Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CAMTA1	23261	broad.mit.edu	37	1	7723412	7723412	+	Splice_Site	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7723412G>T	uc001aoi.2	+	9	1013	c.806_splice	c.e9-1	p.G269_splice		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GATCTCCGCAGGAGCTGGCGG	0.448													25	148	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11308100	11308100	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11308100T>C	uc001asd.2	-	7	1013	c.892A>G	c.(892-894)AAG>GAG	p.K298E		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	298					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						TTGCAGTACTTGTCGTGTACC	0.453													9	250	---	---	---	---	PASS
PRDM2	7799	broad.mit.edu	37	1	14105677	14105677	+	Missense_Mutation	SNP	G	A	A	rs143566559	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14105677G>A	uc001avi.2	+	8	2243	c.1387G>A	c.(1387-1389)GCT>ACT	p.A463T	PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.A463T|PRDM2_uc001avj.2_Intron|PRDM2_uc009vod.1_Missense_Mutation_p.A220T|PRDM2_uc001avk.2_Missense_Mutation_p.A262T|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger	463						Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TTCAGAGAAGGCTTCCCAAGA	0.418													13	76	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16975947	16975947	+	RNA	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16975947C>T	uc010och.1	+	11		c.1969C>T			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						AGAGCCAGGCCTACAGCGGGT	0.577													4	67	---	---	---	---	PASS
BAI2	576	broad.mit.edu	37	1	32221807	32221807	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32221807C>T	uc001btn.2	-	4	985	c.631G>A	c.(631-633)GCT>ACT	p.A211T	BAI2_uc010ogp.1_Missense_Mutation_p.A199T|BAI2_uc010ogq.1_Missense_Mutation_p.A211T|BAI2_uc001bto.2_Missense_Mutation_p.A211T|BAI2_uc001btq.1_Missense_Mutation_p.A199T|BAI2_uc010ogr.1_Missense_Mutation_p.A199T	NM_001703	NP_001694	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	211	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CTGCCGGCAGCGCGGCCACAC	0.647													5	34	---	---	---	---	PASS
GJA4	2701	broad.mit.edu	37	1	35260716	35260716	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35260716C>G	uc001bya.2	+	2	990	c.902C>G	c.(901-903)GCG>GGG	p.A301G	GJA4_uc009vul.2_Missense_Mutation_p.A377G|GJA4_uc009vum.1_Missense_Mutation_p.A301G	NM_002060	NP_002051	P35212	CXA4_HUMAN	connexin 37	301	Cytoplasmic (Potential).				cell-cell junction assembly	integral to plasma membrane				central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GAGAGGCTGGCGTCTTCCAGG	0.607													3	23	---	---	---	---	PASS
RAB3B	5865	broad.mit.edu	37	1	52403035	52403035	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52403035C>T	uc001cth.2	-	3	403	c.278G>A	c.(277-279)CGT>CAT	p.R93H		NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	93					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1						CATGGCCCCACGGTAATAGGC	0.453													28	125	---	---	---	---	PASS
SCP2	6342	broad.mit.edu	37	1	53459360	53459360	+	Intron	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53459360C>T	uc001cur.1	+						SCP2_uc001cus.1_RNA|SCP2_uc010ono.1_Intron|SCP2_uc010onp.1_Intron|SCP2_uc009vzi.1_Intron|SCP2_uc001cuq.1_3'UTR	NM_002979	NP_002970	P22307	NLTP_HUMAN	sterol carrier protein 2 isoform 1 proprotein						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|lipid transport	mitochondrion|nucleus|peroxisomal matrix	propanoyl-CoA C-acyltransferase activity|propionyl-CoA C2-trimethyltridecanoyltransferase activity|protein binding|sterol binding			breast(1)	1						GATCATAATCCGTTACAAAAT	0.244													4	103	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62393501	62393501	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62393501C>T	uc001dab.2	+	27	3784	c.3670C>T	c.(3670-3672)CAA>TAA	p.Q1224*	INADL_uc009waf.1_Nonsense_Mutation_p.Q1224*|INADL_uc001daa.2_Nonsense_Mutation_p.Q1224*|INADL_uc001dad.3_Nonsense_Mutation_p.Q921*|INADL_uc001dac.2_RNA	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	1224					intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						CTTTACCGACCGTGAGTGCCT	0.388													6	36	---	---	---	---	PASS
GBP3	2635	broad.mit.edu	37	1	89480252	89480252	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89480252G>A	uc001dmt.2	-	4	611	c.406C>T	c.(406-408)CAG>TAG	p.Q136*	GBP3_uc010oss.1_Nonsense_Mutation_p.Q57*|GBP3_uc001dmu.2_5'UTR|GBP3_uc001dmv.2_RNA	NM_018284	NP_060754	Q9H0R5	GBP3_HUMAN	guanylate binding protein 3	136						integral to membrane	GTP binding|GTPase activity			ovary(1)|pancreas(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		ATAGCCTGCTGGTTGATGGTT	0.512													16	178	---	---	---	---	PASS
SARS	6301	broad.mit.edu	37	1	109772145	109772145	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109772145G>A	uc001dwu.1	+	4	473	c.398G>A	c.(397-399)CGA>CAA	p.R133Q	SARS_uc001dwt.1_Missense_Mutation_p.R133Q|SARS_uc001dwv.1_Missense_Mutation_p.R133Q|SARS_uc001dww.1_Missense_Mutation_p.R66Q|SARS_uc001dwx.1_Missense_Mutation_p.R133Q|SARS_uc009wfa.1_Missense_Mutation_p.R133Q|SARS_uc001dwy.1_5'UTR|SARS_uc001dwz.1_5'UTR	NM_006513	NP_006504	P49591	SYSC_HUMAN	seryl-tRNA synthetase	133					seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	GAGAACCTCCGAGAGATTGGG	0.532													21	310	---	---	---	---	PASS
SV2A	9900	broad.mit.edu	37	1	149885321	149885321	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149885321C>T	uc001etg.2	-	2	563	c.72G>A	c.(70-72)AAG>AAA	p.K24K	SV2A_uc001eth.2_Silent_p.K24K	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2	24	Cytoplasmic (Potential).|Interaction with SYT1 (By similarity).				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	TGGCCGCATGCTTTTTGACTT	0.547													44	147	---	---	---	---	PASS
SMG5	23381	broad.mit.edu	37	1	156221226	156221226	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156221226C>T	uc001foc.3	-	20	2945	c.2796G>A	c.(2794-2796)CGG>CGA	p.R932R	SMG5_uc009wrv.2_Intron	NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay	932	PINc.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					TCAGCTTATGCCGCTCAAAGC	0.562													5	171	---	---	---	---	PASS
C1orf182	128229	broad.mit.edu	37	1	156316722	156316722	+	Silent	SNP	A	G	G			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156316722A>G	uc001foo.2	+	4	689	c.327A>G	c.(325-327)CCA>CCG	p.P109P	C1orf182_uc009wry.2_Silent_p.P109P|C1orf182_uc001fop.3_Silent_p.P109P	NM_144627	NP_653228	Q96A04	CA182_HUMAN	SSTK-interacting protein	109											0	Hepatocellular(266;0.158)					CTTCTCTCCCAGCCTTATCTC	0.448													6	97	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161039381	161039381	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161039381T>G	uc001fxl.2	-	1	380	c.34A>C	c.(34-36)AGC>CGC	p.S12R	ARHGAP30_uc001fxk.2_Missense_Mutation_p.S12R|ARHGAP30_uc001fxm.2_5'UTR|ARHGAP30_uc009wtx.2_5'UTR|ARHGAP30_uc001fxn.1_5'UTR	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	12					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TCCTTTGCGCTGCCCTTCTTC	0.637													4	89	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183106827	183106827	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183106827A>C	uc001gpy.3	+	26	4595	c.4338A>C	c.(4336-4338)GAA>GAC	p.E1446D		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1446	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCAAGGCAGAAGCTGAAAGAA	0.373													5	60	---	---	---	---	PASS
IVNS1ABP	10625	broad.mit.edu	37	1	185269161	185269161	+	Silent	SNP	A	G	G			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185269161A>G	uc001grl.2	-	13	2094	c.1471T>C	c.(1471-1473)TTG>CTG	p.L491L	IVNS1ABP_uc001gri.2_Silent_p.L151L|IVNS1ABP_uc001grj.2_Silent_p.L151L|IVNS1ABP_uc009wyj.2_Silent_p.L273L|IVNS1ABP_uc009wyk.2_RNA|IVNS1ABP_uc001grm.2_Silent_p.L151L	NM_006469	NP_006460	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	491	Kelch 3.				interspecies interaction between organisms|response to virus|RNA splicing|transcription from RNA polymerase III promoter	cytoplasm|cytoskeleton|spliceosomal complex|transcription factor complex				ovary(4)|central_nervous_system(1)	5						CTTGTCCACAACTTTGTTACA	0.353													20	95	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200522269	200522269	+	3'UTR	SNP	G	A	A	rs6667775	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200522269G>A	uc010ppk.1	-	30					KIF14_uc010ppj.1_3'UTR	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14						microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						acggggtttcgccatgttggc	0.005													5	5	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203677131	203677131	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203677131C>A	uc001gzw.2	+	10	2340	c.1456C>A	c.(1456-1458)CAT>AAT	p.H486N	ATP2B4_uc001gzv.2_Missense_Mutation_p.H486N|ATP2B4_uc009xaq.2_Missense_Mutation_p.H486N	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	486	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGGGGGCATCCATTACCGTCA	0.493													9	179	---	---	---	---	PASS
AVPR1B	553	broad.mit.edu	37	1	206224984	206224984	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206224984G>T	uc001hds.2	+	1	702	c.544G>T	c.(544-546)GGG>TGG	p.G182W		NM_000707	NP_000698	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	182	Extracellular (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity			ovary(2)|large_intestine(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CCAGGGCTCAGGGGTGCTGGA	0.627													7	118	---	---	---	---	PASS
WNT9A	7483	broad.mit.edu	37	1	228111994	228111994	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228111994C>T	uc001hri.2	-	3	548	c.460G>A	c.(460-462)GCA>ACA	p.A154T		NM_003395	NP_003386	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family,	154					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|cornea development in camera-type eye|embryonic arm morphogenesis|embryonic skeletal joint morphogenesis|endoderm development|iris morphogenesis|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|neuron differentiation|positive regulation of smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding|signal transducer activity			central_nervous_system(1)|pancreas(1)	2		Prostate(94;0.0405)				AGGTCGGGTGCCTCATCGCAG	0.642													19	140	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228456388	228456388	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228456388C>T	uc009xez.1	+	17	5063	c.5019C>T	c.(5017-5019)CGC>CGT	p.R1673R	OBSCN_uc001hsn.2_Silent_p.R1673R|OBSCN_uc001hso.2_Silent_p.R119R	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1673	Ig-like 17.			RV -> HM (in Ref. 1; CAC85750).	apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CGAAAGTGCGCGTGGAGGCCG	0.682													6	49	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1926178	1926178	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1926178C>T	uc002qxe.2	-	10	2190	c.1363G>A	c.(1363-1365)GAA>AAA	p.E455K	MYT1L_uc002qxd.2_Missense_Mutation_p.E455K|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	455					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CTCCCAGCTTCCATGGCCATC	0.532													30	219	---	---	---	---	PASS
ADAM17	6868	broad.mit.edu	37	2	9630612	9630612	+	Silent	SNP	C	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9630612C>A	uc002qzu.2	-	19	2352	c.2169G>T	c.(2167-2169)TCG>TCT	p.S723S	IAH1_uc010yiz.1_Intron|ADAM17_uc010ewy.2_Silent_p.S706S|ADAM17_uc010ewz.2_Silent_p.S66S	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17	723	Cytoplasmic (Potential).				B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		TAATGCGAACCGATGCAGAAT	0.542													3	51	---	---	---	---	PASS
PLB1	151056	broad.mit.edu	37	2	28761155	28761155	+	Intron	SNP	A	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28761155A>C	uc002rmb.1	+						PLB1_uc010ezj.1_Silent_p.A186A	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					TCCTGCAGGCACCCTCACTTA	0.627													4	23	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60688396	60688396	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60688396C>T	uc002sae.1	-	4	1879	c.1651G>A	c.(1651-1653)GTG>ATG	p.V551M	BCL11A_uc002sab.2_Missense_Mutation_p.V551M|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Missense_Mutation_p.V220M|BCL11A_uc010ypj.1_Missense_Mutation_p.V517M|BCL11A_uc002sad.1_Missense_Mutation_p.V399M|BCL11A_uc002saf.1_Missense_Mutation_p.V517M	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	551					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GAGCTGAGCACCATGCCCTGC	0.716			T	IGH@	B-CLL								5	35	---	---	---	---	PASS
PROKR1	10887	broad.mit.edu	37	2	68873330	68873330	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68873330G>A	uc010yqj.1	+	1	377	c.377G>A	c.(376-378)CGC>CAC	p.R126H	PROKR1_uc002ses.2_RNA	NM_138964	NP_620414	Q8TCW9	PKR1_HUMAN	G protein-coupled receptor 73	126	Extracellular (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1						TATGTGGTGCGCCAGCTCTCC	0.597													44	177	---	---	---	---	PASS
FLJ40330	645784	broad.mit.edu	37	2	89102464	89102464	+	Intron	SNP	A	G	G	rs113574892	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89102464A>G	uc010fhg.2	+						FLJ40330_uc010fhh.2_RNA|FLJ40330_uc010fhi.1_Intron	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						TACTAATTTTAGTGGATGGCT	0.269													3	6	---	---	---	---	PASS
LYG2	254773	broad.mit.edu	37	2	99861764	99861764	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99861764G>A	uc002szw.1	-	4	455	c.342C>T	c.(340-342)GAC>GAT	p.D114D	MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_Silent_p.D114D|LYG2_uc002szx.1_Silent_p.D114D	NM_175735	NP_783862	Q86SG7	LYG2_HUMAN	lysozyme G-like 2 precursor	114					cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1						GGTCCCAGCCGTCTTGCAGGA	0.527													8	97	---	---	---	---	PASS
TBC1D8	11138	broad.mit.edu	37	2	101656775	101656775	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101656775G>A	uc010fiv.2	-	6	1031	c.900C>T	c.(898-900)CAC>CAT	p.H300H	TBC1D8_uc010yvw.1_Silent_p.H315H|TBC1D8_uc002tau.3_Silent_p.H57H	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	300	GRAM 2.				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						CCACAACCGCGTGCAGCTTCT	0.577													9	41	---	---	---	---	PASS
UBR3	130507	broad.mit.edu	37	2	170938348	170938348	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170938348C>T	uc010zdi.1	+	39	5662	c.5662C>T	c.(5662-5664)CTG>TTG	p.L1888L	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Silent_p.L709L|UBR3_uc002uft.3_Silent_p.L745L|UBR3_uc010zdj.1_Silent_p.L579L|UBR3_uc002ufu.3_Silent_p.L394L	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1888					sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						TTACAATGGGCTGTGACTCTC	0.358													6	142	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238274526	238274526	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238274526C>T	uc002vwl.2	-	12	5938	c.5653G>A	c.(5653-5655)GTG>ATG	p.V1885M	COL6A3_uc002vwo.2_Missense_Mutation_p.V1679M|COL6A3_uc010znj.1_Missense_Mutation_p.V1278M	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1885	VWFA 10.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GACACACGCACGGTGGGCGAG	0.612													8	89	---	---	---	---	PASS
SUSD5	26032	broad.mit.edu	37	3	33194351	33194351	+	Silent	SNP	A	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33194351A>C	uc003cfo.1	-	5	2191	c.1773T>G	c.(1771-1773)GGT>GGG	p.G591G		NM_015551	NP_056366	O60279	SUSD5_HUMAN	sushi domain containing 5 precursor	591	Helical; (Potential).				cell adhesion	integral to membrane	hyaluronic acid binding			ovary(1)|central_nervous_system(1)	2						CCATCCCCACACCTGCCAGGA	0.622													6	44	---	---	---	---	PASS
APPL1	26060	broad.mit.edu	37	3	57303570	57303570	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57303570A>T	uc003dio.2	+	22	2132	c.1985A>T	c.(1984-1986)GAC>GTC	p.D662V	ASB14_uc003dip.1_3'UTR|ASB14_uc003diq.2_3'UTR	NM_012096	NP_036228	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH	662	Potential.				apoptosis|cell cycle|cell proliferation|insulin receptor signaling pathway|regulation of apoptosis|regulation of establishment of protein localization in plasma membrane|regulation of glucose import	cytosol|early endosome membrane|microsome|nucleus|vesicle membrane	protein kinase B binding			breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		TTCCACTAGGACTTGGAAGAA	0.423													5	105	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171427351	171427351	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171427351A>G	uc003fhs.2	-	10	1176	c.1060T>C	c.(1060-1062)TGG>CGG	p.W354R	PLD1_uc003fht.2_Missense_Mutation_p.W354R	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	354					cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	ATAACTTACCATTTAGCTAAA	0.378													11	149	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196388401	196388401	+	Silent	SNP	C	T	T	rs13084645	byFrequency	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196388401C>T	uc003fwv.2	+	3	1991	c.1887C>T	c.(1885-1887)CGC>CGT	p.R629R		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	629	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AGATCATCCGCGTGACGGAGC	0.672													12	131	---	---	---	---	PASS
MFSD7	84179	broad.mit.edu	37	4	680048	680048	+	Missense_Mutation	SNP	C	T	T	rs138706049		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:680048C>T	uc003gay.2	-	3	395	c.338G>A	c.(337-339)CGC>CAC	p.R113H	MFSD7_uc003gaw.2_5'Flank|MFSD7_uc003gax.2_Missense_Mutation_p.R113H|MFSD7_uc003gaz.2_Intron|MFSD7_uc003gba.2_Intron|MFSD7_uc003gbb.1_Missense_Mutation_p.R49H	NM_032219	NP_115595	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing	113	Helical; (Potential).				transmembrane transport	integral to membrane					0						GGGCACCATGCGTAGCACACT	0.612													4	63	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13604158	13604158	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13604158T>C	uc003gmz.1	-	10	4483	c.4366A>G	c.(4366-4368)AAA>GAA	p.K1456E	BOD1L_uc010idr.1_Missense_Mutation_p.K793E	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1456							DNA binding			ovary(5)|breast(1)	6						TGCTTAAGTTTGACAGTTTCA	0.383													7	101	---	---	---	---	PASS
TIGD2	166815	broad.mit.edu	37	4	90034328	90034328	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90034328G>A	uc003hsk.2	+	1	361	c.203G>A	c.(202-204)CGT>CAT	p.R68H	FAM13A_uc003hsh.1_5'Flank	NM_145715	NP_663761	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	68	HTH CENPB-type.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		GTATCCAAACGTAAATCTATG	0.378													5	123	---	---	---	---	PASS
SEC24B	10427	broad.mit.edu	37	4	110447421	110447421	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110447421G>A	uc003hzk.2	+	17	2886	c.2831G>A	c.(2830-2832)CGT>CAT	p.R944H	SEC24B_uc003hzl.2_Missense_Mutation_p.R909H|SEC24B_uc011cfp.1_Missense_Mutation_p.R974H|SEC24B_uc011cfq.1_Missense_Mutation_p.R943H|SEC24B_uc011cfr.1_Missense_Mutation_p.R908H	NM_006323	NP_006314	O95487	SC24B_HUMAN	SEC24 (S. cerevisiae) homolog B isoform a	944					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TTCTTTGTCCGTTCTACTGAT	0.358													12	303	---	---	---	---	PASS
MAML3	55534	broad.mit.edu	37	4	141074098	141074098	+	Silent	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141074098G>T	uc003ihz.1	-	1	1136	c.384C>A	c.(382-384)GGC>GGA	p.G128G	MAML3_uc011chd.1_Silent_p.G128G	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	128					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					GTTTGCCGGTGCCGGCGCCCG	0.677													4	25	---	---	---	---	PASS
NDUFS6	4726	broad.mit.edu	37	5	1814479	1814479	+	Silent	SNP	G	A	A	rs35349407		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1814479G>A	uc003jcy.2	+	3	236	c.213G>A	c.(211-213)TTG>TTA	p.L71L		NM_004553	NP_004544	O75380	NDUS6_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 6,	71					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1					NADH(DB00157)	CCATTGATTTGATAGCAGAGC	0.468													10	152	---	---	---	---	PASS
HEXB	3074	broad.mit.edu	37	5	74016557	74016557	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74016557G>A	uc003kdf.3	+	13	1715	c.1598G>A	c.(1597-1599)CGC>CAC	p.R533H	HEXB_uc003kdd.2_Missense_Mutation_p.R308H|HEXB_uc010izh.2_RNA	NM_000521	NP_000512	P07686	HEXB_HUMAN	hexosaminidase B preproprotein	533					cell death	lysosome	cation binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.72e-57)		ACAAGGCACCGCTGCAGGATG	0.403													4	51	---	---	---	---	PASS
PCDHA2	56146	broad.mit.edu	37	5	140176233	140176233	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140176233G>A	uc003lhd.2	+	1	1790	c.1684G>A	c.(1684-1686)GCG>ACG	p.A562T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.A562T|PCDHA2_uc011czy.1_Missense_Mutation_p.A562T	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	562	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACGACAACGCGCCGGCACT	0.697													4	91	---	---	---	---	PASS
PCDHA4	56144	broad.mit.edu	37	5	140188641	140188641	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140188641C>T	uc003lhi.2	+	1	1970	c.1869C>T	c.(1867-1869)CGC>CGT	p.R623R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Silent_p.R623R|PCDHA4_uc011daa.1_Silent_p.R623R	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	623	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCGTTCCGCGTGGGGCTGT	0.672													8	74	---	---	---	---	PASS
MIR1294	100302181	broad.mit.edu	37	5	153726723	153726723	+	RNA	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153726723G>A	hsa-mir-1294|MI0006356	+			c.58G>A			GALNT10_uc003lvg.1_Intron|GALNT10_uc003lvh.2_Intron|GALNT10_uc010jic.2_Intron|GALNT10_uc010jid.2_Intron																	0						tgtgaggttggcattgttgtc	0.015													13	99	---	---	---	---	PASS
SOX30	11063	broad.mit.edu	37	5	157065386	157065386	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157065386C>T	uc003lxb.1	-	4	2074	c.1732G>A	c.(1732-1734)GCT>ACT	p.A578T	SOX30_uc003lxc.1_Intron|SOX30_uc011dds.1_Missense_Mutation_p.A273T	NM_178424	NP_848511	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30 isoform a	578	Pro-rich.				regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)|central_nervous_system(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGGATTGGAGCACTTCTGGGA	0.552													5	84	---	---	---	---	PASS
GRK6	2870	broad.mit.edu	37	5	176863227	176863227	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176863227T>A	uc011dfz.1	+	12	1371	c.1211T>A	c.(1210-1212)GTC>GAC	p.V404D	GRK6_uc003mgp.2_Missense_Mutation_p.V404D|GRK6_uc003mgq.2_Missense_Mutation_p.V404D|GRK6_uc003mgs.1_Missense_Mutation_p.V374D	NM_002082	NP_002073	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6 isoform B	404	Protein kinase.				regulation of G-protein coupled receptor protein signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)|stomach(1)|breast(1)	3	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGAAGGAGGTCCCCGAGGAG	0.632													4	70	---	---	---	---	PASS
GCM2	9247	broad.mit.edu	37	6	10882021	10882021	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10882021C>T	uc003mzn.3	-	1	78	c.6G>A	c.(4-6)CCG>CCA	p.P2P	SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2	2					cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CCGCGGCCGCCGGCATCTGCC	0.572													3	36	---	---	---	---	PASS
ZNF451	26036	broad.mit.edu	37	6	56999545	56999545	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56999545C>T	uc003pdm.1	+	7	803	c.579C>T	c.(577-579)TTC>TTT	p.F193F	ZNF451_uc003pdl.2_Silent_p.F193F|ZNF451_uc003pdn.1_Silent_p.F193F|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Silent_p.F193F	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1	193	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TGAGTAGGTTCGATCACTCTC	0.353													8	94	---	---	---	---	PASS
FILIP1	27145	broad.mit.edu	37	6	76022502	76022502	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76022502C>T	uc003pia.2	-	5	3419	c.3046G>A	c.(3046-3048)GCA>ACA	p.A1016T	FILIP1_uc003phy.1_Missense_Mutation_p.A1016T|FILIP1_uc003phz.2_Missense_Mutation_p.A917T|FILIP1_uc010kbe.2_Missense_Mutation_p.A1019T|FILIP1_uc003pib.1_Missense_Mutation_p.A768T	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1016										skin(3)|ovary(1)	4						GCTGGTGCTGCTGATGTAGAC	0.488													32	237	---	---	---	---	PASS
GABRR1	2569	broad.mit.edu	37	6	89891738	89891738	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89891738G>A	uc003pna.2	-	8	1290	c.835C>T	c.(835-837)CGC>TGC	p.R279C	GABRR1_uc011dzv.1_Missense_Mutation_p.R256C	NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1	279	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)	AAGATGTGGCGACGCAACGTG	0.488													12	123	---	---	---	---	PASS
SFRS18	25957	broad.mit.edu	37	6	99848915	99848915	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99848915C>T	uc003ppo.3	-	12	2147	c.1919G>A	c.(1918-1920)CGT>CAT	p.R640H	SFRS18_uc003ppl.2_Missense_Mutation_p.R186H|SFRS18_uc003ppp.3_Missense_Mutation_p.R640H|SFRS18_uc011eag.1_Missense_Mutation_p.R640H	NM_032870	NP_116259	Q8TF01	PNISR_HUMAN	splicing factor, arginine/serine-rich 130	640						nuclear speck					0		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0631)		ATCAATTTTACGCCTATCTCG	0.388													7	120	---	---	---	---	PASS
TPD52L1	7164	broad.mit.edu	37	6	125550342	125550342	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125550342G>A	uc003pzu.1	+	3	433	c.214G>A	c.(214-216)GGC>AGC	p.G72S	TPD52L1_uc003pzv.1_Missense_Mutation_p.G72S|TPD52L1_uc003pzw.1_Missense_Mutation_p.G72S|TPD52L1_uc003pzx.1_Missense_Mutation_p.G43S|TPD52L1_uc003pzy.1_Missense_Mutation_p.G43S|TPD52L1_uc003pzz.1_Missense_Mutation_p.G43S	NM_003287	NP_003278	Q16890	TPD53_HUMAN	tumor protein D52-like 1 isoform 1	72	Potential.				DNA fragmentation involved in apoptotic nuclear change|G2/M transition of mitotic cell cycle|induction of apoptosis|positive regulation of JNK cascade|positive regulation of MAP kinase activity	perinuclear region of cytoplasm	caspase activator activity|protein heterodimerization activity|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		ACAAAAACTCGGCATGAACCT	0.393													9	110	---	---	---	---	PASS
KIF25	3834	broad.mit.edu	37	6	168443358	168443358	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168443358G>A	uc003qwk.1	+	8	1209	c.947G>A	c.(946-948)CGG>CAG	p.R316Q	KIF25_uc003qwl.1_Intron	NM_030615	NP_085118	Q9UIL4	KIF25_HUMAN	kinesin family member 25 isoform 1	316					microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(1)|pancreas(1)	2		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GCCCCGTACCGGAACAGCAGG	0.652													4	111	---	---	---	---	PASS
DLL1	28514	broad.mit.edu	37	6	170597656	170597656	+	Intron	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170597656C>T	uc003qxm.2	-						DLL1_uc011ehc.1_Intron|DLL1_uc003qxn.3_3'UTR	NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor						cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		GGGGGTGGGCCGAGACATTCA	0.597													3	42	---	---	---	---	PASS
KIAA0415	9907	broad.mit.edu	37	7	4823971	4823971	+	Silent	SNP	C	T	T	rs17135121	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4823971C>T	uc003sne.2	+	6	842	c.759C>T	c.(757-759)AGC>AGT	p.S253S	KIAA0415_uc010ksp.2_RNA	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	253					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		TGCTGCACAGCGGCCCCGAGG	0.682													3	3	---	---	---	---	PASS
ZPBP	11055	broad.mit.edu	37	7	50121412	50121412	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50121412G>T	uc003tou.2	-	3	362	c.292C>A	c.(292-294)CCA>ACA	p.P98T	ZPBP_uc011kci.1_Missense_Mutation_p.P24T|ZPBP_uc010kyw.2_Missense_Mutation_p.P98T	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	98					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					TGGAATGATGGGTCTATCAGT	0.358													9	127	---	---	---	---	PASS
VKORC1L1	154807	broad.mit.edu	37	7	65419190	65419190	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65419190C>T	uc003tul.2	+	3	536	c.434C>T	c.(433-435)ACG>ATG	p.T145M	VKORC1L1_uc011kds.1_Silent_p.H108H|VKORC1L1_uc003tum.1_5'Flank	NM_173517	NP_775788	Q8N0U8	VKORL_HUMAN	vitamin K epoxide reductase complex, subunit	145	Helical; (Potential).					integral to membrane					0		Lung NSC(55;0.197)			Menadione(DB00170)|Warfarin(DB00682)	TGCATCGTCACGTACGTGCTG	0.512													10	101	---	---	---	---	PASS
EIF4H	7458	broad.mit.edu	37	7	73609663	73609663	+	3'UTR	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73609663C>T	uc003uad.1	+	7					RFC2_uc011kfa.1_Intron|EIF4H_uc010lbm.2_Intron|EIF4H_uc003uae.1_3'UTR|EIF4H_uc003uaf.1_RNA	NM_022170	NP_071496	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H						interspecies interaction between organisms|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0						GGGAATGGGGCGTGGGGGGTT	0.622													8	33	---	---	---	---	PASS
ASB4	51666	broad.mit.edu	37	7	95157409	95157409	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95157409A>G	uc011kij.1	+	3	772	c.772A>G	c.(772-774)AAG>GAG	p.K258E	ASB4_uc003unx.2_Missense_Mutation_p.K258E	NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4	258	ANK 6.				intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			TCCCCTCCACAAGGCAGCCTG	0.557											OREG0018172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	59	---	---	---	---	PASS
GNB2	2783	broad.mit.edu	37	7	100275276	100275276	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100275276C>T	uc003uwb.2	+	6	696	c.423C>T	c.(421-423)GGC>GGT	p.G141G	GNB2_uc003uwc.2_Silent_p.G97G|GNB2_uc010lhd.2_Silent_p.G97G|GNB2_uc010lhe.2_Silent_p.G97G|GNB2_uc003uwd.2_Silent_p.G41G|GNB2_uc010lhf.2_Silent_p.G41G|GNB2_uc003uwe.2_Silent_p.G141G|GNB2_uc003uwf.2_Silent_p.G41G	NM_005273	NP_005264	P62879	GBB2_HUMAN	guanine nucleotide-binding protein, beta-2	141	WD 3.				cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	perinuclear region of cytoplasm|plasma membrane	GTPase activity|GTPase binding|signal transducer activity			ovary(2)	2	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				AGCTGCCTGGCCACACTGGTG	0.657													4	54	---	---	---	---	PASS
ORAI2	80228	broad.mit.edu	37	7	102087010	102087010	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102087010G>A	uc010lhz.1	+	4	511	c.276G>A	c.(274-276)CCG>CCA	p.P92P	ORAI2_uc003uzj.2_Silent_p.P92P|ORAI2_uc003uzk.2_Silent_p.P92P|ORAI2_uc011kks.1_Silent_p.P15P	NM_001126340	NP_001119812	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator	92						integral to membrane	protein binding			ovary(1)|kidney(1)	2						ACCCGCGGCCGCTGCTGATTG	0.652													5	27	---	---	---	---	PASS
OR2A25	392138	broad.mit.edu	37	7	143771567	143771567	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143771567G>A	uc011ktx.1	+	1	255	c.255G>A	c.(253-255)CTG>CTA	p.L85L		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					TGAACCTCCTGCATCCAGCCA	0.552													7	105	---	---	---	---	PASS
PPP1R3B	79660	broad.mit.edu	37	8	8998482	8998482	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8998482C>T	uc003wsn.3	-	2	845	c.680G>A	c.(679-681)GGC>GAC	p.G227D	PPP1R3B_uc003wso.3_Missense_Mutation_p.G226D	NM_024607	NP_078883	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory (inhibitor)	227	CBM21.				glycogen metabolic process					ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		ATAGTTCTTGCCTCTGTTGCT	0.483													11	114	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	12947960	12947960	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12947960C>T	uc003wwm.2	-	15	4319	c.3875G>A	c.(3874-3876)CGA>CAA	p.R1292Q	DLC1_uc003wwk.1_Missense_Mutation_p.R855Q|DLC1_uc003wwl.1_Missense_Mutation_p.R889Q|DLC1_uc011kxx.1_Missense_Mutation_p.R781Q	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	1292					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						ATTACGACATCGGCTCATTTC	0.512													9	106	---	---	---	---	PASS
BMP1	649	broad.mit.edu	37	8	22051965	22051965	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22051965C>T	uc003xbg.2	+	11	1549	c.1305C>T	c.(1303-1305)TGC>TGT	p.C435C	BMP1_uc003xba.2_Silent_p.C435C|BMP1_uc003xbb.2_Silent_p.C435C|BMP1_uc003xbe.2_RNA|BMP1_uc003xbc.2_Silent_p.C184C|BMP1_uc003xbd.2_RNA|BMP1_uc003xbf.2_Silent_p.C184C|BMP1_uc011kzc.1_Silent_p.C184C|BMP1_uc003xbh.2_RNA|BMP1_uc003xbi.2_RNA	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3	435	CUB 2.				cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CAGCCATCTGCGGGGGTGATG	0.587													4	50	---	---	---	---	PASS
SCARA5	286133	broad.mit.edu	37	8	27779152	27779152	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27779152G>A	uc003xgj.2	-	4	1292	c.852C>T	c.(850-852)ACC>ACT	p.T284T	SCARA5_uc010luz.2_Intron|SCARA5_uc003xgk.2_Silent_p.T241T|SCARA5_uc003xgl.2_Silent_p.T284T	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	284	Extracellular (Potential).				cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GCAGGTCCTCGGTGACCGCGT	0.677													3	14	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100454735	100454735	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100454735G>A	uc003yiv.2	+	23	3428	c.3317G>A	c.(3316-3318)GGA>GAA	p.G1106E	VPS13B_uc003yiw.2_Missense_Mutation_p.G1106E|VPS13B_uc003yiu.1_Missense_Mutation_p.G1106E|VPS13B_uc003yix.1_Missense_Mutation_p.G576E	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1106					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGGTACCATGGACAAACCAGC	0.428													10	156	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124338170	124338170	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124338170G>T	uc003yqh.3	-	26	4073	c.3965C>A	c.(3964-3966)CCT>CAT	p.P1322H	ATAD2_uc011lii.1_Missense_Mutation_p.P1113H|ATAD2_uc003yqi.3_RNA	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1322					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TGAGGGTGTAGGCTGAGAAAG	0.423													4	117	---	---	---	---	PASS
FAM91A1	157769	broad.mit.edu	37	8	124799551	124799551	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124799551C>T	uc003yqv.2	+	13	1190	c.1129C>T	c.(1129-1131)CGC>TGC	p.R377C	FAM91A1_uc011lik.1_Missense_Mutation_p.R377C|FAM91A1_uc011lil.1_Missense_Mutation_p.R135C	NM_144963	NP_659400	Q658Y4	F91A1_HUMAN	hypothetical protein LOC157769	377										ovary(1)|central_nervous_system(1)	2	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			ACACACGAAGCGCATCGCATT	0.388													7	81	---	---	---	---	PASS
AQP3	360	broad.mit.edu	37	9	33441826	33441826	+	3'UTR	SNP	C	T	T	rs16919255	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33441826C>T	uc003zsx.2	-	6					SUGT1P1_uc010mjq.1_Intron|AQP3_uc003zsv.1_3'UTR|AQP3_uc003zsw.2_3'UTR|AQP3_uc010mju.2_3'UTR	NM_004925	NP_004916	Q92482	AQP3_HUMAN	aquaporin 3						excretion|odontogenesis|positive regulation of immune system process|regulation of keratinocyte differentiation|response to calcium ion|response to retinoic acid|response to vitamin D	basolateral plasma membrane|cell-cell junction|cytoplasm	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		ACCCAAATTCCGGTTCCACCC	0.423													3	40	---	---	---	---	PASS
FAM75A6	389730	broad.mit.edu	37	9	43625067	43625067	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43625067G>A	uc011lrb.1	-	4	3649	c.3620C>T	c.(3619-3621)ACG>ATG	p.T1207M		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	1207						integral to membrane					0						TCCAACTGCCGTCATGAGACC	0.468													34	305	---	---	---	---	PASS
CBWD3	445571	broad.mit.edu	37	9	70871845	70871845	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70871845G>A	uc004agi.3	+	5	548	c.439G>A	c.(439-441)GCT>ACT	p.A147T	CBWD3_uc011lro.1_Intron|CBWD3_uc004agj.3_Intron|CBWD3_uc011lrp.1_Intron|CBWD3_uc004agl.3_5'UTR	NM_201453	NP_958861	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3	147							ATP binding				0				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		ACGTGCAGTGGCTTCTATGTT	0.264													5	140	---	---	---	---	PASS
ALG2	85365	broad.mit.edu	37	9	101980873	101980873	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101980873G>A	uc004azf.2	-	2	664	c.594C>T	c.(592-594)GTC>GTT	p.V198V	ALG2_uc004azg.2_Silent_p.V105V	NM_033087	NP_149078	Q9H553	ALG2_HUMAN	alpha-1,3-mannosyltransferase ALG2	198					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in endoplasmic reticulum|protein N-linked glycosylation via asparagine|response to calcium ion	endoplasmic reticulum membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	alpha-1,3-mannosyltransferase activity|calcium-dependent protein binding|glycolipid 3-alpha-mannosyltransferase activity|protein anchor|protein heterodimerization activity|protein N-terminus binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.0559)				ATGGATAGAGGACATCAGGGT	0.468													9	121	---	---	---	---	PASS
SMC2	10592	broad.mit.edu	37	9	106889615	106889615	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106889615A>T	uc004bbv.2	+	20	2932	c.2644A>T	c.(2644-2646)ATA>TTA	p.I882L	SMC2_uc004bbw.2_Missense_Mutation_p.I882L|SMC2_uc011lvl.1_Missense_Mutation_p.I882L|SMC2_uc004bbx.2_Missense_Mutation_p.I882L|SMC2_uc004bby.2_RNA	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	882	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						AAAAGAGGTGATAACAGCCCA	0.328													20	93	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109689585	109689585	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109689585T>C	uc004bcz.2	+	3	3681	c.3392T>C	c.(3391-3393)GTC>GCC	p.V1131A	ZNF462_uc010mto.2_Missense_Mutation_p.V979A|ZNF462_uc004bda.2_Missense_Mutation_p.V979A	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	1131					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						GGAGTGCTTGTCCACTACCAG	0.532													7	150	---	---	---	---	PASS
TRIM32	22954	broad.mit.edu	37	9	119461051	119461051	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119461051C>T	uc004bjx.2	+	2	1188	c.1030C>T	c.(1030-1032)CGG>TGG	p.R344W	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Missense_Mutation_p.R344W	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	344					fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|kidney(1)	3						TGCTAAACAGCGGGGTCCTGA	0.557									Bardet-Biedl_syndrome				6	91	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131768055	131768055	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131768055G>T	uc004bws.1	+	41	4891	c.4869G>T	c.(4867-4869)GAG>GAT	p.E1623D		NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1623					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						TGCTTGGAGAGGTAAGTTGGT	0.453													18	254	---	---	---	---	PASS
USP6NL	9712	broad.mit.edu	37	10	11504478	11504478	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11504478G>A	uc001ikt.3	-	15	2770	c.2449C>T	c.(2449-2451)CGG>TGG	p.R817W	USP6NL_uc001iks.1_Missense_Mutation_p.R834W	NM_014688	NP_055503	Q92738	US6NL_HUMAN	USP6 N-terminal like isoform 1	817						intracellular	Rab GTPase activator activity				0						AGCCCGTCCCGATTCCTGTAG	0.507													5	53	---	---	---	---	PASS
KIAA1274	27143	broad.mit.edu	37	10	72300948	72300948	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72300948C>T	uc001jrd.3	+	16	2280	c.1999C>T	c.(1999-2001)CGT>TGT	p.R667C	KIAA1274_uc001jre.3_5'UTR	NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	667										ovary(2)|central_nervous_system(1)	3						CGGCCAGGGCCGTACCACAAC	0.617													9	91	---	---	---	---	PASS
MMRN2	79812	broad.mit.edu	37	10	88702968	88702968	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88702968G>A	uc001kea.2	-	6	1700	c.1573C>T	c.(1573-1575)CGG>TGG	p.R525W	MMRN2_uc010qmn.1_Missense_Mutation_p.R168W|MMRN2_uc009xtb.2_Missense_Mutation_p.R482W	NM_024756	NP_079032	Q9H8L6	MMRN2_HUMAN	multimerin 2 precursor	525						extracellular space				large_intestine(1)	1						AGCTGCCGCCGCTCGTCCAGG	0.697													8	33	---	---	---	---	PASS
HECTD2	143279	broad.mit.edu	37	10	93272193	93272193	+	3'UTR	SNP	A	G	G			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93272193A>G	uc001khl.2	+	21					LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_3'UTR|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_3'UTR|HECTD2_uc001khn.1_3'UTR	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1						CTTCCCTCTTACTGTGCCTTT	0.299													10	150	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105203706	105203706	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105203706G>A	uc001kwy.1	+	34	5246	c.5159G>A	c.(5158-5160)CGT>CAT	p.R1720H		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	1720	HAT 2.				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ATGCTGAAGCGTTTCCGGCAG	0.582													16	205	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18735656	18735656	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18735656G>T	uc009yht.2	-	14	2028	c.1838C>A	c.(1837-1839)GCT>GAT	p.A613D	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	613	Ig-like 4.									ovary(4)|large_intestine(2)|kidney(1)	7						GGCGTGCGCAGCCAGTGCCTC	0.627													9	73	---	---	---	---	PASS
MRGPRX2	117194	broad.mit.edu	37	11	19076976	19076976	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19076976G>A	uc001mph.2	-	2	1062	c.974C>T	c.(973-975)TCG>TTG	p.S325L		NM_054030	NP_473371	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	325	Cytoplasmic (Potential).				sensory perception of pain|sleep	plasma membrane	G-protein coupled receptor activity|neuropeptide binding			ovary(1)	1						ACTGCTTCTCGACATCTCCGG	0.537													8	81	---	---	---	---	PASS
PGA5	5222	broad.mit.edu	37	11	61018744	61018744	+	Silent	SNP	T	C	C	rs601275	byFrequency	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61018744T>C	uc001nqz.2	+	9	1188	c.1158T>C	c.(1156-1158)CCT>CCC	p.P386P		NM_014224	NP_055039	P00790	PEPA_HUMAN	pepsinogen 5, group I precursor	386					digestion|proteolysis	extracellular region	aspartic-type endopeptidase activity			skin(1)	1						GCCTGGCCCCTGTGGCTTAAG	0.537													20	228	---	---	---	---	PASS
C11orf9	745	broad.mit.edu	37	11	61551032	61551032	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61551032T>C	uc001nsc.1	+	23	3175	c.3079T>C	c.(3079-3081)TCC>CCC	p.S1027P	C11orf9_uc001nse.1_Missense_Mutation_p.S987P|C11orf9_uc010rll.1_Missense_Mutation_p.S413P	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	1027					central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						GAATTCGATGTCCATCACCTC	0.617													8	240	---	---	---	---	PASS
MYEOV	26579	broad.mit.edu	37	11	69063454	69063454	+	Silent	SNP	G	A	A	rs146387225	byFrequency	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69063454G>A	uc001oov.2	+	3	987	c.537G>A	c.(535-537)TCG>TCA	p.S179S	MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Silent_p.S179S|MYEOV_uc001oow.2_Silent_p.S121S	NM_138768	NP_620123	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	179											0	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		CCATTAGCTCGTGCCCTGAGG	0.607													29	225	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71725778	71725778	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71725778C>T	uc001orl.1	-	15	2943	c.2771G>A	c.(2770-2772)CGC>CAC	p.R924H	NUMA1_uc009ysw.1_Missense_Mutation_p.R487H|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Missense_Mutation_p.R924H|NUMA1_uc001orn.2_Missense_Mutation_p.R487H|NUMA1_uc009ysx.1_Missense_Mutation_p.R924H|NUMA1_uc001oro.1_Missense_Mutation_p.R924H	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	924	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						ACCTGCCTTGCGCACCAAGGT	0.602			T	RARA	APL								7	95	---	---	---	---	PASS
ARRB1	408	broad.mit.edu	37	11	74979964	74979964	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74979964G>A	uc001owe.1	-	14	1284	c.1062C>T	c.(1060-1062)CCC>CCT	p.P354P	ARRB1_uc001owf.1_Silent_p.P346P	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A	354	Interaction with TRAF6.				G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						CTTTGGGCTTGGGGTGCATTA	0.592													5	106	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128839874	128839874	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128839874G>A	uc009zcp.2	-	22	5192	c.5192C>T	c.(5191-5193)CCG>CTG	p.P1731L	ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Missense_Mutation_p.P690L|ARHGAP32_uc001qez.2_Missense_Mutation_p.P1382L	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	1731	Interaction with FYN.				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						ATCAGCAGCCGGAGGCATGCT	0.542													6	146	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133799647	133799647	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133799647C>T	uc001qgx.3	-	12	1781	c.1550G>A	c.(1549-1551)CGG>CAG	p.R517Q	IGSF9B_uc001qgy.1_Missense_Mutation_p.R359Q	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	517	Extracellular (Potential).|Fibronectin type-III 1.					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GACCTGGACCCGGACACTGCC	0.597													7	83	---	---	---	---	PASS
MIR1291	100302221	broad.mit.edu	37	12	49048303	49048303	+	RNA	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49048303G>T	hsa-mir-1291|MI0006353	-			c.11G>T			C12orf41_uc001rrw.2_Intron|C12orf41_uc001rrz.2_Intron|C12orf41_uc001rrx.2_Intron|C12orf41_uc001rry.2_Intron|C12orf41_uc001rru.2_Intron|C12orf41_uc001rrv.2_Intron|SNORA34_uc001rsa.1_5'Flank																	0						CAGGGCCACTGGAATTCTACC	0.483													4	66	---	---	---	---	PASS
DDX23	9416	broad.mit.edu	37	12	49237789	49237789	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49237789C>T	uc001rsm.2	-	3	345	c.254G>A	c.(253-255)CGG>CAG	p.R85Q		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	85	Arg-rich.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6						CTTCTTATTCCGATCCCGCTC	0.488													21	510	---	---	---	---	PASS
KRT5	3852	broad.mit.edu	37	12	52911443	52911443	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52911443C>T	uc001san.2	-	5	1186	c.1023G>A	c.(1021-1023)GAG>GAA	p.E341E	KRT5_uc009zmh.2_Silent_p.E341E	NM_000424	NP_000415	P13647	K2C5_HUMAN	keratin 5	341	Rod.|Coil 2.				epidermis development|hemidesmosome assembly	cytosol|keratin filament	protein binding|structural constituent of cytoskeleton				0				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGGCCTTGACCTCAGCGATGA	0.567													29	123	---	---	---	---	PASS
TRPV4	59341	broad.mit.edu	37	12	110226321	110226321	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110226321G>T	uc001tpj.1	-	12	2187	c.2092C>A	c.(2092-2094)CTG>ATG	p.L698M	TRPV4_uc001tpg.1_Missense_Mutation_p.L664M|TRPV4_uc001tph.1_Missense_Mutation_p.L651M|TRPV4_uc001tpi.1_Missense_Mutation_p.L591M|TRPV4_uc001tpk.1_Missense_Mutation_p.L698M|TRPV4_uc001tpl.1_Missense_Mutation_p.L638M	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	698	Helical; (Potential).				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						GTCACCAGCAGGATGATGAAG	0.567													7	160	---	---	---	---	PASS
LHFP	10186	broad.mit.edu	37	13	39918026	39918026	+	3'UTR	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39918026G>A	uc001uxf.2	-	4						NM_005780	NP_005771	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		ACCTCTCCAAGCCCCTTTGGC	0.458			T	HMGA2	lipoma								25	145	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108861451	108861451	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861451C>T	uc001vqn.2	-	2	2439	c.2166G>A	c.(2164-2166)AAG>AAA	p.K722K	LIG4_uc001vqo.2_Silent_p.K722K|LIG4_uc010agg.1_Silent_p.K655K|LIG4_uc010agf.2_Silent_p.K722K|LIG4_uc001vqp.2_Silent_p.K722K	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	722	BRCT 1.				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					GCCATGCAGGCTTGACAACAT	0.398								NHEJ					9	130	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111156530	111156530	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111156530G>T	uc001vqx.2	+	45	4610	c.4321G>T	c.(4321-4323)GGA>TGA	p.G1441*		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	1441	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TGGGCCCCAAGGAAGAGGTGG	0.622													9	64	---	---	---	---	PASS
CARS2	79587	broad.mit.edu	37	13	111298323	111298323	+	Silent	SNP	C	T	T	rs141349632		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111298323C>T	uc001vrd.2	-	12	1348	c.1308G>A	c.(1306-1308)GCG>GCA	p.A436A	CARS2_uc010tjm.1_RNA	NM_024537	NP_078813	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial	436					cysteinyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|cysteine-tRNA ligase activity|metal ion binding				0	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	CCTTCAGGGACGCCCTGAGCT	0.617													7	143	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63175050	63175050	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63175050G>A	uc001xfx.2	-	11	2194	c.2143C>T	c.(2143-2145)CAG>TAG	p.Q715*	KCNH5_uc001xfy.2_3'UTR	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	715	Calmodulin-binding (Potential).|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TCCTTCTGCTGCTTGAACTTC	0.562													18	230	---	---	---	---	PASS
KCNK13	56659	broad.mit.edu	37	14	90650708	90650708	+	Silent	SNP	C	T	T	rs114616148	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90650708C>T	uc001xye.1	+	2	1030	c.588C>T	c.(586-588)TAC>TAT	p.Y196Y		NM_022054	NP_071337	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	196	Helical; (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)				CCGTGTACTACGTCATGCTGA	0.612													16	168	---	---	---	---	PASS
C14orf159	80017	broad.mit.edu	37	14	91647609	91647609	+	Silent	SNP	T	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91647609T>C	uc001xzb.2	+	10	1563	c.795T>C	c.(793-795)TGT>TGC	p.C265C	C14orf159_uc010atv.1_RNA|C14orf159_uc001xyy.2_Silent_p.C270C|C14orf159_uc001xyx.2_Silent_p.C253C|C14orf159_uc001xyw.2_Silent_p.C270C|C14orf159_uc001xzc.2_Silent_p.C265C|C14orf159_uc001xza.2_Silent_p.C270C|C14orf159_uc001xyv.2_Silent_p.C270C|C14orf159_uc001xyz.2_Silent_p.C141C|C14orf159_uc001xze.2_Silent_p.C265C	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN	hypothetical protein LOC80017 isoform a	265						mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		CACCTGGTTGTCTCACCCCAG	0.522													9	57	---	---	---	---	PASS
SERPINA10	51156	broad.mit.edu	37	14	94756667	94756667	+	Silent	SNP	T	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94756667T>C	uc001yct.2	-	2	730	c.264A>G	c.(262-264)CGA>CGG	p.R88R	SERPINA10_uc001ycu.3_Silent_p.R88R	NM_016186	NP_057270	Q9UK55	ZPI_HUMAN	serine (or cysteine) proteinase inhibitor, clade	88					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TGGAGATCTTTCGCAGCAGGC	0.567													5	104	---	---	---	---	PASS
MYEF2	50804	broad.mit.edu	37	15	48441588	48441588	+	Intron	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48441588C>T	uc001zwi.3	-						MYEF2_uc001zwg.3_5'UTR|MYEF2_uc001zwh.3_Intron|MYEF2_uc001zwj.3_Intron	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2						transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		CAAGAAAGGACGGGGGGATTT	0.353													6	96	---	---	---	---	PASS
KIAA1370	56204	broad.mit.edu	37	15	52970217	52970217	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52970217A>G	uc002acg.3	-	2	155	c.2T>C	c.(1-3)ATG>ACG	p.M1T	KIAA1370_uc002ach.3_RNA|KIAA1370_uc010bfg.1_5'UTR	NM_019600	NP_062546	Q32MH5	K1370_HUMAN	hypothetical protein LOC56204	1											0				all cancers(107;0.0803)		GTCTGGCTTCATTTTCACATC	0.453													8	126	---	---	---	---	PASS
DIS3L	115752	broad.mit.edu	37	15	66618502	66618502	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66618502C>T	uc010ujm.1	+	12	2016	c.2001C>T	c.(1999-2001)CAC>CAT	p.H667H	DIS3L_uc010ujl.1_Silent_p.H297H|DIS3L_uc002app.2_Silent_p.H584H|DIS3L_uc002apq.2_Silent_p.H667H|DIS3L_uc010bho.2_Silent_p.H533H	NM_001143688	NP_001137160	Q8TF46	DI3L1_HUMAN	DIS3 mitotic control homolog (S.	667					rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding			ovary(2)	2						AGAACATTCACGACCTCATCC	0.537													7	98	---	---	---	---	PASS
ITGA11	22801	broad.mit.edu	37	15	68649516	68649516	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68649516C>T	uc002ari.2	-	7	809	c.722G>A	c.(721-723)CGG>CAG	p.R241Q	ITGA11_uc010bib.2_Missense_Mutation_p.R241Q	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	241	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	AAATGCCGTCCGGGTCTCTGT	0.373													11	57	---	---	---	---	PASS
ARNT2	9915	broad.mit.edu	37	15	80884042	80884042	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80884042C>T	uc002bfr.2	+	18	2218	c.2052C>T	c.(2050-2052)TTC>TTT	p.F684F	ARNT2_uc010unm.1_Silent_p.F673F|ARNT2_uc002bfs.2_Silent_p.F673F	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator	684					central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			CTGAAGTGTTCCAGGTAAATC	0.647													6	95	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85055872	85055872	+	RNA	SNP	C	T	T	rs62029638	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85055872C>T	uc002bkm.2	-	6		c.688G>A				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						CTCCTGTTCACGTAGCCTCTC	0.547													3	10	---	---	---	---	PASS
CASKIN1	57524	broad.mit.edu	37	16	2239048	2239048	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2239048G>A	uc010bsg.1	-	6	629	c.597C>T	c.(595-597)AAC>AAT	p.N199N		NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	199	ANK 5.				signal transduction	cytoplasm				skin(2)	2						CGATGTGGCCGTTTTTAGCTG	0.652													17	66	---	---	---	---	PASS
PAQR4	124222	broad.mit.edu	37	16	3021116	3021116	+	Intron	SNP	T	C	C	rs4786365	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3021116T>C	uc002csj.3	+						PAQR4_uc002csk.3_Intron|PAQR4_uc002csl.3_Intron|PAQR4_uc010uwm.1_5'UTR	NM_152341	NP_689554	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV							integral to membrane	receptor activity				0						CCCTTGAGGATGTGACTGAAA	0.582													3	33	---	---	---	---	PASS
SMPD3	55512	broad.mit.edu	37	16	68405352	68405352	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68405352C>T	uc002ewa.2	-	3	1155	c.733G>A	c.(733-735)GTG>ATG	p.V245M	SMPD3_uc010cfe.2_Missense_Mutation_p.V245M|SMPD3_uc010vlh.1_Missense_Mutation_p.V245M	NM_018667	NP_061137	Q9NY59	NSMA2_HUMAN	neutral sphingomyelin phosphodiesterase 3	245	Lumenal (Potential).				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	CCGATGCGCACGATGCAGGCA	0.726													7	26	---	---	---	---	PASS
ACSF3	197322	broad.mit.edu	37	16	89212411	89212411	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89212411C>T	uc002fmp.2	+	10	1907	c.1567C>T	c.(1567-1569)CGA>TGA	p.R523*	ACSF3_uc010cig.1_Nonsense_Mutation_p.R523*|ACSF3_uc010cih.1_Nonsense_Mutation_p.R258*|ACSF3_uc002fmq.1_RNA|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_Nonsense_Mutation_p.R258*	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor	523					fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)		GGTGACCCTCCGAGAAGGACA	0.597													13	180	---	---	---	---	PASS
ZFP3	124961	broad.mit.edu	37	17	4995356	4995356	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4995356G>A	uc002gaq.2	+	2	682	c.557G>A	c.(556-558)CGG>CAG	p.R186Q		NM_153018	NP_694563	Q96NJ6	ZFP3_HUMAN	zinc finger protein-3	186	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGCCTTCGACGGCACCTGAGA	0.393													5	178	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5033903	5033903	+	Nonsense_Mutation	SNP	C	T	T	rs142168522		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5033903C>T	uc002gau.1	+	11	2309	c.79C>T	c.(79-81)CGA>TGA	p.R27*	USP6_uc002gav.1_Nonsense_Mutation_p.R27*|USP6_uc010ckz.1_5'UTR|USP6_uc002gaw.2_Nonsense_Mutation_p.R27*	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	27					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						ACAGGGACACCGAGCTGGGCT	0.597			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								10	97	---	---	---	---	PASS
PITPNM3	83394	broad.mit.edu	37	17	6381355	6381355	+	Silent	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6381355C>T	uc002gdd.3	-	8	991	c.840G>A	c.(838-840)GCG>GCA	p.A280A	PITPNM3_uc010cln.2_Silent_p.A244A|PITPNM3_uc002gdc.3_5'UTR	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1	280	Ser-rich.				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CTGAGGGCCCCGCACTGTAGC	0.672													13	77	---	---	---	---	PASS
RCVRN	5957	broad.mit.edu	37	17	9801318	9801318	+	3'UTR	SNP	C	T	T	rs71680149		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9801318C>T	uc002gme.1	-	3						NM_002903	NP_002894	P35243	RECO_HUMAN	recoverin						visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						tgtgtgtgtgcgcgcgcgtgt	0.448													4	65	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17701153	17701153	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17701153G>A	uc002grm.2	+	3	5360	c.4891G>A	c.(4891-4893)GCC>ACC	p.A1631T	RAI1_uc002grn.1_Missense_Mutation_p.A1631T	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1631	Ser-rich.					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		Ttcctcctctgcctcctcttc	0.512													8	103	---	---	---	---	PASS
SLC5A10	125206	broad.mit.edu	37	17	18872377	18872377	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18872377G>A	uc002guu.1	+	6	507	c.466G>A	c.(466-468)GCG>ACG	p.A156T	SLC5A10_uc002gur.1_Missense_Mutation_p.A100T|SLC5A10_uc002gut.1_Missense_Mutation_p.A156T|SLC5A10_uc002guv.1_Missense_Mutation_p.A156T|SLC5A10_uc010vyl.1_Missense_Mutation_p.A156T	NM_001042450	NP_001035915	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/glucose	156	Helical; (Potential).				sodium ion transport|transmembrane transport	integral to membrane	transporter activity			ovary(1)	1						GGACCTGTACGCGGGGGCTCT	0.433													8	47	---	---	---	---	PASS
DUSP14	11072	broad.mit.edu	37	17	35872310	35872310	+	5'UTR	SNP	G	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35872310G>T	uc002hnx.2	+	3					DUSP14_uc002hny.2_5'UTR|DUSP14_uc002hnz.2_5'UTR	NM_007026	NP_008957	O95147	DUS14_HUMAN	dual specificity phosphatase 14								MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Breast(25;0.00637)|Ovarian(249;0.15)				TGGATTCCTTGGTGGAGGAAA	0.453													4	44	---	---	---	---	PASS
GPR179	440435	broad.mit.edu	37	17	36486199	36486199	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36486199G>A	uc002hpz.2	-	11	3274	c.3253C>T	c.(3253-3255)CGC>TGC	p.R1085C		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	1085	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CCCAGGCTGCGCATGGAACCC	0.582													5	81	---	---	---	---	PASS
WIPF2	147179	broad.mit.edu	37	17	38421246	38421246	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38421246C>T	uc002hug.1	+	5	1058	c.818C>T	c.(817-819)GCC>GTC	p.A273V	WIPF2_uc002huh.1_Missense_Mutation_p.A123V|WIPF2_uc010cww.1_Missense_Mutation_p.A123V|WIPF2_uc002hui.1_Missense_Mutation_p.A273V|WIPF2_uc010cwx.1_Intron|WIPF2_uc010cwy.1_Missense_Mutation_p.A273V	NM_133264	NP_573571	Q8TF74	WIPF2_HUMAN	WIRE protein	273						cytoplasm|cytoskeleton	actin binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						AATGAGTCAGCCCCTGAGCTG	0.602										HNSCC(43;0.11)			6	150	---	---	---	---	PASS
PTRF	284119	broad.mit.edu	37	17	40557266	40557266	+	Silent	SNP	G	A	A	rs137932986		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40557266G>A	uc002hzo.2	-	2	771	c.612C>T	c.(610-612)GAC>GAT	p.D204D	PTRF_uc010wgi.1_Silent_p.D186D	NM_012232	NP_036364	Q6NZI2	PTRF_HUMAN	polymerase I and transcript release factor	204	Potential.				regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription initiation from RNA polymerase I promoter	caveola|cytosol|endoplasmic reticulum|microsome|mitochondrion|nucleoplasm	protein binding|rRNA primary transcript binding			breast(1)	1		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CCACCGCCTCGTCCGACGAAA	0.672													11	208	---	---	---	---	PASS
MPP3	4356	broad.mit.edu	37	17	41891642	41891642	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41891642G>A	uc002iei.3	-	15	1263	c.1097C>T	c.(1096-1098)CCG>CTG	p.P366L	MPP3_uc002ieh.2_Missense_Mutation_p.P391L|MPP3_uc002iej.2_RNA	NM_001932	NP_001923	Q13368	MPP3_HUMAN	palmitoylated membrane protein 3	366					signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity			large_intestine(1)|skin(1)	2		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		CAGCAGCTCCGGAGACTCAGC	0.632													8	215	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42636103	42636103	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42636103G>A	uc002igx.1	+	1	1179	c.1047G>A	c.(1045-1047)TCG>TCA	p.S349S		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	349	Cytoplasmic (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TCATCCTGTCGCTCACCTGGT	0.632													8	96	---	---	---	---	PASS
ADAM11	4185	broad.mit.edu	37	17	42855196	42855196	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42855196G>A	uc002ihh.2	+	23	2035	c.2035G>A	c.(2035-2037)GGC>AGC	p.G679S	ADAM11_uc010wjd.1_Missense_Mutation_p.G479S|ADAM11_uc002ihi.2_Silent_p.P31P	NM_002390	NP_002381	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11 preproprotein	679	EGF-like.|Extracellular (Potential).				integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)				CACCTGCCCCGGCAGTGGGGA	0.642													4	26	---	---	---	---	PASS
MSI2	124540	broad.mit.edu	37	17	55339544	55339544	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55339544G>A	uc002iuz.1	+	5	476	c.303G>A	c.(301-303)GCG>GCA	p.A101A	MSI2_uc010wnm.1_Silent_p.A79A|MSI2_uc002iva.2_Silent_p.A97A|MSI2_uc002ivb.2_RNA	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a	101	RRM 1.					cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		CTCGTCGAGCGCAACCCAAGG	0.368			T	HOXA9	CML								7	142	---	---	---	---	PASS
CACNG4	27092	broad.mit.edu	37	17	65026808	65026808	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65026808G>A	uc002jft.1	+	4	687	c.672G>A	c.(670-672)GCG>GCA	p.A224A		NM_014405	NP_055220	Q9UBN1	CCG4_HUMAN	voltage-dependent calcium channel gamma-4	224	Cytoplasmic (Potential).				membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			TCCTTAAGGCGTCTTCCTCTT	0.542													37	128	---	---	---	---	PASS
SEPT9	10801	broad.mit.edu	37	17	75398336	75398336	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75398336G>A	uc002jts.3	+	3	398	c.272G>A	c.(271-273)CGG>CAG	p.R91Q	SEPT9_uc010wtk.1_Missense_Mutation_p.R72Q|SEPT9_uc002jtt.3_5'UTR|SEPT9_uc002jtu.3_Missense_Mutation_p.R73Q|SEPT9_uc002jtv.2_Missense_Mutation_p.R84Q|SEPT9_uc002jtw.2_5'UTR|SEPT9_uc002jtx.1_5'UTR|SEPT9_uc010wtl.1_5'Flank	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a	91					cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			GCGTCCCTGCGGAGGGTGGAG	0.667													3	21	---	---	---	---	PASS
C18orf10	25941	broad.mit.edu	37	18	34378380	34378380	+	Intron	SNP	A	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34378380A>T	uc002kzw.1	-						C18orf10_uc002kzv.1_Intron|C18orf10_uc010xci.1_Intron|C18orf10_uc002kzx.1_Intron|C18orf10_uc002kzy.3_3'UTR	NM_015476	NP_056291	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2							cytoplasm|microtubule				skin(1)	1						GGAATATACCATAGTTTACAA	0.333													8	95	---	---	---	---	PASS
ADNP2	22850	broad.mit.edu	37	18	77896569	77896569	+	Silent	SNP	T	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77896569T>C	uc002lnw.2	+	4	3728	c.3273T>C	c.(3271-3273)TTT>TTC	p.F1091F		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	1091	Homeobox.				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CTTCATTTTTTGGAAAAAGAA	0.308													7	137	---	---	---	---	PASS
HMHA1	23526	broad.mit.edu	37	19	1068742	1068742	+	Silent	SNP	C	T	T	rs3764655		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1068742C>T	uc002lqz.1	+	2	651	c.420C>T	c.(418-420)GAC>GAT	p.D140D	HMHA1_uc010xgd.1_Silent_p.D156D|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_Translation_Start_Site|HMHA1_uc002lrb.1_5'Flank	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	140					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTTGCGTGACGGTGAGAGCC	0.507													6	72	---	---	---	---	PASS
TBXA2R	6915	broad.mit.edu	37	19	3595923	3595923	+	Silent	SNP	G	A	A	rs1131882	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3595923G>A	uc002lyg.1	-	3	1009	c.795C>T	c.(793-795)ATC>ATT	p.I265I	TBXA2R_uc002lye.1_Missense_Mutation_p.R136C	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	265	Helical; Name=6; (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	CTGTCTGGGCGATGAAGACCT	0.697													4	0	---	---	---	---	PASS
LASS4	79603	broad.mit.edu	37	19	8319479	8319479	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8319479G>A	uc002mjg.2	+	4	590	c.270G>A	c.(268-270)ACG>ACA	p.T90T	LASS4_uc002mjh.2_Silent_p.T39T|LASS4_uc002mji.2_5'UTR|LASS4_uc010dvz.2_Silent_p.T90T	NM_024552	NP_078828	Q9HA82	CERS4_HUMAN	LAG1 homolog, ceramide synthase 4	90	Homeobox.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(1)	1						ACTTCCTCACGGAAGGGCACA	0.647													3	29	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8976368	8976368	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8976368C>A	uc002mkp.2	-	75	42664	c.42460G>T	c.(42460-42462)GGC>TGC	p.G14154C	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.G954C|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGCCCGGGGCCCACAGGGTCA	0.597													8	48	---	---	---	---	PASS
ZNF317	57693	broad.mit.edu	37	19	9271970	9271970	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9271970G>A	uc002mku.2	+	7	1924	c.1649G>A	c.(1648-1650)CGG>CAG	p.R550Q	ZNF317_uc002mkv.2_Missense_Mutation_p.R409Q|ZNF317_uc002mkw.2_Missense_Mutation_p.R518Q|ZNF317_uc002mkx.2_Missense_Mutation_p.R465Q|ZNF317_uc002mky.2_Missense_Mutation_p.R433Q	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	550	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTGCACAGGCGGATCCACACC	0.587													5	67	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10262102	10262102	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10262102C>T	uc002mng.2	-	23	2369	c.2189G>A	c.(2188-2190)CGC>CAC	p.R730H	DNMT1_uc010xlc.1_Missense_Mutation_p.R746H|DNMT1_uc002mnh.2_Missense_Mutation_p.R625H|DNMT1_uc010xld.1_Missense_Mutation_p.R730H	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	730					chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	CCAAGAGATGCGATTCTTGTT	0.512													22	213	---	---	---	---	PASS
ECSIT	51295	broad.mit.edu	37	19	11624790	11624790	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11624790G>A	uc002msb.2	-	3	477	c.343C>T	c.(343-345)CGC>TGC	p.R115C	ECSIT_uc002msa.1_5'Flank|ECSIT_uc010dyc.1_Missense_Mutation_p.R115C|ECSIT_uc010dyd.2_Missense_Mutation_p.R115C|ECSIT_uc010xma.1_Intron	NM_016581	NP_057665	Q9BQ95	ECSIT_HUMAN	evolutionarily conserved signaling intermediate	115					innate immune response|regulation of oxidoreductase activity	mitochondrion	oxidoreductase activity, acting on NADH or NADPH|protein binding			ovary(1)	1						CGCATCTTGCGCAGGGCCAGG	0.592													5	86	---	---	---	---	PASS
HOOK2	29911	broad.mit.edu	37	19	12881812	12881812	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12881812C>T	uc002muy.2	-	10	1007	c.836G>A	c.(835-837)CGG>CAG	p.R279Q	HOOK2_uc002muz.2_Missense_Mutation_p.R279Q	NM_013312	NP_037444	Q96ED9	HOOK2_HUMAN	hook homolog 2 isoform 1	279	Sufficient for interaction with microtubules.|Potential.				early endosome to late endosome transport|endocytosis|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|protein transport	centrosome|FHF complex|microtubule	identical protein binding|microtubule binding			ovary(1)|breast(1)|skin(1)	3						CGCCTGGTTCCGGTGCTGCAG	0.652													5	39	---	---	---	---	PASS
RAB3A	5864	broad.mit.edu	37	19	18313413	18313413	+	Silent	SNP	C	T	T	rs144222621		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18313413C>T	uc002nie.2	-	2	307	c.138G>A	c.(136-138)TCG>TCA	p.S46S		NM_002866	NP_002857	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	46					glutamate secretion|protein transport|small GTPase mediated signal transduction	clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|plasma membrane|synaptic vesicle	GTP binding|GTPase activity				0						CAGGCGTGAACGAGTCGTCAG	0.542											OREG0025360	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	172	---	---	---	---	PASS
ZBTB32	27033	broad.mit.edu	37	19	36206307	36206307	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36206307C>A	uc002oay.2	+	2	989	c.779C>A	c.(778-780)CCT>CAT	p.P260H	ZBTB32_uc002oaz.2_RNA|MLL4_uc010eei.2_5'Flank	NM_014383	NP_055198	Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	260					DNA repair|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleoplasm	DNA binding|protein binding|transcription corepressor activity|zinc ion binding			ovary(1)|skin(1)	2	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGGGGCCAGCCTGCCCTGTGG	0.672													12	97	---	---	---	---	PASS
ZNF574	64763	broad.mit.edu	37	19	42584668	42584668	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42584668G>A	uc002osm.3	+	2	2079	c.1910G>A	c.(1909-1911)CGC>CAC	p.R637H	ZNF574_uc002osk.3_Missense_Mutation_p.R727H	NM_022752	NP_073589	Q6ZN55	ZN574_HUMAN	zinc finger protein 574	637	C2H2-type 15; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.059)				CAGCCCCACCGCTGCCCATCC	0.701													8	104	---	---	---	---	PASS
CLPTM1	1209	broad.mit.edu	37	19	45476426	45476426	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45476426C>T	uc002pai.2	+	3	283	c.268C>T	c.(268-270)CGC>TGC	p.R90C	CLPTM1_uc010ejv.1_Translation_Start_Site|CLPTM1_uc010xxf.1_Translation_Start_Site|CLPTM1_uc010xxg.1_Missense_Mutation_p.R76C	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane	90	Extracellular (Potential).				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		AGGAGCTCCACGCGTCGCCAG	0.627													5	23	---	---	---	---	PASS
CKM	1158	broad.mit.edu	37	19	45810883	45810883	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45810883C>T	uc002pbd.2	-	7	877	c.803G>A	c.(802-804)GGC>GAC	p.G268D		NM_001824	NP_001815	P06732	KCRM_HUMAN	muscle creatine kinase	268	Phosphagen kinase C-terminal.				creatine metabolic process	cytosol	ATP binding|creatine kinase activity			skin(1)	1		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	GAAGGGGTGGCCAGCTTTCTT	0.617													3	43	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55147987	55147987	+	Missense_Mutation	SNP	G	C	C	rs41308744		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55147987G>C	uc002qgj.2	+	15	2030	c.1690G>C	c.(1690-1692)GAG>CAG	p.E564Q	LILRB1_uc010erp.1_3'UTR|LILRB1_uc002qgl.2_Missense_Mutation_p.E565Q|LILRB1_uc002qgk.2_Missense_Mutation_p.E565Q|LILRB1_uc002qgm.2_Missense_Mutation_p.E566Q|LILRB1_uc010erq.2_Missense_Mutation_p.E548Q|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	564	Cytoplasmic (Potential).|ITIM motif 2.				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		GACGTATGCCGAGGTGAAACA	0.577										HNSCC(37;0.09)			4	84	---	---	---	---	PASS
C20orf96	140680	broad.mit.edu	37	20	264701	264701	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:264701G>A	uc002wde.1	-	4	348	c.209C>T	c.(208-210)ACG>ATG	p.T70M	C20orf96_uc002wdc.2_Missense_Mutation_p.T17M|C20orf96_uc002wdd.2_Missense_Mutation_p.T35M|C20orf96_uc010zpi.1_Missense_Mutation_p.T17M|C20orf96_uc010zpj.1_Missense_Mutation_p.T35M|C20orf96_uc010zpk.1_Missense_Mutation_p.T8M	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680	70											0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TGTCACCACCGTAGTGGGCTT	0.537													5	98	---	---	---	---	PASS
BMP7	655	broad.mit.edu	37	20	55748206	55748206	+	Intron	SNP	G	A	A	rs2148328	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55748206G>A	uc010gip.1	-						BMP7_uc010giq.1_Intron|BMP7_uc002xyc.2_Missense_Mutation_p.A399V	NM_001719	NP_001710	P18075	BMP7_HUMAN	bone morphogenetic protein 7 precursor						BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity			skin(1)	1	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			TGGTGGCCCCGCAGCCTGCCC	0.527													8	9	---	---	---	---	PASS
SPO11	23626	broad.mit.edu	37	20	55904843	55904843	+	5'UTR	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55904843C>T	uc002xye.2	+	1					SPO11_uc002xyf.2_5'UTR	NM_012444	NP_036576	Q9Y5K1	SPO11_HUMAN	meiotic recombination protein SPO11 isoform a						female gamete generation|reciprocal meiotic recombination	chromosome|nucleus	ATP binding|DNA binding|hydrolase activity			breast(2)|skin(1)	3	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			GCTCAGAAAGCGCGGGAAAGG	0.687								Editing_and_processing_nucleases					3	16	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	31062069	31062069	+	Missense_Mutation	SNP	C	T	T	rs143948570		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31062069C>T	uc002yno.1	-	3	987	c.523G>A	c.(523-525)GTG>ATG	p.V175M	GRIK1_uc002ynn.2_Missense_Mutation_p.V175M|GRIK1_uc011acs.1_Missense_Mutation_p.V175M|GRIK1_uc011act.1_Missense_Mutation_p.V119M|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Missense_Mutation_p.V175M	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	175	Extracellular (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	TCATACACCACTGTCACTGTT	0.433													25	287	---	---	---	---	PASS
ZNF295	49854	broad.mit.edu	37	21	43412180	43412180	+	Silent	SNP	G	A	A	rs143540135	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43412180G>A	uc002zab.3	-	3	2239	c.2025C>T	c.(2023-2025)TGC>TGT	p.C675C	ZNF295_uc002yzz.3_Intron|ZNF295_uc002yzy.3_Silent_p.C675C|ZNF295_uc002zaa.3_Silent_p.C675C	NM_001098402	NP_001091872	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	675	C2H2-type 3.				negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3						ACGCTTTTCCGCAGTAAGTAC	0.438													20	219	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50716578	50716578	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50716578C>T	uc003bkv.3	-	31	4961	c.4855G>A	c.(4855-4857)GAG>AAG	p.E1619K	PLXNB2_uc003bkt.1_Missense_Mutation_p.E411K|PLXNB2_uc003bku.1_Missense_Mutation_p.E604K	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1619	Cytoplasmic (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGGTAGATCTCGGTGATGGCC	0.682													3	47	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153587627	153587627	+	Silent	SNP	G	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153587627G>A	uc004fkk.2	-	25	4539	c.4290C>T	c.(4288-4290)GGC>GGT	p.G1430G	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Silent_p.G1430G	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1430	Filamin 12.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCACTTGATGGCCACCATAGG	0.612													5	51	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19467923	19467923	+	Frame_Shift_Del	DEL	G	-	-	rs145307465		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19467923delG	uc001bbi.2	-	57	8410	c.8406delC	c.(8404-8406)CCCfs	p.P2802fs	UBR4_uc001bbk.1_Frame_Shift_Del_p.P484fs	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2802					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGTCCAGCATGGGGGGGAAGC	0.587													107	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31128106	31128111	+	IGR	DEL	TGGTGA	-	-	rs112746252		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128106_31128111delTGGTGA								None (None upstream) : MATN1 (56015 downstream)																							gtgatggtggtggtgatggtggtggt	0.000													6	3	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39770238	39770238	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39770238delT	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc009vvq.1_Intron|MACF1_uc001cdb.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			cttttctttcttttttttttt	0.159													7	4	---	---	---	---	
KANK4	163782	broad.mit.edu	37	1	62740427	62740427	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62740427delG	uc001dah.3	-	3	726	c.349delC	c.(349-351)CAGfs	p.Q117fs	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	117										ovary(3)|skin(2)|lung(1)	6						GTTGAGGCCTGGGGGGCATTA	0.607													56	10	---	---	---	---	
AK5	26289	broad.mit.edu	37	1	77759441	77759442	+	Intron	INS	-	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77759441_77759442insT	uc001dhn.2	+						AK5_uc001dho.2_Intron|AK5_uc001dhm.1_Intron	NM_174858	NP_777283	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1						TTATTATGGTGTTTTTTCCTTT	0.337													34	18	---	---	---	---	
PKN2	5586	broad.mit.edu	37	1	89237082	89237082	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89237082delA	uc001dmn.2	+						PKN2_uc001dmm.1_Intron|PKN2_uc010osp.1_Intron|PKN2_uc010osq.1_Intron|PKN2_uc009wcv.2_Intron	NM_006256	NP_006247	Q16513	PKN2_HUMAN	protein kinase N2						signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		TGGTGCAATTAAAATTTTTTT	0.308													137	14	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145109975	145109976	+	Intron	INS	-	C	C	rs11458983		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109975_145109976insC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CAGGAACTTTGCTAAAGATCTA	0.386													5	3	---	---	---	---	
FCRL1	115350	broad.mit.edu	37	1	157774046	157774047	+	Intron	INS	-	A	A	rs12133090		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774046_157774047insA	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ACCCCCCCCCCAGTGGCCCATG	0.520													4	7	---	---	---	---	
DCAF6	55827	broad.mit.edu	37	1	168024985	168024985	+	Intron	DEL	G	-	-	rs35042830		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168024985delG	uc001gew.2	+						DCAF6_uc001gev.2_Intron|DCAF6_uc001gex.2_Intron|DCAF6_uc010plk.1_Intron|DCAF6_uc001gey.2_Intron|DCAF6_uc001gez.2_Intron	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b						positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						GAAAGTTAAAGGGCATTTTCT	0.289													8	5	---	---	---	---	
CAMSAP1L1	23271	broad.mit.edu	37	1	200816751	200816752	+	Intron	INS	-	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200816751_200816752insT	uc001gvl.2	+						CAMSAP1L1_uc001gvk.2_Intron|CAMSAP1L1_uc001gvm.2_Intron	NM_203459	NP_982284	Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein							cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4						ATGGCTTTTTCTTTTTTGCATT	0.312													174	8	---	---	---	---	
PPP1R12B	4660	broad.mit.edu	37	1	202457853	202457854	+	Intron	DEL	AC	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202457853_202457854delAC	uc001gya.1	+						PPP1R12B_uc001gxz.1_Intron|PPP1R12B_uc001gyb.1_Intron|PPP1R12B_uc001gyc.1_Intron	NM_002481	NP_002472	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCTGATTTAAacacacacacac	0.173													4	2	---	---	---	---	
ATP2B4	493	broad.mit.edu	37	1	203676578	203676578	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203676578delT	uc001gzw.2	+						ATP2B4_uc001gzv.2_Intron|ATP2B4_uc009xaq.2_Intron	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GTATCTTGGAttttttttttt	0.199													2	4	---	---	---	---	
INTS7	25896	broad.mit.edu	37	1	212180338	212180338	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212180338delT	uc001hiw.1	-						INTS7_uc009xdb.1_Intron|INTS7_uc001hix.1_Intron|INTS7_uc001hiy.1_Intron|INTS7_uc010pta.1_Intron	NM_015434	NP_056249	Q9NVH2	INT7_HUMAN	integrator complex subunit 7						snRNA processing	integrator complex	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		CAATCCTTTCTTTTTTTTTTT	0.353													5	3	---	---	---	---	
ACBD3	64746	broad.mit.edu	37	1	226347211	226347214	+	Intron	DEL	AAGA	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226347211_226347214delAAGA	uc001hpy.2	-							NM_022735	NP_073572	Q9H3P7	GCP60_HUMAN	acyl-Coenzyme A binding domain containing 3						steroid biosynthetic process|transport	Golgi membrane|integral to membrane|mitochondrion	fatty-acyl-CoA binding|protein binding				0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		CTGGGTCCAGAAGAAAGATTTAAG	0.328													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229824632	229824633	+	IGR	INS	-	CAAAA	CAAAA			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229824632_229824633insCAAAA								URB2 (28686 upstream) : GALNT2 (368903 downstream)																							agactccatctcaaaacaaaac	0.158													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	234492402	234492402	+	IGR	DEL	T	-	-	rs145467850		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234492402delT								SLC35F3 (32140 upstream) : C1orf31 (16873 downstream)																							TTTGCATATCTTTTTTTTTTT	0.418													3	3	---	---	---	---	
C2orf43	60526	broad.mit.edu	37	2	20995706	20995709	+	Intron	DEL	CACA	-	-	rs140703798		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20995706_20995709delCACA	uc002rec.2	-						C2orf43_uc002rea.1_Intron|C2orf43_uc002reb.1_Intron|C2orf43_uc010yka.1_Intron|C2orf43_uc010ykb.1_Intron|C2orf43_uc010ykc.1_Intron|C2orf43_uc010ykd.1_Intron|C2orf43_uc010yke.1_Intron|C2orf43_uc010ykf.1_Intron	NM_021925	NP_068744	Q9H6V9	CB043_HUMAN	hypothetical protein LOC60526												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGAAACCTGCcacacacacacaca	0.309													4	3	---	---	---	---	
PPM1B	5495	broad.mit.edu	37	2	44457544	44457544	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44457544delA	uc002rtt.2	+						PPM1B_uc002rtu.2_3'UTR|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Intron|PPM1B_uc002rtx.2_Intron	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1						protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTTGAATCTTAAAAAAAGGCC	0.378													193	10	---	---	---	---	
CRIPT	9419	broad.mit.edu	37	2	46846809	46846809	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46846809delA	uc002rve.2	+	3	223	c.126delA	c.(124-126)TCAfs	p.S42fs	PIGF_uc002rvc.2_5'Flank|PIGF_uc002rvd.2_5'Flank	NM_014171	NP_054890	Q9P021	CRIPT_HUMAN	postsynaptic protein CRIPT	42						cell junction|cytoplasm|dendritic spine					0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CTTTGACTTCAAAAAAAGCAA	0.323													70	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92320421	92320422	+	IGR	DEL	CA	-	-	rs79578857		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92320421_92320422delCA								FKSG73 (189927 upstream) : None (None downstream)																							caattgaagtcacagtgttgaa	0.000													123	7	---	---	---	---	
MFSD9	84804	broad.mit.edu	37	2	103334978	103334978	+	Frame_Shift_Del	DEL	G	-	-	rs145424077		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103334978delG	uc002tcb.2	-	6	1394	c.1326delC	c.(1324-1326)CCCfs	p.P442fs	MFSD9_uc010fja.2_RNA	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing	442	Helical; (Potential).				transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						CGCCCAGGCTGGGGGGGCCGC	0.557													117	7	---	---	---	---	
IWS1	55677	broad.mit.edu	37	2	128260345	128260345	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128260345delA	uc002ton.2	-						IWS1_uc010yzl.1_Intron|uc002too.1_5'Flank	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog						transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TAAAAACACCAAAAAAAAGCA	0.308													63	9	---	---	---	---	
WDR12	55759	broad.mit.edu	37	2	203762146	203762146	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203762146delA	uc002uzl.2	-						WDR12_uc010ftt.2_Intron	NM_018256	NP_060726	Q9GZL7	WDR12_HUMAN	WD repeat domain 12 protein						cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						ATCCTATGAGAAAAAAAAATC	0.338													102	11	---	---	---	---	
VPRBP	9730	broad.mit.edu	37	3	51467343	51467343	+	Intron	DEL	A	-	-	rs112905156		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51467343delA	uc003dbe.1	-							NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		GAAGAAAGGGAAAAAAAAAAA	0.403													4	3	---	---	---	---	
PIK3R4	30849	broad.mit.edu	37	3	130463254	130463254	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130463254delA	uc003enj.2	-							NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4						fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						TCTGGTGACTAAAAAAAGCCA	0.378													81	11	---	---	---	---	
STAG1	10274	broad.mit.edu	37	3	136152643	136152643	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136152643delT	uc003era.1	-						STAG1_uc003erb.1_Intron|STAG1_uc003erc.1_Intron|STAG1_uc010hua.1_Intron	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1						cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						TACTTTGCTATTTTTTTTTTT	0.269													4	2	---	---	---	---	
TFDP2	7029	broad.mit.edu	37	3	141697190	141697192	+	Intron	DEL	AAC	-	-	rs147759999	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141697190_141697192delAAC	uc003eun.3	-						TFDP2_uc003euk.3_Intron|TFDP2_uc010hur.2_Intron|TFDP2_uc003eul.3_Intron|TFDP2_uc011bnf.1_Intron|TFDP2_uc011bng.1_Intron|TFDP2_uc003eum.3_Intron	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization						cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						ccgcctaaaaaacaaaaaaaaaG	0.158													6	4	---	---	---	---	
PFN2	5217	broad.mit.edu	37	3	149684634	149684634	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149684634delA	uc003ext.1	-						PFN2_uc003exs.1_Intron|PFN2_uc003exu.1_Intron|PFN2_uc011bnu.1_Intron	NM_053024	NP_444252	P35080	PROF2_HUMAN	profilin 2 isoform a						actin cytoskeleton organization|regulation of actin polymerization or depolymerization	actin cytoskeleton|cytoplasm	actin binding|phosphatidylinositol-4,5-bisphosphate binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CTAGCTACAGAAAAAAAAAAA	0.308													5	3	---	---	---	---	
OPA1	4976	broad.mit.edu	37	3	193361754	193361754	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193361754delT	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		CATTTTTTTATTTTTTTCAGA	0.343													95	14	---	---	---	---	
NFXL1	152518	broad.mit.edu	37	4	47888020	47888020	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47888020delA	uc010igh.2	-						NFXL1_uc003gxp.2_Intron|NFXL1_uc003gxq.3_Intron|NFXL1_uc010igi.2_Intron	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CAACTGCCTGAAAAAAAAGTC	0.294													262	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49156524	49156524	+	IGR	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49156524delA								CWH43 (92431 upstream) : None (None downstream)																							attcgggttgattccattcca	0.000													133	7	---	---	---	---	
ENAM	10117	broad.mit.edu	37	4	71509665	71509666	+	Frame_Shift_Ins	INS	-	AG	AG			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71509665_71509666insAG	uc011caw.1	+	9	2803_2804	c.2522_2523insAG	c.(2521-2523)CCAfs	p.P841fs		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	841					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			ATGAATTCTCCAGAGAGAGAAC	0.421													149	13	---	---	---	---	
SNCA	6622	broad.mit.edu	37	4	90650173	90650173	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90650173delT	uc003hsq.2	-						SNCA_uc010ikt.2_Intron|SNCA_uc003hso.2_Intron|SNCA_uc003hsp.2_Intron|SNCA_uc003hsr.2_Intron|uc011cdr.1_5'Flank	NM_001146054	NP_001139526	P37840	SYUA_HUMAN	alpha-synuclein isoform NACP140						activation of caspase activity|anti-apoptosis|negative regulation of dopamine uptake|negative regulation of exocytosis|negative regulation of histone acetylation|negative regulation of microtubule polymerization|negative regulation of monooxygenase activity|negative regulation of norepinephrine uptake|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of serotonin uptake|negative regulation of thrombin receptor signaling pathway|negative regulation of transporter activity|positive regulation of endocytosis|positive regulation of inositol phosphate biosynthetic process|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein serine/threonine kinase activity|positive regulation of receptor recycling|positive regulation of release of sequestered calcium ion into cytosol|receptor internalization|regulation of phospholipase activity|response to interferon-gamma|response to interleukin-1|response to iron(II) ion|response to lipopolysaccharide|response to magnesium ion|synaptic vesicle endocytosis	actin cytoskeleton|axon|cell cortex|cell junction|cytosol|fibril|growth cone|nucleus|synapse	alpha-tubulin binding|calcium ion binding|caspase inhibitor activity|dynein binding|ferrous iron binding|histone binding|Hsp70 protein binding|kinesin binding|magnesium ion binding|phosphoprotein binding|tau protein binding|zinc ion binding				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)	Melatonin(DB01065)	cctcctcctctttttttttaa	0.085													7	4	---	---	---	---	
TET2	54790	broad.mit.edu	37	4	106158589	106158589	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106158589delT	uc003hxk.2	+						TET2_uc011cez.1_Intron|TET2_uc003hxj.2_Intron|TET2_uc010ilp.1_Intron|TET2_uc003hxi.1_Frame_Shift_Del_p.F1164fs	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a						cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		ATTTTCCTTCTTTTTTTAAAT	0.368			Mis N|F		MDS								118	13	---	---	---	---	
SLC7A11	23657	broad.mit.edu	37	4	139103262	139103262	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139103262delA	uc011chb.1	-							NM_014331	NP_055146	Q9UPY5	XCT_HUMAN	solute carrier family 7, (cationic amino acid						blood coagulation|cellular nitrogen compound metabolic process|leukocyte migration|response to toxin	integral to membrane|plasma membrane	cystine:glutamate antiporter activity|protein binding			skin(1)	1	all_hematologic(180;0.166)				L-Cystine(DB00138)|L-Glutamic Acid(DB00142)|Sulfasalazine(DB00795)	CCAAAGCATCAAAAAAAATAG	0.398													4	3	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140750130	140750133	+	Intron	DEL	AGGA	-	-	rs35172258		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140750130_140750133delAGGA	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					ctgtTGAAAGaggaaggaaggaag	0.034													4	3	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32000586	32000597	+	Intron	DEL	TTTGTTTTTGTT	-	-	rs71863988		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000586_32000597delTTTGTTTTTGTT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCTTAAGAAGtttgtttttgtttttgtttttg	0.222													5	3	---	---	---	---	
OXCT1	5019	broad.mit.edu	37	5	41840641	41840641	+	Intron	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41840641delG	uc003jmn.2	-							NM_000436	NP_000427	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1 precursor						cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			ovary(2)|large_intestine(1)	3					Succinic acid(DB00139)	ATAAGAAAGTGGGGGGGAAAA	0.388													176	20	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	90159720	90159722	+	Intron	DEL	TTC	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90159720_90159722delTTC	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjw.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATGTTTGTGTTTCTTCTTCTTTG	0.394													63	12	---	---	---	---	
YTHDC2	64848	broad.mit.edu	37	5	112889603	112889603	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112889603delT	uc003kqn.2	+						YTHDC2_uc010jce.1_Intron|YTHDC2_uc010jcf.1_Intron	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		ATTTTTTCTGTTTTTTTATTA	0.294													131	11	---	---	---	---	
CCNG1	900	broad.mit.edu	37	5	162866031	162866031	+	Intron	DEL	A	-	-	rs72299838		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162866031delA	uc003lzb.2	+						CCNG1_uc011dek.1_Intron|CCNG1_uc011del.1_Intron|CCNG1_uc003lzc.2_Intron	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1						cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		actccttctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170261080	170261082	+	IGR	DEL	CAT	-	-	rs111380690		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170261080_170261082delCAT								GABRP (20032 upstream) : RANBP17 (27940 downstream)																							ccaccatcaccatcaccaccacc	0.118													6	4	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170341157	170341158	+	Intron	INS	-	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170341157_170341158insT	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTAGAAAATAATTTTTTTTCCC	0.347			T	TRD@	ALL								99	10	---	---	---	---	
BNIP1	662	broad.mit.edu	37	5	172587243	172587243	+	Intron	DEL	T	-	-	rs10693152		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172587243delT	uc003mcj.3	+						BNIP1_uc003mci.3_Intron|BNIP1_uc003mck.3_Intron|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1						anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCTAtttctcttttttttttt	0.244													5	4	---	---	---	---	
CPEB4	80315	broad.mit.edu	37	5	173317066	173317067	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173317066_173317067delAG	uc003mcs.3	+	1	1736_1737	c.330_331delAG	c.(328-333)ACAGAGfs	p.T110fs	CPEB4_uc010jju.1_Frame_Shift_Del_p.T110fs|CPEB4_uc010jjv.2_Frame_Shift_Del_p.T110fs|CPEB4_uc011dfg.1_Frame_Shift_Del_p.T110fs|CPEB4_uc003mct.3_5'Flank|CPEB4_uc003mcu.3_5'Flank	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	110_111							nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGCCTGAAACAGAGAAGGCAAA	0.446													124	8	---	---	---	---	
SIRT5	23408	broad.mit.edu	37	6	13584591	13584591	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13584591delT	uc003nay.2	+						SIRT5_uc003naw.2_Intron|SIRT5_uc003nax.2_Intron|SIRT5_uc011dit.1_Intron	NM_012241	NP_036373	Q9NXA8	SIRT5_HUMAN	sirtuin 5 isoform 1						chromatin silencing|protein ADP-ribosylation|protein deacetylation	mitochondrial intermembrane space|mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|zinc ion binding			skin(2)|upper_aerodigestive_tract(1)	3	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.176)		Suramin(DB04786)	TCATCttctcttttttttttt	0.204													2	4	---	---	---	---	
DTNBP1	84062	broad.mit.edu	37	6	15638038	15638038	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15638038delA	uc003nbm.2	-						DTNBP1_uc003nbl.2_Intron|DTNBP1_uc003nbn.2_Intron|DTNBP1_uc003nbo.2_Intron|DTNBP1_uc003nbp.2_Intron|DTNBP1_uc010jph.2_Intron	NM_032122	NP_115498	Q96EV8	DTBP1_HUMAN	dystrobrevin binding protein 1 isoform a						actin cytoskeleton reorganization|cellular membrane organization|neuron projection morphogenesis|post-Golgi vesicle-mediated transport|regulation of dopamine receptor signaling pathway	axon part|BLOC-1 complex|cell junction|dendritic spine|endoplasmic reticulum membrane|endosome membrane|growth cone|melanosome membrane|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|synaptic vesicle membrane|synaptosome	identical protein binding				0	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)			CCTCATACCTAAAAAAAAGCA	0.284									Hermansky-Pudlak_syndrome				186	11	---	---	---	---	
MRPS18B	28973	broad.mit.edu	37	6	30585855	30585855	+	Intron	DEL	C	-	-	rs3214308		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30585855delC	uc003nqo.2	+						PPP1R10_uc003nqn.1_5'Flank|PPP1R10_uc010jsc.1_5'Flank|MRPS18B_uc011dml.1_Intron|MRPS18B_uc010jsd.1_Intron	NM_014046	NP_054765	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B precursor						translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(1)	1						CTTCCTGCAACCCCCCCCCCA	0.512													4	4	---	---	---	---	
EHMT2	10919	broad.mit.edu	37	6	31857166	31857166	+	Intron	DEL	C	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31857166delC	uc003nxz.1	-						EHMT2_uc003nxy.1_Intron|EHMT2_uc011don.1_Intron|EHMT2_uc003nya.1_Intron	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2						DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						CCCCCAGGGGCCCCCCCAACA	0.592													117	7	---	---	---	---	
PTK7	5754	broad.mit.edu	37	6	43109863	43109863	+	Intron	DEL	C	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43109863delC	uc003oub.1	+						PTK7_uc003ouc.1_Intron|PTK7_uc003oud.1_Intron|PTK7_uc003oue.1_Intron|PTK7_uc003ouf.1_Intron|PTK7_uc003oug.1_Intron|PTK7_uc011dve.1_Intron|PTK7_uc010jyj.1_Intron	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a						actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			TCTCCTGCAGCCCCCCTCCCT	0.637													99	14	---	---	---	---	
GSTA4	2941	broad.mit.edu	37	6	52859205	52859206	+	5'Flank	INS	-	A	A	rs112533503		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52859205_52859206insA	uc003pbc.2	-						GSTA4_uc003pbd.2_5'Flank|GSTA4_uc003pbe.2_5'Flank|GSTA4_uc003pbf.2_Intron|GSTA4_uc003pbg.2_5'Flank	NM_001512	NP_001503	O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4						glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity				0	Lung NSC(77;0.103)				Glutathione(DB00143)	CCTCACTCAAGAAAAAAAAACC	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58778432	58778451	+	IGR	DEL	AAAAGGGAATATCTTTCCAT	-	-	rs4428530		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58778432_58778451delAAAAGGGAATATCTTTCCAT								GUSBL2 (490708 upstream) : None (None downstream)																							cctatggtagaaaagggaatatctttccataaaaggtaga	0.000													476	9	---	---	---	---	
PHF3	23469	broad.mit.edu	37	6	64415953	64415953	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64415953delA	uc003pep.1	+	11	3428	c.3402delA	c.(3400-3402)CCAfs	p.P1134fs	PHF3_uc010kah.1_Frame_Shift_Del_p.P948fs|PHF3_uc003pen.2_Frame_Shift_Del_p.P1046fs|PHF3_uc011dxs.1_Frame_Shift_Del_p.P403fs	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	1134					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			ATCTTTCTCCAAAAAAAGTAA	0.358													93	12	---	---	---	---	
LAMA4	3910	broad.mit.edu	37	6	112462354	112462354	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112462354delT	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TAGAAATGACTTTTTTTTTTC	0.313													8	5	---	---	---	---	
LAMA2	3908	broad.mit.edu	37	6	129573211	129573211	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129573211delT	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TTTTTATTTCTTTTTTTTCCC	0.338													59	7	---	---	---	---	
WTAP	9589	broad.mit.edu	37	6	160159864	160159864	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160159864delA	uc003qsl.2	+						WTAP_uc010kjx.2_Intron|WTAP_uc003qsk.2_Intron|WTAP_uc003qsm.1_Intron|WTAP_uc003qsn.2_Intron	NM_004906	NP_004897	Q15007	FL2D_HUMAN	Wilms' tumour 1-associating protein isoform 1						cell cycle|mRNA processing|RNA splicing	nuclear membrane|nucleolus					0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		AGTTTACCTTAAAAAAAAAAA	0.179													4	2	---	---	---	---	
SLC22A2	6582	broad.mit.edu	37	6	160663649	160663650	+	Intron	INS	-	AC	AC			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160663649_160663650insAC	uc003qtf.2	-						SLC22A2_uc003qte.1_Intron	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2						body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		ttttaaaaaagatatttttttt	0.158													4	3	---	---	---	---	
DPY19L2P1	554236	broad.mit.edu	37	7	35218857	35218857	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35218857delA	uc003teq.1	-											RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						TTTTTTTCTGAAAAAAAAAGT	0.244													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61968770	61968770	+	IGR	DEL	G	-	-	rs61713499		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61968770delG								None (None upstream) : LOC643955 (782902 downstream)																							ttgaaacactgtttttgcgga	0.000													241	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61968939	61968940	+	IGR	DEL	CT	-	-	rs71274614		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61968939_61968940delCT								None (None upstream) : LOC643955 (782732 downstream)																							tttggaaacactctgtttgtaa	0.000													1547	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65268578	65268578	+	IGR	DEL	A	-	-	rs1810216		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65268578delA								CCT6P1 (39917 upstream) : VKORC1L1 (69679 downstream)																							CTTCttttttaaaaaaaaaaa	0.363													6	3	---	---	---	---	
SRCRB4D	136853	broad.mit.edu	37	7	76029886	76029886	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76029886delG	uc003ufb.2	-	4	540	c.192delC	c.(190-192)CCCfs	p.P64fs	ZP3_uc003ufc.3_Intron	NM_080744	NP_542782	Q8WTU2	SRB4D_HUMAN	scavenger receptor cysteine rich domain	64	SRCR 1.					extracellular region|membrane	scavenger receptor activity			pancreas(1)	1						GGCAGCGGCTGGGGCCCCCCA	0.652													6	4	---	---	---	---	
ZC3HC1	51530	broad.mit.edu	37	7	129679184	129679185	+	Intron	INS	-	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129679184_129679185insA	uc003vpi.2	-						ZC3HC1_uc003vph.2_Intron|ZC3HC1_uc010lma.2_Intron	NM_016478	NP_057562	Q86WB0	NIPA_HUMAN	zinc finger, C3HC type 1						cell division|mitosis	nucleus	protein kinase binding|zinc ion binding				0	Melanoma(18;0.0435)					aactccatctcaaaaaaaaaaa	0.119													10	5	---	---	---	---	
ARHGEF10	9639	broad.mit.edu	37	8	1833755	1833755	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1833755delT	uc003wpr.2	+						ARHGEF10_uc003wpq.1_Intron|ARHGEF10_uc003wps.2_Intron|ARHGEF10_uc003wpt.2_Intron|ARHGEF10_uc003wpv.2_Intron|ARHGEF10_uc010lre.2_Intron	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10						centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GCATTTTGACTTTTTTTTTAA	0.338													48	10	---	---	---	---	
ASAH1	427	broad.mit.edu	37	8	17920980	17920980	+	Intron	DEL	T	-	-	rs71894904		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17920980delT	uc003wyl.2	-						ASAH1_uc010ltb.1_Intron|ASAH1_uc003wym.2_Intron|ASAH1_uc003wyn.2_Intron|ASAH1_uc003wyo.2_Intron	NM_177924	NP_808592	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		acctggctacttttttttttt	0.000													8	4	---	---	---	---	
POLB	5423	broad.mit.edu	37	8	42228944	42228944	+	Intron	DEL	T	-	-	rs79893094		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42228944delT	uc003xoz.1	+						POLB_uc003xpa.1_Intron|POLB_uc011lcs.1_Intron	NM_002690	NP_002681	P06746	DPOLB_HUMAN	DNA-directed DNA polymerase beta						DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding			ovary(1)|breast(1)	2	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	tccgCCGGTCTTTTTTTTTTT	0.179								DNA_polymerases_(catalytic_subunits)					7	4	---	---	---	---	
C8orf34	116328	broad.mit.edu	37	8	69699867	69699867	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69699867delA	uc010lyz.2	+						C8orf34_uc003xyb.2_Intron	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			CAACTTCTGTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	16908609	16908609	+	IGR	DEL	G	-	-	rs7848057	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16908609delG								BNC2 (37823 upstream) : CNTLN (226429 downstream)																							aaggaaggaaggGACTTAATA	0.134													4	2	---	---	---	---	
MOBKL2B	79817	broad.mit.edu	37	9	27524103	27524103	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27524103delA	uc003zqn.2	-						IFNK_uc003zqp.2_5'Flank	NM_024761	NP_079037	Q86TA1	MOL2B_HUMAN	MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)		TTTTTCAGGGAAAAAAAAAAG	0.398													3	3	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69420646	69420647	+	Intron	INS	-	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69420646_69420647insT	uc004afn.2	+							NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						tgcccggctaattttttgtatt	0.000													9	4	---	---	---	---	
NTRK2	4915	broad.mit.edu	37	9	87518660	87518661	+	Intron	DEL	TC	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87518660_87518661delTC	uc004aoa.1	+						NTRK2_uc004any.1_Intron|NTRK2_uc004anz.1_Intron	NM_001018064	NP_001018074	Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16						ctccctcccttcTCTCTCTCTC	0.228										TSP Lung(25;0.17)			4	2	---	---	---	---	
ISCA1	81689	broad.mit.edu	37	9	88889345	88889345	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88889345delA	uc004aop.2	-						GOLM1_uc010mqd.1_Intron	NM_030940	NP_112202	Q9BUE6	ISCA1_HUMAN	HESB like domain containing 2 precursor						iron-sulfur cluster assembly	mitochondrion	iron-sulfur cluster binding|metal ion binding|structural molecule activity				0				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		CTCTTTATTTAAAAAAAAAAT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90747470	90747470	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90747470delG	uc011lti.1	-	4	511	c.482delC	c.(481-483)CCGfs	p.P161fs						SubName: Full=cDNA FLJ59639;																		TCGAGGATCCGGGGAAGCTAA	0.612													139	10	---	---	---	---	
IKBKAP	8518	broad.mit.edu	37	9	111665955	111665955	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111665955delA	uc004bdm.3	-						IKBKAP_uc004bdl.2_Intron|IKBKAP_uc011lwc.1_Intron|IKBKAP_uc010mtq.2_Intron	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene						immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						ATGAACTGACAAAAAAAAGGA	0.388													158	9	---	---	---	---	
RABGAP1	23637	broad.mit.edu	37	9	125860247	125860247	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125860247delT	uc011lzh.1	+						RABGAP1_uc004bnl.3_Intron|RABGAP1_uc011lzj.1_Intron	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						TTCCAAAGACTTTTTTTTTCC	0.453													2	4	---	---	---	---	
SLC25A25	114789	broad.mit.edu	37	9	130866086	130866087	+	Frame_Shift_Ins	INS	-	C	C			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130866086_130866087insC	uc004bte.2	+	5	642_643	c.613_614insC	c.(613-615)GCCfs	p.A205fs	SLC25A25_uc004btb.2_Frame_Shift_Ins_p.A239fs|SLC25A25_uc004btc.2_Frame_Shift_Ins_p.A225fs|SLC25A25_uc004btd.2_Frame_Shift_Ins_p.A237fs|SLC25A25_uc004btf.2_Frame_Shift_Ins_p.A102fs	NM_052901	NP_443133	Q6KCM7	SCMC2_HUMAN	solute carrier family 25, member 25 isoform a	205	Solcar 1.|Helical; Name=1; (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding				0						AACCTGCACGGCCCCCCTGGAC	0.639													59	8	---	---	---	---	
TTF1	7270	broad.mit.edu	37	9	135276754	135276754	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135276754delA	uc004cbl.2	-						TTF1_uc011mcp.1_Intron|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase						negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		aattaaaaataaaaaaaaGTC	0.214													34	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383716	42383717	+	IGR	INS	-	G	G	rs145968937		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383716_42383717insG								None (None upstream) : LOC441666 (443598 downstream)																							tggaatcaaaataaccatcatc	0.000													104	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385340	42385362	+	IGR	DEL	GAATTATCTAATGCAATCGAATA	-	-	rs66510027		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385340_42385362delGAATTATCTAATGCAATCGAATA								None (None upstream) : LOC441666 (441953 downstream)																							gaatcgaagggaattatctaatgcaatcgaatagaattatcga	0.000													348	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385465	42385474	+	IGR	DEL	GAATGGAATA	-	-	rs67030057		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385465_42385474delGAATGGAATA								None (None upstream) : LOC441666 (441841 downstream)																							aatcatcattgaatggaatagaatggaatc	0.000													156	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42396712	42396712	+	IGR	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42396712delT								None (None upstream) : LOC441666 (430603 downstream)																							ttgaacggaatcaaatggaat	0.000													273	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42400586	42400586	+	IGR	DEL	A	-	-	rs74207080		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42400586delA								None (None upstream) : LOC441666 (426729 downstream)																							atcttcgtataaaaactagac	0.000													1057	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42597159	42597159	+	IGR	DEL	T	-	-	rs149908177		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42597159delT								None (None upstream) : LOC441666 (230156 downstream)																							ttgaacggaatcgaatggaat	0.035													1380	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42599640	42599640	+	IGR	DEL	A	-	-	rs145203825		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42599640delA								None (None upstream) : LOC441666 (227675 downstream)																							aatggaaatgaaaggagtcat	0.000													2284	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42600053	42600053	+	IGR	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42600053delT								None (None upstream) : LOC441666 (227262 downstream)																							ttgaacggaattgaatggaat	0.000													623	17	---	---	---	---	
ANKRD22	118932	broad.mit.edu	37	10	90582786	90582786	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90582786delA	uc001kfj.3	-							NM_144590	NP_653191	Q5VYY1	ANR22_HUMAN	ankyrin repeat domain 22												0		Colorectal(252;0.0163)		Colorectal(12;6.29e-05)|COAD - Colon adenocarcinoma(12;7.69e-05)		CTGAGGGGGGAAAAATATACA	0.418													162	10	---	---	---	---	
SLIT1	6585	broad.mit.edu	37	10	98781316	98781317	+	Intron	DEL	TT	-	-	rs11303965		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98781316_98781317delTT	uc001kmw.2	-							NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor						axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		tcagtgctgctttttttttttt	0.178													5	4	---	---	---	---	
CHUK	1147	broad.mit.edu	37	10	101961753	101961754	+	Intron	INS	-	A	A			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101961753_101961754insA	uc001kqp.2	-							NM_001278	NP_001269	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase						I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)		GGAATGACATGAAAAATGCTCT	0.267													38	7	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114925494	114925494	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114925494delC	uc001lae.3	+	14	2079	c.1572delC	c.(1570-1572)GACfs	p.D524fs	TCF7L2_uc001lac.3_Frame_Shift_Del_p.D518fs|TCF7L2_uc010qrk.1_3'UTR|TCF7L2_uc010qrl.1_Frame_Shift_Del_p.D501fs|TCF7L2_uc010qrm.1_3'UTR|TCF7L2_uc010qrn.1_3'UTR|TCF7L2_uc001lad.3_3'UTR|TCF7L2_uc001lag.3_3'UTR|TCF7L2_uc001laf.3_Frame_Shift_Del_p.D501fs|TCF7L2_uc010qro.1_3'UTR|TCF7L2_uc001lah.2_3'UTR|TCF7L2_uc010qrp.1_3'UTR|TCF7L2_uc010qrq.1_3'UTR|TCF7L2_uc010qrr.1_Frame_Shift_Del_p.D456fs|TCF7L2_uc010qrs.1_Frame_Shift_Del_p.D412fs|TCF7L2_uc010qrt.1_Frame_Shift_Del_p.D412fs|TCF7L2_uc010qru.1_3'UTR|TCF7L2_uc010qrv.1_3'UTR|TCF7L2_uc010qrw.1_3'UTR|TCF7L2_uc010qrx.1_3'UTR	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1	541					anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TGAAGCCCGACCCCCTGGCCC	0.697													124	20	---	---	---	---	
POLR2L	5441	broad.mit.edu	37	11	840579	840579	+	Intron	DEL	C	-	-	rs34627090		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840579delC	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951	P62875	RPAB5_HUMAN	DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGCCTCACCCCCCCCGCC	0.607													7	4	---	---	---	---	
TRIM3	10612	broad.mit.edu	37	11	6478302	6478302	+	Intron	DEL	G	-	-	rs61876784		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6478302delG	uc001mdh.2	-						TRIM3_uc001mdi.2_Intron|TRIM3_uc010raj.1_Intron|TRIM3_uc009yfd.2_Intron|TRIM3_uc010rak.1_Intron|TRIM3_uc001mdj.2_Intron	NM_006458	NP_006449	O75382	TRIM3_HUMAN	tripartite motif-containing 3						nervous system development|protein transport	early endosome	protein C-terminus binding|zinc ion binding			central_nervous_system(2)|large_intestine(1)|ovary(1)|skin(1)	5		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GACTGGCACAGGGGGAGTCTC	0.567													107	17	---	---	---	---	
PARVA	55742	broad.mit.edu	37	11	12499254	12499255	+	Intron	INS	-	C	C	rs148790777	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12499254_12499255insC	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN	parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)		acatagtgagaccccatctcaa	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49056787	49056787	+	IGR	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49056787delT								OR4A47 (545515 upstream) : FOLH1 (111401 downstream)																							TTGATACCACTTTTTTTTTGC	0.308													33	7	---	---	---	---	
OSBP	5007	broad.mit.edu	37	11	59368180	59368180	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59368180delA	uc001noc.1	-						OSBP_uc009ymr.1_Intron	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein						lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CCCCCGTGCTAAAAAAAGAAA	0.408													123	28	---	---	---	---	
CORO1B	57175	broad.mit.edu	37	11	67207355	67207355	+	Intron	DEL	C	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67207355delC	uc001olj.1	-						PTPRCAP_uc001oli.1_5'Flank|CORO1B_uc009yrs.1_Intron|CORO1B_uc001olk.1_Intron|CORO1B_uc009yrt.1_Intron|CORO1B_uc009yru.1_Intron|CORO1B_uc001oll.1_Intron	NM_020441	NP_065174	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm	actin filament binding			large_intestine(1)|ovary(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			ACCCTCACCGCCCCCCCCACC	0.637													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115497786	115497786	+	IGR	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115497786delT								CADM1 (122545 upstream) : None (None downstream)																							ttccccctccttttttttttt	0.000													3	4	---	---	---	---	
BACE1	23621	broad.mit.edu	37	11	117161995	117161995	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117161995delT	uc001pqz.2	-						BACE1_uc001pqw.2_Intron|BACE1_uc001pqx.2_Intron|BACE1_uc001pqy.2_Intron|BACE1_uc010rxg.1_Intron|BACE1_uc010rxh.1_Intron|BACE1_uc009yzo.1_Intron|uc010rxi.1_5'Flank	NM_012104	NP_036236	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1 isoform A						beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding			ovary(1)	1	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		AGGGGAAGAGttttttttttt	0.239													4	2	---	---	---	---	
CLSTN3	9746	broad.mit.edu	37	12	7295315	7295316	+	Intron	DEL	TT	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7295315_7295316delTT	uc001qsr.2	+						CLSTN3_uc001qss.2_Intron	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						tCttttttcctttttttttttt	0.030											OREG0021650	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
GSG1	83445	broad.mit.edu	37	12	13241220	13241221	+	Intron	DEL	TG	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13241220_13241221delTG	uc001rbn.2	-						GSG1_uc001rbj.2_Intron|GSG1_uc001rbk.2_Intron|GSG1_uc001rbl.2_Intron|GSG1_uc001rbm.2_Intron|GSG1_uc001rbo.2_Intron|GSG1_uc001rbp.2_Intron|GSG1_uc001rbq.1_Intron	NM_001080555	NP_001074024	Q2KHT4	GSG1_HUMAN	germ cell associated 1 isoform 4							endoplasmic reticulum membrane|integral to membrane					0		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		CTTGACTGACTGTAAATACTGT	0.381													3	3	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48253630	48253649	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCT	-	-	rs60761635		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48253630_48253649delTTCCTTCCTTCCTTCCTTCT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	tttcccttccttccttccttccttccttctttccttcctt	0.036													4	2	---	---	---	---	
GALNT6	11226	broad.mit.edu	37	12	51773184	51773184	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51773184delG	uc001ryk.2	-	2	607	c.382delC	c.(382-384)CTGfs	p.L128fs	GALNT6_uc009zma.1_RNA|GALNT6_uc001ryl.1_Frame_Shift_Del_p.L128fs|GALNT6_uc010snh.1_Frame_Shift_Del_p.L128fs	NM_007210	NP_009141	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	128	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						TGGGTCTCCAGGGGGGTCCAC	0.582													169	15	---	---	---	---	
AVPR1A	552	broad.mit.edu	37	12	63541343	63541343	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63541343delA	uc001sro.1	-	2	3027	c.1053delT	c.(1051-1053)TTTfs	p.F351fs		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	351	Helical; Name=7; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	GATGGCCACTAAAAAACATGT	0.398													220	8	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78224950	78224957	+	5'Flank	DEL	AGAGAGAG	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224950_78224957delAGAGAGAG	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						agagagagacagagagagagagagagag	0.226										HNSCC(70;0.22)			4	5	---	---	---	---	
HAL	3034	broad.mit.edu	37	12	96370173	96370173	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96370173delA	uc001tem.1	-						HAL_uc009zti.1_Intron|HAL_uc010suw.1_Intron|HAL_uc010sux.1_Intron	NM_002108	NP_002099	P42357	HUTH_HUMAN	histidine ammonia-lyase						biosynthetic process|histidine catabolic process	cytosol	histidine ammonia-lyase activity			ovary(2)|skin(1)	3					L-Histidine(DB00117)	TGTAACAATTAAAAATTAAGA	0.468													151	19	---	---	---	---	
CHST11	50515	broad.mit.edu	37	12	105150501	105150501	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105150501delT	uc001tkx.1	+						CHST11_uc001tky.2_Intron|uc001tkz.2_5'Flank	NM_018413	NP_060883	Q9NPF2	CHSTB_HUMAN	carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0						aattttttagtttttttagag	0.000													4	2	---	---	---	---	
VPS33A	65082	broad.mit.edu	37	12	122720397	122720397	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122720397delC	uc001ucd.2	-	11	1489	c.1376delG	c.(1375-1377)GGCfs	p.G459fs	VPS33A_uc001ucc.2_RNA	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33A	459					lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		ATTGTTTCTGCCCCCCGTCTG	0.498													347	7	---	---	---	---	
CCDC92	80212	broad.mit.edu	37	12	124422263	124422263	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124422263delT	uc001ufw.1	-	5	485	c.338delA	c.(337-339)AACfs	p.N113fs	CCDC92_uc001ufv.1_Frame_Shift_Del_p.N96fs|CCDC92_uc001ufx.1_Frame_Shift_Del_p.N113fs|CCDC92_uc001ufy.1_Frame_Shift_Del_p.N96fs	NM_025140	NP_079416	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92	113	Potential.										0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		GATCATCGCGTTTTTCTGCTC	0.463													378	37	---	---	---	---	
FAM48A	55578	broad.mit.edu	37	13	37600289	37600289	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37600289delA	uc001uwg.2	-						FAM48A_uc010abt.2_Intron|FAM48A_uc001uwh.2_Intron|FAM48A_uc001uwi.2_Intron|FAM48A_uc001uwj.2_Intron|FAM48A_uc001uwk.2_Intron|FAM48A_uc010tes.1_Intron|FAM48A_uc001uwl.1_Intron|FAM48A_uc001uwe.2_5'Flank|FAM48A_uc001uwf.2_Intron	NM_001014286	NP_001014308	Q8NEM7	FA48A_HUMAN	family with sequence similarity 48, member A						autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)		TATAAGGGTGAAAAATTTTTC	0.274													85	7	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96600473	96600474	+	Intron	DEL	AC	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96600473_96600474delAC	uc001vmt.2	-							NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						TCTAAGGAATacacacacacac	0.213													4	2	---	---	---	---	
STK24	8428	broad.mit.edu	37	13	99116095	99116095	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99116095delA	uc001vnm.1	-						STK24_uc001vnn.1_Intron|STK24_uc010tim.1_Intron	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24 isoform a						cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GGGTCTCTGGAAAAACACACC	0.438													171	8	---	---	---	---	
ZBTB1	22890	broad.mit.edu	37	14	64989787	64989787	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64989787delA	uc001xhh.3	+	4	1996	c.1565delA	c.(1564-1566)CAAfs	p.Q522fs	ZBTB1_uc010aqg.2_Frame_Shift_Del_p.Q522fs|ZBTB1_uc001xhi.2_Frame_Shift_Del_p.Q522fs	NM_001123329	NP_001116801	Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1 isoform	522					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		AACAGTATCCAAAAAAAGCAG	0.378													298	39	---	---	---	---	
ERH	2079	broad.mit.edu	37	14	69847046	69847046	+	3'UTR	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69847046delA	uc001xlc.2	-	4						NM_004450	NP_004441	P84090	ERH_HUMAN	enhancer of rudimentary homolog						cell cycle|pyrimidine nucleoside metabolic process	midbody	protein binding				0				all cancers(60;0.00365)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0507)		ATGTTTAAGTAAAAAAAAAAA	0.333													4	2	---	---	---	---	
ATG2B	55102	broad.mit.edu	37	14	96783613	96783613	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96783613delA	uc001yfi.2	-	20	3444	c.3079delT	c.(3079-3081)TCCfs	p.S1027fs		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	1027										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TCAACAGTGGAAAAATACTGC	0.338													139	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22440159	22440159	+	3'UTR	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22440159delT	uc001yug.2	-	1										full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																		TCTGTTTCTCTTTTTTTTTTG	0.239													4	2	---	---	---	---	
CYFIP1	23191	broad.mit.edu	37	15	22928530	22928530	+	Intron	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22928530delG	uc001yus.2	+						CYFIP1_uc001yut.2_Intron|CYFIP1_uc010aya.1_Intron	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CAAATAATCTGGGGGGGGTGT	0.488													99	8	---	---	---	---	
SNRPN	6638	broad.mit.edu	37	15	25223444	25223444	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25223444delC	uc001ywp.1	+	12	1554	c.664delC	c.(664-666)CCCfs	p.P222fs	SNRPN_uc001ywq.1_Frame_Shift_Del_p.P222fs|SNRPN_uc001ywr.1_Frame_Shift_Del_p.P222fs|SNRPN_uc001yws.1_Frame_Shift_Del_p.P222fs|SNRPN_uc001ywt.1_Frame_Shift_Del_p.P222fs|SNRPN_uc001ywv.1_Frame_Shift_Del_p.P225fs|SNRPN_uc001yww.1_Frame_Shift_Del_p.P222fs|SNRPN_uc001ywx.1_Frame_Shift_Del_p.P222fs|SNRPN_uc001ywz.1_RNA|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	222	Repeat-rich region.|				RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		GGGAATGAGACCCCCTCCACC	0.552									Prader-Willi_syndrome				292	19	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28388214	28388214	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28388214delA	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TAAAAAAACTAAAAAAAAAAA	0.333													9	4	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30020390	30020390	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30020390delT	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CATACTTCCCTTTTTTTTTTT	0.164													6	3	---	---	---	---	
ANKDD1A	348094	broad.mit.edu	37	15	65213950	65213951	+	Intron	INS	-	A	A	rs112295552		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65213950_65213951insA	uc002aoa.2	+						ANKDD1A_uc002anx.1_Intron|ANKDD1A_uc002any.2_Intron|ANKDD1A_uc002anz.2_Intron|ANKDD1A_uc002aob.2_Intron|ANKDD1A_uc002aoc.2_5'Flank|ANKDD1A_uc010bha.2_5'Flank	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1						AGCCTCTATTTAAAAAAAAAAA	0.233													4	2	---	---	---	---	
IDH3A	3419	broad.mit.edu	37	15	78455875	78455875	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78455875delA	uc002bdd.2	+	7	665	c.638delA	c.(637-639)CAAfs	p.Q213fs	IDH3A_uc010umt.1_Frame_Shift_Del_p.Q178fs|IDH3A_uc010umu.1_Frame_Shift_Del_p.Q104fs|IDH3A_uc002bde.2_Frame_Shift_Del_p.Q163fs|IDH3A_uc010umv.1_Frame_Shift_Del_p.Q163fs|IDH3A_uc002bdf.2_Frame_Shift_Del_p.Q64fs|IDH3A_uc002bdg.2_Frame_Shift_Del_p.Q126fs	NM_005530	NP_005521	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	213					carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	CTTTTTCTACAAAAATGCAGG	0.303													174	12	---	---	---	---	
UNC45A	55898	broad.mit.edu	37	15	91486677	91486677	+	Intron	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91486677delG	uc002bqg.2	+						UNC45A_uc002bqd.2_Intron	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform						cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			aaaaaaaaaagaaagaaaaGT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96985640	96985641	+	IGR	INS	-	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96985640_96985641insT								NR2F2 (102150 upstream) : SPATA8 (341038 downstream)																							TATTTGCCAAATTTTTTTGTAA	0.287													4	2	---	---	---	---	
SRRM2	23524	broad.mit.edu	37	16	2816168	2816168	+	Frame_Shift_Del	DEL	C	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2816168delC	uc002crk.2	+	11	6188	c.5639delC	c.(5638-5640)ACCfs	p.T1880fs	SRRM2_uc002crj.1_Frame_Shift_Del_p.T1784fs|SRRM2_uc002crl.1_Frame_Shift_Del_p.T1880fs|SRRM2_uc010bsu.1_Frame_Shift_Del_p.T1784fs	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1880	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						AGGTCCAGAACCCCCCTGATA	0.597													112	7	---	---	---	---	
LOC641298	641298	broad.mit.edu	37	16	22491541	22491542	+	Intron	INS	-	T	T			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22491541_22491542insT	uc010bxf.2	+						LOC641298_uc002dkt.1_5'Flank	NR_027154				Homo sapiens cDNA FLJ54878 complete cds, highly similar to Serine/threonine-protein kinase SMG1 (EC 2.7.11.1).												0						ttttgttgttgttttttttttA	0.257													6	4	---	---	---	---	
PHKB	5257	broad.mit.edu	37	16	47730282	47730282	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47730282delT	uc002eev.3	+						PHKB_uc002eeu.3_Intron|PHKB_uc002eew.3_Intron	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TGTGGAGTTATTTTTTTCAGC	0.343													95	12	---	---	---	---	
TOP3A	7156	broad.mit.edu	37	17	18211538	18211556	+	Intron	DEL	AAAAAAAAAAAAAAAAAAA	-	-	rs67569771		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18211538_18211556delAAAAAAAAAAAAAAAAAAA	uc002gsx.1	-						TOP3A_uc002gsw.1_5'Flank|TOP3A_uc010vxs.1_Intron|TOP3A_uc010cqa.1_Intron	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha						DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						tgtctccaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaa	0.132													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20744542	20744546	+	RNA	DEL	CGCAC	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20744542_20744546delCGCAC	uc010crb.1	+	1		c.202_206delCGCAC								Homo sapiens cDNA clone IMAGE:6269068, partial cds.																		CCTCCTCGGGCGCACCGCACCCGGG	0.722													33	7	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21312637	21312638	+	Intron	INS	-	TGT	TGT	rs143247012		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21312637_21312638insTGT	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	aggagACTTGGTGTGGGGCATC	0.312										Prostate(3;0.18)			6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	26603003	26603003	+	IGR	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26603003delT								PPY2 (27689 upstream) : FLJ40504 (605 downstream)																							tttttttttctttttttttAA	0.328													5	3	---	---	---	---	
SARM1	23098	broad.mit.edu	37	17	26715786	26715786	+	Intron	DEL	T	-	-	rs34588381		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26715786delT	uc010crl.1	+						SARM1_uc010waj.1_Intron|SARM1_uc002hbe.1_Intron	NM_015077	NP_055892	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1						innate immune response	cytoplasm|intrinsic to membrane	binding|transmembrane receptor activity				0	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TTtctttttcttttttttttt	0.219													4	2	---	---	---	---	
RDM1	201299	broad.mit.edu	37	17	34247461	34247461	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34247461delT	uc002hkh.2	-						RDM1_uc010cty.2_Intron|RDM1_uc010ctz.2_Intron|RDM1_uc010cua.2_Intron|RDM1_uc002hkg.3_Intron|RDM1_uc010cub.2_Intron|RDM1_uc010cud.2_Intron|RDM1_uc010cuf.2_Intron|RDM1_uc010cue.2_Intron|RDM1_uc010cug.2_Intron|RDM1_uc010cuc.2_Intron	NM_145654	NP_663629	Q8NG50	RDM1_HUMAN	RAD52 motif 1 isoform 1						DNA recombination|DNA repair	Cajal body|cytoplasm|nucleolus|PML body	DNA binding|nucleotide binding|RNA binding			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		tctttctttcttttttttttt	0.139								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					5	3	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025820	64025821	+	Intron	INS	-	TAAA	TAAA	rs144628903	by1000genomes	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025820_64025821insTAAA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gaccctgtctctaaataaacaa	0.114													4	3	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78516455	78516456	+	5'Flank	INS	-	AA	AA	rs112348092		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78516455_78516456insAA	uc002jyt.1	+						RPTOR_uc002jys.2_5'Flank|RPTOR_uc010wuf.1_5'Flank|RPTOR_uc010wug.1_5'Flank|RPTOR_uc002jyr.1_5'Flank	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						GTAAAAACTGCAAAAAAAaaaa	0.228													4	3	---	---	---	---	
THOC4	10189	broad.mit.edu	37	17	79845851	79845851	+	3'UTR	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79845851delA	uc002kbu.2	-	6						NM_005782	NP_005773	Q86V81	THOC4_HUMAN	THO complex 4						intronless viral mRNA export from host nucleus|mRNA 3'-end processing|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear speck|transcription export complex	nucleotide binding|protein binding|RNA binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			aaaaaaaaagaaaaaaaaaaa	0.358													6	3	---	---	---	---	
ANAPC11	51529	broad.mit.edu	37	17	79852589	79852591	+	Intron	DEL	TTC	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79852589_79852591delTTC	uc002kbv.1	+						ANAPC11_uc002kbw.1_Intron|ANAPC11_uc002kbx.1_Intron|ANAPC11_uc002kby.1_Intron|ANAPC11_uc002kbz.1_Intron|ANAPC11_uc002kca.1_Intron|ANAPC11_uc002kcb.1_Intron|ANAPC11_uc002kcc.1_Intron|ANAPC11_uc010dih.1_Intron	NM_016476	NP_057560	Q9NYG5	APC11_HUMAN	APC11 anaphase promoting complex subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	zinc ion binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CAGtttcattttctttttttttt	0.266													4	2	---	---	---	---	
ALPK2	115701	broad.mit.edu	37	18	56246441	56246442	+	Frame_Shift_Ins	INS	-	C	C	rs12606191	byFrequency	TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56246441_56246442insC	uc002lhj.3	-	4	1780_1781	c.1566_1567insG	c.(1564-1569)GGAAAGfs	p.G522fs		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	522_523							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						CATAAGTCCTTTCCCCCCACTC	0.520											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	211	29	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59925008	59925008	+	Intron	DEL	A	-	-	rs79682519		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59925008delA	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				ttatgtcttcaaaaAAAAAAG	0.149													3	3	---	---	---	---	
CRB3	92359	broad.mit.edu	37	19	6464817	6464817	+	Intron	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6464817delG	uc002mey.2	+						CRB3_uc002mez.2_Intron|CRB3_uc002mfa.2_Intron	NM_139161	NP_631900	Q9BUF7	CRUM3_HUMAN	crumbs 3 isoform a precursor						protein localization in plasma membrane|tight junction assembly	apical plasma membrane|integral to membrane|tight junction	SH3 domain binding				0						TGAGAGCGCTGGGGGGGAGGG	0.677													5	3	---	---	---	---	
CALR3	125972	broad.mit.edu	37	19	16590240	16590241	+	Intron	INS	-	A	A	rs150170208		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16590240_16590241insA	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0						accaaaaatacaaaaaaaaaaa	0.000													6	3	---	---	---	---	
ZNF708	7562	broad.mit.edu	37	19	21493258	21493258	+	Intron	DEL	T	-	-	rs669560		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21493258delT	uc002npq.1	-						ZNF708_uc002npr.1_Intron|ZNF708_uc010ecs.1_Intron	NM_021269	NP_067092	P17019	ZN708_HUMAN	zinc finger protein 708						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6						aaaaaaaaaataataataaat	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27736391	27736392	+	IGR	DEL	CT	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27736391_27736392delCT								None (None upstream) : LOC148189 (545010 downstream)																							tttggaaacactctgtttgtaa	0.000													450	7	---	---	---	---	
GIPR	2696	broad.mit.edu	37	19	46175977	46175979	+	Intron	DEL	ATC	-	-	rs13306396		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46175977_46175979delATC	uc002pcu.1	+						GIPR_uc002pct.1_Intron|GIPR_uc010xxp.1_Intron|GIPR_uc010xxq.1_Intron|MIR642_hsa-mir-642|MI0003657_5'Flank	NM_000164	NP_000155	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor						generation of precursor metabolites and energy|response to nutrient	integral to membrane|plasma membrane				skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		ATAAGGGTTTatcatcatcatca	0.163													8	6	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56755967	56755971	+	Intron	DEL	CAAGG	-	-	rs57532903		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56755967_56755971delCAAGG	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tttgttgtcacaagggggaggacag	0.117													6	3	---	---	---	---	
ACSS2	55902	broad.mit.edu	37	20	33470426	33470426	+	Intron	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33470426delA	uc002xbd.2	+						ACSS2_uc002xbc.2_Intron|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Intron|ACSS2_uc002xbe.2_Intron|ACSS2_uc002xbf.2_Intron	NM_018677	NP_061147	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2						ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding				0					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ctccatctccaaaaaaaaaaa	0.214													4	5	---	---	---	---	
TUBB1	81027	broad.mit.edu	37	20	57598688	57598688	+	Intron	DEL	G	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57598688delG	uc002yak.2	+							NM_030773	NP_110400	Q9H4B7	TBB1_HUMAN	beta tubulin 1, class VI						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity			ovary(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)		Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	ACCAGGAGGAGGGGGGGATGC	0.512													210	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37388193	37388194	+	IGR	INS	-	AAA	AAA	rs112036301		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37388193_37388194insAAA								RUNX1 (31146 upstream) : SETD4 (18646 downstream)																							ATCTGAGAGAGAAAAAAAAAAA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756755	44756755	+	IGR	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756755delA								CRYAA (163842 upstream) : SIK1 (77643 downstream)																							caccatcaccaccaccatcac	0.000													8	4	---	---	---	---	
CECR1	51816	broad.mit.edu	37	22	17674249	17674264	+	Intron	DEL	AAAAAAAAAAAAAAAA	-	-	rs71200244		TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17674249_17674264delAAAAAAAAAAAAAAAA	uc002zmk.1	-						CECR1_uc010gqu.1_Intron|CECR1_uc011agi.1_Intron|CECR1_uc011agj.1_Intron|CECR1_uc002zmj.1_Intron	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1						adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				TAAAAACTGCaaaaaaaaaaaaaaaaaaaaaaaaaa	0.218													4	2	---	---	---	---	
P2RY8	286530	broad.mit.edu	37	X	1585603	1585604	+	Intron	INS	-	CCTC	CCTC			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1585603_1585604insCCTC	uc004cpz.2	-							NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCTGCTGTCtcctccctccct	0.356			T	CRLF2	B-ALL|Downs associated ALL								5	3	---	---	---	---	
ACE2	59272	broad.mit.edu	37	X	15618761	15618761	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15618761delT	uc004cxa.1	-						ACE2_uc004cxb.2_Intron	NM_021804	NP_068576	Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2 precursor						angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding			ovary(3)	3	Hepatocellular(33;0.183)				Moexipril(DB00691)	ACTCAGAGCATTTTTTTTGAT	0.393													43	10	---	---	---	---	
ZNF645	158506	broad.mit.edu	37	X	22292424	22292424	+	3'UTR	DEL	A	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22292424delA	uc004dai.1	+	1						NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645							intracellular	zinc ion binding			lung(1)|pancreas(1)	2						ACCTGATGGGAAAAAAACCTT	0.428													27	14	---	---	---	---	
USP9X	8239	broad.mit.edu	37	X	40999845	40999845	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40999845delT	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						TCAATAAGGCTTTTTTTTCGT	0.299													24	7	---	---	---	---	
AMOT	154796	broad.mit.edu	37	X	112035025	112035025	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112035025delT	uc004epr.2	-						AMOT_uc004eps.2_Intron	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1						actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1						ATTTTCTTACTTTTTTTTCCC	0.423													99	8	---	---	---	---	
WDR44	54521	broad.mit.edu	37	X	117527853	117527853	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117527853delT	uc004eqn.2	+						WDR44_uc004eqo.2_Intron|WDR44_uc011mtr.1_Intron|WDR44_uc010nqi.2_Intron	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN	WD repeat domain 44 protein							cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						gtcctgcatcttttttttgta	0.055													4	2	---	---	---	---	
IL13RA1	3597	broad.mit.edu	37	X	117925706	117925706	+	Intron	DEL	T	-	-			TCGA-CH-5769-01	TCGA-CH-5769-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117925706delT	uc004eqs.2	+						IL13RA1_uc004eqt.1_Intron	NM_001560	NP_001551	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1 precursor							interleukin-13 receptor complex	cytokine receptor activity				0						TGTGTATGTGTTTTTTTCCTC	0.408													88	12	---	---	---	---	
