTCCTGTTGAC	0.458													7	276	---	---	---	---	PASS
SCARA5	286133	broad.mit.edu	37	8	27762295	27762295	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27762295T>G	uc003xgj.2	-	7	1593	c.1153A>C	c.(1153-1155)AGT>CGT	p.S385R	SCARA5_uc010luz.2_Missense_Mutation_p.S160R|SCARA5_uc003xgk.2_Missense_Mutation_p.S342R|SCARA5_uc003xgl.2_Missense_Mutation_p.S385R	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	385	Extracellular (Potential).				cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		ATGTCCTTACTGGCATCCCCA	0.478													6	51	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48811034	48811034	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48811034G>A	uc003xqi.2	-	29	3517	c.3460C>T	c.(3460-3462)CCG>TCG	p.P1154S	PRKDC_uc003xqj.2_Missense_Mutation_p.P1154S|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	1154					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				ACCTACCGCGGCAAACGTCGT	0.403								NHEJ					3	7	---	---	---	---	PASS
ZNF7	7553	broad.mit.edu	37	8	146066508	146066508	+	Intron	SNP	T	C	C	rs2242651	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146066508T>C	uc003zeg.3	+						ZNF7_uc010mge.2_Intron|ZNF7_uc011lln.1_Intron|ZNF7_uc003zeh.2_Intron|ZNF7_uc003zek.3_Intron|COMMD5_uc003zel.1_RNA	NM_003416	NP_003407	P17097	ZNF7_HUMAN	zinc finger protein 7						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		AACCCAGCCCTGCCCCAGCAA	0.507													11	5	---	---	---	---	PASS
PSIP1	11168	broad.mit.edu	37	9	15465632	15465632	+	Intron	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15465632G>A	uc003zlv.3	-						PSIP1_uc003zlw.3_Intron|SNAPC3_uc003zlu.2_RNA	NM_033222	NP_150091	O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1 isoform 2						initiation of viral infection|interspecies interaction between organisms|nuclear mRNA 5'-splice site recognition|provirus integration|regulation of transcription, DNA-dependent|response to heat|response to oxidative stress|transcription, DNA-dependent	cytosol|nuclear heterochromatin|nuclear periphery|nucleoplasm|nucleoplasm|transcriptionally active chromatin	activating transcription factor binding|chromatin binding|DNA secondary structure binding|RNA polymerase II transcription coactivator activity			breast(1)	1				GBM - Glioblastoma multiforme(50;2.38e-06)		CCTGATGAAGGAAAAAAAGAC	0.348													9	68	---	---	---	---	PASS
ZNF658	26149	broad.mit.edu	37	9	40772246	40772246	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40772246C>A	uc004abs.2	-	5	3181	c.3029G>T	c.(3028-3030)AGA>ATA	p.R1010I	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Missense_Mutation_p.R1010I	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	1010	C2H2-type 23.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CTGGTGTACTCTGAGAGTTGA	0.443													33	146	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413581	68413581	+	RNA	SNP	G	C	C	rs1809619		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413581G>C	uc004aex.2	+	1		c.136G>C								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		CCGGATCTAGGAAAGGTTGTG	0.602													3	22	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68414303	68414303	+	RNA	SNP	T	G	G	rs74823923		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68414303T>G	uc004aex.2	+	1		c.858T>G								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		tctctcactttaagtccagag	0.109													7	22	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790136	78790136	+	Intron	SNP	T	C	C	rs62556589		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790136T>C	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.M664T|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						tggaatggaatgaaatggaat	0.204													5	27	---	---	---	---	PASS
ROR2	4920	broad.mit.edu	37	9	94495690	94495690	+	Silent	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94495690C>T	uc004arj.1	-	6	850	c.651G>A	c.(649-651)ACG>ACA	p.T217T	ROR2_uc004ari.1_Silent_p.T77T|ROR2_uc004ark.2_Silent_p.T217T	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	217	FZ.|Extracellular (Potential).				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						CCGACAGGTGCGTAGACGTGC	0.647													3	34	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121971070	121971070	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121971070G>A	uc004bkc.2	-	7	1528	c.1072C>T	c.(1072-1074)CGC>TGC	p.R358C		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	358					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						CGGGCAGTGCGTTGGATCTTT	0.577													7	87	---	---	---	---	PASS
KIAA0649	9858	broad.mit.edu	37	9	138378219	138378219	+	Silent	SNP	C	T	T	rs149069756		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138378219C>T	uc004cfr.1	+	4	2412	c.1863C>T	c.(1861-1863)GCC>GCT	p.A621A		NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	621						nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)		GCCAGGATGCCGACCACAGCC	0.647													5	62	---	---	---	---	PASS
RNLS	55328	broad.mit.edu	37	10	90342915	90342915	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90342915C>T	uc001kfe.2	-	1	168	c.33G>A	c.(31-33)ATG>ATA	p.M11I	RNLS_uc010qms.1_Missense_Mutation_p.M11I|RNLS_uc001kfd.2_Missense_Mutation_p.M11I	NM_001031709	NP_001026879	Q5VYX0	RNLS_HUMAN	renalase isoform 1	11						extracellular region	oxidoreductase activity			ovary(1)	1						AGCTTCCTGTCATCCCGGCGC	0.647											OREG0020353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	75	---	---	---	---	PASS
SYCE1	93426	broad.mit.edu	37	10	135369308	135369308	+	Missense_Mutation	SNP	C	T	T	rs150742469		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135369308C>T	uc001lno.2	-	10	800	c.695G>A	c.(694-696)CGC>CAC	p.R232H	CYP2E1_uc001lnl.1_3'UTR|SYCE1_uc001lnm.2_Missense_Mutation_p.R104H|SYCE1_uc009ybn.2_Missense_Mutation_p.R232H|SYCE1_uc001lnn.2_Missense_Mutation_p.R196H	NM_001143764	NP_001137236	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	232	Potential.				cell division	central element				ovary(1)	1		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CTCCTGGCTGCGGAGAAAGAG	0.642													6	105	---	---	---	---	PASS
EPS8L2	64787	broad.mit.edu	37	11	721931	721931	+	Silent	SNP	C	T	T	rs7949926	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:721931C>T	uc001lqt.2	+	11	1171	c.924C>T	c.(922-924)CCC>CCT	p.P308P	EPS8L2_uc010qwj.1_Missense_Mutation_p.P395S|EPS8L2_uc001lqu.2_Silent_p.P308P|EPS8L2_uc010qwk.1_Silent_p.P324P|EPS8L2_uc001lqv.2_Silent_p.P263P|EPS8L2_uc001lqw.2_Intron|EPS8L2_uc001lqx.2_5'UTR|EPS8L2_uc001lqy.2_5'Flank	NM_022772	NP_073609	Q9H6S3	ES8L2_HUMAN	epidermal growth factor receptor pathway	308						cytoplasm				pancreas(1)	1		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGCACGGCCCCCCTCTGAGG	0.667													5	9	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1093512	1093512	+	Silent	SNP	C	A	A	rs34493663	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1093512C>A	uc001lsx.1	+	31	12444	c.12417C>A	c.(12415-12417)ACC>ACA	p.T4139T		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4139						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ctacgatgaccccaaccccaa	0.129													5	26	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													4	56	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3721914	3721914	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3721914T>C	uc001lyh.2	-	24	3959	c.3668A>G	c.(3667-3669)AAT>AGT	p.N1223S	NUP98_uc001lyi.2_Missense_Mutation_p.N1223S|NUP98_uc001lyg.2_Missense_Mutation_p.N188S	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	1240					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AACTCCCAGATTGGGGACAAT	0.418			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								5	94	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	19955124	19955124	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19955124C>G	uc010rdm.1	+	8	1764	c.1403C>G	c.(1402-1404)GCC>GGC	p.A468G	NAV2_uc001mpp.2_Missense_Mutation_p.A381G|NAV2_uc001mpr.3_Missense_Mutation_p.A445G	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	468						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						CTGGAGGCCGCCAGTCGCATG	0.647													4	60	---	---	---	---	PASS
OR4D9	390199	broad.mit.edu	37	11	59282922	59282922	+	Silent	SNP	C	T	T	rs145873782		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59282922C>T	uc010rkv.1	+	1	537	c.537C>T	c.(535-537)TGC>TGT	p.C179C		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	179	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTTTCTACTGCGATGTCCCCC	0.493													10	200	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108032027	108032027	+	Silent	SNP	A	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108032027A>G	uc001pjz.3	-	17	3888	c.3786T>C	c.(3784-3786)AGT>AGC	p.S1262S	NPAT_uc010rvv.1_Silent_p.S318S	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	1262					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GTAAATCACTACTATCAGCAA	0.438													6	234	---	---	---	---	PASS
C1S	716	broad.mit.edu	37	12	7177943	7177943	+	Silent	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7177943C>T	uc001qsj.2	+	15	2774	c.2055C>T	c.(2053-2055)CCC>CCT	p.P685P	C1S_uc001qsk.2_Silent_p.P685P|C1S_uc001qsl.2_Silent_p.P685P|C1S_uc009zfr.2_Silent_p.P518P|C1S_uc009zfs.2_RNA	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent	685					complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	ATAGCACCCCCCGTGAGGACT	0.483													15	127	---	---	---	---	PASS
CLEC2D	29121	broad.mit.edu	37	12	9822387	9822387	+	Missense_Mutation	SNP	C	G	G	rs16914640	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9822387C>G	uc001qwg.1	+	1	79	c.57C>G	c.(55-57)AAC>AAG	p.N19K	CLEC2D_uc001qwf.1_Missense_Mutation_p.N19K|CLEC2D_uc009zgs.1_RNA|CLEC2D_uc001qwh.1_RNA|CLEC2D_uc009zgt.1_RNA	NM_013269	NP_037401	Q9UHP7	CLC2D_HUMAN	osteoclast inhibitory lectin isoform 1	19	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway	cell surface|endoplasmic reticulum|integral to plasma membrane|membrane fraction	sugar binding|transmembrane receptor activity				0						TGCCTGCAAACCCAGGTAAGA	0.453													3	65	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57111843	57111843	+	Intron	SNP	A	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57111843A>G	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Silent_p.P1157P|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Intron|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						CTTTTGGGGAAGGAGGAGTTG	0.627			T	BCL6	NHL								8	266	---	---	---	---	PASS
FGD6	55785	broad.mit.edu	37	12	95604290	95604290	+	Missense_Mutation	SNP	T	C	C	rs10507047	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95604290T>C	uc001tdp.3	-	2	994	c.770A>G	c.(769-771)CAG>CGG	p.Q257R	FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	257					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						ACTGTCATCCTGGCAAGTTTC	0.393													7	189	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117768455	117768455	+	Silent	SNP	C	T	T	rs9658278	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117768455C>T	uc001twm.1	-	2	1106	c.420G>A	c.(418-420)CCG>CCA	p.P140P		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	140	Interaction with NOSIP (By similarity).				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CTTTGCCGGCCGGTGGCTGGT	0.662													11	101	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39262558	39262558	+	Silent	SNP	T	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39262558T>C	uc001uwv.2	+	1	1386	c.1077T>C	c.(1075-1077)CTT>CTC	p.L359L		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	359	CSPG 1.|Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCTTCAACCTTACTTCTCCAT	0.572													5	79	---	---	---	---	PASS
GPR183	1880	broad.mit.edu	37	13	99948335	99948335	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99948335T>G	uc001vog.2	-	2	239	c.65A>C	c.(64-66)GAC>GCC	p.D22A	UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_004951	NP_004942	P32249	GP183_HUMAN	EBV-induced G protein-coupled receptor 2	22	Extracellular (Potential).				humoral immune response|mature B cell differentiation involved in immune response	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0						TGCATAGAGGTCACAGTCATT	0.478													7	96	---	---	---	---	PASS
PROZ	8858	broad.mit.edu	37	13	113825982	113825982	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113825982G>A	uc001vta.1	+	8	773	c.766G>A	c.(766-768)GAC>AAC	p.D256N	PROZ_uc010agr.1_Missense_Mutation_p.D278N	NM_003891	NP_003882	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma	256	Peptidase S1.				blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	GTATGACGCGGACGCGGGGGA	0.562													9	129	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	19969244	19969244	+	RNA	SNP	T	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19969244T>C	uc001vvw.1	-	1		c.815A>G								Homo sapiens prostate-specific P775P mRNA sequence.																		CTAATTTTTCTATTGCCTGCA	0.274													2	1	---	---	---	---	PASS
OR4N2	390429	broad.mit.edu	37	14	20296397	20296397	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20296397G>T	uc010tkv.1	+	1	790	c.790G>T	c.(790-792)GCT>TCT	p.A264S		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	264	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCCCTTCAGGGCTTTCCCAGC	0.458													9	115	---	---	---	---	PASS
BRMS1L	84312	broad.mit.edu	37	14	36334938	36334938	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36334938C>A	uc001wtl.2	+	8	824	c.698C>A	c.(697-699)ACA>AAA	p.T233K		NM_032352	NP_115728	Q5PSV4	BRM1L_HUMAN	breast cancer metastasis-suppressor 1-like	233					regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				skin(1)	1	Breast(36;0.137)|Hepatocellular(127;0.158)		Lung(8;1.7e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.00467)|all cancers(34;0.0157)|BRCA - Breast invasive adenocarcinoma(188;0.158)	GBM - Glioblastoma multiforme(112;0.0333)		GCAATGGCTACATTGGGGCCA	0.323													5	28	---	---	---	---	PASS
DHRS7	51635	broad.mit.edu	37	14	60619800	60619800	+	Missense_Mutation	SNP	A	C	C	rs111656127		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60619800A>C	uc001xes.2	-	4	674	c.490T>G	c.(490-492)TTA>GTA	p.L164V	C14orf135_uc001xeq.2_Intron|DHRS7_uc001xet.2_Missense_Mutation_p.L114V|DHRS7_uc001xeu.2_Missense_Mutation_p.L164V	NM_016029	NP_057113	Q9Y394	DHRS7_HUMAN	dehydrogenase/reductase (SDR family) member 7	164							binding|oxidoreductase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.121)		ACCGTCCCTAAGTAGTTAAGC	0.443													16	174	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20170343	20170343	+	IGR	SNP	A	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20170343A>G								None (None upstream) : GOLGA6L6 (566751 downstream)																							GGATCCTCCAAGTCCAGCCCA	0.522													6	195	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21936414	21936414	+	RNA	SNP	G	C	C	rs144232485	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21936414G>C	uc010tzj.1	-	1		c.4326C>G				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						ATTTTCTCTTGGTTGTCTTCA	0.348													8	42	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21936415	21936415	+	RNA	SNP	G	A	A	rs141023927	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21936415G>A	uc010tzj.1	-	1		c.4325C>T				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						TTTTCTCTTGGTTGTCTTCAG	0.343													8	43	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21938316	21938316	+	RNA	SNP	A	C	C	rs111913251	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21938316A>C	uc010tzj.1	-	1		c.2424T>G				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						aaacctgacaaaaacaagaaa	0.010													4	29	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22440816	22440816	+	Missense_Mutation	SNP	A	G	G	rs4505267	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22440816A>G	uc001yug.2	-	1	50	c.31T>C	c.(31-33)TGC>CGC	p.C11R						full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																		GTTTTGTGGCACTTGTGCCAG	0.537													4	7	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74327406	74327406	+	Intron	SNP	A	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74327406A>G	uc002awv.2	+						PML_uc002awm.2_3'UTR|PML_uc002awl.2_3'UTR|PML_uc002awj.1_3'UTR|PML_uc002awk.2_Intron|PML_uc002awn.2_Intron|PML_uc002awo.2_Intron|PML_uc002awp.2_Intron|PML_uc002awq.2_Intron|PML_uc002awr.2_Intron|PML_uc002aws.2_Intron|PML_uc002awt.2_Intron|PML_uc002awu.2_Intron|PML_uc010ule.1_Intron|PML_uc002awx.2_Intron|PML_uc002awy.2_5'UTR	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						tagaggctggactatcacctg	0.035			T	RARA|PAX5	APL|ALL								6	18	---	---	---	---	PASS
ETFA	2108	broad.mit.edu	37	15	76584842	76584842	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76584842G>A	uc002bbt.2	-	4	362	c.281C>T	c.(280-282)CCA>CTA	p.P94L	ETFA_uc010bkq.1_Missense_Mutation_p.P45L|ETFA_uc002bbu.1_Missense_Mutation_p.P94L	NM_000126	NP_000117	P13804	ETFA_HUMAN	electron transfer flavoprotein, alpha	94					respiratory electron transport chain|transport	mitochondrial matrix	electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity				0						CAAAATCAATGGTGTCAGTTC	0.338													7	102	---	---	---	---	PASS
ITFG3	83986	broad.mit.edu	37	16	309488	309488	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:309488A>G	uc002cgf.2	+	4	470	c.275A>G	c.(274-276)TAT>TGT	p.Y92C	ITFG3_uc010bqr.2_RNA|ITFG3_uc002cgg.2_Missense_Mutation_p.Y92C|ITFG3_uc010uud.1_RNA|ITFG3_uc002cgh.2_Missense_Mutation_p.Y92C	NM_032039	NP_114428	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	92	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				TCAGTTATCTATGACTTTCTG	0.453													19	369	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2140788	2140788	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2140788C>T	uc002cos.1	-	44	12234	c.12025G>A	c.(12025-12027)GTG>ATG	p.V4009M	PKD1_uc002cot.1_Missense_Mutation_p.V4008M|MIR1225_hsa-mir-1225|MI0006311_5'Flank	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	4009	Cytoplasmic (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						CACTGGCGCACGAAGCGTAGC	0.672													14	78	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3786756	3786756	+	Silent	SNP	A	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3786756A>G	uc002cvv.2	-	27	4659	c.4455T>C	c.(4453-4455)CAT>CAC	p.H1485H	CREBBP_uc002cvw.2_Silent_p.H1447H	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1485	Cys/His-rich.|Interaction with TRERF1.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GTGGGTGGCAATGGAAGATGT	0.512			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				16	169	---	---	---	---	PASS
ABAT	18	broad.mit.edu	37	16	8875289	8875289	+	3'UTR	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8875289G>A	uc002czc.3	+	16					ABAT_uc002czd.3_3'UTR|ABAT_uc010buh.2_3'UTR|ABAT_uc010bui.2_3'UTR	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	TTCAAGTAAAGAAGCCATTTC	0.423													6	55	---	---	---	---	PASS
CACNG3	10368	broad.mit.edu	37	16	24268023	24268023	+	5'UTR	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24268023G>A	uc002dmf.2	+	1						NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		TTTCCCCTCCGGCACTGACTC	0.517													5	65	---	---	---	---	PASS
XPO6	23214	broad.mit.edu	37	16	28157508	28157508	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28157508T>C	uc002dpa.1	-	9	1742	c.1241A>G	c.(1240-1242)TAC>TGC	p.Y414C	XPO6_uc002dpb.1_Missense_Mutation_p.Y400C|XPO6_uc010vcp.1_Missense_Mutation_p.Y414C	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6	414					protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						ACAAGAGAAGTAACCTTCATG	0.358													5	124	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51173559	51173559	+	Silent	SNP	G	A	A	rs1965024	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51173559G>A	uc010vgs.1	-	2	2605	c.2574C>T	c.(2572-2574)CTC>CTT	p.L858L	SALL1_uc010vgr.1_Silent_p.L761L|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	858					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TCGACATCTCGAGGGGCAAAG	0.527													5	170	---	---	---	---	PASS
CRK	1398	broad.mit.edu	37	17	1359240	1359240	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1359240A>C	uc002fsl.2	-	1	305	c.172T>G	c.(172-174)TCC>GCC	p.S58A	CRK_uc002fsm.2_Missense_Mutation_p.S58A	NM_016823	NP_058431	P46108	CRK_HUMAN	v-crk sarcoma virus CT10 oncogene homolog	58	SH2.				actin cytoskeleton organization|activation of MAPKK activity|blood coagulation|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of transcription from RNA polymerase II promoter	cytosol|endosome|nucleus|plasma membrane	protein binding|SH2 domain binding			lung(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.083)		ATGTAGTGGGAGACGCGCGAG	0.731													7	40	---	---	---	---	PASS
NEURL4	84461	broad.mit.edu	37	17	7221921	7221921	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7221921A>G	uc002gga.1	-	23	3764	c.3757T>C	c.(3757-3759)TCT>CCT	p.S1253P	NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_5'UTR|NEURL4_uc002ggb.1_Missense_Mutation_p.S1251P	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1	1253	NHR 6.						protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						AGCCCCCCAGAGCTGTCCAGC	0.617													8	63	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	21731144	21731144	+	Missense_Mutation	SNP	T	G	G	rs149119138	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21731144T>G	uc002gyy.3	+	2	571	c.446T>G	c.(445-447)CTG>CGG	p.L149R						SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																		GTCCTGCGTCTGAGAGGTGGT	0.542													5	60	---	---	---	---	PASS
NLE1	54475	broad.mit.edu	37	17	33462276	33462276	+	Silent	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33462276C>T	uc002hiy.1	-	10	1234	c.1206G>A	c.(1204-1206)AGG>AGA	p.R402R	NLE1_uc010ctn.1_Silent_p.R110R|NLE1_uc002hiz.1_Silent_p.R110R	NM_018096	NP_060566	Q9NVX2	NLE1_HUMAN	Notchless gene homolog isoform a	402	WD 6.					nucleolus				breast(3)|ovary(1)	4		Ovarian(249;0.17)				ACTTGCCCGTCCTGCCATCCC	0.453													9	80	---	---	---	---	PASS
KRT14	3861	broad.mit.edu	37	17	39742894	39742894	+	Silent	SNP	G	A	A	rs3826551	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39742894G>A	uc002hxf.1	-	1	254	c.193C>T	c.(193-195)CTG>TTG	p.L65L	JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Silent_p.L65L	NM_000526	NP_000517	P02533	K1C14_HUMAN	keratin 14	65	Head.				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.000307)				CCGCCCCCCAGCCCGCAGGCT	0.517													3	8	---	---	---	---	PASS
KRT14	3861	broad.mit.edu	37	17	39742898	39742898	+	Silent	SNP	G	A	A	rs11551758	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39742898G>A	uc002hxf.1	-	1	250	c.189C>T	c.(187-189)TAC>TAT	p.Y63Y	JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Silent_p.C63C	NM_000526	NP_000517	P02533	K1C14_HUMAN	keratin 14	63	Head.				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.000307)				CCCCCAGCCCGCAGGCTCCCC	0.527													4	8	---	---	---	---	PASS
ILF3	3609	broad.mit.edu	37	19	10798203	10798203	+	Silent	SNP	G	C	C			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10798203G>C	uc002mpn.2	+	18	2558	c.2241G>C	c.(2239-2241)TCG>TCC	p.S747S	ILF3_uc002mpo.2_Silent_p.S751S|ILF3_uc002mpq.2_Missense_Mutation_p.R50P	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a	747	Interaction with PRMT1.				M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			CCTACGGCTCGGGCTACCAGT	0.607													8	22	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12502821	12502821	+	Missense_Mutation	SNP	A	G	G	rs2902319		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12502821A>G	uc010dyt.2	-	4	541	c.391T>C	c.(391-393)TAT>CAT	p.Y131H	ZNF799_uc002mts.3_Intron	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN	zinc finger protein 799	131					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						TGATACTCATATGGTTTGTGC	0.448													4	181	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940554	22940554	+	Silent	SNP	A	G	G	rs12980594		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940554A>G	uc010xrh.1	-	5	1884	c.1884T>C	c.(1882-1884)ACT>ACC	p.T628T		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGAGTTGAGGACT	0.363													5	94	---	---	---	---	PASS
ZNF781	163115	broad.mit.edu	37	19	38160949	38160949	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38160949T>A	uc002ogy.2	-	4	843	c.101A>T	c.(100-102)GAA>GTA	p.E34V	ZNF781_uc002ogz.2_Missense_Mutation_p.E29V	NM_152605	NP_689818	Q8N8C0	ZN781_HUMAN	zinc finger protein 781	34	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TATCTGACATTCATAGGGTTT	0.383													21	290	---	---	---	---	PASS
SIGLEC11	114132	broad.mit.edu	37	19	50455562	50455562	+	Missense_Mutation	SNP	C	T	T	rs140702198	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50455562C>T	uc010ybh.1	-	9	1832	c.1741G>A	c.(1741-1743)GTC>ATC	p.V581I	SIGLEC11_uc010ybi.1_Missense_Mutation_p.V485I	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	581	Helical; (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TACCTGAAGACGACAAGGCAG	0.622													6	97	---	---	---	---	PASS
RASSF2	9770	broad.mit.edu	37	20	4770305	4770305	+	Silent	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4770305G>A	uc002wld.2	-	7	630	c.576C>T	c.(574-576)AAC>AAT	p.N192N	RASSF2_uc002wlc.2_RNA|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_Silent_p.N192N|RASSF2_uc010gbh.2_5'Flank	NM_170774	NP_739580	P50749	RASF2_HUMAN	Ras association domain family 2	192	Ras-associating.				cell cycle|signal transduction	nucleus	protein binding			ovary(3)|lung(2)|large_intestine(1)	6						TGATGCGGACGTTGGTGACAG	0.542													7	66	---	---	---	---	PASS
CSRP2BP	57325	broad.mit.edu	37	20	18142564	18142564	+	Silent	SNP	A	G	G	rs3828013	byFrequency	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18142564A>G	uc002wqj.2	+	6	1405	c.783A>G	c.(781-783)AAA>AAG	p.K261K	CSRP2BP_uc002wqk.2_Silent_p.K133K|CSRP2BP_uc010zru.1_Silent_p.K132K	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	261					histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						TAAAAGAGAAAAGGTCTCGAA	0.443													4	191	---	---	---	---	PASS
PIGP	51227	broad.mit.edu	37	21	38444995	38444995	+	5'UTR	SNP	A	G	G	rs7280542	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38444995A>G	uc002yvw.1	-	1					TTC3_uc002yvz.2_5'Flank|TTC3_uc011aee.1_5'Flank|PIGP_uc002yvy.1_Intron|PIGP_uc002yvx.1_Intron|TTC3_uc011aed.1_5'Flank|TTC3_uc010gne.1_5'Flank	NM_153681	NP_710148	P57054	PIGP_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity				0		Myeloproliferative disorder(46;0.0412)				GCGCATACAGACACCCAGGCT	0.746													11	15	---	---	---	---	PASS
KRTAP10-2	386679	broad.mit.edu	37	21	45970417	45970417	+	3'UTR	SNP	A	G	G	rs113903987	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45970417A>G	uc002zfi.1	-	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198693	NP_941966	P60368	KR102_HUMAN	keratin associated protein 10-2							keratin filament				large_intestine(1)	1						GGGAGGTCAGAGAGGAGCCAG	0.692													3	9	---	---	---	---	PASS
LDOC1L	84247	broad.mit.edu	37	22	44892839	44892839	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44892839G>A	uc003beu.1	-	2	935	c.598C>T	c.(598-600)CGA>TGA	p.R200*		NM_032287	NP_115663	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	200										ovary(1)	1		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		TGCCTCTCTCGCACAGCCCTA	0.647													11	63	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24806822	24806822	+	Intron	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24806822C>T	uc004dbl.2	+							NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	TTGTGCAAGACGTTCTTCCCT	0.413													6	230	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70349258	70349258	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70349258C>T	uc004dyy.2	+	26	3869	c.3670C>T	c.(3670-3672)CTC>TTC	p.L1224F	MED12_uc011mpq.1_Missense_Mutation_p.L1224F|MED12_uc004dyz.2_Missense_Mutation_p.L1224F|MED12_uc004dza.2_Missense_Mutation_p.L1071F|MED12_uc010nla.2_5'Flank	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1224					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GTTTGCTGTTCTCAAGGCTGT	0.562											OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	33	---	---	---	---	PASS
TCEAL6	158931	broad.mit.edu	37	X	101395981	101395981	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101395981C>T	uc004eiq.2	-	3	484	c.323G>A	c.(322-324)CGG>CAG	p.R108Q		NM_001006938	NP_001006939	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	108					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						TTTTGCTTTCCGGGGCACATA	0.602													28	98	---	---	---	---	PASS
SLC25A5	292	broad.mit.edu	37	X	118605099	118605099	+	3'UTR	SNP	C	A	A	rs78501953	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118605099C>A	uc004erh.3	+	4					LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_5'Flank	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2						chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)	TTGACAGACTCCTGGCTGTCA	0.363													4	29	---	---	---	---	PASS
SLC25A5	292	broad.mit.edu	37	X	118605114	118605114	+	3'UTR	SNP	C	A	A	rs75063279	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118605114C>A	uc004erh.3	+	4					LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_5'Flank	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2						chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)	CTGTCAGTTTCTCAGTGGCAA	0.378													4	23	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24401567	24401571	+	Intron	DEL	AAAAG	-	-	rs113201863		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24401567_24401571delAAAAG	uc001bin.3	-						MYOM3_uc001bim.3_Intron|MYOM3_uc001bio.2_Intron	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3											skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		ctgtctcaaaaaaagaaaagaaaag	0.166													4	3	---	---	---	---	
CLSPN	63967	broad.mit.edu	37	1	36229148	36229148	+	Intron	DEL	T	-	-	rs3833992		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36229148delT	uc001bzi.2	-						CLSPN_uc009vux.2_Intron	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin						activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACAGTAAATATTTTTTTGAAG	0.284													7	4	---	---	---	---	
MAST2	23139	broad.mit.edu	37	1	46493536	46493539	+	Splice_Site	DEL	GTAA	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46493536_46493539delGTAA	uc001cov.2	+	17	2335	c.2052_splice	c.e17+1	p.Q684_splice	MAST2_uc001cow.2_Splice_Site_p.Q684_splice|MAST2_uc001coy.1_Splice_Site_p.Q358_splice|MAST2_uc001coz.1_Splice_Site_p.Q569_splice|MAST2_uc001cpa.2_Splice_Site	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase						regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GGACAAGCAGGTAAGGAAGGGTAG	0.343													114	9	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	65915368	65915368	+	Intron	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65915368delT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		cctatttatcttttttttttt	0.224													4	2	---	---	---	---	
PTPN22	26191	broad.mit.edu	37	1	114380072	114380072	+	Intron	DEL	A	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114380072delA	uc001eds.2	-						PTPN22_uc009wgq.2_Intron|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Intron|PTPN22_uc009wgs.2_Intron|PTPN22_uc001edu.2_Intron	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type						negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		actccatctcaaaaaaaaaaa	0.035													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	115910207	115910208	+	IGR	INS	-	GT	GT	rs138385847	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115910207_115910208insGT								NGF (29350 upstream) : VANGL1 (274366 downstream)																							tgtgtgtatcagtgtgtgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121484151	121484152	+	IGR	DEL	CT	-	-	rs9729839		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121484151_121484152delCT								LOC647121 (170465 upstream) : None (None downstream)																							acttgaaacactctttttctgg	0.000													1261	7	---	---	---	---	
RASSF5	83593	broad.mit.edu	37	1	206681655	206681656	+	Intron	INS	-	CA	CA	rs71633590		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206681655_206681656insCA	uc001hed.2	+						RASSF5_uc001hec.1_Intron|RASSF5_uc001hee.2_Intron	NM_182663	NP_872604	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family 5						apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CCTTGGCCCTCcacacacacac	0.480													2	4	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241850607	241850607	+	Intron	DEL	A	-	-	rs67963688		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241850607delA	uc001hze.1	+						WDR64_uc001hzf.1_Intron			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			gactccatctaaaaaaaaaaa	0.139													3	4	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28205710	28205711	+	Intron	INS	-	TA	TA	rs146951804	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28205710_28205711insTA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					ttcattatgtgtacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64603416	64603417	+	IGR	INS	-	CACCACCAT	CACCACCAT	rs141783487	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603416_64603417insCACCACCAT								PELI1 (231811 upstream) : HSPC159 (77910 downstream)																							catgccaccaccaccaccatca	0.040													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92319926	92319926	+	IGR	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92319926delT								FKSG73 (189432 upstream) : None (None downstream)																							gagttgaacctttcttttgag	0.000													123	7	---	---	---	---	
TLK1	9874	broad.mit.edu	37	2	171939288	171939289	+	Splice_Site	INS	-	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171939288_171939289insA	uc002ugn.2	-	3	802	c.330_splice	c.e3+1	p.E110_splice	TLK1_uc002ugo.2_Splice_Site_p.E110_splice|TLK1_uc002ugp.2_Splice_Site_p.E62_splice|TLK1_uc002ugq.2_Splice_Site	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						TGAAATTACTTACCTCTGATTC	0.297													139	10	---	---	---	---	
PNKD	25953	broad.mit.edu	37	2	219144567	219144568	+	Intron	DEL	AG	-	-	rs66505705		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219144567_219144568delAG	uc002vhn.2	+						TMBIM1_uc002vhp.1_Intron|TMBIM1_uc010zjz.1_Intron|TMBIM1_uc010zka.1_Intron|TMBIM1_uc002vho.1_Intron	NM_015488	NP_056303	Q8N490	PNKD_HUMAN	myofibrillogenesis regulator 1 isoform 1							membrane|mitochondrion|nucleus	hydroxyacylglutathione hydrolase activity|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGTGCAAAAAGAGAGGGAACC	0.540													5	5	---	---	---	---	
ANKZF1	55139	broad.mit.edu	37	2	220098363	220098363	+	Intron	DEL	G	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220098363delG	uc002vkg.2	+						ANKZF1_uc010zkv.1_Intron|ANKZF1_uc010zkw.1_Intron|ANKZF1_uc002vkh.2_Intron|ANKZF1_uc002vki.2_Intron|ANKZF1_uc002vkj.1_Intron	NM_018089	NP_060559	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing							intracellular	zinc ion binding			ovary(2)	2		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCACTTCTGTGGGCCATTTTT	0.453													80	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236347837	236347838	+	IGR	INS	-	AC	AC	rs147522734	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236347837_236347838insAC								SH3BP4 (383481 upstream) : AGAP1 (54898 downstream)																							CTTGTCATTAAacacacacaca	0.361													4	2	---	---	---	---	
SLC6A6	6533	broad.mit.edu	37	3	14507773	14507774	+	Intron	INS	-	AA	AA	rs11310077		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14507773_14507774insAA	uc010heg.2	+						SLC6A6_uc003byq.2_Intron|SLC6A6_uc003byr.2_Intron	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter						cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						gtctcaaatttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
IL17RB	55540	broad.mit.edu	37	3	53898562	53898563	+	Intron	INS	-	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53898562_53898563insA	uc003dha.2	+							NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor						defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		actatgtctccaaaaaaaaaaa	0.183													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142895155	142895155	+	IGR	DEL	C	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142895155delC								CHST2 (53345 upstream) : SLC9A9 (88910 downstream)																							GGCCTCAGGGCCCCCCCCCAG	0.746													6	4	---	---	---	---	
PIK3CA	5290	broad.mit.edu	37	3	178941854	178941854	+	Intron	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178941854delT	uc003fjk.2	+							NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GTGACTATCCTTTTTTTTTAA	0.378		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			88	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49107447	49107447	+	IGR	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49107447delT								CWH43 (43354 upstream) : None (None downstream)																							ttccattccattccattgcac	0.000													234	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49323469	49323470	+	IGR	INS	-	CA	CA	rs79117116		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49323469_49323470insCA								CWH43 (259376 upstream) : None (None downstream)																							acacacacacgcacacacacac	0.243													164	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49644698	49644699	+	IGR	INS	-	GGAAA	GGAAA	rs4066504		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49644698_49644699insGGAAA								CWH43 (580605 upstream) : None (None downstream)																							atggaatggaatggaatggaat	0.000													183	7	---	---	---	---	
EMCN	51705	broad.mit.edu	37	4	101343954	101343955	+	Intron	INS	-	TTTC	TTTC			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101343954_101343955insTTTC	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326	Q9ULC0	MUCEN_HUMAN	endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		tcctcttctgttttctttcttt	0.287													4	2	---	---	---	---	
FHDC1	85462	broad.mit.edu	37	4	153889445	153889446	+	Intron	INS	-	T	T	rs75046217		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153889445_153889446insT	uc003inf.2	+							NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1						actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					AGCCTGATATATTTTTTTTTTT	0.223													5	3	---	---	---	---	
SV2C	22987	broad.mit.edu	37	5	75507289	75507290	+	Intron	DEL	GT	-	-	rs34055477		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75507289_75507290delGT	uc003kei.1	+							NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TTCTGGTtgcgtgtgtgtgtgt	0.317													7	6	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130897900	130897900	+	Intron	DEL	A	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130897900delA	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		AAAAAGAAAGAAAAAAAAAAA	0.264													4	2	---	---	---	---	
PCDHGA10	56106	broad.mit.edu	37	5	140812926	140812929	+	Intron	DEL	CTAT	-	-	rs72463976		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140812926_140812929delCTAT	uc003lkl.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tactgtctgcctatctatctatct	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153940150	153940150	+	IGR	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153940150delT								HAND1 (82326 upstream) : MIR1303 (125186 downstream)																							ttggtttttgttttttttttt	0.090													4	2	---	---	---	---	
TIMD4	91937	broad.mit.edu	37	5	156378745	156378747	+	In_Frame_Del	DEL	TTG	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156378745_156378747delTTG	uc003lwh.2	-	3	512_514	c.455_457delCAA	c.(454-459)ACAAGC>AGC	p.T152del	TIMD4_uc010jii.2_In_Frame_Del_p.T152del	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	152	Extracellular (Potential).|Thr-rich.					integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTGGTGGGGCTTGTTGTTGTTGT	0.537													526	7	---	---	---	---	
LSM11	134353	broad.mit.edu	37	5	157181701	157181703	+	Intron	DEL	AAA	-	-	rs35885459		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157181701_157181703delAAA	uc003lxe.1	+						LSM11_uc003lxf.1_5'Flank	NM_173491	NP_775762	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated						histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ctccgtctccaaaaaaaaaaaaa	0.108													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159674905	159674906	+	IGR	DEL	AA	-	-	rs10568222		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159674905_159674906delAA								FABP6 (9176 upstream) : CCNJL (3765 downstream)																							actctggctcaaaaaaaaaaaa	0.228													5	3	---	---	---	---	
LRRC16A	55604	broad.mit.edu	37	6	25279840	25279840	+	5'UTR	DEL	T	-	-	rs72361376		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25279840delT	uc011djw.1	+	1					LRRC16A_uc010jpx.2_5'UTR|LRRC16A_uc010jpy.2_5'UTR	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						TTTGCAACTCTTTTTTTTTTT	0.532													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58777999	58778001	+	IGR	DEL	GAG	-	-	rs4928387		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58777999_58778001delGAG								GUSBL2 (490275 upstream) : None (None downstream)																							tcaactcacagagtttaacattt	0.000													944	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58778285	58778285	+	IGR	DEL	C	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58778285delC								GUSBL2 (490561 upstream) : None (None downstream)																							atcttataaacccagacagaa	0.000													1044	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58778954	58778954	+	IGR	DEL	C	-	-	rs67064770		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58778954delC								GUSBL2 (491230 upstream) : None (None downstream)																							aacgggatttcttcgtataaa	0.000													1036	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58779082	58779083	+	IGR	INS	-	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58779082_58779083insT								GUSBL2 (491358 upstream) : None (None downstream)																							ccaagcggatattagagcgcct	0.000													991	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61970266	61970266	+	IGR	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61970266delT								None (None upstream) : LOC643955 (781406 downstream)																							actcacagagtttaacctttc	0.000													1129	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64975025	64975025	+	IGR	DEL	C	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64975025delC								ZNF92 (109028 upstream) : INTS4L2 (137752 downstream)																							AGGTAGAAGGCTGGCACAGCT	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96665223	96665224	+	IGR	DEL	GC	-	-	rs113072858		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96665223_96665224delGC								DLX5 (11080 upstream) : ACN9 (80681 downstream)																							tctggacactgcgtgtgtgtgt	0.015													4	2	---	---	---	---	
EPHB4	2050	broad.mit.edu	37	7	100414704	100414705	+	Intron	INS	-	A	A			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100414704_100414705insA	uc003uwn.1	-						EPHB4_uc003uwm.1_Intron|EPHB4_uc010lhj.1_Intron|EPHB4_uc011kkf.1_Intron	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor						cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					gactccatctcaaaaaaaaaaa	0.233													6	3	---	---	---	---	
MOGAT3	346606	broad.mit.edu	37	7	100842282	100842282	+	Intron	DEL	T	-	-	rs68152186		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100842282delT	uc003uyc.2	-						MOGAT3_uc010lhr.2_Intron	NM_178176	NP_835470	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3						glycerol metabolic process|lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity|diacylglycerol O-acyltransferase activity			ovary(2)	2	Lung NSC(181;0.168)|all_lung(186;0.215)					AGGGCCCAGGttttttttttt	0.259													6	3	---	---	---	---	
NOS3	4846	broad.mit.edu	37	7	150706436	150706437	+	Intron	INS	-	C	C	rs142498418	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150706436_150706437insC	uc003wif.2	+						NOS3_uc011kuy.1_Intron	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1						anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	ACATTCTCCCGCCCCCACCCCT	0.678													3	3	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38092287	38092288	+	Intron	INS	-	TT	TT			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38092287_38092288insTT	uc003xlb.2	+						DDHD2_uc003xla.2_Intron|DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			TTATTTTCAGAttttttttttt	0.149													3	3	---	---	---	---	
LAPTM4B	55353	broad.mit.edu	37	8	98827797	98827797	+	Intron	DEL	T	-	-	rs111936259		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98827797delT	uc003yia.2	+						LAPTM4B_uc010mbg.2_Intron	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4						transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			ATACTGGAAAttttttttttt	0.159													6	4	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386780	33386781	+	Intron	INS	-	A	A	rs144468472	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386780_33386781insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		aatggtaggtcggggggcccag	0.257													8	5	---	---	---	---	
GTF3C4	9329	broad.mit.edu	37	9	135546500	135546500	+	Intron	DEL	A	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135546500delA	uc010mzv.2	+						DDX31_uc004cbq.1_5'Flank|DDX31_uc010mzu.1_5'Flank|DDX31_uc004cbr.1_5'Flank|DDX31_uc004cbs.1_5'Flank|GTF3C4_uc010mzw.2_Intron	NM_012204	NP_036336	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC 4						transcription initiation from RNA polymerase III promoter	transcription factor TFIIIC complex	DNA binding|enzyme activator activity|histone acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		ACCACAGCTTAAAAAAAAAAA	0.562													4	2	---	---	---	---	
PRTFDC1	56952	broad.mit.edu	37	10	25226485	25226485	+	Intron	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25226485delT	uc001ise.1	-						PRTFDC1_uc010qdd.1_Intron|PRTFDC1_uc001isf.1_Intron|PRTFDC1_uc009xkm.1_Intron	NM_020200	NP_064585	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1						adenine salvage|central nervous system neuron development|cerebral cortex neuron differentiation|cytolysis|dendrite morphogenesis|GMP salvage|grooming behavior|hypoxanthine metabolic process|IMP salvage|lymphocyte proliferation|positive regulation of dopamine metabolic process|purine ribonucleoside salvage|response to amphetamine|striatum development	cytosol	hypoxanthine phosphoribosyltransferase activity|magnesium ion binding|nucleotide binding|protein homodimerization activity			ovary(1)	1						AACATACTGCttttttttttt	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30672265	30672265	+	IGR	DEL	A	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30672265delA								MTPAP (8888 upstream) : MAP3K8 (50601 downstream)																							ATTGCCAGCCAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383716	42383717	+	IGR	INS	-	G	G	rs145968937		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383716_42383717insG								None (None upstream) : LOC441666 (443598 downstream)																							tggaatcaaaataaccatcatc	0.000													279	29	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385606	42385606	+	IGR	DEL	G	-	-	rs67827809		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385606delG								None (None upstream) : LOC441666 (441709 downstream)																							ggaattcaaaggaatcatcat	0.000													2504	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42387928	42387928	+	IGR	DEL	T	-	-	rs77755875		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42387928delT								None (None upstream) : LOC441666 (439387 downstream)																							tcaaacggaatcaaacggaat	0.000													1645	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42391470	42391470	+	IGR	DEL	T	-	-	rs28839468		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42391470delT								None (None upstream) : LOC441666 (435845 downstream)																							tcaaacggaatcaaacggaat	0.000													1429	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42396450	42396450	+	IGR	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42396450delT								None (None upstream) : LOC441666 (430865 downstream)																							tggtctcgaatggaatcacct	0.000													946	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42396712	42396712	+	IGR	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42396712delT								None (None upstream) : LOC441666 (430603 downstream)																							ttgaacggaatcaaatggaat	0.000													1080	34	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42597165	42597165	+	IGR	DEL	G	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42597165delG								None (None upstream) : LOC441666 (230150 downstream)																							ggaatcgaatggaatcatcat	0.020													3730	9	---	---	---	---	
PSMC3	5702	broad.mit.edu	37	11	47445343	47445343	+	Intron	DEL	A	-	-	rs66818621		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47445343delA	uc001nfh.2	-						PSMC3_uc009ylr.1_Intron	NM_002804	NP_002795	P17980	PRS6A_HUMAN	proteasome 26S ATPase subunit 3						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|nucleoside-triphosphatase activity|protein binding|transcription coactivator activity|transcription corepressor activity			ovary(4)	4				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		tccatctcggaaaaaaaaaaa	0.000													9	6	---	---	---	---	
MS4A8B	83661	broad.mit.edu	37	11	60474783	60474784	+	Intron	DEL	GA	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60474783_60474784delGA	uc001npv.2	+						MS4A8B_uc009yne.1_Intron	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity				0						TATGgagagcgagagagagaga	0.470													4	2	---	---	---	---	
MTL5	9633	broad.mit.edu	37	11	68518237	68518251	+	Intron	DEL	CAGCCAAGGGAGGGG	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68518237_68518251delCAGCCAAGGGAGGGG	uc001ooc.2	-						MTL5_uc001ood.1_Intron|MTL5_uc009ysi.1_Intron|MTL5_uc001ooe.2_5'Flank	NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform						cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			ggaaaggggacagccaagggaggggcagccaaggg	0.228													4	2	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134037301	134037304	+	Intron	DEL	ACTT	-	-	rs66495156		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134037301_134037304delACTT	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron|NCAPD3_uc001qhc.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTGCACACTCACTTGTGAGATGAG	0.598													5	3	---	---	---	---	
ARHGDIB	397	broad.mit.edu	37	12	15095807	15095807	+	Intron	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15095807delT	uc001rcq.1	-						ARHGDIB_uc001rcp.1_Intron	NM_001175	NP_001166	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta						actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity				0						CTGAGGCATCttttttttttt	0.199													5	3	---	---	---	---	
C12orf71	728858	broad.mit.edu	37	12	27235548	27235548	+	5'Flank	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27235548delT	uc001rhq.2	-							NM_001080406	NP_001073875	A8MTZ7	CL071_HUMAN	hypothetical protein LOC728858												0						ctcttttttcttttttttttt	0.149													4	2	---	---	---	---	
LASS5	91012	broad.mit.edu	37	12	50528077	50528078	+	Intron	INS	-	CTT	CTT	rs72518097		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50528077_50528078insCTT	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron	NM_147190	NP_671723	Q8N5B7	CERS5_HUMAN	LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0						tgggagaatccaagcccaggtg	0.025													5	5	---	---	---	---	
PLEKHG7	440107	broad.mit.edu	37	12	93155336	93155339	+	Intron	DEL	GAAG	-	-	rs117312592	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93155336_93155339delGAAG	uc001tcj.2	+							NM_001004330	NP_001004330	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1						aagaaagaaagaaggaaggaagga	0.162													3	3	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94653676	94653676	+	Intron	DEL	A	-	-	rs67260160		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94653676delA	uc001tdc.2	+						PLXNC1_uc010sut.1_Intron|PLXNC1_uc009zsv.2_5'Flank	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						ttgtctctacaaaaaaaaaaa	0.159													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110072327	110072328	+	IGR	INS	-	ACC	ACC	rs147833484	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110072327_110072328insACC								MVK (37257 upstream) : C12orf34 (79862 downstream)																							ccaccaccactaccaccaccac	0.020													6	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965154	117965157	+	Intron	DEL	ACAC	-	-	rs7309204		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965154_117965157delACAC	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					acacacacagacacacacacacac	0.230													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	33533926	33533927	+	IGR	INS	-	TA	TA			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33533926_33533927insTA								PDS5B (181771 upstream) : KL (56274 downstream)																							GCgtgtgtgtgtgtgtgtgtgt	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19488190	19488190	+	IGR	DEL	C	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19488190delC								OR11H12 (109618 upstream) : POTEG (65175 downstream)																							CTTGTTGTCACAGCCTAGTTT	0.299													4	2	---	---	---	---	
BTBD7	55727	broad.mit.edu	37	14	93708432	93708433	+	3'UTR	INS	-	A	A	rs72253031		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93708432_93708433insA	uc001ybo.2	-	11					BTBD7_uc010aur.2_3'UTR|BTBD7_uc010two.1_3'UTR|BTBD7_uc001ybp.2_3'UTR	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1											pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GATGCAACATTAAAAAAAAAAA	0.327													4	2	---	---	---	---	
MTA1	9112	broad.mit.edu	37	14	105905492	105905493	+	Intron	INS	-	T	T	rs140601392	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105905492_105905493insT	uc001yqx.2	+						MTA1_uc001yqy.2_Intron|MTA1_uc001yqz.1_Intron|MTA1_uc001yra.1_Intron	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein						signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		GAGCTCTGCCCCCACCCCTGAG	0.644													8	5	---	---	---	---	
CYFIP1	23191	broad.mit.edu	37	15	22938906	22938907	+	Intron	INS	-	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22938906_22938907insT	uc001yus.2	+						CYFIP1_uc001yut.2_Intron|CYFIP1_uc010aya.1_Intron	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		aaatgcagtgattttttttttt	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	32635922	32635922	+	5'Flank	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32635922delT	uc001zfv.1	-						uc001zfw.1_5'Flank					Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.																		CATAACGCTCTTTTTTTTTTT	0.413													4	5	---	---	---	---	
GLDN	342035	broad.mit.edu	37	15	51696228	51696229	+	Intron	INS	-	TCTT	TCTT	rs149014390	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51696228_51696229insTCTT	uc002aba.2	+						GLDN_uc002abb.2_Intron	NM_181789	NP_861454	Q6ZMI3	GLDN_HUMAN	gliomedin						cell differentiation|nervous system development	collagen|integral to membrane|plasma membrane				ovary(2)	2				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		GGTGATTATTCTGACACCACAC	0.381													6	4	---	---	---	---	
KLHL25	64410	broad.mit.edu	37	15	86314432	86314433	+	Intron	INS	-	A	A	rs55642980		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86314432_86314433insA	uc002bly.2	-						MIR1276_hsa-mir-1276|MI0006416_5'Flank	NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN	BTB/POZ KELCH domain protein							cytoplasm				ovary(2)	2						AATTAAGCCTGaaaaaaaaaaa	0.406													3	3	---	---	---	---	
CCDC78	124093	broad.mit.edu	37	16	773313	773314	+	Intron	INS	-	C	C	rs142788906	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:773313_773314insC	uc002cjg.2	-						CCDC78_uc002cjf.2_Intron|CCDC78_uc002cji.3_3'UTR|CCDC78_uc002cjj.3_3'UTR|CCDC78_uc002cjh.2_Intron	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78											central_nervous_system(1)	1		Hepatocellular(780;0.0218)				CTCCTGTGGCGCCCCCCCCAGG	0.693													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46388420	46388422	+	IGR	DEL	GAT	-	-	rs28778314		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46388420_46388422delGAT								None (None upstream) : ANKRD26P1 (114827 downstream)																							aattccattcgatgatgattccc	0.000													640	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46391542	46391542	+	IGR	DEL	C	-	-	rs111846833		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46391542delC								None (None upstream) : ANKRD26P1 (111707 downstream)																							TTAATGATTGCTTTGTTttca	0.045													692	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46394988	46394990	+	IGR	DEL	ATG	-	-	rs144015128		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46394988_46394990delATG								None (None upstream) : ANKRD26P1 (108259 downstream)																							tcgattccatatgatgatgactc	0.000													396	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46403697	46403698	+	IGR	INS	-	G	G	rs142975115		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46403697_46403698insG								None (None upstream) : ANKRD26P1 (99551 downstream)																							tttcattcgatgatgattccat	0.000													1939	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46405144	46405144	+	IGR	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46405144delT								None (None upstream) : ANKRD26P1 (98105 downstream)																							tccgagtccattcgatgattc	0.000													1085	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46405916	46405916	+	IGR	DEL	T	-	-	rs77422485		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46405916delT								None (None upstream) : ANKRD26P1 (97333 downstream)																							ctttcaatcattCCCTTTGAT	0.050													889	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46406908	46406910	+	IGR	DEL	ATG	-	-	rs142002187		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46406908_46406910delATG								None (None upstream) : ANKRD26P1 (96339 downstream)																							tcgattccatatgatgatgactc	0.000													618	14	---	---	---	---	
ZNF423	23090	broad.mit.edu	37	16	49794826	49794827	+	Intron	INS	-	AC	AC	rs146463417	by1000genomes	TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49794826_49794827insAC	uc002efs.2	-							NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				ACCTCCCTCCAacacacacaca	0.287													4	3	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57919461	57919462	+	Intron	INS	-	CTCT	CTCT	rs34366661		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919461_57919462insCTCT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						ttccttccttcctctctctctc	0.000													3	3	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	15943962	15943963	+	Intron	INS	-	T	T			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15943962_15943963insT	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpl.2_Intron|NCOR1_uc002gpm.2_Intron|NCOR1_uc010vwb.1_Intron|NCOR1_uc010coy.2_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AAATGGAAGTAttttttttttt	0.208													4	2	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45367839	45367841	+	Intron	DEL	AGA	-	-	rs78819126		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45367839_45367841delAGA	uc002ilj.2	+						ITGB3_uc002ili.1_Intron|ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	aggaaggaagagagaaagaagga	0.453													5	4	---	---	---	---	
SLC38A10	124565	broad.mit.edu	37	17	79257417	79257418	+	Intron	INS	-	TT	TT	rs111438281		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79257417_79257418insTT	uc002jzz.1	-						SLC38A10_uc002jzy.1_Intron|SLC38A10_uc002kab.2_Intron	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a						amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			tttcttttttcttttttttttt	0.277													4	3	---	---	---	---	
APCDD1	147495	broad.mit.edu	37	18	10462589	10462596	+	Intron	DEL	TCCTTCCT	-	-	rs35280622		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10462589_10462596delTCCTTCCT	uc002kom.3	+							NM_153000	NP_694545	Q8J025	APCD1_HUMAN	adenomatosis polyposis coli down-regulated 1						hair follicle development|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to plasma membrane	Wnt-protein binding				0				READ - Rectum adenocarcinoma(15;0.08)		cttccctccctccttccttccttccttc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11644890	11644890	+	IGR	DEL	A	-	-	rs11080529		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11644890delA								FAM38B (942911 upstream) : GNAL (44246 downstream)																							GACTGAAGACaaaaaaaaaaa	0.303													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	18517211	18517211	+	IGR	DEL	C	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18517211delC								None (None upstream) : ROCK1 (12494 downstream)																							gaaatgtcttcccataaaaac	0.000													987	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27732663	27732663	+	IGR	DEL	T	-	-	rs77451260		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27732663delT								None (None upstream) : LOC148189 (548739 downstream)																							ctgtttgtaatgtctgcaagt	0.000													1163	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27733247	27733247	+	IGR	DEL	A	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27733247delA								None (None upstream) : LOC148189 (548155 downstream)																							aactagacagaatcattctca	0.000													1879	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27736391	27736392	+	IGR	DEL	CT	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27736391_27736392delCT								None (None upstream) : LOC148189 (545010 downstream)																							tttggaaacactctgtttgtaa	0.000													1205	9	---	---	---	---	
LYPD3	27076	broad.mit.edu	37	19	43966189	43966189	+	Intron	DEL	A	-	-	rs35056869		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43966189delA	uc002owl.1	-						LYPD3_uc002owm.2_3'UTR	NM_014400	NP_055215	O95274	LYPD3_HUMAN	GPI-anchored metastasis-associated protein							anchored to plasma membrane				pancreas(1)	1		Prostate(69;0.0153)				tctgtcttgcaaaaaaaaaaa	0.204													7	5	---	---	---	---	
PLEKHA4	57664	broad.mit.edu	37	19	49361884	49361885	+	Intron	INS	-	A	A	rs77497983		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49361884_49361885insA	uc002pkx.2	-						PLEKHA4_uc002pkw.1_Intron|PLEKHA4_uc010eml.2_Intron	NM_020904	NP_065955	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing family A							cytoplasm|membrane	1-phosphatidylinositol binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		acctcagtctcaaaaaaaaaaa	0.233													6	4	---	---	---	---	
ZNFX1	57169	broad.mit.edu	37	20	47870567	47870567	+	Intron	DEL	T	-	-	rs11353174		TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47870567delT	uc002xui.2	-							NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ttcttttttcttttttttttt	0.194													13	10	---	---	---	---	
TMPRSS15	5651	broad.mit.edu	37	21	19704340	19704340	+	Intron	DEL	G	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19704340delG	uc002ykw.2	-							NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						GCTGCGTCAAGGGGAGATCTA	0.348													61	7	---	---	---	---	
PHKA2	5256	broad.mit.edu	37	X	18970470	18970470	+	Intron	DEL	G	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18970470delG	uc004cyv.3	-						PHKA2_uc010nfh.1_Intron|PHKA2_uc010nfi.1_Intron	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)						glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					aaaaaaaaaaGAGAGAGAGAA	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	24447607	24447607	+	IGR	DEL	T	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24447607delT								FAM48B1 (64067 upstream) : PDK3 (35737 downstream)																							attaaacctcttttttttTTT	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61731081	61731082	+	IGR	DEL	CT	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61731081_61731082delCT								None (None upstream) : SPIN4 (836026 downstream)																							ttcaaaactgctctctcaaaag	0.000													208	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13466365	13466365	+	IGR	DEL	C	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13466365delC								None (None upstream) : None (None downstream)																							agttacatcacctgcgtgatc	0.000													61	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13842666	13842667	+	IGR	INS	-	CATCC	CATCC			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13842666_13842667insCATCC								None (None upstream) : TTTY15 (931631 downstream)																							tggaatggaatggaatggaatg	0.000													1174	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13842715	13842715	+	IGR	DEL	G	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13842715delG								None (None upstream) : TTTY15 (931583 downstream)																							atcaacccgagtggaatggaa	0.000													1904	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58827381	58827381	+	IGR	DEL	A	-	-			TCGA-CH-5748-01	TCGA-CH-5748-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58827381delA								None (None upstream) : None (None downstream)																							tttccattccatttgatttga	0.000													1334	19	---	---	---	---	
