Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC2A7	155184	broad.mit.edu	37	1	9074861	9074861	+	Missense_Mutation	SNP	C	T	T	rs12402973	byFrequency	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9074861C>T	uc009vmo.1	-	7	782	c.782G>A	c.(781-783)CGG>CAG	p.R261Q		NM_207420	NP_997303	Q6PXP3	GTR7_HUMAN	intestinal facilitative glucose transporter 7	261	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sugar transmembrane transporter activity				0	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GCGCTCGGCCCGGGCCTCCGC	0.697													7	5	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19439347	19439347	+	Silent	SNP	C	T	T	rs117673421	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19439347C>T	uc001bbi.2	-	78	11476	c.11472G>A	c.(11470-11472)TCG>TCA	p.S3824S	UBR4_uc001bbj.1_3'UTR	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	3824					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACTCTTTGCGCGAAGCAAAGA	0.413													10	332	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240977013	240977013	+	Silent	SNP	C	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240977013C>A	uc001hyv.2	-	13	1191	c.861G>T	c.(859-861)ACG>ACT	p.T287T	RGS7_uc010pyh.1_Silent_p.T261T|RGS7_uc010pyj.1_Silent_p.T203T|RGS7_uc001hyu.2_Silent_p.T287T|RGS7_uc009xgn.1_Silent_p.T234T|RGS7_uc001hyw.2_Silent_p.T287T|RGS7_uc001hyt.2_Silent_p.T119T	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	287	G protein gamma.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			AATACTGTTCCGTGTAACTTA	0.433													8	89	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183846059	183846059	+	Silent	SNP	A	G	G			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183846059A>G	uc002upc.2	-	13	1656	c.1254T>C	c.(1252-1254)CAT>CAC	p.H418H	NCKAP1_uc002upb.2_Silent_p.H424H	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	418					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ATTTCCTCACATGTGCTCTAA	0.328													7	109	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218683368	218683368	+	Silent	SNP	C	T	T	rs34144104	byFrequency	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218683368C>T	uc002vgt.2	-	24	3773	c.3375G>A	c.(3373-3375)CCG>CCA	p.P1125P	TNS1_uc002vgr.2_Silent_p.P1112P|TNS1_uc002vgs.2_Silent_p.P1104P|TNS1_uc010zjv.1_Silent_p.P1104P	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	1125	Ser-rich.					cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TCTGGGCAGACGGGCTGGGCT	0.632													4	80	---	---	---	---	PASS
CCDC140	151278	broad.mit.edu	37	2	223168894	223168894	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223168894G>C	uc002vnb.1	+	2	657	c.273G>C	c.(271-273)AAG>AAC	p.K91N		NM_153038	NP_694583	Q96MF4	CC140_HUMAN	coiled-coil domain containing 140	91											0		Renal(207;0.0376)		Epithelial(121;4.03e-10)|all cancers(144;1.8e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCGTTTTGAAGAGTGCTGCGC	0.662													3	40	---	---	---	---	PASS
AGAP1	116987	broad.mit.edu	37	2	236708166	236708166	+	Silent	SNP	C	T	T	rs2292708	byFrequency	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236708166C>T	uc002vvs.2	+	8	1552	c.957C>T	c.(955-957)ACC>ACT	p.T319T	AGAP1_uc002vvt.2_Silent_p.T319T	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1	319					protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						ACCTGTTCACCGTGAGTGTCA	0.542													4	89	---	---	---	---	PASS
CAPN7	23473	broad.mit.edu	37	3	15292798	15292798	+	3'UTR	SNP	C	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15292798C>A	uc003bzn.2	+	21					uc003bzo.1_5'Flank	NM_014296	NP_055111	Q9Y6W3	CAN7_HUMAN	calpain 7						proteolysis	nucleus	calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1						GGCTTTTATACTTACCAAACA	0.348													5	145	---	---	---	---	PASS
BCL6	604	broad.mit.edu	37	3	187447376	187447376	+	Missense_Mutation	SNP	T	C	C	rs139857005		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187447376T>C	uc003frp.3	-	5	1274	c.817A>G	c.(817-819)ATG>GTG	p.M273V	BCL6_uc011bsf.1_Missense_Mutation_p.M273V|BCL6_uc010hza.2_Missense_Mutation_p.M171V|BCL6_uc003frq.1_Missense_Mutation_p.M273V	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	273					negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		CTGTAGTGCATATCACTTCGT	0.547			T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								7	122	---	---	---	---	PASS
TNIP3	79931	broad.mit.edu	37	4	122075727	122075727	+	Silent	SNP	A	G	G			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122075727A>G	uc010ing.2	-	5	667	c.471T>C	c.(469-471)TGT>TGC	p.C157C	TNIP3_uc010inh.2_Silent_p.C157C|TNIP3_uc011cgj.1_Silent_p.C215C|TNIP3_uc010ini.2_Silent_p.C157C	NM_024873	NP_079149	Q96KP6	TNIP3_HUMAN	TNFAIP3 interacting protein 3	157	Potential.									ovary(1)	1						GTTTTATTTCACATTCGTAAT	0.348													7	260	---	---	---	---	PASS
SNCAIP	9627	broad.mit.edu	37	5	121739540	121739540	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121739540C>T	uc003ksw.1	+	3	316	c.110C>T	c.(109-111)ACG>ATG	p.T37M	SNCAIP_uc011cwl.1_Translation_Start_Site|SNCAIP_uc010jct.2_Missense_Mutation_p.T37M|SNCAIP_uc003ksx.1_Missense_Mutation_p.T84M|SNCAIP_uc003ksy.1_Missense_Mutation_p.R22C|SNCAIP_uc003ksz.1_Missense_Mutation_p.R22C|SNCAIP_uc010jcu.2_Missense_Mutation_p.R22C|SNCAIP_uc011cwm.1_Missense_Mutation_p.R22C|SNCAIP_uc003kta.1_Missense_Mutation_p.R20C|SNCAIP_uc010jcv.1_RNA|SNCAIP_uc010jcw.1_Missense_Mutation_p.R22C|SNCAIP_uc010jcx.1_Missense_Mutation_p.T37M	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein	37					cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		AGATGTGATACGCAAAACGAA	0.463													12	169	---	---	---	---	PASS
DRD1	1812	broad.mit.edu	37	5	174868700	174868700	+	3'UTR	SNP	G	A	A	rs686	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174868700G>A	uc003mcz.2	-	2						NM_000794	NP_000785	P21728	DRD1_HUMAN	dopamine receptor D1						activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|adult walking behavior|cerebral cortex GABAergic interneuron migration|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|mating behavior|positive regulation of cAMP biosynthetic process|positive regulation of cell migration|positive regulation of potassium ion transport|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of synaptic transmission, glutamatergic|prepulse inhibition|response to drug|synapse assembly|visual learning	endoplasmic reticulum membrane|membrane fraction	protein binding			ovary(2)|skin(1)	3	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Carphenazine(DB01038)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Cocaine(DB00907)|Dopamine(DB00988)|Fenoldopam(DB00800)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methylergonovine(DB00353)|Minaprine(DB00805)|Olanzapine(DB00334)|Pegademase bovine(DB00061)|Pergolide(DB01186)|Perphenazine(DB00850)|Prochlorperazine(DB00433)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Triflupromazine(DB00508)|Zuclopenthixol(DB01624)	TTAATAGCAAGCCCCAGAGCA	0.483													5	150	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32037587	32037587	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32037587C>T	uc003nzl.2	-	15	5532	c.5330G>A	c.(5329-5331)CGT>CAT	p.R1777H		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	1859	Fibronectin type-III 11.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						CTCCCCCAGACGGGGTTTTGG	0.582													3	42	---	---	---	---	PASS
DAAM2	23500	broad.mit.edu	37	6	39832798	39832798	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39832798A>G	uc003oow.2	+	5	532	c.376A>G	c.(376-378)AGG>GGG	p.R126G	DAAM2_uc010jxc.2_Missense_Mutation_p.R126G|DAAM2_uc003oox.2_Missense_Mutation_p.R126G	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	126	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					GACGGAGATGAGGAACCAAGT	0.557											OREG0017416	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	14	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180449	20180449	+	3'UTR	SNP	G	C	C	rs113534252		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180449G>C	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacacagacacacacac	0.164													5	56	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32957139	32957139	+	Intron	SNP	T	C	C			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32957139T>C	uc011kai.1	+						RP9P_uc003tdc.2_RNA|RP9P_uc003tdd.2_RNA|RP9P_uc011kaj.1_RNA	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						CCAGTAACTGTTTTAACTGCT	0.313													6	94	---	---	---	---	PASS
RECQL4	9401	broad.mit.edu	37	8	145736738	145736738	+	3'UTR	SNP	T	G	G			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145736738T>G	uc003zdj.2	-	22						NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4						DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTGTGGCAGGTTTTGCCCAGG	0.562			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				11	29	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66499716	66499716	+	Missense_Mutation	SNP	A	G	G	rs141617852	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66499716A>G	uc004aee.1	+	1	526	c.526A>G	c.(526-528)AAT>GAT	p.N176D	LOC442421_uc004aed.1_RNA					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						CCTGGAGCCCAATCTGCTGGA	0.607													12	118	---	---	---	---	PASS
ZER1	10444	broad.mit.edu	37	9	131503068	131503068	+	Silent	SNP	C	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131503068C>T	uc004bwa.1	-	12	2269	c.1836G>A	c.(1834-1836)CAG>CAA	p.Q612Q		NM_006336	NP_006327	Q7Z7L7	ZER1_HUMAN	zyg-11 homolog B (C. elegans)-like	612	ARM 4.				ATP hydrolysis coupled proton transport|regulation of ubiquitin-protein ligase activity	Cul2-RING ubiquitin ligase complex|vacuolar proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism|ubiquitin-protein ligase activity			ovary(1)	1						CGCTGATGAACTGGGAAGTCA	0.308													8	166	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1264631	1264631	+	Intron	SNP	A	G	G	rs56726556	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1264631A>G	uc009ycr.1	+						MUC5B_uc001ltb.2_Missense_Mutation_p.N2177S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		gccaccagcaacacAGTGACT	0.328													3	6	---	---	---	---	PASS
TRIM6	117854	broad.mit.edu	37	11	5632424	5632424	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5632424A>G	uc001mbc.1	+	8	1451	c.1319A>G	c.(1318-1320)GAG>GGG	p.E440G	HBG2_uc001mak.1_Intron|TRIM6-TRIM34_uc001mbf.2_Intron|TRIM6_uc009yeo.1_Missense_Mutation_p.E414G|TRIM6_uc010qzj.1_Missense_Mutation_p.E265G|TRIM6_uc001mbe.2_Missense_Mutation_p.E265G|TRIM6_uc010qzk.1_Missense_Mutation_p.E265G|TRIM6_uc010qzl.1_Missense_Mutation_p.E265G|TRIM6_uc001mbd.2_Missense_Mutation_p.E468G|TRIM6_uc001mbg.1_Missense_Mutation_p.E265G|TRIM6_uc009yep.1_3'UTR	NM_058166	NP_477514	Q9C030	TRIM6_HUMAN	tripartite motif-containing 6 isoform 2	440	B30.2/SPRY.				protein trimerization	cytoplasm	zinc ion binding				0		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		TTAGATTATGAGGCTGGTACT	0.433													14	316	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46401517	46401517	+	3'UTR	SNP	A	G	G	rs61882687	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46401517A>G	uc001ncn.1	+	32					DGKZ_uc001nch.1_3'UTR|DGKZ_uc001ncj.1_3'UTR|DGKZ_uc010rgr.1_3'UTR|DGKZ_uc001nck.1_3'UTR|DGKZ_uc001ncl.2_3'UTR|DGKZ_uc001ncm.2_3'UTR|DGKZ_uc009yky.1_3'UTR|DGKZ_uc010rgs.1_3'UTR|MDK_uc009ykz.1_5'Flank|MDK_uc001nco.2_5'Flank|MDK_uc001ncp.2_5'Flank|MDK_uc009yla.2_5'Flank|MDK_uc009ylb.2_5'Flank|MDK_uc001ncq.2_5'Flank|MDK_uc001ncr.2_5'Flank|MDK_uc001ncs.2_5'Flank	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CACGGGCAGCAGGAGGGACAA	0.682													3	13	---	---	---	---	PASS
OR5B17	219965	broad.mit.edu	37	11	58126475	58126475	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58126475A>C	uc010rke.1	-	1	68	c.68T>G	c.(67-69)GTT>GGT	p.V23G		NM_001005489	NP_001005489	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B,	23	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AAAGAGGGGAACCTGTAGTTC	0.438													11	166	---	---	---	---	PASS
DRD2	1813	broad.mit.edu	37	11	113295366	113295366	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113295366G>A	uc001pnz.2	-	1	329	c.8C>T	c.(7-9)CCA>CTA	p.P3L	DRD2_uc010rwv.1_Missense_Mutation_p.P3L|DRD2_uc001poa.3_Missense_Mutation_p.P3L|DRD2_uc001pob.3_Missense_Mutation_p.P3L|DRD2_uc009yyr.1_Missense_Mutation_p.P3L	NM_000795	NP_000786	P14416	DRD2_HUMAN	dopamine receptor D2 isoform long	3	Extracellular (By similarity).				activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)	CAGATTCAGTGGATCCATCAG	0.582													4	79	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92991	92991	+	5'UTR	SNP	C	G	G	rs71277143	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92991C>G	uc010sdi.1	-	1					uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		TGCCTGGCATCACCACACACC	0.617													2	7	---	---	---	---	PASS
C1RL	51279	broad.mit.edu	37	12	7248981	7248981	+	3'UTR	SNP	C	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7248981C>A	uc001qsn.2	-	6					C1RL_uc009zft.2_3'UTR	NM_016546	NP_057630	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like						complement activation, classical pathway|innate immune response|proteolysis		serine-type endopeptidase activity			pancreas(1)	1						GTTCAAGCCCCCAGGGTCAAT	0.592													4	87	---	---	---	---	PASS
LRIG3	121227	broad.mit.edu	37	12	59267899	59267899	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59267899G>A	uc001sqr.2	-	18	3299	c.3053C>T	c.(3052-3054)TCC>TTC	p.S1018F	LRIG3_uc009zqh.2_Missense_Mutation_p.S958F|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	1018						integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			ATCTAAAGAGGACTTGTTTAG	0.403													11	219	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116446661	116446661	+	Silent	SNP	C	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116446661C>A	uc001tvw.2	-	10	1612	c.1557G>T	c.(1555-1557)GTG>GTT	p.V519V		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	519					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TACTGCTAGACACCTCTAAGG	0.453													7	97	---	---	---	---	PASS
P2RX2	22953	broad.mit.edu	37	12	133197607	133197607	+	Silent	SNP	T	C	C			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133197607T>C	uc001ukj.1	+	8	795	c.795T>C	c.(793-795)ATT>ATC	p.I265I	P2RX2_uc001uki.1_Silent_p.I265I|P2RX2_uc001ukk.1_Silent_p.I265I|P2RX2_uc001ukl.1_Silent_p.I241I|P2RX2_uc001ukm.1_Silent_p.I193I|P2RX2_uc001ukn.1_Silent_p.I173I|P2RX2_uc009zyt.1_Silent_p.I265I|P2RX2_uc001uko.1_Silent_p.I231I	NM_170682	NP_733782	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X2 isoform A	265	Extracellular (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		TCGGGGTCATTATCAACTGGG	0.637													5	84	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20006719	20006719	+	Splice_Site	SNP	C	G	G	rs143769638		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20006719C>G	uc001umd.2	-	17	1328	c.1117_splice	c.e17-1	p.N373_splice	TPTE2_uc009zzk.2_Splice_Site|TPTE2_uc009zzl.2_Splice_Site_p.N262_splice|TPTE2_uc001ume.2_Splice_Site_p.N296_splice|TPTE2_uc009zzm.2_Splice_Site_p.N44_splice|TPTE2_uc010tcm.1_Splice_Site|TPTE2_uc010tcl.1_Splice_Site_p.N44_splice	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid							endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CATATCTATTCTGAAAAGCAA	0.313													6	81	---	---	---	---	PASS
MTHFD1	4522	broad.mit.edu	37	14	64909059	64909059	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64909059C>G	uc001xhb.2	+	21	2462	c.2075C>G	c.(2074-2076)CCC>CGC	p.P692R	MTHFD1_uc010aqf.2_Missense_Mutation_p.P748R	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1	692	Formyltetrahydrofolate synthetase.				folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GGCCTCTGCCCCCACGTGGTG	0.527													5	154	---	---	---	---	PASS
AK7	122481	broad.mit.edu	37	14	96909069	96909069	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96909069G>A	uc001yfn.2	+	7	737	c.693G>A	c.(691-693)ATG>ATA	p.M231I		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	231	Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		CCTTTCAGATGGCTTGGTTGG	0.443													13	402	---	---	---	---	PASS
SLC7A5P2	387254	broad.mit.edu	37	16	21531609	21531609	+	Missense_Mutation	SNP	C	T	T	rs42139	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21531609C>T	uc002djd.2	-	1	157	c.78G>A	c.(76-78)ATG>ATA	p.M26I	uc002diq.3_Intron|LOC100271836_uc002dja.2_RNA|LOC100271836_uc002djb.2_RNA	NR_002594				RecName: Full=Putative L-type amino acid transporter 1-like protein MLAS; AltName: Full=hLAT1 3-transmembrane protein MLAS;          Short=hLAT1 3TM MLAS;												0						TGGCGGCCATCATCTTCTCCC	0.741													4	8	---	---	---	---	PASS
UBTF	7343	broad.mit.edu	37	17	42293143	42293143	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42293143G>A	uc002igb.2	-	4	420	c.353C>T	c.(352-354)CCT>CTT	p.P118L	UBTF_uc002igc.2_Missense_Mutation_p.P118L|UBTF_uc010czs.2_Missense_Mutation_p.P118L|UBTF_uc002igd.2_Missense_Mutation_p.P118L|UBTF_uc010czt.2_Missense_Mutation_p.P118L|UBTF_uc002ige.2_Missense_Mutation_p.P118L	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA	118	HMG box 1.				positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCGGAAATAAGGGGTCAGGGG	0.488													7	162	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75212424	75212424	+	3'UTR	SNP	T	C	C	rs142751453	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75212424T>C	uc002jto.2	+	17					SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_3'UTR|SEC14L1_uc002jtm.2_3'UTR|SEC14L1_uc010wti.1_3'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						gtaggtagggttagtaggtag	0.000													3	14	---	---	---	---	PASS
SGSH	6448	broad.mit.edu	37	17	78188012	78188012	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78188012G>T	uc002jxz.3	-	5	709	c.622C>A	c.(622-624)CCA>ACA	p.P208T	SGSH_uc002jya.3_Missense_Mutation_p.P5T|SGSH_uc002jxy.2_Missense_Mutation_p.P208T|SGSH_uc010wue.1_Silent_p.S219S	NM_000199	NP_000190	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase precursor	208					proteoglycan metabolic process	lysosome	metal ion binding|N-sulfoglucosamine sulfohydrolase activity|sulfuric ester hydrolase activity			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GTCCAGTCTGGGATACGACCC	0.667													4	31	---	---	---	---	PASS
ZNF441	126068	broad.mit.edu	37	19	11892189	11892189	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11892189C>T	uc010dyj.2	+	4	1744	c.1550C>T	c.(1549-1551)TCA>TTA	p.S517L	ZNF441_uc002msn.3_Missense_Mutation_p.S473L	NM_152355	NP_689568	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	517	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TCTCCCAGTTCATTTCGAAGA	0.398													8	160	---	---	---	---	PASS
SCAF1	58506	broad.mit.edu	37	19	50158050	50158050	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50158050A>C	uc002poq.2	+	9	3665	c.3541A>C	c.(3541-3543)ACC>CCC	p.T1181P		NM_021228	NP_067051	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1181					mRNA processing|RNA splicing	nucleus	RNA binding				0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		GACCCCCCCCACCCCCACCGG	0.692													4	23	---	---	---	---	PASS
PRIC285	85441	broad.mit.edu	37	20	62193019	62193019	+	Silent	SNP	C	T	T	rs11551684	byFrequency	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62193019C>T	uc002yfm.2	-	13	7663	c.6771G>A	c.(6769-6771)CCG>CCA	p.P2257P	PRIC285_uc002yfl.1_Silent_p.P1688P	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	2257					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			TGCCCACACGCGGCACTGGGA	0.652													6	104	---	---	---	---	PASS
MICAL3	57553	broad.mit.edu	37	22	18273463	18273463	+	3'UTR	SNP	G	A	A	rs62238879	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18273463G>A	uc002zng.3	-	32					MICAL3_uc011agl.1_3'UTR|MICAL3_uc010grd.1_3'UTR|MICAL3_uc010gre.1_RNA	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		CTGGCCAGGCGGATGCCAACA	0.607													2	2	---	---	---	---	PASS
C22orf29	79680	broad.mit.edu	37	22	19838698	19838698	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19838698C>G	uc002zqg.2	-	2	1686	c.1087G>C	c.(1087-1089)GGG>CGG	p.G363R	GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqe.1_Intron|GNB1L_uc002zqf.1_Intron|C22orf29_uc002zqh.2_Missense_Mutation_p.G363R|C22orf29_uc002zqi.2_Missense_Mutation_p.G363R|C22orf29_uc010grt.1_Intron	NM_024627	NP_078903	Q7L3V2	CV029_HUMAN	hypothetical protein LOC79680	363											0	Colorectal(54;0.0993)					GTTCAGAACCCAGGAGAAAGT	0.607													2	8	---	---	---	---	PASS
AIFM3	150209	broad.mit.edu	37	22	21322168	21322168	+	5'UTR	SNP	G	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21322168G>A	uc002ztj.2	+	2					AIFM3_uc002ztk.2_5'UTR|AIFM3_uc002ztl.2_5'UTR|AIFM3_uc011ahx.1_Missense_Mutation_p.A4T	NM_144704	NP_653305	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor,						activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CATGGGGGGCGCCCTAGGCCT	0.672													7	47	---	---	---	---	PASS
PKDREJ	10343	broad.mit.edu	37	22	46657040	46657040	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46657040C>T	uc003bhh.2	-	1	2180	c.2180G>A	c.(2179-2181)CGA>CAA	p.R727Q		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	727	Extracellular (Potential).|REJ.				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TCTGTCATCTCGGAGAGGTAA	0.388													6	209	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17275557	17275558	+	Intron	INS	-	CTTAGAT	CTTAGAT			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17275557_17275558insCTTAGAT	uc001azt.2	+						CROCC_uc009voz.1_Intron|CROCC_uc001azu.2_Intron	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ctgtgccaccacttagatctca	0.149													6	4	---	---	---	---	
HNRNPR	10236	broad.mit.edu	37	1	23660245	23660245	+	Intron	DEL	A	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23660245delA	uc001bgr.3	-						HNRNPR_uc001bgp.3_Intron|HNRNPR_uc009vqk.2_Intron|HNRNPR_uc001bgs.3_Intron|HNRNPR_uc010odw.1_Intron|HNRNPR_uc010odx.1_Intron|HNRNPR_uc009vql.2_Intron	NM_005826	NP_005817	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R							catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		ATGGTTAGGTAAAAAAAAAAG	0.318													6	3	---	---	---	---	
ZMYM6	9204	broad.mit.edu	37	1	35495990	35495990	+	Intron	DEL	C	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35495990delC	uc001byh.2	-						ZMYM6_uc001byf.1_Intron|ZMYM6_uc010oht.1_Intron|ZMYM6_uc009vup.2_Intron|ZMYM6_uc009vuq.1_Intron|ZMYM6_uc009vur.1_Intron|ZMYM6_uc001byj.2_Intron|ZMYM6_uc001byi.2_Intron|ZMYM6_uc001byk.2_Intron	NM_007167	NP_009098	O95789	ZMYM6_HUMAN	zinc finger protein 258						multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				ctaaggagatcgcaccactgc	0.080													5	3	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62613787	62613788	+	Intron	DEL	TG	-	-	rs66743140		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62613787_62613788delTG	uc001dab.2	+						INADL_uc001dac.2_Intron|INADL_uc009wag.2_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						agtgagacactgtctttaaaaa	0.005													4	2	---	---	---	---	
PLB1	151056	broad.mit.edu	37	2	28773037	28773038	+	Intron	INS	-	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28773037_28773038insT	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_Intron	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					CTTCCACGTGGttttttttttt	0.223													9	4	---	---	---	---	
MTMR14	64419	broad.mit.edu	37	3	9739253	9739253	+	Intron	DEL	T	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9739253delT	uc003brz.2	+						MTMR14_uc003bsa.2_Intron|MTMR14_uc003bsb.2_Intron|MTMR14_uc011ath.1_Intron|MTMR14_uc010hcl.2_Intron|MTMR14_uc003bsc.2_Intron	NM_001077525	NP_001070993	Q8NCE2	MTMRE_HUMAN	jumpy isoform 2							perinuclear region of cytoplasm|ruffle	phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(99;0.227)					CTTGTCCAGCTTTTTTTTTTA	0.468													27	7	---	---	---	---	
NGLY1	55768	broad.mit.edu	37	3	25820384	25820384	+	Intron	DEL	G	-	-	rs71867147		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25820384delG	uc003cdl.2	-						NGLY1_uc010hfg.2_Intron|NGLY1_uc003cdm.2_Intron|NGLY1_uc011awo.1_Intron|NGLY1_uc003cdk.2_5'Flank	NM_018297	NP_060767	Q96IV0	NGLY1_HUMAN	N-glycanase 1 isoform 1						glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding			breast(1)	1						TTTTTGAGATGGGGGGGGTCT	0.214													4	2	---	---	---	---	
KIF15	56992	broad.mit.edu	37	3	44887009	44887009	+	Intron	DEL	A	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44887009delA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc010hir.2_Intron	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TCTGGCACCTAAAAAAAAAAG	0.378													4	2	---	---	---	---	
FOXP1	27086	broad.mit.edu	37	3	71027051	71027051	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71027051delT	uc003dol.2	-	11	1599	c.1276delA	c.(1276-1278)ACCfs	p.T426fs	FOXP1_uc003dom.2_Frame_Shift_Del_p.T350fs|FOXP1_uc003don.2_RNA|FOXP1_uc003doo.2_Frame_Shift_Del_p.T426fs|FOXP1_uc003dop.2_Frame_Shift_Del_p.T426fs|FOXP1_uc003doq.1_Frame_Shift_Del_p.T425fs|FOXP1_uc003doi.2_Frame_Shift_Del_p.T326fs|FOXP1_uc003doj.2_Frame_Shift_Del_p.T326fs|FOXP1_uc003dok.2_Frame_Shift_Del_p.T239fs|FOXP1_uc003dor.1_Frame_Shift_Del_p.T204fs	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1	426					cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		ATGCTGGTGGTTGTGATGACA	0.577			T	PAX5	ALL								265	11	---	---	---	---	
ZBTB38	253461	broad.mit.edu	37	3	141164925	141164926	+	3'UTR	INS	-	A	A	rs79262793		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141164925_141164926insA	uc003etw.2	+	8					ZBTB38_uc010hun.2_3'UTR|ZBTB38_uc010huo.2_3'UTR|ZBTB38_uc003ety.2_3'UTR|ZBTB38_uc010hup.2_3'UTR	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38						positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						GGAGTGAAATTAAAAAAAAAAA	0.262													9	5	---	---	---	---	
MAP9	79884	broad.mit.edu	37	4	156281741	156281741	+	Intron	DEL	A	-	-	rs78652179		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156281741delA	uc003ios.2	-						MAP9_uc011cin.1_Intron|MAP9_uc010iqa.1_Intron|MAP9_uc003iot.1_Intron	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein						cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		AGTGATTTACAAAAAAAAATA	0.254													6	3	---	---	---	---	
CYP4V2	285440	broad.mit.edu	37	4	187131993	187131994	+	3'UTR	INS	-	T	T	rs150697121		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187131993_187131994insT	uc003iyw.3	+	11					CYP4V2_uc010ism.2_RNA	NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,						response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		ttttttctttattttttttttt	0.139													4	2	---	---	---	---	
MOCS2	4338	broad.mit.edu	37	5	52394685	52394685	+	Intron	DEL	T	-	-	rs3842048		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52394685delT	uc011cqf.1	-						MOCS2_uc003joz.2_Intron	NM_176806	NP_789776	O96033	MOC2A_HUMAN	molybdopterin synthase small subunit MOCS2A						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex	nucleotide binding				0		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				GTTTTAAACATTTTTTTTTCT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475785	90475786	+	IGR	INS	-	A	A	rs140241795	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475785_90475786insA								GPR98 (15753 upstream) : ARRDC3 (188755 downstream)																							aggaaggaaggaggaaggaagg	0.030													3	4	---	---	---	---	
XPO5	57510	broad.mit.edu	37	6	43533306	43533306	+	Intron	DEL	A	-	-	rs113079021		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43533306delA	uc003ovp.2	-							NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			atctcaaaataaaaaaaaaaa	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55659699	55659699	+	IGR	DEL	C	-	-	rs140374894		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55659699delC								VOPP1 (19499 upstream) : LOC442308 (53613 downstream)																							CTCAGCTGCACCCCCCCTCTT	0.587													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56244094	56244094	+	IGR	DEL	A	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56244094delA								PSPH (60004 upstream) : DKFZp434L192 (319822 downstream)																							TCCCCCACCTAAAAAAAAACA	0.448													322	7	---	---	---	---	
AKAP9	10142	broad.mit.edu	37	7	91706403	91706403	+	Intron	DEL	T	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91706403delT	uc003ulg.2	+						AKAP9_uc003ulf.2_Intron|AKAP9_uc003uli.2_Intron|AKAP9_uc003ulj.2_Intron	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			attattattattTCtttcttt	0.100			T	BRAF	papillary thyroid								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7679341	7679342	+	IGR	INS	-	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7679341_7679342insA								FAM90A7 (262107 upstream) : SPAG11A (26060 downstream)																							gactccttctcaaaaaaaaaaa	0.074													11	5	---	---	---	---	
CNOT7	29883	broad.mit.edu	37	8	17088040	17088040	+	3'UTR	DEL	T	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17088040delT	uc003wxf.1	-	7					CNOT7_uc003wxg.1_3'UTR	NM_013354	NP_037486	Q9UIV1	CNOT7_HUMAN	CCR4-NOT transcription complex, subunit 7						carbohydrate metabolic process|nuclear-transcribed mRNA poly(A) tail shortening	CCR4-NOT complex|cytoplasmic mRNA processing body|cytosol	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(1)	1				Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)		CCTGAATGCGTTTTTTTTTTT	0.358													4	2	---	---	---	---	
LRRC6	23639	broad.mit.edu	37	8	133584934	133584934	+	Intron	DEL	A	-	-	rs34229467		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133584934delA	uc003ytk.2	-						LRRC6_uc003ytl.2_Intron	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6							cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GAAAAGTTCTAAAAAAAAAAA	0.249													4	2	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	400095	400097	+	Intron	DEL	CAC	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400095_400097delCAC	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		cctccaccatcaccaccaccacc	0.000													4	3	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14824710	14824711	+	Intron	DEL	TA	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14824710_14824711delTA	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		ACCACAGTACTATATATATATA	0.356													6	3	---	---	---	---	
C9orf11	54586	broad.mit.edu	37	9	27291192	27291193	+	Intron	INS	-	T	T	rs138227130	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27291192_27291193insT	uc003zql.2	-						C9orf11_uc011lnq.1_Intron	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1							acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		tgtgtcagacctgtggttggca	0.054													3	3	---	---	---	---	
HIATL1	84641	broad.mit.edu	37	9	97221855	97221855	+	3'UTR	DEL	T	-	-	rs34087557		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97221855delT	uc004aur.2	+	12					HIATL1_uc011luh.1_3'UTR	NM_032558	NP_115947	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1						transmembrane transport	integral to membrane|plasma membrane	protein binding|transporter activity			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)				CCTCCTCCTGTTTTTTTTTTT	0.403													4	3	---	---	---	---	
C9orf80	58493	broad.mit.edu	37	9	115461441	115461442	+	Intron	INS	-	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115461441_115461442insT	uc004bgg.2	-						C9orf80_uc010muk.2_Intron	NM_021218	NP_067041	Q9NRY2	SOSSC_HUMAN	SOSSC protein						DNA repair|response to ionizing radiation	SOSS complex	protein binding				0						cttaaaaaaaaaattttttttt	0.000													4	2	---	---	---	---	
C10orf68	79741	broad.mit.edu	37	10	33123596	33123609	+	Intron	DEL	TTTTTACTAATTCA	-	-	rs72280983		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33123596_33123609delTTTTTACTAATTCA	uc001iwn.3	+						C10orf68_uc001iwl.1_Intron|C10orf68_uc001iwm.1_Intron|C10orf68_uc010qei.1_Intron|C10orf68_uc001iwo.3_Intron	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68											skin(2)|ovary(1)	3						TGCTTTTTTTTTTTTACTAATTCATCTTCTTTAA	0.182													3	3	---	---	---	---	
MYOF	26509	broad.mit.edu	37	10	95211928	95211928	+	Intron	DEL	A	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95211928delA	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc001kip.3_Intron|MYOF_uc009xuf.2_Intron	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						GAAAAAAGAGAAAAAAAAAGG	0.363													168	7	---	---	---	---	
NXF1	10482	broad.mit.edu	37	11	62564556	62564556	+	Intron	DEL	C	-	-	rs111331941		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62564556delC	uc001nvf.1	-						NXF1_uc001nvg.1_Intron|NXF1_uc009yog.1_Intron	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1						gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						aaaaaaaaaacaaaacaaaaa	0.244													12	6	---	---	---	---	
ARHGAP32	9743	broad.mit.edu	37	11	128993224	128993225	+	Intron	INS	-	A	A	rs145776868	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128993224_128993225insA	uc009zcp.2	-						ARHGAP32_uc009zcq.1_Intron	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1						cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						AGACATCAATTAAAAAAAAAAC	0.277													4	2	---	---	---	---	
NCKAP1L	3071	broad.mit.edu	37	12	54910234	54910234	+	Intron	DEL	C	-	-	rs60294924	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54910234delC	uc001sgc.3	+						NCKAP1L_uc010sox.1_Intron|NCKAP1L_uc010soy.1_Intron	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like						actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						cttttcttttctttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	96505610	96505610	+	IGR	DEL	T	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96505610delT								LTA4H (68312 upstream) : ELK3 (82597 downstream)																							tccttcttccttccttccttc	0.144													4	2	---	---	---	---	
SLC24A6	80024	broad.mit.edu	37	12	113747851	113747852	+	Intron	INS	-	A	A	rs144628302		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113747851_113747852insA	uc001tvc.2	-						SLC24A6_uc001tuz.2_Intron|SLC24A6_uc001tva.2_Intron|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor						response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						aagctattaccaaaaaAAAAAA	0.173													4	2	---	---	---	---	
C14orf68	283600	broad.mit.edu	37	14	100793289	100793290	+	Intron	INS	-	A	A			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100793289_100793290insA	uc001yhc.2	+						C14orf68_uc001yhd.2_Intron	NM_207117	NP_997000	Q6Q0C1	S2547_HUMAN	chromosome 14 open reading frame 68						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0		Melanoma(154;0.152)				ccagcctgggcaaAAAAAAAAA	0.208													3	3	---	---	---	---	
EFTUD1	79631	broad.mit.edu	37	15	82555147	82555151	+	5'Flank	DEL	CTCTG	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82555147_82555151delCTCTG	uc002bgt.1	-						EFTUD1_uc002bgu.1_5'Flank|FAM154B_uc002bgv.2_5'Flank|FAM154B_uc010unr.1_5'Flank|FAM154B_uc010uns.1_5'Flank	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain						mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity			ovary(1)	1						CCGGGCATCCCTCTGTTGCCTTGAC	0.556													1	5	---	---	---	---	
SRRM2	23524	broad.mit.edu	37	16	2821013	2821014	+	3'UTR	INS	-	T	T			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2821013_2821014insT	uc002crk.2	+	15						NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300							Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						TTTCCCTCCCCTTTTTTTTTTC	0.530													6	3	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27990888	27990888	+	Intron	DEL	A	-	-	rs77066595		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27990888delA	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						agaatccatcaaaaaaaaaaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87302142	87302142	+	Intron	DEL	A	-	-	rs144361402		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87302142delA	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		CCTTTGATTTAAAAAAAAAAT	0.343													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																							GTTTGTTACCTCTATCTATTGACT	0.343													4	2	---	---	---	---	
MRPL45	84311	broad.mit.edu	37	17	36476863	36476863	+	Intron	DEL	T	-	-	rs67792707		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36476863delT	uc002hpy.2	+							NM_032351	NP_115727	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45 precursor						intracellular protein transport|translation	mitochondrial inner membrane presequence translocase complex|ribosome	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|structural constituent of ribosome				0	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTCTTCCTGAttttttttttc	0.249													6	3	---	---	---	---	
MED1	5469	broad.mit.edu	37	17	37566389	37566390	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37566389_37566390delTA	uc002hrv.3	-	17	2296_2297	c.2084_2085delTA	c.(2083-2085)TTAfs	p.L695fs	MED1_uc010wee.1_Frame_Shift_Del_p.L523fs|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	695	Interaction with PPARGC1A and THRA.|Interaction with ESR1.|Interaction with VDR.|Interaction with GATA1 (By similarity).				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TCTCAGGTGGTAATCTTGATGA	0.460										HNSCC(31;0.082)			410	15	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39920786	39920787	+	Intron	INS	-	GAAA	GAAA	rs60346985		TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39920786_39920787insGAAA	uc002hxq.2	-						JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Intron|JUP_uc002hxs.2_Intron	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		gactccgtcagaaaaaaaaaaa	0.188													1	5	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60070140	60070141	+	Intron	INS	-	T	T	rs138009503	by1000genomes	TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60070140_60070141insT	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						cttattattacttttttttgag	0.000													5	5	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467599	1467600	+	Intron	INS	-	TTTC	TTTC			TCGA-CH-5763-01	TCGA-CH-5763-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467599_1467600insTTTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ctttctttctgtttctgtttct	0.045													8	4	---	---	---	---	
