Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MRPL20	55052	broad.mit.edu	37	1	1341203	1341203	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1341203C>A	uc001afo.3	-	3	358	c.262G>T	c.(262-264)GGG>TGG	p.G88W	MRPL20_uc010nyn.1_Missense_Mutation_p.G88W	NM_017971	NP_060441	Q9BYC9	RM20_HUMAN	mitochondrial ribosomal protein L20 precursor	88							protein binding|rRNA binding				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		ACTAAATTCCCAATGAGCGCT	0.343													13	289	---	---	---	---	PASS
ATAD3B	83858	broad.mit.edu	37	1	1431295	1431295	+	3'UTR	SNP	T	C	C	rs9793057		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1431295T>C	uc001afv.2	+	16					ATAD3B_uc001afx.2_3'UTR|ATAD3B_uc001afy.2_3'UTR	NM_031921	NP_114127	Q5T9A4	ATD3B_HUMAN	AAA-ATPase  TOB3								ATP binding|nucleoside-triphosphatase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGAGGCTTTGTACCCCAGCCC	0.657													3	17	---	---	---	---	PASS
CLSTN1	22883	broad.mit.edu	37	1	9795231	9795231	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9795231A>C	uc001aqh.2	-	14	2644	c.1885T>G	c.(1885-1887)TGT>GGT	p.C629G	CLSTN1_uc001aqi.2_Missense_Mutation_p.C619G|CLSTN1_uc010oag.1_Missense_Mutation_p.C610G|CLSTN1_uc001aqf.2_5'Flank	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1	629	Extracellular (Potential).				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TCGTTAAAACACCTGCCAGCA	0.587													28	88	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17084968	17084968	+	Missense_Mutation	SNP	G	C	C	rs2761533		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17084968G>C	uc010ock.1	-	11	1507	c.1507C>G	c.(1507-1509)CGG>GGG	p.R503G	CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_Missense_Mutation_p.R77G	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						CACCGATTCCGCAAGCTGACT	0.617													9	72	---	---	---	---	PASS
GPATCH3	63906	broad.mit.edu	37	1	27217393	27217393	+	3'UTR	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27217393A>C	uc001bne.2	-	7					GPN2_uc001bnd.1_5'Flank|GPATCH3_uc009vsp.1_3'UTR	NM_022078	NP_071361	Q96I76	GPTC3_HUMAN	G patch domain containing 3							intracellular	nucleic acid binding				0		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		AACACCCTGAACCAGCCACGA	0.552													9	18	---	---	---	---	PASS
COL8A2	1296	broad.mit.edu	37	1	36563467	36563467	+	Nonsense_Mutation	SNP	G	T	T	rs149251273	byFrequency	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36563467G>T	uc001bzv.1	-	2	1822	c.1815C>A	c.(1813-1815)TAC>TAA	p.Y605*	COL8A2_uc001bzw.1_Nonsense_Mutation_p.Y540*	NM_005202	NP_005193	P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2 precursor	605	C1q.|Nonhelical region (NC1).				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGGCTGGGTTGTAGCCGCTGT	0.612													6	26	---	---	---	---	PASS
ERMAP	114625	broad.mit.edu	37	1	43296646	43296646	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43296646C>T	uc001cic.1	+	4	563	c.293C>T	c.(292-294)ACG>ATG	p.T98M	ERMAP_uc010ojw.1_Missense_Mutation_p.T159M|ERMAP_uc001cid.1_Intron|ERMAP_uc001cie.1_Missense_Mutation_p.T98M|ERMAP_uc001cif.1_Missense_Mutation_p.T8M	NM_001017922	NP_001017922	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein	98	Ig-like V-type.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AAGGGGAGGACGGTGCTAGTG	0.562													22	45	---	---	---	---	PASS
NASP	4678	broad.mit.edu	37	1	46073803	46073803	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46073803G>T	uc001coi.1	+	6	1322	c.1220G>T	c.(1219-1221)GGC>GTC	p.G407V	NASP_uc010olq.1_Missense_Mutation_p.G370V|NASP_uc001coh.1_Missense_Mutation_p.G409V|NASP_uc001coj.1_Intron|NASP_uc010olr.1_Missense_Mutation_p.G343V|NASP_uc001cok.1_Missense_Mutation_p.G290V	NM_002482	NP_002473	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein isoform 2	407	Glu-rich (acidic).				blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					ACAAAAGATGGCTCAGGACTA	0.488													8	143	---	---	---	---	PASS
TXNIP	10628	broad.mit.edu	37	1	145439572	145439572	+	Intron	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145439572C>A	uc001enn.3	+						NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_Missense_Mutation_p.T22N	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein						cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTAATGGCTACTCGATTTTCT	0.423													7	39	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152284306	152284306	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152284306G>A	uc001ezu.1	-	3	3092	c.3056C>T	c.(3055-3057)GCG>GTG	p.A1019V	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1019	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGGGATGACGCAGCCTGTCC	0.582									Ichthyosis				286	571	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157504477	157504477	+	Silent	SNP	T	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157504477T>C	uc001fqu.2	-	8	1766	c.1608A>G	c.(1606-1608)TCA>TCG	p.S536S	FCRL5_uc009wsm.2_Silent_p.S536S|FCRL5_uc010phv.1_Silent_p.S536S|FCRL5_uc010phw.1_Silent_p.S451S|FCRL5_uc001fqv.1_Silent_p.S536S|FCRL5_uc010phx.1_Silent_p.S287S	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	536	Extracellular (Potential).|Ig-like C2-type 5.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AGTAATTCCCTGAATGTCCTT	0.512													31	55	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186295344	186295344	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186295344A>T	uc001grv.2	-	41	6210	c.5913T>A	c.(5911-5913)GAT>GAA	p.D1971E		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1971	Poly-Asp.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		catcatcatcatcttcctcat	0.194			T	NTRK1	papillary thyroid								27	49	---	---	---	---	PASS
SRGAP2	23380	broad.mit.edu	37	1	206566195	206566195	+	Silent	SNP	C	T	T	rs148059703	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206566195C>T	uc001hdy.2	+	3	708	c.375C>T	c.(373-375)AAC>AAT	p.N125N	SRGAP2_uc009xbt.2_Silent_p.N49N|SRGAP2_uc010prt.1_Silent_p.N49N|SRGAP2_uc001hdx.2_Silent_p.N125N|SRGAP2_uc010pru.1_Silent_p.N49N|SRGAP2_uc010prv.1_Silent_p.N49N	NM_015326	NP_056141	O75044	FNBP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	212					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)					CCACGGCCAACGTTCGCATTG	0.532													5	21	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216052411	216052411	+	Silent	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216052411G>A	uc001hku.1	-	42	8640	c.8253C>T	c.(8251-8253)AAC>AAT	p.N2751N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2751	Fibronectin type-III 14.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTATGTCTCCGTTCTGGATGA	0.418										HNSCC(13;0.011)			60	111	---	---	---	---	PASS
OR2C3	81472	broad.mit.edu	37	1	247695757	247695757	+	Silent	SNP	G	A	A	rs61746303	byFrequency	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247695757G>A	uc009xgy.2	-	2	419	c.57C>T	c.(55-57)TCC>TCT	p.S19S	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C,	19	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			AGGGTCGTGTGGAGAAGCCCA	0.488													46	87	---	---	---	---	PASS
DHX57	90957	broad.mit.edu	37	2	39088318	39088318	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39088318T>C	uc002rrf.2	-	5	1333	c.1234A>G	c.(1234-1236)ATA>GTA	p.I412V	DHX57_uc002rre.2_5'UTR|DHX57_uc002rrg.2_Missense_Mutation_p.I412V	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	412							ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				AAAAGGGTTATCAAAGAATAT	0.423													106	149	---	---	---	---	PASS
RTKN	6242	broad.mit.edu	37	2	74666767	74666767	+	Intron	SNP	C	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74666767C>G	uc002sle.2	-						RTKN_uc002slc.2_5'UTR|RTKN_uc002sld.2_Intron|RTKN_uc010ffe.1_Intron|RTKN_uc010fff.1_5'UTR|RTKN_uc010ffg.1_Intron	NM_001015055	NP_001015055	Q9BST9	RTKN_HUMAN	rhotekin isoform a						apoptosis|regulation of anti-apoptosis|Rho protein signal transduction	intracellular	GTP binding|GTP-Rho binding|GTPase inhibitor activity			skin(1)	1						CCCCCCGGTGCCCTTTCCCTT	0.572													15	35	---	---	---	---	PASS
ARID5A	10865	broad.mit.edu	37	2	97216444	97216444	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97216444G>A	uc002swe.2	+	6	644	c.544G>A	c.(544-546)GCC>ACC	p.A182T	ARID5A_uc010yuq.1_Missense_Mutation_p.A130T|ARID5A_uc002swf.2_Missense_Mutation_p.A18T|ARID5A_uc002swg.2_Missense_Mutation_p.A130T	NM_212481	NP_997646	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A	182					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding				0						GCCGAAGAAGGCCAAGGAGGA	0.647													8	5	---	---	---	---	PASS
RGPD5	84220	broad.mit.edu	37	2	113127621	113127621	+	3'UTR	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113127621C>T	uc002ths.1	-	23					RGPD8_uc010fkk.1_3'UTR	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						AATGCAAACACATATACACAC	0.308													3	36	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152474946	152474946	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152474946A>C	uc010fnx.2	-	70	10381	c.10190T>G	c.(10189-10191)GTT>GGT	p.V3397G		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3397	Nebulin 93.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATCAATCGGAACCCAGCCAAT	0.393													15	53	---	---	---	---	PASS
STAT4	6775	broad.mit.edu	37	2	191922752	191922752	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191922752G>A	uc002usm.1	-	13	1452	c.1198C>T	c.(1198-1200)CGA>TGA	p.R400*	STAT4_uc002usn.1_Nonsense_Mutation_p.R400*|STAT4_uc010zgk.1_Nonsense_Mutation_p.R245*|STAT4_uc002uso.2_Nonsense_Mutation_p.R400*	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription	400					JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			ACCAAATGTCGAAATTCTACT	0.363													45	78	---	---	---	---	PASS
PDCD1	5133	broad.mit.edu	37	2	242793207	242793207	+	3'UTR	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242793207C>T	uc002wcq.3	-	5					PDCD1_uc010fzs.2_3'UTR|PDCD1_uc010fzt.2_RNA	NM_005018	NP_005009	Q15116	PDCD1_HUMAN	programmed cell death 1 precursor						apoptosis|humoral immune response|multicellular organismal development|T cell costimulation	integral to membrane	protein tyrosine phosphatase activity|signal transducer activity			ovary(1)	1		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0219)		CCAAGGAAGCCGGTCAGAGGG	0.667													17	26	---	---	---	---	PASS
GPX1	2876	broad.mit.edu	37	3	49395339	49395339	+	Intron	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49395339G>T	uc011bcl.1	-						GPX1_uc011bcm.1_3'UTR	NM_000581	NP_000572	P07203	GPX1_HUMAN	glutathione peroxidase 1 isoform 1						anti-apoptosis|cell redox homeostasis|glutathione metabolic process|heart contraction|hydrogen peroxide catabolic process|negative regulation of caspase activity|purine base metabolic process|purine nucleotide catabolic process|regulation of gene expression, epigenetic|regulation of mammary gland epithelial cell proliferation|regulation of proteasomal protein catabolic process|release of cytochrome c from mitochondria|response to selenium ion|UV protection	cytosol|mitochondrion	endopeptidase inhibitor activity|glutathione peroxidase activity|SH3 domain binding			large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Glutathione(DB00143)	CAACAGAAAGGAAACGAGAGA	0.567													6	7	---	---	---	---	PASS
MBD4	8930	broad.mit.edu	37	3	129150264	129150264	+	3'UTR	SNP	A	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129150264A>G	uc003emh.1	-	8					uc003emg.2_5'Flank|MBD4_uc003emi.1_3'UTR|MBD4_uc003emj.1_3'UTR|MBD4_uc003emk.1_3'UTR	NM_003925	NP_003916	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4						depyrimidination	nucleoplasm	DNA N-glycosylase activity|endodeoxyribonuclease activity|protein binding|satellite DNA binding			ovary(1)|lung(1)	2						CTATGGCTGGAAAGGTGGTTG	0.373								BER_DNA_glycosylases					22	49	---	---	---	---	PASS
MYNN	55892	broad.mit.edu	37	3	169497118	169497118	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169497118A>G	uc003fft.2	+	3	1258	c.829A>G	c.(829-831)ATA>GTA	p.I277V	MYNN_uc011bpm.1_Missense_Mutation_p.I163V|MYNN_uc003ffu.2_Missense_Mutation_p.I277V|MYNN_uc003ffv.2_Missense_Mutation_p.I4V|MYNN_uc010hwo.2_Missense_Mutation_p.I277V|MYNN_uc003ffw.1_RNA	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin	277						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			TATGTCTAATATAGCCAGCGT	0.458													28	59	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195511780	195511780	+	Missense_Mutation	SNP	G	A	A	rs391928	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195511780G>A	uc011bto.1	-	2	7131	c.6671C>T	c.(6670-6672)CCT>CTT	p.P2224L	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAAGAAGAGGGATGGCGTG	0.592													4	2	---	---	---	---	PASS
NOP14	8602	broad.mit.edu	37	4	2952002	2952002	+	Intron	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2952002A>C	uc003ggj.1	-						C4orf10_uc003ggh.2_RNA|C4orf10_uc003ggi.1_RNA|NOP14_uc010icp.2_Intron|NOP14_uc003ggk.3_Intron|NOP14_uc003ggl.2_Intron	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						GGACCATCTCACAGCCACATC	0.552													13	39	---	---	---	---	PASS
FAM13A	10144	broad.mit.edu	37	4	89660254	89660254	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89660254A>C	uc003hse.1	-	20	2697	c.2489T>G	c.(2488-2490)GTG>GGG	p.V830G	FAM13A_uc011cdp.1_5'Flank|FAM13A_uc003hsa.1_Missense_Mutation_p.V301G|FAM13A_uc003hsb.1_Missense_Mutation_p.V504G|FAM13A_uc003hsd.1_Missense_Mutation_p.V504G|FAM13A_uc003hsc.1_Missense_Mutation_p.V490G|FAM13A_uc011cdq.1_Missense_Mutation_p.V476G|FAM13A_uc003hsf.1_Missense_Mutation_p.V416G|FAM13A_uc003hsg.1_Missense_Mutation_p.V301G	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	830					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						TGGCTTCATCACCTGCCGTTC	0.512													9	18	---	---	---	---	PASS
TNIP3	79931	broad.mit.edu	37	4	122063932	122063932	+	Splice_Site	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122063932C>A	uc010ing.2	-	8	932	c.736_splice	c.e8-1	p.I246_splice	TNIP3_uc010inh.2_Splice_Site_p.I246_splice|TNIP3_uc011cgj.1_Splice_Site_p.I304_splice	NM_024873	NP_079149	Q96KP6	TNIP3_HUMAN	TNFAIP3 interacting protein 3											ovary(1)	1						AAGCTTTTATCTAAAGACAAA	0.338													34	163	---	---	---	---	PASS
NEK1	4750	broad.mit.edu	37	4	170458976	170458976	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170458976C>T	uc003isb.1	-	18	2141	c.1649G>A	c.(1648-1650)CGA>CAA	p.R550Q	NEK1_uc003isc.1_Missense_Mutation_p.R506Q|NEK1_uc003isd.1_Missense_Mutation_p.R550Q|NEK1_uc003ise.1_Missense_Mutation_p.R506Q|NEK1_uc003isf.1_Missense_Mutation_p.R481Q	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	550					cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TCCTTCGGCTCGAGCTTTATT	0.383													11	503	---	---	---	---	PASS
NDUFS4	4724	broad.mit.edu	37	5	52979037	52979037	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52979037G>T	uc003jpe.2	+	5	542	c.514G>T	c.(514-516)GTA>TTA	p.V172L		NM_002495	NP_002486	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4	172					brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1		Lung NSC(810;8.27e-05)|Breast(144;0.0848)			NADH(DB00157)	AAGAACAAGAGTATCCACAAA	0.378													6	31	---	---	---	---	PASS
PDE8B	8622	broad.mit.edu	37	5	76709105	76709105	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76709105G>A	uc003kfa.2	+	17	1927	c.1882G>A	c.(1882-1884)GCT>ACT	p.A628T	PDE8B_uc003kfb.2_Missense_Mutation_p.A608T|PDE8B_uc003kfc.2_Missense_Mutation_p.A573T|PDE8B_uc003kfd.2_Missense_Mutation_p.A581T|PDE8B_uc003kfe.2_Missense_Mutation_p.A531T	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1	628	Catalytic (By similarity).				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		GCACGCCACCGCTTTCTTTCT	0.473													34	157	---	---	---	---	PASS
LOC100133050	100133050	broad.mit.edu	37	5	99715528	99715528	+	RNA	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99715528C>T	uc011cuw.1	-	4		c.382G>A				NR_027503				Homo sapiens glucuronidase, beta pseudogene (LOC100133050), non-coding RNA.												0						AGCGGACAGTCGAAGCCCTTC	0.607													3	19	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127595146	127595146	+	3'UTR	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127595146G>T	uc003kuu.2	-	65						NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCTGTGAAGGGTTAATAGAGC	0.448													35	167	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140208009	140208009	+	Missense_Mutation	SNP	C	A	A	rs138737999	byFrequency	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140208009C>A	uc003lho.2	+	1	360	c.333C>A	c.(331-333)GAC>GAA	p.D111E	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.D111E|PCDHA6_uc011dab.1_Missense_Mutation_p.D111E	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	111	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATCGTGGACAGGCCGCTGC	0.557													10	314	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140515710	140515710	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140515710G>A	uc003liq.2	+	1	911	c.694G>A	c.(694-696)GTC>ATC	p.V232I		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	232	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCGCATTGTCGTCTTGGATAA	0.552													33	433	---	---	---	---	PASS
TAP1	6890	broad.mit.edu	37	6	32815790	32815790	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32815790G>C	uc003ocg.2	-	8	1981	c.1826C>G	c.(1825-1827)GCC>GGC	p.A609G	TAP1_uc011dqi.1_Missense_Mutation_p.A348G	NM_000593	NP_000584	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family	609	Cytoplasmic (Potential).|ABC transporter.				antigen processing and presentation of endogenous peptide antigen via MHC class I|cytosol to ER transport|intracellular transport of viral proteins in host cell|positive regulation of T cell mediated cytotoxicity	cytosol|plasma membrane|TAP complex	ADP binding|ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding			skin(1)	1						CTGCAGCAGGGCAGCCACTGT	0.627													8	24	---	---	---	---	PASS
PACSIN1	29993	broad.mit.edu	37	6	34495228	34495228	+	Silent	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34495228C>A	uc003ojo.2	+	3	389	c.183C>A	c.(181-183)ACC>ACA	p.T61T	PACSIN1_uc003ojp.2_Silent_p.T61T	NM_020804	NP_065855	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in	61	FCH.				endocytosis		protein kinase activity				0						AGCAGCTCACCGACTGGGCCA	0.657											OREG0017366	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	5	---	---	---	---	PASS
SLC26A8	116369	broad.mit.edu	37	6	35930384	35930384	+	Silent	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35930384A>C	uc003olm.2	-	12	1491	c.1380T>G	c.(1378-1380)GGT>GGG	p.G460G	SLC26A8_uc010jwa.2_RNA|SLC26A8_uc003olk.2_Silent_p.G42G|SLC26A8_uc003oln.2_Silent_p.G460G|SLC26A8_uc003oll.2_Silent_p.G355G	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a	460	Helical; (Potential).				cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						TCAGAATAATACCAGCCAGCA	0.463													16	46	---	---	---	---	PASS
IL20RA	53832	broad.mit.edu	37	6	137322636	137322636	+	3'UTR	SNP	A	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137322636A>G	uc003qhj.2	-	7					IL20RA_uc011edl.1_3'UTR|IL20RA_uc003qhk.2_3'UTR|IL20RA_uc003qhi.2_3'UTR	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha precursor							integral to membrane	receptor activity			ovary(2)|skin(2)	4	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		TATGGCTGGGATCAAAGGGGT	0.413													20	95	---	---	---	---	PASS
TTLL2	83887	broad.mit.edu	37	6	167754664	167754664	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167754664G>A	uc003qvs.1	+	3	1364	c.1276G>A	c.(1276-1278)GAA>AAA	p.E426K	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	426	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGAGGGGAGAGAAGCCAGTAA	0.418													8	121	---	---	---	---	PASS
C7orf28B	221960	broad.mit.edu	37	7	6865838	6865838	+	5'UTR	SNP	G	A	A	rs71524081		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6865838G>A	uc003sqx.1	-	1					C7orf28B_uc011jxd.1_5'UTR|C7orf28B_uc003sqy.1_5'UTR	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		TCCCGCCCCGGCCCCCACCTC	0.562													5	6	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55220302	55220302	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55220302G>C	uc003tqk.2	+	6	938	c.692G>C	c.(691-693)TGC>TCC	p.C231S	EGFR_uc003tqh.2_Missense_Mutation_p.C231S|EGFR_uc003tqi.2_Missense_Mutation_p.C231S|EGFR_uc003tqj.2_Missense_Mutation_p.C231S|EGFR_uc010kzg.1_Missense_Mutation_p.C186S|EGFR_uc011kco.1_Missense_Mutation_p.C178S|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	231	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CCCAGTGACTGCTGCCACAAC	0.627		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			8	44	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107834822	107834822	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107834822T>A	uc003vfb.2	-	16	1985	c.1514A>T	c.(1513-1515)CAT>CTT	p.H505L	NRCAM_uc003vfc.2_Missense_Mutation_p.H499L|NRCAM_uc011kmk.1_Missense_Mutation_p.H500L|NRCAM_uc003vfd.2_Missense_Mutation_p.H481L|NRCAM_uc003vfe.2_Missense_Mutation_p.H481L	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	505	Ig-like 5.|Extracellular (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						TCCATTTTCATGTAAAACATA	0.333													62	116	---	---	---	---	PASS
METTL2B	55798	broad.mit.edu	37	7	128142064	128142064	+	3'UTR	SNP	T	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128142064T>C	uc003vnf.2	+	9					METTL2B_uc003vng.2_3'UTR|METTL2B_uc011kop.1_3'UTR	NM_018396	NP_060866	Q6P1Q9	MTL2B_HUMAN	methyltransferase like 2B								methyltransferase activity			skin(1)	1						atgcctgtaatcccagccact	0.179													8	21	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48771531	48771531	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48771531G>A	uc003xqi.2	-	48	6281	c.6224C>T	c.(6223-6225)ACG>ATG	p.T2075M	PRKDC_uc003xqj.2_Missense_Mutation_p.T2075M|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	2075					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				ATCATGCACCGTGGGGTCCCG	0.602								NHEJ					7	265	---	---	---	---	PASS
CA2	760	broad.mit.edu	37	8	86376332	86376332	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86376332G>T	uc003ydk.2	+	1	202	c.22G>T	c.(22-24)GGC>TGC	p.G8C		NM_000067	NP_000058	P00918	CAH2_HUMAN	carbonic anhydrase II	8					one-carbon metabolic process	apical part of cell	carbonate dehydratase activity|zinc ion binding			central_nervous_system(1)	1					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)	CTGGGGGTACGGCAAACACAA	0.622													2	0	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131792813	131792813	+	Silent	SNP	G	A	A	rs146198447		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131792813G>A	uc003ytd.3	-	18	3835	c.3579C>T	c.(3577-3579)GCC>GCT	p.A1193A	ADCY8_uc010mds.2_Silent_p.A1062A	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	1193	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GGACAACCGCGGCCAGGGAGT	0.498										HNSCC(32;0.087)			62	99	---	---	---	---	PASS
KIAA1539	80256	broad.mit.edu	37	9	35107646	35107646	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35107646C>A	uc003zwl.2	-	3	951	c.626G>T	c.(625-627)GGT>GTT	p.G209V	KIAA1539_uc003zwm.2_Missense_Mutation_p.G209V|KIAA1539_uc003zwn.2_Intron|KIAA1539_uc003zwo.2_Missense_Mutation_p.G209V|KIAA1539_uc003zwp.1_Missense_Mutation_p.G209V|KIAA1539_uc010mkk.1_Intron	NM_025182	NP_079458	Q7L5A3	K1539_HUMAN	hypothetical protein LOC80256	209						nucleus				ovary(2)	2	all_epithelial(49;0.217)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CCAGAGGCTACCCCCATTGCC	0.657													8	63	---	---	---	---	PASS
SYK	6850	broad.mit.edu	37	9	93637062	93637062	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93637062C>T	uc004aqz.2	+	9	1317	c.1112C>T	c.(1111-1113)ACG>ATG	p.T371M	SYK_uc004ara.2_Missense_Mutation_p.T348M|SYK_uc004arb.2_Missense_Mutation_p.T348M|SYK_uc004arc.2_Missense_Mutation_p.T371M|SYK_uc011ltr.1_RNA|SYK_uc011lts.1_RNA|SYK_uc011ltt.1_RNA	NM_003177	NP_003168	P43405	KSYK_HUMAN	spleen tyrosine kinase isoform 1	371	Protein kinase.				cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						AAGCTGCTGACGCTGGAAGAC	0.522			T	ETV6|ITK	MDS|peripheral T-cell lymphoma								13	315	---	---	---	---	PASS
CTNNAL1	8727	broad.mit.edu	37	9	111718091	111718091	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111718091G>T	uc004bdo.1	-	12	1650	c.1608C>A	c.(1606-1608)TAC>TAA	p.Y536*	CTNNAL1_uc010mts.1_Nonsense_Mutation_p.Y188*|CTNNAL1_uc010mtt.1_Nonsense_Mutation_p.Y536*|CTNNAL1_uc004bdp.1_Nonsense_Mutation_p.Y536*|CTNNAL1_uc004bdq.1_Nonsense_Mutation_p.Y22*	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1	536					cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)		GAAGTGAAAGGTAGCCATACT	0.244													10	35	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127790688C>A	uc004bpe.2	-	5	477	c.396G>T	c.(394-396)CAG>CAT	p.Q132H	SCAI_uc004bpd.2_Missense_Mutation_p.Q155H|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	132	Required for interaction with MKL1 (By similarity).|Necessary to inhibit MKL1-induced SRF transcriptional activity (By similarity).				negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						GATAGTATAGCTGCCCAATCT	0.338													13	141	---	---	---	---	PASS
ENTPD8	377841	broad.mit.edu	37	9	140330681	140330681	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140330681G>T	uc004cmw.2	-	7	1018	c.834C>A	c.(832-834)TAC>TAA	p.Y278*	C9orf167_uc011mew.1_Intron|ENTPD8_uc004cmx.2_Nonsense_Mutation_p.Y278*	NM_001033113	NP_001028285	Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	278	Extracellular (Potential).					integral to membrane|plasma membrane	ATP binding			skin(1)	1	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		GTGTGGTCTGGTAGCCGCTGA	0.697													5	24	---	---	---	---	PASS
UNC5B	219699	broad.mit.edu	37	10	73050753	73050753	+	Missense_Mutation	SNP	T	G	G	rs114541882	byFrequency	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73050753T>G	uc001jro.2	+	9	1626	c.1181T>G	c.(1180-1182)GTG>GGG	p.V394G	UNC5B_uc001jrp.2_Missense_Mutation_p.V383G	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B precursor	394	Helical; (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane				ovary(2)|lung(1)	3						CTCATGGCGGTGGGGGTGGTG	0.627													27	149	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97192297	97192297	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97192297G>A	uc001kkp.2	-	4	254	c.209C>T	c.(208-210)GCG>GTG	p.A70V	SORBS1_uc001kkn.2_Missense_Mutation_p.A26V|SORBS1_uc001kkm.2_Missense_Mutation_p.A58V|SORBS1_uc001kko.2_Missense_Mutation_p.A70V|SORBS1_uc001kkq.2_Missense_Mutation_p.A70V|SORBS1_uc001kkr.2_Missense_Mutation_p.A38V|SORBS1_uc001kks.2_Missense_Mutation_p.A38V|SORBS1_uc001kkt.2_RNA|SORBS1_uc001kku.2_Missense_Mutation_p.A70V|SORBS1_uc001kkv.2_Missense_Mutation_p.A38V|SORBS1_uc001kkw.2_Missense_Mutation_p.A70V|SORBS1_uc010qoe.1_Missense_Mutation_p.A38V|SORBS1_uc010qof.1_Missense_Mutation_p.A38V|SORBS1_uc001kkx.1_Missense_Mutation_p.A38V	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	70					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GAGAGTCACCGCTCCCTTCCC	0.517													45	86	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104678361	104678361	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104678361C>A	uc001kwm.2	+	1	248	c.124C>A	c.(124-126)CAG>AAG	p.Q42K	CNNM2_uc001kwn.2_Missense_Mutation_p.Q42K|CNNM2_uc001kwl.2_Missense_Mutation_p.Q42K	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	42					ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GGGGATCCTGCAGGCGGCTGC	0.587													2	2	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104679671	104679671	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104679671C>A	uc001kwm.2	+	1	1558	c.1434C>A	c.(1432-1434)TAC>TAA	p.Y478*	CNNM2_uc001kwn.2_Nonsense_Mutation_p.Y478*|CNNM2_uc001kwl.2_Nonsense_Mutation_p.Y478*	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	478	CBS 1.				ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		AGAGCGGCTACACCCGCATTC	0.567													6	62	---	---	---	---	PASS
OR52R1	119695	broad.mit.edu	37	11	4825344	4825344	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4825344C>A	uc010qym.1	-	1	504	c.504G>T	c.(502-504)TGG>TGT	p.W168C		NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R,	89	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAGCATGAAACCAGAATATGG	0.527													31	56	---	---	---	---	PASS
GIF	2694	broad.mit.edu	37	11	59608634	59608634	+	Silent	SNP	A	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59608634A>G	uc001noi.2	-	5	723	c.675T>C	c.(673-675)AGT>AGC	p.S225S		NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	225					cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						CGAGGCCAGTACTGTAGATGT	0.363													57	101	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88781056	88781056	+	5'UTR	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88781056C>A	uc001pcq.2	-	1					GRM5_uc009yvm.2_5'UTR|GRM5_uc009yvn.1_5'UTR	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	GAAAGGAGTTCAAGCCAATAA	0.463													6	17	---	---	---	---	PASS
PARP11	57097	broad.mit.edu	37	12	3921218	3921218	+	3'UTR	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3921218G>A	uc001qmk.1	-	7					PARP11_uc001qml.2_3'UTR|PARP11_uc009zef.2_RNA|PARP11_uc001qmm.2_3'UTR|PARP11_uc001qmn.2_3'UTR	NM_020367	NP_065100	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11								NAD+ ADP-ribosyltransferase activity			ovary(1)|central_nervous_system(1)	2			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			TTAGTGGCTAGATGACTGAAG	0.348													9	18	---	---	---	---	PASS
CD4	920	broad.mit.edu	37	12	6928064	6928064	+	Missense_Mutation	SNP	A	C	C	rs145973129	byFrequency	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6928064A>C	uc001qqv.1	+	9	1575	c.1330A>C	c.(1330-1332)ACC>CCC	p.T444P	CD4_uc010sfj.1_Missense_Mutation_p.T171P|CD4_uc009zfc.1_Missense_Mutation_p.T265P|CD4_uc010sfk.1_Missense_Mutation_p.T171P|CD4_uc010sfl.1_Missense_Mutation_p.T171P|CD4_uc010sfm.1_Missense_Mutation_p.T171P|GPR162_uc010sfn.1_5'Flank|GPR162_uc001qqw.1_5'Flank|GPR162_uc001qqx.1_5'Flank|GPR162_uc009zfd.1_5'Flank	NM_000616	NP_000607	P01730	CD4_HUMAN	CD4 antigen precursor	444	Cytoplasmic (Potential).|HIV-1 Vpu-susceptibility domain.				cell adhesion|entry into host cell|immune response|induction by virus of host cell-cell fusion|initiation of viral infection|maintenance of protein location in cell|positive regulation of interleukin-2 biosynthetic process|positive regulation of protein kinase activity|protein palmitoleylation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|T cell selection|transmembrane receptor protein tyrosine kinase signaling pathway	early endosome|endoplasmic reticulum membrane|integral to membrane|T cell receptor complex	coreceptor activity|extracellular matrix structural constituent|glycoprotein binding|MHC class II protein binding|protein homodimerization activity|protein kinase binding|transmembrane receptor activity|zinc ion binding				0		Myeloproliferative disorder(1001;0.0122)				TGAGAAGAAGACCTGCCAGTG	0.363													7	14	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9583205	9583205	+	Missense_Mutation	SNP	G	T	T	rs61340441		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9583205G>T	uc010sgs.1	-	10	1416	c.1221C>A	c.(1219-1221)AGC>AGA	p.S407R		NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						TGACCTCCACGCTGTGCATGC	0.677													6	6	---	---	---	---	PASS
DUSP16	80824	broad.mit.edu	37	12	12630584	12630584	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12630584T>C	uc001rao.1	-	7	1813	c.1181A>G	c.(1180-1182)AAT>AGT	p.N394S	DUSP16_uc001ram.1_5'Flank|DUSP16_uc001ran.1_Missense_Mutation_p.N246S	NM_030640	NP_085143	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	394					inactivation of MAPK activity|MAPK export from nucleus|MAPK phosphatase export from nucleus, leptomycin B sensitive	cytoplasmic membrane-bounded vesicle|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		CTTGAGCTTATTGCTGTCTTC	0.478													53	91	---	---	---	---	PASS
RPL13AP20	387841	broad.mit.edu	37	12	13028751	13028751	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13028751G>C	uc010sho.1	+	1	341	c.319G>C	c.(319-321)GGC>CGC	p.G107R		NR_003932				SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;												0						GGTGTTTGACGGCATCCCACC	0.612													4	15	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31270149	31270149	+	Missense_Mutation	SNP	G	C	C	rs7316147	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31270149G>C	uc010sjy.1	-	28	3720	c.3720C>G	c.(3718-3720)TGC>TGG	p.C1240W	uc001rjy.2_Intron|uc001rjz.2_Intron					RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CCTCTTCCCCGCCTGGCTCTT	0.587													5	15	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31270150	31270150	+	Missense_Mutation	SNP	C	A	A	rs7315923	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31270150C>A	uc010sjy.1	-	28	3719	c.3719G>T	c.(3718-3720)TGC>TTC	p.C1240F	uc001rjy.2_Intron|uc001rjz.2_Intron					RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CTCTTCCCCGCCTGGCTCTTA	0.587													5	15	---	---	---	---	PASS
GALNT6	11226	broad.mit.edu	37	12	51753107	51753107	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51753107A>C	uc001ryk.2	-	7	1402	c.1177T>G	c.(1177-1179)TGT>GGT	p.C393G	GALNT6_uc009zma.1_RNA|GALNT6_uc001ryl.1_Missense_Mutation_p.C393G|GALNT6_uc001ryj.1_5'UTR	NM_007210	NP_009141	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	393	Catalytic subdomain B.|Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						TGGCCCCCACACTGCCACACC	0.572													24	87	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57566959	57566959	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57566959C>A	uc001snd.2	+	21	3638	c.3172C>A	c.(3172-3174)CCC>ACC	p.P1058T		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1058	Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGCCACGAGGCCCCCTGGTGG	0.672											OREG0021936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	54	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88442916	88442916	+	3'UTR	SNP	T	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88442916T>C	uc001tar.2	-	54					CEP290_uc001taq.2_3'UTR|C12orf29_uc001tao.2_3'UTR|C12orf29_uc001tap.2_RNA|C12orf29_uc009zsk.2_RNA	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						ATTTAACTTATAAAGTTAATA	0.289													54	76	---	---	---	---	PASS
HNF1A	6927	broad.mit.edu	37	12	121437365	121437365	+	Missense_Mutation	SNP	C	T	T	rs144674840		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121437365C>T	uc001tzg.2	+	9	1726	c.1703C>T	c.(1702-1704)CCC>CTC	p.P568L	HNF1A_uc010szn.1_Missense_Mutation_p.P575L	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha	568					glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTCCACGTCCCCAGCCAGGAC	0.687									Hepatic_Adenoma_Familial_Clustering_of				14	15	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122825728	122825728	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122825728C>A	uc001ucg.1	-	10	2129	c.2023G>T	c.(2023-2025)GAA>TAA	p.E675*	CLIP1_uc001uch.1_Nonsense_Mutation_p.E664*|CLIP1_uc001uci.1_Nonsense_Mutation_p.E629*|CLIP1_uc001ucj.1_Nonsense_Mutation_p.E365*|CLIP1_uc009zxo.1_Nonsense_Mutation_p.E231*	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	675	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TGCAAATTTTCTATTTCGTGT	0.388													147	255	---	---	---	---	PASS
MPHOSPH9	10198	broad.mit.edu	37	12	123641348	123641348	+	3'UTR	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123641348C>A	uc001uel.2	-	20					MPHOSPH9_uc010tal.1_3'UTR|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_3'UTR	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9						M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		TTAATGGCTACAAATCTCAAA	0.353													9	36	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29599666	29599666	+	Silent	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29599666C>T	uc001usl.3	+	1	919	c.861C>T	c.(859-861)TCC>TCT	p.S287S		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	277						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						CATCACATTCCGCCCATCCAG	0.517													12	23	---	---	---	---	PASS
RCBTB2	1102	broad.mit.edu	37	13	49089864	49089864	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49089864G>T	uc001vch.2	-	5	427	c.56C>A	c.(55-57)ACT>AAT	p.T19N	RCBTB2_uc010tgg.1_Missense_Mutation_p.T24N|RCBTB2_uc001vci.2_5'UTR|RCBTB2_uc010tgh.1_5'UTR|RCBTB2_uc001vcj.2_Missense_Mutation_p.T23N|RCBTB2_uc010acv.1_RNA|RCBTB2_uc010tgi.1_5'UTR	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	19							Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		AGATGACAGAGTAGCCTGTAC	0.388													8	75	---	---	---	---	PASS
COMMD6	170622	broad.mit.edu	37	13	76112056	76112056	+	5'Flank	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76112056G>T	uc001vjo.1	-						COMMD6_uc001vjn.1_5'Flank|COMMD6_uc010aet.1_5'Flank|COMMD6_uc001vjp.1_RNA	NM_203495	NP_987091	Q7Z4G1	COMD6_HUMAN	COMM domain containing 6 isoform b							cytoplasm|nucleus	protein binding				0		Breast(118;0.0979)|Prostate(6;0.122)		GBM - Glioblastoma multiforme(99;0.0104)		AGCAGGGGAAGCTGAAAAAAG	0.488													5	25	---	---	---	---	PASS
ZNF828	283489	broad.mit.edu	37	13	115090481	115090481	+	Silent	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115090481G>A	uc010ahb.2	+	3	1493	c.1164G>A	c.(1162-1164)GAG>GAA	p.E388E	ZNF828_uc001vuv.2_Silent_p.E388E|ZNF828_uc010tko.1_Silent_p.E388E	NM_001164144	NP_001157616	Q96JM3	ZN828_HUMAN	zinc finger protein 828	388	Mediates interaction with MAD2L2.|Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|protein localization to kinetochore|protein localization to microtubule|sister chromatid biorientation	condensed chromosome kinetochore|cytoplasm|nucleus|spindle	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_epithelial(44;0.122)|all_lung(25;0.123)	BRCA - Breast invasive adenocarcinoma(86;0.104)	OV - Ovarian serous cystadenocarcinoma(48;0.193)|Epithelial(10;0.197)		CATCTCCTGAGTCATGGAAGT	0.542													13	231	---	---	---	---	PASS
EFS	10278	broad.mit.edu	37	14	23828655	23828655	+	Silent	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23828655C>T	uc001wjo.2	-	4	1640	c.1032G>A	c.(1030-1032)CTG>CTA	p.L344L	EFS_uc001wjp.2_Silent_p.L251L|EFS_uc010tnm.1_Silent_p.L175L	NM_005864	NP_005855	O43281	EFS_HUMAN	embryonal Fyn-associated substrate isoform 1	344	Pro-rich.				cell adhesion|intracellular signal transduction	cytoplasm	SH3 domain binding			large_intestine(1)	1	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		CATAACCAGGCAGGCGGGGTG	0.687													33	61	---	---	---	---	PASS
NOVA1	4857	broad.mit.edu	37	14	26917261	26917261	+	Silent	SNP	T	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26917261T>C	uc001wpy.2	-	5	1746	c.1428A>G	c.(1426-1428)GGA>GGG	p.G476G	NOVA1_uc001wpz.2_Silent_p.G452G|NOVA1_uc001wqa.2_Silent_p.G354G	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1	479	KH 3.				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		CAGCTGGTGTTCCAGTAATGG	0.458													50	90	---	---	---	---	PASS
C14orf129	51527	broad.mit.edu	37	14	96848763	96848763	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96848763C>T	uc001yfj.3	+	3	324	c.179C>T	c.(178-180)GCG>GTG	p.A60V	C14orf129_uc001yfl.2_Missense_Mutation_p.A60V	NM_016472	NP_057556	Q9P0R6	GSKIP_HUMAN	chromosome 14 open reading frame 129	60						cytoplasm	protein binding				0		Melanoma(154;0.226)		Epithelial(152;0.109)|COAD - Colon adenocarcinoma(157;0.205)		CTGCGGTGTGCGGATGATGTG	0.428													74	110	---	---	---	---	PASS
JAG2	3714	broad.mit.edu	37	14	105615535	105615535	+	Silent	SNP	G	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105615535G>C	uc001yqg.2	-	13	2129	c.1725C>G	c.(1723-1725)CGC>CGG	p.R575R	JAG2_uc010axf.2_5'Flank|JAG2_uc001yqf.2_5'UTR|JAG2_uc001yqh.2_Silent_p.R537R	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	575	Extracellular (Potential).|EGF-like 10; atypical.				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GGCACGGCTCGCGGGGCACGG	0.682													11	65	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106134512	106134512	+	Intron	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106134512C>T	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001ysb.1_RNA					Parts of antibodies, mostly variable regions.												0						AGTATGTAGACGGGGTACGTG	0.642													9	46	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25326355	25326355	+	Intron	SNP	T	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25326355T>G	uc001yxh.1	+						SNORD116-4_uc001yxm.1_RNA|IPW_uc001yxn.3_RNA|SNORD116-28_uc001yxy.2_RNA|SNORD116-15_uc001yxz.2_5'Flank|SNORD116-16_uc001yya.2_5'Flank|IPW_uc001yyb.3_5'Flank|SNORD116-19_uc001yyc.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CCAGAGGCTGTTGGGATCCTC	0.507													11	40	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49305008	49305008	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49305008G>T	uc001zxe.1	-	12	1702	c.1568C>A	c.(1567-1569)ACT>AAT	p.T523N	SECISBP2L_uc001zxd.1_Missense_Mutation_p.T478N|SECISBP2L_uc010bep.1_Missense_Mutation_p.T285N	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	523										breast(1)|skin(1)	2						AGAAGCTGCAGTAACCACTAA	0.363													8	56	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63125610	63125610	+	Intron	SNP	T	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63125610T>G	uc002alb.3	+						TLN2_uc002alc.3_Intron|TLN2_uc010uic.1_Intron|uc002ale.1_RNA	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						AATAGGCAGGTGAAGAGCCAG	0.438													14	80	---	---	---	---	PASS
FAM169B	283777	broad.mit.edu	37	15	99029197	99029197	+	5'UTR	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99029197A>C	uc002buk.1	-	3						NM_182562	NP_872368	Q8N8A8	F169B_HUMAN	hypothetical protein LOC283777												0						CTTTATGTAAACAGCCACAAC	0.483													21	45	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2506607	2506607	+	Silent	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2506607C>T	uc002cqd.1	+	17	2035	c.1947C>T	c.(1945-1947)TGC>TGT	p.C649C	CCNF_uc002cqe.1_Silent_p.C341C	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	649	PEST.				cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				AACAGCATTGCTGCCAGGAAT	0.607													25	42	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30731617	30731617	+	Silent	SNP	A	C	C	rs145842115	byFrequency	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30731617A>C	uc002dze.1	+	19	3337	c.2952A>C	c.(2950-2952)CCA>CCC	p.P984P	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Silent_p.P841P|SRCAP_uc010bzz.1_Silent_p.P554P	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	984	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CTGACCCCCCACCCCGGCCCA	0.572													38	88	---	---	---	---	PASS
LPCAT2	54947	broad.mit.edu	37	16	55543073	55543073	+	5'UTR	SNP	G	C	C	rs17302903	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55543073G>C	uc002eie.3	+	1						NM_017839	NP_060309	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2						cellular membrane organization|platelet activating factor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|Golgi stack|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding				0						GCTTCGGCCGGGTTCTACGCC	0.706													3	5	---	---	---	---	PASS
DDX19B	11269	broad.mit.edu	37	16	70363960	70363960	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70363960A>G	uc002eyo.2	+	9	1141	c.1012A>G	c.(1012-1014)ATC>GTC	p.I338V	DDX19B_uc010vly.1_Missense_Mutation_p.I338V|DDX19A_uc002eys.2_Intron|DDX19B_uc010vlv.1_Missense_Mutation_p.I312V|DDX19B_uc010vlw.1_Missense_Mutation_p.I229V|DDX19B_uc002eyp.2_Missense_Mutation_p.I307V|DDX19B_uc002eyq.2_Missense_Mutation_p.I229V|DDX19B_uc002eyr.2_Missense_Mutation_p.I187V|DDX19B_uc010vlx.1_Missense_Mutation_p.I187V|uc002eyt.2_Intron	NM_007242	NP_009173	Q9UMR2	DD19B_HUMAN	DEAD (Asp-Glu-Ala-As) box polypeptide 19 isoform	338	Helicase C-terminal.				mRNA export from nucleus|protein transport|transmembrane transport	cytoplasm|nuclear membrane|nuclear pore	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			kidney(1)	1		Ovarian(137;0.0694)				TCAAGCCATGATCTTCTGCCA	0.592													11	150	---	---	---	---	PASS
C17orf97	400566	broad.mit.edu	37	17	263615	263615	+	Silent	SNP	C	T	T	rs75457484		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263615C>T	uc002frh.2	+	3	1027	c.1011C>T	c.(1009-1011)CCC>CCT	p.P337P	C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	357	16.|20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									ovary(1)	1						GCTTCCACCCCGACCCCAAGG	0.706													4	49	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10367810	10367810	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10367810T>G	uc002gmn.2	-	7	738	c.627A>C	c.(625-627)GAA>GAC	p.E209D	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	209	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						CAGAGGCAGGTTCCTCTTTTT	0.348													16	46	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37883561	37883561	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37883561A>C	uc002hso.2	+	26	3411	c.3173A>C	c.(3172-3174)GAC>GCC	p.D1058A	ERBB2_uc002hsm.2_Missense_Mutation_p.D1028A|ERBB2_uc010cwa.2_Missense_Mutation_p.D1043A|ERBB2_uc002hsp.2_Missense_Mutation_p.D861A|ERBB2_uc010cwb.2_Intron|ERBB2_uc010wek.1_Missense_Mutation_p.D782A	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	1058	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	GGCGGTGGGGACCTGACACTA	0.597		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			12	8	---	---	---	---	PASS
KAT2A	2648	broad.mit.edu	37	17	40272812	40272812	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40272812G>T	uc002hyx.2	-	2	435	c.375C>A	c.(373-375)AAC>AAA	p.N125K	HSPB9_uc002hyy.2_5'Flank	NM_021078	NP_066564	Q92830	KAT2A_HUMAN	general control of amino acid synthesis 5-like	125					chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity			upper_aerodigestive_tract(1)|lung(1)	2						GGGGCTTGGGGTTTTTCCAGC	0.592													16	60	---	---	---	---	PASS
KAT2A	2648	broad.mit.edu	37	17	40272817	40272817	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40272817T>C	uc002hyx.2	-	2	430	c.370A>G	c.(370-372)AAA>GAA	p.K124E	HSPB9_uc002hyy.2_5'Flank	NM_021078	NP_066564	Q92830	KAT2A_HUMAN	general control of amino acid synthesis 5-like	124					chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity			upper_aerodigestive_tract(1)|lung(1)	2						TTGGGGTTTTTCCAGCCATTA	0.582													21	46	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587569	43587569	+	Intron	SNP	G	C	C	rs149697015	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587569G>C	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						aactccgtctgaaaagaaaag	0.144													5	115	---	---	---	---	PASS
MRPL38	64978	broad.mit.edu	37	17	73897875	73897875	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73897875C>T	uc010wso.1	-	4	734	c.509G>A	c.(508-510)CGA>CAA	p.R170Q	FBF1_uc002jqa.1_RNA|MRPL38_uc002jpz.1_RNA	NM_032478	NP_115867	Q96DV4	RM38_HUMAN	mitochondrial ribosomal protein L38 precursor	170						actin cytoskeleton|mitochondrion|ribosome				pancreas(1)	1			all cancers(21;0.000154)|Epithelial(20;0.000156)|BRCA - Breast invasive adenocarcinoma(9;0.00936)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGGGGGACTCGGGGCACAAA	0.607													29	49	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18534948	18534948	+	Missense_Mutation	SNP	G	C	C	rs150345683	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18534948G>C	uc002kte.2	-	31	4590	c.3649C>G	c.(3649-3651)CAA>GAA	p.Q1217E		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1217	PH.|Auto-inhibitory.		Q -> E.		actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					TTTTCAGCTTGTTGTACTGGT	0.363													5	100	---	---	---	---	PASS
SOCS6	9306	broad.mit.edu	37	18	67993603	67993603	+	3'UTR	SNP	G	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67993603G>C	uc002lkr.1	+	2					SOCS6_uc010dqq.2_3'UTR	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6						defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				AAAATCTTTTGCTGCCATAAC	0.368													5	10	---	---	---	---	PASS
CNDP1	84735	broad.mit.edu	37	18	72228208	72228208	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72228208G>A	uc002llq.2	+	4	632	c.421G>A	c.(421-423)GGC>AGC	p.G141S	uc002llr.2_5'Flank	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor	141					proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		TGCTGACCGGGGCGATGGGTG	0.622													87	132	---	---	---	---	PASS
GPATCH1	55094	broad.mit.edu	37	19	33603475	33603475	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33603475C>A	uc002nug.1	+	13	2162	c.1848C>A	c.(1846-1848)GAC>GAA	p.D616E	GPATCH1_uc002nuh.1_5'Flank	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	616						catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					GGCACCCTGACAAGCTTCTAT	0.413													44	85	---	---	---	---	PASS
NFKBIB	4793	broad.mit.edu	37	19	39398360	39398360	+	Intron	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39398360G>A	uc002ojw.2	+						NFKBIB_uc002ojx.2_3'UTR|NFKBIB_uc002ojy.2_3'UTR	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CGGCAGGCAAGAAGCCCAAGA	0.612													2	1	---	---	---	---	PASS
PSMC4	5704	broad.mit.edu	37	19	40485824	40485824	+	Silent	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40485824A>C	uc002omq.2	+	7	811	c.774A>C	c.(772-774)GCA>GCC	p.A258A	PSMC4_uc002omr.2_Silent_p.A227A	NM_006503	NP_006494	P43686	PRS6B_HUMAN	proteasome 26S ATPase subunit 4 isoform 1	258					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding			ovary(1)	1	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGGAGAATGCACCTGCCATCA	0.567													10	38	---	---	---	---	PASS
ZNF223	7766	broad.mit.edu	37	19	44564709	44564709	+	Silent	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44564709G>A	uc002oyf.1	+	3	370	c.117G>A	c.(115-117)GAG>GAA	p.E39E	ZNF284_uc010ejd.2_RNA	NM_013361	NP_037493	Q9UK11	ZN223_HUMAN	zinc finger protein 223	39	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0352)				TGATGCTGGAGAACTTCAGGA	0.532													97	191	---	---	---	---	PASS
RPS9	6203	broad.mit.edu	37	19	54710365	54710365	+	Intron	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54710365A>C	uc002qdx.2	+						RPS9_uc002qdy.2_Intron|RPS9_uc002qdz.2_Intron|RPS9_uc002qea.2_Intron|RPS9_uc002qeb.2_Missense_Mutation_p.T148P|RPS9_uc002qec.2_Intron|RPS9_uc002qed.1_Intron	NM_001013	NP_001004	P46781	RS9_HUMAN	ribosomal protein S9						endocrine pancreas development|positive regulation of cell proliferation|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|rRNA binding|structural constituent of ribosome|translation regulator activity			breast(1)	1	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.18)		ATCTTCCTCCACCTGCCCCTC	0.592													9	12	---	---	---	---	PASS
KIR2DL4	3805	broad.mit.edu	37	19	55324635	55324635	+	Silent	SNP	T	C	C	rs649216	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55324635T>C	uc010yfm.1	+	6	802	c.762T>C	c.(760-762)TTT>TTC	p.F254F	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_Silent_p.F249F|KIR2DL4_uc002qhg.2_Intron|KIR2DL4_uc002qhi.2_Silent_p.F237F|KIR2DL4_uc002qhh.2_Intron|KIR2DL4_uc002qhj.2_Intron|KIR2DL4_uc002qhf.2_Intron|KIR2DL4_uc010esd.2_Intron|KIR2DL4_uc010ese.2_RNA	NM_002255	NP_002246	Q99706	KI2L4_HUMAN	killer cell immunoglobulin-like receptor, two	254	Helical; (Potential).				cellular defense response|regulation of immune response	integral to plasma membrane	protein binding|transmembrane receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0192)		TCATCCTCTTTACCATCCTTC	0.502													4	107	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56539873	56539873	+	Silent	SNP	A	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56539873A>G	uc002qmj.2	+	7	2274	c.2274A>G	c.(2272-2274)CTA>CTG	p.L758L	NLRP5_uc002qmi.2_Silent_p.L739L	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	758						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGGTCCCTCTATGGTGAGTAC	0.527													8	346	---	---	---	---	PASS
ANGPT4	51378	broad.mit.edu	37	20	861913	861913	+	Silent	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:861913A>C	uc002wei.2	-	5	955	c.852T>G	c.(850-852)GGT>GGG	p.G284G	ANGPT4_uc010zpn.1_Silent_p.G278G	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	284	Fibrinogen C-terminal.				anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						ACACCTGCTCACCTGCCATTA	0.567													6	16	---	---	---	---	PASS
ANKRD5	63926	broad.mit.edu	37	20	10026343	10026343	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10026343G>A	uc002wno.2	+	6	1211	c.818G>A	c.(817-819)CGA>CAA	p.R273Q	uc002wnn.1_Intron|ANKRD5_uc002wnp.2_Missense_Mutation_p.R273Q|ANKRD5_uc010gbz.2_Missense_Mutation_p.R84Q	NM_022096	NP_071379	Q9NU02	ANKR5_HUMAN	ankyrin repeat domain protein 5	273	ANK 4.						calcium ion binding			ovary(1)|breast(1)	2						ATAGCTCAGCGAGGTAAAATT	0.408													31	77	---	---	---	---	PASS
CSRP2BP	57325	broad.mit.edu	37	20	18123556	18123556	+	Silent	SNP	A	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18123556A>C	uc002wqj.2	+	2	874	c.252A>C	c.(250-252)ATA>ATC	p.I84I	CSRP2BP_uc002wqk.2_5'Flank	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	84					histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						AAAAATGGATACCAGCCAGTA	0.458													4	17	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40162157	40162157	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40162157T>C	uc002xka.1	-	3	264	c.86A>G	c.(85-87)AAT>AGT	p.N29S	CHD6_uc002xkd.2_Missense_Mutation_p.N7S|CHD6_uc002xkc.2_Missense_Mutation_p.N64S	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	29					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				GTAGTCAAAATTGACAGAGGC	0.388													80	101	---	---	---	---	PASS
ZMYND8	23613	broad.mit.edu	37	20	45839322	45839322	+	3'UTR	SNP	T	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45839322T>G	uc002xta.1	-	22					ZMYND8_uc010ghq.1_Missense_Mutation_p.N852T|ZMYND8_uc010ghr.1_3'UTR|ZMYND8_uc002xst.1_3'UTR|ZMYND8_uc002xsu.1_3'UTR|ZMYND8_uc002xsv.1_3'UTR|ZMYND8_uc002xsw.1_3'UTR|ZMYND8_uc002xsx.1_3'UTR|ZMYND8_uc002xsy.1_3'UTR|ZMYND8_uc002xsz.1_3'UTR|ZMYND8_uc010zxy.1_3'UTR|ZMYND8_uc002xtb.1_3'UTR|ZMYND8_uc002xss.2_3'UTR|ZMYND8_uc010zxz.1_3'UTR|ZMYND8_uc002xtc.1_3'UTR|ZMYND8_uc002xtd.1_3'UTR|ZMYND8_uc002xte.1_3'UTR|ZMYND8_uc010zya.1_3'UTR|ZMYND8_uc002xtf.1_3'UTR|ZMYND8_uc002xsr.1_3'UTR	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			AAAGTGGCTGTTCTCCTGCCT	0.537													22	51	---	---	---	---	PASS
KRTAP10-3	386682	broad.mit.edu	37	21	45978372	45978372	+	Missense_Mutation	SNP	G	A	A	rs144695928	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45978372G>A	uc002zfj.1	-	1	272	c.227C>T	c.(226-228)ACG>ATG	p.T76M	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198696	NP_941969	P60369	KR103_HUMAN	keratin associated protein 10-3	76	18 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						GCACGAGGGCGTGCAGGAGCT	0.413													5	126	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42523636	42523636	+	Missense_Mutation	SNP	C	A	A	rs3915951		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42523636C>A	uc003bce.2	-	7	1076	c.986G>T	c.(985-987)CGC>CTC	p.R329L	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Missense_Mutation_p.R23L|CYP2D6_uc003bcf.2_Missense_Mutation_p.R278L	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	329							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						TTGGACACGGCCTGGACAGAC	0.602													5	44	---	---	---	---	PASS
SELO	83642	broad.mit.edu	37	22	50649061	50649061	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50649061T>G	uc011arr.1	+	5	1130	c.1072T>G	c.(1072-1074)TAC>GAC	p.Y358D	SELO_uc010hap.2_Missense_Mutation_p.Y169D|SELO_uc003bjy.2_Missense_Mutation_p.Y38D|SELO_uc003bjz.2_Missense_Mutation_p.Y38D	NM_031454	NP_113642	Q9BVL4	SELO_HUMAN	selenoprotein O	358											0		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		GTGTGGCAGGTACGACCCCGA	0.667											OREG0026676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	32	---	---	---	---	PASS
TUBGCP6	85378	broad.mit.edu	37	22	50659571	50659571	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50659571T>G	uc003bkb.1	-	16	3729	c.3217A>C	c.(3217-3219)ACC>CCC	p.T1073P	TUBGCP6_uc003bka.1_Missense_Mutation_p.T160P|TUBGCP6_uc010har.1_Missense_Mutation_p.T1065P|TUBGCP6_uc010has.1_RNA	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1073	2.|9 X 27 AA tandem repeats.				G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CGTGGCTGGGTGGGAGCCACA	0.612													16	110	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50728676	50728676	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50728676C>G	uc003bkv.3	-	3	444	c.338G>C	c.(337-339)GGC>GCC	p.G113A		NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	113	Extracellular (Potential).|Sema.				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GAAGAGGCTGCCGCACTCCAC	0.642													6	25	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142718073	142718073	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142718073G>T	uc004fbx.2	-	2	1228	c.852C>A	c.(850-852)TAC>TAA	p.Y284*	SLITRK4_uc004fby.2_Nonsense_Mutation_p.Y284*	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	284	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TGGGAGTGGTGTAGCCATTTT	0.453													8	154	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	6894336	6894337	+	Intron	INS	-	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6894336_6894337insT	uc001aoi.2	+						CAMTA1_uc001aoh.2_Intron	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		tttattttttgttttttttttt	0.228													4	2	---	---	---	---	
RERE	473	broad.mit.edu	37	1	8505745	8505745	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8505745delT	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc010nzx.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GAACCCCACCTtttttttttt	0.254													103	9	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39799059	39799060	+	Frame_Shift_Ins	INS	-	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39799059_39799060insG	uc010oiu.1	+	1	2250_2251	c.2119_2120insG	c.(2119-2121)AGGfs	p.R707fs	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2272					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGATAGTGGCAGGGAAATTTTT	0.391													197	10	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	42011367	42011369	+	Intron	DEL	CAC	-	-	rs72324958		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42011367_42011369delCAC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				tcaccaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
PLK3	1263	broad.mit.edu	37	1	45270777	45270778	+	Intron	INS	-	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45270777_45270778insA	uc001cmn.2	+						PLK3_uc001cmo.2_Intron	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3							membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					gactccatctcaaaaaaaaaaa	0.193													4	2	---	---	---	---	
BAT2L2	23215	broad.mit.edu	37	1	171546909	171546910	+	Intron	INS	-	ATA	ATA	rs138767556	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171546909_171546910insATA	uc010pmg.1	+						BAT2L2_uc010pmh.1_Intron|BAT2L2_uc010pmi.1_Intron|BAT2L2_uc010pmj.1_5'Flank	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2								protein C-terminus binding				0						TTTAAATTCGCAtttttttttt	0.153													6	5	---	---	---	---	
LAMC2	3918	broad.mit.edu	37	1	183155716	183155716	+	Intron	DEL	T	-	-	rs79122995		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183155716delT	uc001gqa.2	+						LAMC2_uc001gpz.3_Intron|LAMC2_uc010poa.1_Intron	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						CTGGGGCTCCTCCAGAGACGG	0.433													3	4	---	---	---	---	
CFHR3	10878	broad.mit.edu	37	1	196759163	196759164	+	Intron	INS	-	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196759163_196759164insT	uc001gtl.2	+						CFHR3_uc010poy.1_Intron|CFHR1_uc001gtm.2_Intron	NM_021023	NP_066303	Q02985	FHR3_HUMAN	complement factor H-related 3 precursor							extracellular space					0						CATATAAAGTATTTTTTTTCAG	0.337													61	8	---	---	---	---	
KDM5B	10765	broad.mit.edu	37	1	202701171	202701171	+	Intron	DEL	A	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202701171delA	uc001gyf.2	-						KDM5B_uc009xag.2_Intron|KDM5B_uc001gyg.1_Intron	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B						negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						CAACCAGGGGAAAAAAAAAAA	0.388													5	4	---	---	---	---	
NUCKS1	64710	broad.mit.edu	37	1	205687214	205687214	+	3'UTR	DEL	A	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205687214delA	uc001hdb.2	-	7						NM_022731	NP_073568	Q9H1E3	NUCKS_HUMAN	nuclear casein kinase and cyclin-dependent							nucleus					0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GGTTTGCTTTaaaaaaaaaaa	0.318													5	3	---	---	---	---	
CR1L	1379	broad.mit.edu	37	1	207850683	207850684	+	Intron	DEL	GT	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207850683_207850684delGT	uc001hga.3	+						CR1L_uc001hfz.2_Intron|CR1L_uc001hgb.1_5'Flank	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like							cytoplasm|extracellular region|membrane					0						aaaaaaaaaaGTATGGTAATTT	0.238													74	9	---	---	---	---	
SPAST	6683	broad.mit.edu	37	2	32340026	32340027	+	Intron	INS	-	T	T	rs67016851		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32340026_32340027insT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ATAAAGTTAAAttttttttttt	0.114													10	5	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39085574	39085575	+	Intron	DEL	TG	-	-	rs144247886		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39085574_39085575delTG	uc002rrf.2	-						DHX57_uc002rre.2_Intron|DHX57_uc002rrg.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				CACATGACTCTGAGACTATTTG	0.327													8	6	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54131014	54131015	+	Intron	INS	-	T	T	rs72533956		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54131014_54131015insT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			attaaaaaaaagaacagatatg	0.069													4	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102866421	102866421	+	IGR	DEL	G	-	-	rs66763003		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102866421delG								IL1RL2 (10611 upstream) : IL1RL1 (61541 downstream)																							TCTGGGTTGAGGGGGGGGCAC	0.572													8	4	---	---	---	---	
GPD2	2820	broad.mit.edu	37	2	157435842	157435842	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157435842delT	uc002tzf.3	+						GPD2_uc010zch.1_Intron|GPD2_uc002tzd.3_Intron|GPD2_uc002tze.1_Intron	NM_001083112	NP_001076581	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2,						cellular lipid metabolic process	glycerol-3-phosphate dehydrogenase complex|mitochondrial inner membrane	calcium ion binding|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity			ovary(1)	1						tttttctttcttttttttttt	0.080													11	5	---	---	---	---	
MOGAT1	116255	broad.mit.edu	37	2	223562830	223562831	+	Intron	INS	-	T	T	rs148576038	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223562830_223562831insT	uc010fws.1	+						MOGAT1_uc010fwt.1_Intron	NM_058165	NP_477513	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1						glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			breast(1)	1		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		AGCAGATGGGGTTTTAGTGAGA	0.381													6	3	---	---	---	---	
ZNF197	10168	broad.mit.edu	37	3	44674312	44674313	+	Intron	DEL	GT	-	-	rs111907137		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44674312_44674313delGT	uc003cnm.2	+						ZNF197_uc003cnn.2_Intron|ZNF197_uc003cno.2_Intron|ZNF197_uc003cnp.2_Intron	NM_006991	NP_008922	O14709	ZN197_HUMAN	zinc finger protein 197 isoform 1						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		TTGTTCCAAAGTGTGTGTGTGT	0.233													4	2	---	---	---	---	
MASP1	5648	broad.mit.edu	37	3	186971115	186971116	+	Intron	DEL	GA	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186971115_186971116delGA	uc003frh.1	-						MASP1_uc003fri.2_Intron|MASP1_uc003frj.2_Intron|MASP1_uc003frk.1_Intron|MASP1_uc011bse.1_Intron	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform						complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGCAAAATATGAGAGAGAGAGA	0.490													357	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																							tccattccgttccggtccattccat	0.000													21	7	---	---	---	---	
CCNG2	901	broad.mit.edu	37	4	78081697	78081697	+	Intron	DEL	A	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78081697delA	uc003hkq.3	+						CCNG2_uc003hkn.3_Intron|CCNG2_uc011ccc.1_Intron|CCNG2_uc003hkp.3_Intron	NM_004354	NP_004345	Q16589	CCNG2_HUMAN	cyclin G2						cell cycle checkpoint|cell division|mitosis	cytoplasm				ovary(2)|lung(1)	3						GGGGGGGGGGAGGTCGAGAAC	0.249													3	3	---	---	---	---	
TPPP	11076	broad.mit.edu	37	5	666244	666245	+	Intron	INS	-	GGGCACAGGCGACTTA	GGGCACAGGCGACTTA	rs149807312	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:666244_666245insGGGCACAGGCGACTTA	uc003jbg.3	-						TPPP_uc003jbh.3_Intron	NM_007030	NP_008961	O94811	TPPP_HUMAN	tubulin polymerization promoting protein						microtubule bundle formation|microtubule polymerization|positive regulation of protein polymerization	nucleus|perinuclear region of cytoplasm|soluble fraction	calcium ion binding|microtubule binding				0		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		TCCCTCTACAGGGGCACAGGCG	0.658													87	7	---	---	---	---	
ACOT12	134526	broad.mit.edu	37	5	80626095	80626096	+	3'UTR	INS	-	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80626095_80626096insT	uc003khl.3	-	15					RNU5E_uc011cto.1_Intron	NM_130767	NP_570123	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12						acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		CCGTCACTGCATTTTGCTTAGG	0.351													25	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166327307	166327308	+	IGR	INS	-	AAGG	AAGG	rs145009687	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166327307_166327308insAAGG								None (None upstream) : ODZ2 (384535 downstream)																							cctgaaaaaaaaaggaaggaag	0.000													4	2	---	---	---	---	
MAPK9	5601	broad.mit.edu	37	5	179684756	179684756	+	Intron	DEL	A	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179684756delA	uc003mls.3	-						MAPK9_uc003mlt.3_Intron|MAPK9_uc010jlc.2_Intron|MAPK9_uc003mlv.3_Intron|MAPK9_uc011dgx.1_Intron	NM_002752	NP_002743	P45984	MK09_HUMAN	mitogen-activated protein kinase 9 isoform JNK2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|protein binding|protein binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)	4	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTATGGGAGAAAGACTCTGT	0.363													4	2	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	20955922	20955922	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20955922delT	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			CTCCTTCACATTTTTTTTTTG	0.383													38	8	---	---	---	---	
PDSS2	57107	broad.mit.edu	37	6	107655731	107655733	+	Intron	DEL	GTT	-	-	rs141150367		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107655731_107655733delGTT	uc003prt.2	-						PDSS2_uc011eak.1_Intron|PDSS2_uc011eal.1_Intron|PDSS2_uc003pru.2_Intron|PDSS2_uc003prv.2_Intron	NM_020381	NP_065114	Q86YH6	DLP1_HUMAN	prenyl diphosphate synthase, subunit 2						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		CTACGGCTGCgttgttgttgttg	0.212													2	4	---	---	---	---	
SLC2A12	154091	broad.mit.edu	37	6	134373388	134373389	+	Intron	INS	-	ACACACAC	ACACACAC	rs150064447		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134373388_134373389insACACACAC	uc003qem.1	-							NM_145176	NP_660159	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity			ovary(1)	1	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		CGCGCGCGcatacacacacaca	0.455													8	4	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40228055	40228055	+	Intron	DEL	C	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40228055delC	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						aaaaaaaaaacaaaCCCCAAA	0.194													31	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	49500915	49500935	+	IGR	DEL	AGGAAGGAAGGCCTGGAAGGA	-	-	rs140184305	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49500915_49500935delAGGAAGGAAGGCCTGGAAGGA								CDC14C (533866 upstream) : VWC2 (312322 downstream)																							taaggaaggcaggaaggaaggcctggaaggaaggaaggaag	0.072													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56357563	56357571	+	IGR	DEL	AAAAAAAAA	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56357563_56357571delAAAAAAAAA								PSPH (173473 upstream) : DKFZp434L192 (206345 downstream)																							actccatctcaaaaaaaaaaaaaaaaaaa	0.172													5	3	---	---	---	---	
TAC1	6863	broad.mit.edu	37	7	97363746	97363749	+	Intron	DEL	TCTC	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97363746_97363749delTCTC	uc003uop.3	+						TAC1_uc003uoq.3_Intron|TAC1_uc003uor.3_Intron|TAC1_uc003uos.3_Intron	NM_003182	NP_003173	P20366	TKN1_HUMAN	tachykinin 1 isoform beta precursor						detection of abiotic stimulus|elevation of cytosolic calcium ion concentration|insemination|neuropeptide signaling pathway|synaptic transmission|tachykinin receptor signaling pathway	extracellular space					0	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)				Bacitracin(DB00626)	tctctcggtttctctctctctctg	0.211													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	118029592	118029593	+	IGR	INS	-	A	A	rs140418635	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118029592_118029593insA								ANKRD7 (146810 upstream) : None (None downstream)																							tctcaaaaaagaaaaaaaaTAT	0.000													3	3	---	---	---	---	
PIWIL2	55124	broad.mit.edu	37	8	22165711	22165711	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22165711delT	uc003xbn.2	+						PIWIL2_uc011kzf.1_Intron|PIWIL2_uc010ltv.2_Intron	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2						DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TTTTTCTAAGTTTTTTTTTTT	0.323													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110460728	110460728	+	Intron	DEL	G	-	-	rs1673406		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460728delG	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATTTCTAGTGttttttttgt	0.129										HNSCC(38;0.096)			6	3	---	---	---	---	
LOC286094	286094	broad.mit.edu	37	8	136268296	136268297	+	Intron	INS	-	T	T			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136268296_136268297insT	uc011ljm.1	+							NR_026706				Homo sapiens cDNA clone IMAGE:4837396.												0						CCtttttttcctttttttttgc	0.030													4	2	---	---	---	---	
POLR1E	64425	broad.mit.edu	37	9	37489233	37489233	+	Intron	DEL	A	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37489233delA	uc003zzz.1	+						POLR1E_uc011lqj.1_Intron|POLR1E_uc003zzy.1_Intron|POLR1E_uc011lqk.1_Intron	NM_022490	NP_071935	Q9GZS1	RPA49_HUMAN	RNA polymerase I associated factor 53						rRNA transcription	cell junction|cytoplasm|nucleolus	DNA binding|DNA-directed RNA polymerase activity|protein binding				0				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		actctgtctcaaaaaaaaaaa	0.119													43	7	---	---	---	---	
TMEFF1	8577	broad.mit.edu	37	9	103271154	103271154	+	Intron	DEL	A	-	-	rs72170452		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103271154delA	uc004baz.1	+						TMEFF1_uc004bay.1_Intron	NM_003692	NP_003683	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two						multicellular organismal development	integral to membrane|plasma membrane					0		Acute lymphoblastic leukemia(62;0.0452)				TTTTTAAGCCAAAAAAAAAAA	0.284													26	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	13199671	13199672	+	IGR	INS	-	G	G	rs113702003		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13199671_13199672insG								OPTN (19395 upstream) : MCM10 (3909 downstream)																							tttttttttttttttttttttg	0.183													10	5	---	---	---	---	
FAM21A	387680	broad.mit.edu	37	10	51829177	51829178	+	Intron	DEL	AA	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51829177_51829178delAA	uc001jjb.2	+						uc001jiz.1_5'Flank|FAM21A_uc001jja.1_Intron|FAM21A_uc010qhi.1_Intron|FAM21A_uc010qhj.1_Intron	NM_001005751	NP_001005751	Q641Q2	FA21A_HUMAN	hypothetical protein LOC387680						retrograde transport, endosome to Golgi	early endosome membrane|WASH complex				ovary(1)	1						aaactctctcaaaaaaaaaaaa	0.149													11	6	---	---	---	---	
CCDC6	8030	broad.mit.edu	37	10	61572221	61572222	+	Intron	INS	-	A	A	rs35063910		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61572221_61572222insA	uc001jks.3	-							NM_005436	NP_005427	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6							cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)		CTATAACACTCAAAAAAAAAAA	0.272													9	4	---	---	---	---	
TTC18	118491	broad.mit.edu	37	10	75036753	75036753	+	Intron	DEL	T	-	-	rs11291318		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75036753delT	uc009xrc.2	-						TTC18_uc001jty.2_Intron|TTC18_uc001jtv.3_Intron|TTC18_uc001jtw.3_Intron|TTC18_uc001jtx.2_Intron	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18								binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					AACATATGCCTTTAGAGTCTG	0.438													4	2	---	---	---	---	
FAM190B	54462	broad.mit.edu	37	10	86148861	86148863	+	Intron	DEL	TTT	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86148861_86148863delTTT	uc001kdh.1	+						FAM190B_uc010qmd.1_Intron	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14											ovary(3)|skin(1)	4						caataataacttttTTTTTTTTT	0.158													4	2	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ctccctgcactccctgcctctcccgcattccctgcctc	0.193													4	6	---	---	---	---	
CDKN1C	1028	broad.mit.edu	37	11	2905204	2905205	+	Intron	INS	-	C	C	rs140121791	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2905204_2905205insC	uc001lws.3	-						CDKN1C_uc001lwu.3_Intron|CDKN1C_uc009ydr.2_Intron|CDKN1C_uc001lwt.3_Intron|CDKN1C_uc001lwr.3_Intron	NM_000076	NP_000067	P49918	CDN1C_HUMAN	cyclin-dependent kinase inhibitor 1C isoform a						cell cycle arrest|G1 phase of mitotic cell cycle|negative regulation of epithelial cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of cyclin-dependent protein kinase activity	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding			central_nervous_system(1)	1		all_epithelial(84;0.000187)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|Breast(177;0.00328)|all_neural(188;0.00681)|all_lung(207;0.157)|Lung NSC(207;0.216)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCCCTCCGCGCCCCCCCAGGT	0.733									Beckwith-Wiedemann_syndrome				3	4	---	---	---	---	
PDE3B	5140	broad.mit.edu	37	11	14746856	14746859	+	Intron	DEL	TCTT	-	-	rs10534250		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14746856_14746859delTCTT	uc001mln.2	+						PDE3B_uc001mlm.2_Intron|PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						tctttctttctctttctttctttc	0.078													3	3	---	---	---	---	
LDHC	3948	broad.mit.edu	37	11	18451635	18451636	+	Intron	INS	-	A	A	rs72508145		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18451635_18451636insA	uc001mon.3	+						LDHC_uc001mom.3_Intron|LDHC_uc009yhp.2_Intron|LDHC_uc001moo.3_Intron|LDHC_uc009yhq.2_Intron|LDHC_uc009yhr.2_Intron	NM_017448	NP_059144	P07864	LDHC_HUMAN	L-lactate dehydrogenase C						glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	atgatcaagatacaaaacattt	0.000													5	3	---	---	---	---	
ANKRD33	341405	broad.mit.edu	37	12	52285209	52285210	+	3'UTR	INS	-	TA	TA	rs147140141	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52285209_52285210insTA	uc001rzf.3	+	6					ANKRD33_uc001rzh.3_3'UTR|ANKRD33_uc001rzd.2_3'UTR|ANKRD33_uc001rze.2_3'UTR|ANKRD33_uc001rzg.3_3'UTR|ANKRD33_uc001rzi.3_3'UTR	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1												0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		TGCTCTCAACCTatatatatac	0.302													3	3	---	---	---	---	
KRT7	3855	broad.mit.edu	37	12	52631510	52631511	+	Intron	INS	-	TGTGTG	TGTGTG	rs112794441		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52631510_52631511insTGTGTG	uc001saa.1	+						KRT7_uc009zmf.1_Intron	NM_005556	NP_005547	P08729	K2C7_HUMAN	keratin 7						cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.105)		gggtgcgtgtatgtgtgtgtgt	0.282													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95861037	95861038	+	IGR	INS	-	T	T	rs112312528		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95861037_95861038insT								MIR331 (158748 upstream) : METAP2 (6784 downstream)																							ttccataCTTCTTTTTTTTTTT	0.287													11	5	---	---	---	---	
VPS29	51699	broad.mit.edu	37	12	110937446	110937446	+	Intron	DEL	A	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110937446delA	uc001tqy.2	-						VPS29_uc001tqw.2_5'Flank|VPS29_uc001tqx.2_Intron|VPS29_uc001tqz.2_Intron|RAD9B_uc001trc.1_5'Flank|RAD9B_uc001trf.3_5'Flank|RAD9B_uc001trg.3_5'Flank|RAD9B_uc010sya.1_5'Flank|RAD9B_uc001tre.3_5'Flank|RAD9B_uc001trd.3_5'Flank	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1						protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						aaaagaaaccaaaaaaaaaaa	0.289													4	2	---	---	---	---	
P704P	641455	broad.mit.edu	37	14	20010424	20010425	+	Intron	INS	-	A	A			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20010424_20010425insA	uc001vwc.3	-						P704P_uc001vwb.3_Intron|uc001vwd.2_RNA	NM_001145442	NP_001138914	A6NI47	POTEM_HUMAN	prostate-specific P704P												0						AAGGAAGGGACAAAAAAAAAAA	0.366													7	4	---	---	---	---	
TOX4	9878	broad.mit.edu	37	14	21955595	21955595	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21955595delT	uc001waz.2	+						TOX4_uc001way.2_Intron|TOX4_uc001wba.2_Intron|TOX4_uc010tlu.1_Intron|TOX4_uc010tlv.1_5'Flank	NM_014828	NP_055643	O94842	TOX4_HUMAN	epidermal Langerhans cell protein LCP1							chromatin|nucleus|PTW/PP1 phosphatase complex	DNA binding|protein binding			ovary(1)	1	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		CTTTTCCCCCTTTTTTCCCCT	0.418													483	7	---	---	---	---	
ZFYVE21	79038	broad.mit.edu	37	14	104193286	104193286	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104193286delT	uc001yoc.2	+						ZFYVE21_uc001yod.2_Intron	NM_024071	NP_076976	Q9BQ24	ZFY21_HUMAN	zinc finger, FYVE domain containing 21							cytoplasmic membrane-bounded vesicle|focal adhesion	metal ion binding				0		Melanoma(154;0.226)		Epithelial(152;0.245)		TTATGGCTCGttttttttttt	0.333													71	7	---	---	---	---	
ARHGAP11A	9824	broad.mit.edu	37	15	32922143	32922146	+	Intron	DEL	GTGT	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32922143_32922146delGTGT	uc001zgy.1	+						ARHGAP11A_uc010ubw.1_Intron|ARHGAP11A_uc001zgw.2_Intron|ARHGAP11A_uc001zgx.2_Intron|ARHGAP11A_uc010ubx.1_Intron	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		TTTCAATATAgtgtgtgtgtgtgt	0.279													4	2	---	---	---	---	
CALML4	91860	broad.mit.edu	37	15	68486471	68486471	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68486471delT	uc002arb.2	-						CALML4_uc002arc.2_Intron|CALML4_uc002ard.2_Intron|CALML4_uc002are.2_Intron|CALML4_uc010bhz.2_Intron	NM_033429	NP_219501	Q96GE6	CALL4_HUMAN	calmodulin-like 4 isoform 1								calcium ion binding				0						TCACATTTAATTTTTCAGTTT	0.408													81	37	---	---	---	---	
TMC3	342125	broad.mit.edu	37	15	81665212	81665213	+	Intron	DEL	GT	-	-	rs113422518		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81665212_81665213delGT	uc002bgo.1	-						TMC3_uc010blr.1_Intron|TMC3_uc002bgp.2_Intron	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3							integral to membrane				ovary(1)|liver(1)	2						gtgtttgtgcgtgtgtgtgtgt	0.332													6	3	---	---	---	---	
TTLL13	440307	broad.mit.edu	37	15	90794513	90794513	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90794513delT	uc002bpd.1	+						TTLL13_uc002bpe.1_Intron	NM_001029964	NP_001025135	A6NNM8	TTL13_HUMAN	tubulin tyrosine ligase-like family, member 13						protein modification process		ATP binding|tubulin-tyrosine ligase activity				0	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			gcatggcaaattttttttttt	0.000													4	7	---	---	---	---	
TRAP1	10131	broad.mit.edu	37	16	3713602	3713603	+	Intron	INS	-	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3713602_3713603insC	uc002cvt.3	-						TRAP1_uc002cvs.2_Intron|TRAP1_uc010uxf.1_Intron|uc002cvu.2_RNA	NM_016292	NP_057376	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1 precursor						cellular response to oxidative stress|protein folding	mitochondrion	ATP binding|tumor necrosis factor receptor binding|unfolded protein binding			central_nervous_system(1)	1		Ovarian(90;0.0261)				GACCCCGGGGGCCTCCAGCCAC	0.619													40	7	---	---	---	---	
TNRC6A	27327	broad.mit.edu	37	16	24741818	24741818	+	Intron	DEL	A	-	-	rs115981479		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24741818delA	uc002dmm.2	+							NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		TTCTTTCTTTAAAAAAAAAAA	0.408													8	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32077916	32077917	+	IGR	INS	-	TTT	TTT	rs139112308	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32077916_32077917insTTT								ZNF267 (149290 upstream) : HERC2P4 (84693 downstream)																							ATGGAAAACGGTTATTTTTTTG	0.421													7	4	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2888573	2888573	+	Intron	DEL	G	-	-	rs146159488		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2888573delG	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						AAACAGTGATGTTTTTTTTTT	0.393													5	6	---	---	---	---	
KCNAB3	9196	broad.mit.edu	37	17	7828870	7828870	+	Intron	DEL	G	-	-	rs4396585		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7828870delG	uc002gjm.1	-						KCNAB3_uc010vul.1_Intron	NM_004732	NP_004723	O43448	KCAB3_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(1)	1		Prostate(122;0.157)				aaaaaaaaaagaaTTCAGACC	0.249													201	8	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20279958	20279958	+	Intron	DEL	C	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20279958delC	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						GAAGATATATCCCATCAAAAC	0.423													1	11	---	---	---	---	
RHOT1	55288	broad.mit.edu	37	17	30477376	30477376	+	Intron	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30477376delT	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron|RHOT1_uc002hgv.2_Intron	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				GCTAATGAACTTTTTTTTTTT	0.313													6	3	---	---	---	---	
HOXB7	3217	broad.mit.edu	37	17	46685066	46685066	+	3'UTR	DEL	T	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46685066delT	uc002inv.2	-	2					HOXB6_uc002ins.1_5'Flank|HOXB6_uc010dbh.1_5'Flank	NM_004502	NP_004493	P09629	HXB7_HUMAN	homeobox B7							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TTAAATAGGGttttttttttg	0.264													8	7	---	---	---	---	
GIP	2695	broad.mit.edu	37	17	47041501	47041504	+	Intron	DEL	GAAA	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47041501_47041504delGAAA	uc002iol.1	-							NM_004123	NP_004114	P09681	GIP_HUMAN	gastric inhibitory polypeptide preproprotein						energy reserve metabolic process|signal transduction	extracellular region|soluble fraction	hormone activity			skin(1)	1						cagcctgggcgaaagagtgagact	0.162													4	5	---	---	---	---	
MMD	23531	broad.mit.edu	37	17	53498972	53498973	+	Intron	INS	-	G	G			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53498972_53498973insG	uc002iui.2	-							NM_012329	NP_036461	Q15546	PAQRB_HUMAN	monocyte to macrophage						cytolysis	integral to plasma membrane|late endosome membrane|lysosomal membrane|membrane fraction	receptor activity				0						CGCTTAACGGCGGGATTTGGGA	0.634													132	7	---	---	---	---	
EFCAB3	146779	broad.mit.edu	37	17	60475386	60475387	+	Intron	INS	-	A	A	rs146811952		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60475386_60475387insA	uc002izu.1	+						EFCAB3_uc010wpc.1_Intron	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b								calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			gactccatctcaaaaaaaaaaa	0.183													6	4	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025826	64025829	+	Intron	DEL	AAAC	-	-	rs67867456		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025826_64025829delAAAC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gtctctaaataaacaaacaaacaa	0.123													6	4	---	---	---	---	
ESCO1	114799	broad.mit.edu	37	18	19153404	19153406	+	In_Frame_Del	DEL	ATC	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19153404_19153406delATC	uc002kth.1	-	4	2333_2335	c.1399_1401delGAT	c.(1399-1401)GATdel	p.D467del	ESCO1_uc002kti.1_RNA	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1	467					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						CTACTGTAATATCATTAATTTTC	0.330													126	57	---	---	---	---	
GNG7	2788	broad.mit.edu	37	19	2585102	2585125	+	Intron	DEL	GAAGGAAGGAAAGAAGGTAGGAAT	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2585102_2585125delGAAGGAAGGAAAGAAGGTAGGAAT	uc002lwd.2	-							NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aagaaggaaggaaggaaggaaagaaggtaggaatgaaggaagga	0.000													2	4	---	---	---	---	
DUS3L	56931	broad.mit.edu	37	19	5789039	5789040	+	Intron	INS	-	ACCAGAGTGGG	ACCAGAGTGGG	rs140764504	by1000genomes	TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5789039_5789040insACCAGAGTGGG	uc002mdc.2	-						DUS3L_uc002mdd.2_Intron|DUS3L_uc010duk.2_Intron|DUS3L_uc010xiw.1_Intron	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like isoform 1						tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0						TTTCTGTCCCCACCTCCTGAGG	0.381													4	5	---	---	---	---	
EPS8L1	54869	broad.mit.edu	37	19	55587649	55587649	+	Intron	DEL	G	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55587649delG	uc002qis.3	+						EPS8L1_uc010ess.1_Intron|EPS8L1_uc010est.1_Intron|EPS8L1_uc010yfr.1_Intron|EPS8L1_uc010esu.1_5'Flank	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway							cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		aggaggggctgggggcctgga	0.070													4	3	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1332941	1332942	+	Intron	INS	-	T	T	rs35712372		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332941_1332942insT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron			P62942	FKB1A_HUMAN	Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	tccttccttccttccttccttc	0.005													4	3	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10959812	10959812	+	Intron	DEL	A	-	-	rs34027183		TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10959812delA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTAGCCACCAAAAAAAAAGC	0.313													116	33	---	---	---	---	
FRMPD4	9758	broad.mit.edu	37	X	12725042	12725042	+	Intron	DEL	C	-	-			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12725042delC	uc004cuz.1	+						FRMPD4_uc011mij.1_Intron	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						GTGGTAATTTCTTTTTTTTTT	0.433													132	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	M	3492	3493	+	RNA	INS	-	C	C			TCGA-CH-5765-01	TCGA-CH-5765-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3492_3493insC	uc004cos.3	+	2		c.1785_1786insC			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		GAGCCCCTAAAACCCGCCACAT	0.554													39	9	---	---	---	---	
