Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P9	11223	broad.mit.edu	37	1	17085865	17085865	+	Missense_Mutation	SNP	A	G	G	rs1057378	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17085865A>G	uc010ock.1	-	8	956	c.956T>C	c.(955-957)CTC>CCC	p.L319P	CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						TGAGCCGTCGAGGTTCCAGCA	0.667													3	25	---	---	---	---	PASS
C1orf175	374977	broad.mit.edu	37	1	55166842	55166842	+	Silent	SNP	C	T	T	rs1065173	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55166842C>T	uc010ooe.1	+	19	3456	c.3132C>T	c.(3130-3132)CCC>CCT	p.P1044P	C1orf175_uc001cxq.2_RNA|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Silent_p.P562P|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc009vzq.1_RNA|C1orf175_uc001cxt.1_RNA|C1orf175_uc009vzr.1_Silent_p.P246P	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977	1044	HEAT 2.					integral to membrane	binding				0						CCCTCCTGCCCTCCATGGTGA	0.587													3	63	---	---	---	---	PASS
PGM1	5236	broad.mit.edu	37	1	64089265	64089265	+	Intron	SNP	A	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64089265A>G	uc001dbh.2	+						PGM1_uc010ooy.1_Intron|PGM1_uc010ooz.1_Missense_Mutation_p.Y45C	NM_002633	NP_002624	P36871	PGM1_HUMAN	phosphoglucomutase 1						cellular calcium ion homeostasis|galactose catabolic process|glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity			ovary(2)|kidney(1)	3						AAGAAAACCTATTATTTTGAG	0.418													29	117	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612013	120612013	+	Missense_Mutation	SNP	G	A	A	rs150390977	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612013G>A	uc001eik.2	-	1	264	c.8C>T	c.(7-9)GCC>GTC	p.A3V	NOTCH2_uc001eil.2_Missense_Mutation_p.A3V|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	3					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGGGCGCAGGGCGGGCATCTT	0.647			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	19	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612014	120612014	+	Missense_Mutation	SNP	C	A	A	rs138341092	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612014C>A	uc001eik.2	-	1	263	c.7G>T	c.(7-9)GCC>TCC	p.A3S	NOTCH2_uc001eil.2_Missense_Mutation_p.A3S|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	3					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGGCGCAGGGCGGGCATCTTC	0.647			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	19	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004307	148004307	+	3'UTR	SNP	T	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004307T>C	uc001eqq.2	-	22					LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_3'UTR|NBPF14_uc010pac.1_3'UTR	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832							cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					TTAAAATGTCTGACTGATCAC	0.483													3	7	---	---	---	---	PASS
OR10Z1	128368	broad.mit.edu	37	1	158576873	158576873	+	Silent	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158576873C>T	uc010pio.1	+	1	645	c.645C>T	c.(643-645)ACC>ACT	p.T215T		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	215	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)					TCTTCATCACCATCTCCTACG	0.537													28	267	---	---	---	---	PASS
RNASEL	6041	broad.mit.edu	37	1	182550489	182550489	+	Silent	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182550489G>A	uc001gpj.1	-	4	1943	c.1776C>T	c.(1774-1776)CGC>CGT	p.R592R	RNASEL_uc009wxz.1_Silent_p.R592R|RNASEL_uc001gpk.2_Silent_p.R592R	NM_021133	NP_066956	Q05823	RN5A_HUMAN	ribonuclease L	592	KEN.				mRNA processing|response to virus|type I interferon-mediated signaling pathway	mitochondrion	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding|protein kinase activity|RNA binding			ovary(4)|stomach(1)	5						GCGTCCTATAGCGGCTGAAGA	0.413									Hereditary_Prostate_Cancer				46	187	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203682293	203682293	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203682293G>A	uc001gzw.2	+	14	3096	c.2212G>A	c.(2212-2214)GTA>ATA	p.V738I	ATP2B4_uc001gzv.2_Missense_Mutation_p.V738I|ATP2B4_uc009xaq.2_Missense_Mutation_p.V738I	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	738	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GTGTTGGCAGGTAGAGCAAGA	0.502													34	153	---	---	---	---	PASS
OR2M5	127059	broad.mit.edu	37	1	248308779	248308779	+	Silent	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248308779C>T	uc010pze.1	+	1	330	c.330C>T	c.(328-330)TCC>TCT	p.S110S		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	110	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TGCTTGGCTCCGAATGCTTTC	0.443													113	409	---	---	---	---	PASS
KLF11	8462	broad.mit.edu	37	2	10188711	10188711	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10188711G>A	uc002raf.1	+	3	1409	c.1247G>A	c.(1246-1248)CGC>CAC	p.R416H	KLF11_uc010yjc.1_Missense_Mutation_p.R399H	NM_003597	NP_003588	O14901	KLF11_HUMAN	Kruppel-like factor 11	416	C2H2-type 1.				apoptosis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|regulation of transcription involved in S phase of mitotic cell cycle	nucleus	sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		GCCCATCTTCGCACTCACACA	0.567											OREG0014425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	82	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48915655	48915655	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915655A>T	uc002rwu.3	-	11	1351	c.1281T>A	c.(1279-1281)TAT>TAA	p.Y427*	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	427	Extracellular (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TGGCATGGTTATAGTACTGGC	0.493									Familial_Male-Limited_Precocious_Puberty				12	94	---	---	---	---	PASS
FABP1	2168	broad.mit.edu	37	2	88423942	88423942	+	Intron	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88423942G>A	uc002sst.1	-						FABP1_uc002ssu.2_3'UTR	NM_001443	NP_001434	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver						organ morphogenesis						0						TATGTGAGCCGCTCCCCATGC	0.557													7	52	---	---	---	---	PASS
ZSWIM2	151112	broad.mit.edu	37	2	187693166	187693166	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187693166A>T	uc002upu.1	-	9	1487	c.1447T>A	c.(1447-1449)TTA>ATA	p.L483I		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	483					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TCATAGGTTAATTTTTTTGAA	0.318													17	85	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49928943	49928943	+	Silent	SNP	C	T	T	rs138521247		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49928943C>T	uc003cxy.3	-	16	3687	c.3423G>A	c.(3421-3423)CCG>CCA	p.P1141P	MST1R_uc011bdc.1_Silent_p.P20P	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	1141	Cytoplasmic (Potential).|Protein kinase.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CCAGCACATTCGGGTGGTTCA	0.612													15	160	---	---	---	---	PASS
PDZRN3	23024	broad.mit.edu	37	3	73432865	73432865	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73432865C>T	uc003dpl.1	-	10	2948	c.2852G>A	c.(2851-2853)CGG>CAG	p.R951Q	PDZRN3_uc011bgh.1_Missense_Mutation_p.R608Q|PDZRN3_uc010hoe.1_Missense_Mutation_p.R649Q|PDZRN3_uc011bgf.1_Missense_Mutation_p.R668Q|PDZRN3_uc011bgg.1_Missense_Mutation_p.R671Q	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	951							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GCGCTCTTCCCGGATCTTCAG	0.657													8	72	---	---	---	---	PASS
SLC41A3	54946	broad.mit.edu	37	3	125725761	125725761	+	Intron	SNP	T	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125725761T>G	uc003eij.2	-						SLC41A3_uc003eii.2_3'UTR|SLC41A3_uc003eil.2_3'UTR|SLC41A3_uc003eik.2_Intron|SLC41A3_uc011bkh.1_3'UTR	NM_001008485	NP_001008485	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3 isoform 1							integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(114;0.167)		GAGGCAGGGGTCAACCATCCC	0.522													7	44	---	---	---	---	PASS
LOC220729	220729	broad.mit.edu	37	3	197348739	197348739	+	RNA	SNP	G	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197348739G>C	uc011bug.1	-	4		c.352C>G			LOC220729_uc003fxw.2_RNA|LOC220729_uc003fxy.2_RNA|LOC220729_uc010iao.1_Intron					Homo sapiens cDNA FLJ60865 complete cds, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC 1.3.5.1).												0						TAATTTTCTAGCTGTGAAAGA	0.398													4	138	---	---	---	---	PASS
HSPA4L	22824	broad.mit.edu	37	4	128723042	128723042	+	Missense_Mutation	SNP	T	C	C	rs1380154	byFrequency	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128723042T>C	uc003ifm.2	+	6	885	c.632T>C	c.(631-633)TTG>TCG	p.L211S	HSPA4L_uc010iny.1_Missense_Mutation_p.L170S|HSPA4L_uc011cgr.1_Missense_Mutation_p.L178S	NM_014278	NP_055093	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	211					protein folding|response to unfolded protein	cytoplasm|nucleus	ATP binding|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						TATCAGGTCTTGGTTTGTGCT	0.279													3	112	---	---	---	---	PASS
HSPB3	8988	broad.mit.edu	37	5	53751988	53751988	+	Silent	SNP	T	C	C	rs7823	byFrequency	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53751988T>C	uc003jph.1	+	1	544	c.369T>C	c.(367-369)GGT>GGC	p.G123G		NM_006308	NP_006299	Q12988	HSPB3_HUMAN	heat shock 27kDa protein 3	123					cell death|response to heat|response to unfolded protein	cytoplasm|nucleus					0		Lung NSC(810;0.00104)				TACCAGATGGTGTGGAAATCA	0.458													4	128	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79029070	79029070	+	Silent	SNP	A	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79029070A>G	uc003kgc.2	+	2	4554	c.4482A>G	c.(4480-4482)AAA>AAG	p.K1494K		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1494						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TAGAAGACAAACAAGATCTTT	0.403													13	213	---	---	---	---	PASS
FAM81B	153643	broad.mit.edu	37	5	94749818	94749818	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94749818C>T	uc003kla.1	+	4	507	c.461C>T	c.(460-462)TCG>TTG	p.S154L	FAM81B_uc010jbe.1_5'UTR	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	154										ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		AAAGAGGAATCGCTCGCCAGG	0.473													25	110	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140564009	140564009	+	Silent	SNP	C	T	T	rs61743312		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140564009C>T	uc003liv.2	+	1	3030	c.1875C>T	c.(1873-1875)CGC>CGT	p.R625R	PCDHB9_uc003liw.1_5'Flank	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	625	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGAGGTGCGCACCGCCAGGC	0.697													7	121	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29910622	29910622	+	Silent	SNP	C	T	T	rs143754376	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29910622C>T	uc003nol.2	+	2	162	c.162C>T	c.(160-162)GAC>GAT	p.D54D	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_Intron|HLA-A_uc010jrq.2_5'UTR|HLA-A_uc003nok.2_5'UTR|HLA-A_uc003non.2_Silent_p.D54D|HLA-A_uc003noo.2_Silent_p.D54D|HLA-A_uc010jrr.2_Silent_p.D54D|HLA-A_uc003nom.2_5'UTR|HLA-A_uc010klp.2_Silent_p.D26D|HLA-A_uc011dmc.1_5'UTR|HLA-A_uc011dmd.1_5'Flank	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	54	Extracellular (Potential).|Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						ACGTGGACGACACGCAGTTCG	0.687									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			5	32	---	---	---	---	PASS
HLA-DRB5	3127	broad.mit.edu	37	6	32521666	32521666	+	Intron	SNP	T	C	C	rs117454723	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32521666T>C	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_RNA|HLA-DRB6_uc003obn.1_RNA	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AACAGCCCTGTCCCAAGGAAG	0.507													3	21	---	---	---	---	PASS
NOD1	10392	broad.mit.edu	37	7	30491366	30491366	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30491366G>A	uc003tav.2	-	6	2190	c.1667C>T	c.(1666-1668)ACG>ATG	p.T556M		NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	556					activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						ATAGCAGGACGTGGTCGCTGC	0.607													39	136	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51287624	51287624	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51287624C>G	uc003tpr.3	-	2	244	c.59G>C	c.(58-60)CGT>CCT	p.R20P	COBL_uc003tps.2_Missense_Mutation_p.R20P|COBL_uc011kcl.1_Missense_Mutation_p.R20P|COBL_uc010kzc.2_Missense_Mutation_p.R20P|COBL_uc003tpt.2_Missense_Mutation_p.R20P	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	20										skin(3)|ovary(2)	5	Glioma(55;0.08)					TGGGGGAGCACGAGCCTTCAT	0.547													4	16	---	---	---	---	PASS
STAG3L2	442582	broad.mit.edu	37	7	74299371	74299371	+	3'UTR	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74299371C>T	uc003ubj.3	-	8					STAG3L2_uc011kfj.1_Intron	NM_001025202	NP_001020373	P0CL84	ST3L2_HUMAN	STAG3-like							nucleus	binding				0						tcccaaagtgctgggcttaca	0.159													4	13	---	---	---	---	PASS
STAG3L2	442582	broad.mit.edu	37	7	74299389	74299389	+	3'UTR	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74299389G>A	uc003ubj.3	-	8					STAG3L2_uc011kfj.1_Intron	NM_001025202	NP_001020373	P0CL84	ST3L2_HUMAN	STAG3-like							nucleus	binding				0						acaggcgtgagccaccaaccc	0.209													4	23	---	---	---	---	PASS
VGF	7425	broad.mit.edu	37	7	100807837	100807837	+	Silent	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100807837G>A	uc003uxx.3	-	2	506	c.288C>T	c.(286-288)CCC>CCT	p.P96P		NM_003378	NP_003369	O15240	VGF_HUMAN	VGF nerve growth factor inducible precursor	96					response to cAMP	extracellular space|transport vesicle	growth factor activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)					TTGGTGCCGGGGGTGAGGCGG	0.716													4	21	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103243855	103243855	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103243855T>C	uc003vca.2	-	24	3389	c.3229A>G	c.(3229-3231)AAT>GAT	p.N1077D	RELN_uc010liz.2_Missense_Mutation_p.N1077D	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1077					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCCAGCCATTCTGGTTCTCA	0.493													3	132	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141796215	141796215	+	Silent	SNP	T	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141796215T>C	uc003vwy.2	+	42	5058	c.5004T>C	c.(5002-5004)CGT>CGC	p.R1668R		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1668	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCCTGGAGCGTGTGAGTATGG	0.468													3	95	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154667767	154667767	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154667767C>T	uc003wlk.2	+	20	2164	c.2035C>T	c.(2035-2037)CGG>TGG	p.R679W	DPP6_uc003wli.2_Missense_Mutation_p.R615W|DPP6_uc003wlm.2_Missense_Mutation_p.R617W|DPP6_uc011kvq.1_Missense_Mutation_p.R572W	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	679	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AGTGAGGCGGCGGCTGGGCTT	0.687													7	27	---	---	---	---	PASS
ARHGEF10	9639	broad.mit.edu	37	8	1905302	1905302	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1905302C>A	uc003wpr.2	+	29	4086	c.3908C>A	c.(3907-3909)GCC>GAC	p.A1303D	ARHGEF10_uc003wps.2_Missense_Mutation_p.A1265D|ARHGEF10_uc010lre.2_Missense_Mutation_p.A954D	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	1328					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		AAAGCCAAGGCCAGCTCGGCG	0.637													5	79	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3889497	3889497	+	Silent	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3889497G>A	uc011kwk.1	-	4	930	c.540C>T	c.(538-540)CAC>CAT	p.H180H		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	180	Extracellular (Potential).|Sushi 1.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCAGGATGGCGTGGCCTTCCA	0.542													8	35	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38162867	38162867	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38162867C>T	uc003xli.2	-	13	2857	c.2339G>A	c.(2338-2340)CGC>CAC	p.R780H	WHSC1L1_uc011lbm.1_Missense_Mutation_p.R780H|WHSC1L1_uc010lwe.2_Missense_Mutation_p.R780H	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	780	PHD-type 2.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			GGGGAATTTGCGGACACAGGC	0.463			T	NUP98	AML								4	110	---	---	---	---	PASS
REXO1L1	254958	broad.mit.edu	37	8	86573410	86573410	+	3'UTR	SNP	G	A	A	rs79376271	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86573410G>A	uc011lfw.1	-	1						NM_172239	NP_758439	Q8IX06	GOR_HUMAN	exonuclease GOR							cytoplasm|nucleus	exonuclease activity|nucleic acid binding				0						TGGGCAGAGGGATGTGAACAG	0.667													3	28	---	---	---	---	PASS
TNFRSF11B	4982	broad.mit.edu	37	8	119945484	119945484	+	Missense_Mutation	SNP	A	C	C	rs144062067	byFrequency	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119945484A>C	uc003yon.3	-	2	409	c.86T>G	c.(85-87)CTT>CGT	p.L29R	TNFRSF11B_uc010mdc.1_RNA	NM_002546	NP_002537	O00300	TR11B_HUMAN	osteoprotegerin precursor	29	TNFR-Cys 1.				apoptosis|skeletal system development		cytokine activity|receptor activity			central_nervous_system(2)	2	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			GTCATAATGAAGGTACTTTGG	0.443													36	165	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66500810	66500810	+	RNA	SNP	G	A	A	rs142815546	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66500810G>A	uc004aed.1	+	3		c.903G>A								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						ACCTACGGTCGGTTGTGTGCA	0.637													11	38	---	---	---	---	PASS
GDA	9615	broad.mit.edu	37	9	74863311	74863311	+	3'UTR	SNP	C	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74863311C>A	uc004aiq.2	+	14					GDA_uc011lse.1_3'UTR|GDA_uc011lsf.1_3'UTR|GDA_uc004air.2_Intron|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Intron	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase						nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		TCTGCATCTCCCTTGTGCCCA	0.463													25	61	---	---	---	---	PASS
NFIL3	4783	broad.mit.edu	37	9	94172250	94172250	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94172250G>C	uc004arh.2	-	2	1162	c.767C>G	c.(766-768)TCA>TGA	p.S256*		NM_005384	NP_005375	Q16649	NFIL3_HUMAN	nuclear factor, interleukin 3 regulated	256					circadian rhythm|immune response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0						GGGAGAGTGTGAGTACCCAGA	0.488													28	187	---	---	---	---	PASS
MRPS2	51116	broad.mit.edu	37	9	138395801	138395801	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138395801G>A	uc004cfv.3	+	4	787	c.713G>A	c.(712-714)GGC>GAC	p.G238D	MRPS2_uc004cfw.3_Missense_Mutation_p.G148D|MRPS2_uc004cfx.3_Missense_Mutation_p.G153D|MRPS2_uc010nat.2_Missense_Mutation_p.G219D|uc004cfy.2_Intron	NM_016034	NP_057118	Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	238					translation	mitochondrion|small ribosomal subunit	structural constituent of ribosome				0				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		CCTGTACCCGGCAATGACGAC	0.612													4	130	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24820812	24820812	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24820812C>A	uc001iru.3	+	15	3539	c.3136C>A	c.(3136-3138)CCT>ACT	p.P1046T	KIAA1217_uc001irs.2_Missense_Mutation_p.P966T|KIAA1217_uc001irt.3_Missense_Mutation_p.P1011T|KIAA1217_uc010qcy.1_Missense_Mutation_p.P1010T|KIAA1217_uc010qcz.1_Missense_Mutation_p.P1011T|KIAA1217_uc010qda.1_RNA|KIAA1217_uc001irw.2_Missense_Mutation_p.P729T|KIAA1217_uc001irz.2_Missense_Mutation_p.P729T|KIAA1217_uc001irx.2_Missense_Mutation_p.P729T|KIAA1217_uc001iry.2_Missense_Mutation_p.P729T	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	1046					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						AAAGTCGCCCCCTCCTCCTCC	0.517													3	55	---	---	---	---	PASS
NDST2	8509	broad.mit.edu	37	10	75565719	75565719	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75565719G>A	uc001jvk.2	-	7	2306	c.1502C>T	c.(1501-1503)TCT>TTT	p.S501F	NDST2_uc010qks.1_Missense_Mutation_p.S127F|NDST2_uc010qkt.1_Missense_Mutation_p.S378F|NDST2_uc001jvl.1_5'Flank|NDST2_uc009xro.2_Missense_Mutation_p.S127F|NDST2_uc010qku.1_Missense_Mutation_p.S376F	NM_003635	NP_003626	P52849	NDST2_HUMAN	heparan glucosaminyl	501	Lumenal (Potential).|Heparan sulfate N-deacetylase 2.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			ovary(1)	1	Prostate(51;0.0112)					TAGTTCACGAGAGCCTCCAGG	0.507													34	129	---	---	---	---	PASS
KCNQ1	3784	broad.mit.edu	37	11	2608867	2608867	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2608867C>A	uc001lwn.2	+	9	1304	c.1196C>A	c.(1195-1197)GCC>GAC	p.A399D	KCNQ1_uc009ydp.1_Missense_Mutation_p.A183D|KCNQ1_uc001lwo.2_Missense_Mutation_p.A272D	NM_000218	NP_000209	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like	399	Cytoplasmic (Potential).				blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	ATCCGGAAGGCCCCCCGGAGC	0.637													7	151	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													16	45	---	---	---	---	PASS
PTPRJ	5795	broad.mit.edu	37	11	48145375	48145375	+	Missense_Mutation	SNP	A	C	C	rs1566734	byFrequency	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48145375A>C	uc001ngp.3	+	5	1182	c.827A>C	c.(826-828)CAA>CCA	p.Q276P	PTPRJ_uc001ngo.3_Missense_Mutation_p.Q276P	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	276	Extracellular (Potential).|Fibronectin type-III 2.|Fibronectin type-III 3.				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						TATCTTCTACAATCAAATAAG	0.468													4	113	---	---	---	---	PASS
ESRRA	2101	broad.mit.edu	37	11	64083442	64083442	+	3'UTR	SNP	A	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64083442A>G	uc001nzq.1	+	7					ESRRA_uc001nzr.1_3'UTR|ESRRA_uc001nzs.1_3'UTR|PRDX5_uc001nzu.2_5'Flank|PRDX5_uc001nzv.2_5'Flank|PRDX5_uc001nzw.2_5'Flank|PRDX5_uc001nzx.2_5'Flank	NM_004451	NP_004442	P11474	ERR1_HUMAN	estrogen-related receptor alpha						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein domain specific binding|sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0						GGACTGAGGCAAGGGGTGGGA	0.637													3	76	---	---	---	---	PASS
KLC2	64837	broad.mit.edu	37	11	66032690	66032690	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66032690G>T	uc010rov.1	+	11	1561	c.1318G>T	c.(1318-1320)GCC>TCC	p.A440S	KLC2_uc010row.1_Missense_Mutation_p.A440S|KLC2_uc009yra.2_Intron|KLC2_uc001ohb.2_Missense_Mutation_p.A440S|KLC2_uc010rox.1_Missense_Mutation_p.A363S|KLC2_uc001ohc.2_Missense_Mutation_p.A440S|KLC2_uc001ohd.2_Missense_Mutation_p.A363S|KLC2_uc001ohe.1_Missense_Mutation_p.A301S	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	440					blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0						CTGGTACAAGGCCTGTAAAGT	0.373													5	81	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	113661349	113661349	+	RNA	SNP	A	G	G	rs1713675	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113661349A>G	uc001pof.1	+	1		c.1397A>G								Homo sapiens cDNA FLJ36034 fis, clone TESTI2017107, highly similar to CYCLIC-AMP-DEPENDENT TRANSCRIPTION FACTOR ATF-4.																		GGGTATAGATAACCTGGAAAC	0.478													4	124	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7640278	7640278	+	Intron	SNP	A	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7640278A>G	uc001qsz.3	-						CD163_uc001qta.3_Intron|CD163_uc009zfw.2_Missense_Mutation_p.L609P	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a						acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						TCCTGGAAGGAGACAGGGCTT	0.488													40	145	---	---	---	---	PASS
WNT1	7471	broad.mit.edu	37	12	49373343	49373343	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49373343G>A	uc001rsu.2	+	2	395	c.197G>A	c.(196-198)CGC>CAC	p.R66H		NM_005430	NP_005421	P04628	WNT1_HUMAN	wingless-type MMTV integration site family,	66					brain segmentation|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|central nervous system morphogenesis|cerebellum formation|dermatome development|diencephalon development|embryonic axis specification|forebrain anterior/posterior pattern formation|fourth ventricle development|hemopoietic stem cell proliferation|hepatocyte differentiation|inner ear morphogenesis|mesoderm morphogenesis|midbrain development|midbrain-hindbrain boundary maturation during brain development|negative regulation of cell-cell adhesion|negative regulation of cell-substrate adhesion|negative regulation of DNA damage checkpoint|negative regulation of fat cell differentiation|neuron fate determination|positive regulation of fibroblast proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of lamellipodium assembly|positive regulation of Notch signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to wounding|signal transduction in response to DNA damage|Spemann organizer formation|T cell differentiation in thymus|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled-2 binding|transcription regulatory region DNA binding			kidney(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.244)		CTGTTGAGCCGCAAACAGCGG	0.597													4	125	---	---	---	---	PASS
HCFC2	29915	broad.mit.edu	37	12	104487302	104487302	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104487302C>T	uc001tkj.3	+	10	1526	c.1423C>T	c.(1423-1425)CAT>TAT	p.H475Y	HCFC2_uc009zul.2_RNA	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	475					regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						TGCTTCTAATCATAATAGTCA	0.323													17	98	---	---	---	---	PASS
RASL11A	387496	broad.mit.edu	37	13	27847649	27847649	+	3'UTR	SNP	C	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27847649C>G	uc001urd.1	+	4						NM_206827	NP_996563	Q6T310	RSLBA_HUMAN	RAS-like, family 11, member A						positive regulation of transcription from RNA polymerase I promoter|small GTPase mediated signal transduction|transcription, DNA-dependent	membrane|nucleolus	GTP binding|GTPase activity			breast(1)	1		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0173)|GBM - Glioblastoma multiforme(144;0.0557)|OV - Ovarian serous cystadenocarcinoma(117;0.152)|Epithelial(112;0.164)		CAGACAGATGCCTCTCCTTTT	0.433													3	31	---	---	---	---	PASS
COMMD6	170622	broad.mit.edu	37	13	76112056	76112056	+	5'Flank	SNP	G	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76112056G>T	uc001vjo.1	-						COMMD6_uc001vjn.1_5'Flank|COMMD6_uc010aet.1_5'Flank|COMMD6_uc001vjp.1_RNA	NM_203495	NP_987091	Q7Z4G1	COMD6_HUMAN	COMM domain containing 6 isoform b							cytoplasm|nucleus	protein binding				0		Breast(118;0.0979)|Prostate(6;0.122)		GBM - Glioblastoma multiforme(99;0.0104)		AGCAGGGGAAGCTGAAAAAAG	0.488													6	58	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24877295	24877295	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24877295G>A	uc001wpf.3	+	3	737	c.419G>A	c.(418-420)CGA>CAA	p.R140Q		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	140					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						CTGGTGGGGCGACTGCGCTGG	0.682													18	43	---	---	---	---	PASS
WDHD1	11169	broad.mit.edu	37	14	55448285	55448285	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55448285C>A	uc001xbm.1	-	16	2114	c.2036G>T	c.(2035-2037)GGT>GTT	p.G679V	WDHD1_uc010aom.1_Missense_Mutation_p.G196V|WDHD1_uc001xbn.1_Missense_Mutation_p.G556V	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	679						cytoplasm|nucleoplasm	DNA binding			skin(1)	1						TTCATGGATACCAACCACCCA	0.373													7	127	---	---	---	---	PASS
SEL1L	6400	broad.mit.edu	37	14	81993164	81993164	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81993164C>T	uc010tvv.1	-	3	370	c.253G>A	c.(253-255)GAA>AAA	p.E85K	SEL1L_uc001xvo.3_Missense_Mutation_p.E85K	NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor	85	Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		GTGACACTTTCCCCCTCTTGG	0.418													10	316	---	---	---	---	PASS
SEL1L	6400	broad.mit.edu	37	14	81993233	81993233	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81993233C>T	uc010tvv.1	-	3	301	c.184G>A	c.(184-186)GAT>AAT	p.D62N	SEL1L_uc001xvo.3_Missense_Mutation_p.D62N	NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor	62	Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		TCTTCTGAATCAAGAAATATT	0.383													10	160	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106174767	106174767	+	RNA	SNP	G	T	T	rs1128862		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106174767G>T	uc010tyt.1	-	3631		c.59567C>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron					Parts of antibodies, mostly variable regions.												0						GGACTTGCCGGCTAGGCACTG	0.662													4	39	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107078542	107078542	+	RNA	SNP	C	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107078542C>A	uc010tyt.1	-	117		c.5748G>T								Parts of antibodies, mostly variable regions.												0						AAGGCGTTGTCCACGAGCCTG	0.532													4	28	---	---	---	---	PASS
IGF1R	3480	broad.mit.edu	37	15	99482581	99482581	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99482581A>G	uc002bul.2	+	18	3499	c.3449A>G	c.(3448-3450)AAA>AGA	p.K1150R	IGF1R_uc010bon.2_Missense_Mutation_p.K1149R	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	1150	Protein kinase.|Cytoplasmic (Potential).				anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	TTCACAGTCAAAATCGGAGGT	0.498													36	160	---	---	---	---	PASS
MSLNL	401827	broad.mit.edu	37	16	820888	820888	+	Missense_Mutation	SNP	T	C	C	rs12599339	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:820888T>C	uc002cjz.1	-	13	2497	c.2497A>G	c.(2497-2499)ACC>GCC	p.T833A		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	482	Extracellular (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4						CTGCCGAAGGTCTCATGGGCC	0.692													4	3	---	---	---	---	PASS
C16orf46	123775	broad.mit.edu	37	16	81095725	81095725	+	Missense_Mutation	SNP	T	C	C	rs17855893		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81095725T>C	uc002fgc.3	-	4	488	c.229A>G	c.(229-231)ACT>GCT	p.T77A	C16orf46_uc010chf.2_Missense_Mutation_p.T77A|C16orf46_uc010vno.1_5'UTR	NM_152337	NP_689550	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46 isoform 2	77											0						GCTGGAGAAGTCCTTCCCCAC	0.552													29	100	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5035642	5035642	+	Intron	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5035642G>A	uc002gau.1	+						USP6_uc002gav.1_Intron|USP6_uc010ckz.1_Intron|USP6_uc002gaw.2_Missense_Mutation_p.R97Q|uc002gay.1_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						AGGCTTGGGCGGCTCCAGGCC	0.652			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								10	60	---	---	---	---	PASS
TAF15	8148	broad.mit.edu	37	17	34147368	34147368	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34147368C>T	uc002hkd.2	+	5	303	c.217C>T	c.(217-219)CAA>TAA	p.Q73*	TAF15_uc010ctw.1_RNA|TAF15_uc002hkc.2_Nonsense_Mutation_p.Q70*	NM_139215	NP_631961	Q92804	RBP56_HUMAN	TBP-associated factor 15 isoform 1	73	Gln/Gly/Ser/Tyr-rich.				positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TTATGAGAATCAAAAGCAGAG	0.348			T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								16	73	---	---	---	---	PASS
C17orf37	84299	broad.mit.edu	37	17	37885702	37885702	+	3'UTR	SNP	A	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37885702A>G	uc002hsq.2	-	4						NM_032339	NP_115715	Q9BRT3	CQ037_HUMAN	hypothetical protein LOC84299						cell redox homeostasis	cytosol|membrane	selenium binding				0	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;3.72e-63)|all cancers(3;1.87e-56)|BRCA - Breast invasive adenocarcinoma(8;6.8e-45)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)			AGGCAGGGGGAGCTCCCAGCA	0.567													8	101	---	---	---	---	PASS
RAB5C	5878	broad.mit.edu	37	17	40282379	40282379	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40282379C>T	uc002hyz.2	-	3	459	c.142G>A	c.(142-144)GAG>AAG	p.E48K	RAB5C_uc002hza.2_Missense_Mutation_p.E48K|RAB5C_uc010cxx.2_Missense_Mutation_p.E81K|RAB5C_uc010cxy.2_Intron	NM_201434	NP_958842	P51148	RAB5C_HUMAN	RAB5C, member RAS oncogene family isoform a	48					protein transport|small GTPase mediated signal transduction	early endosome membrane|melanosome|plasma membrane	GTP binding|GTPase activity|protein binding			large_intestine(1)|skin(1)	2		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		TCCTGGTACTCGTGAAACTGT	0.542													11	66	---	---	---	---	PASS
RHBDF2	79651	broad.mit.edu	37	17	74473094	74473094	+	Silent	SNP	G	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74473094G>T	uc002jrq.1	-	9	1313	c.1020C>A	c.(1018-1020)GGC>GGA	p.G340G	RHBDF2_uc002jrp.1_Silent_p.G311G|RHBDF2_uc002jrr.1_Silent_p.G192G|RHBDF2_uc010wtf.1_Silent_p.G311G|RHBDF2_uc002jrs.1_Silent_p.G335G	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1	340	Cytoplasmic (Potential).				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						CTGGGGCTCGGCCATACTCCT	0.652													7	102	---	---	---	---	PASS
SFRS2	6427	broad.mit.edu	37	17	74732290	74732290	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74732290T>A	uc002jsv.2	-	2	789	c.619A>T	c.(619-621)AAG>TAG	p.K207*	SFRS2_uc002jsw.1_RNA|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Nonsense_Mutation_p.K207*|SFRS2_uc010wtg.1_Nonsense_Mutation_p.K195*|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	NM_003016	NP_003007	Q01130	SRSF2_HUMAN	splicing factor, arginine/serine-rich 2	207	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity				0						GGGGGACTCTTCGATCGCGAC	0.547													5	175	---	---	---	---	PASS
SFRS2	6427	broad.mit.edu	37	17	74732291	74732291	+	Silent	SNP	C	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74732291C>A	uc002jsv.2	-	2	788	c.618G>T	c.(616-618)TCG>TCT	p.S206S	SFRS2_uc002jsw.1_RNA|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Silent_p.S206S|SFRS2_uc010wtg.1_Silent_p.S194S|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	NM_003016	NP_003007	Q01130	SRSF2_HUMAN	splicing factor, arginine/serine-rich 2	206	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity				0						GGGGACTCTTCGATCGCGACC	0.547													6	175	---	---	---	---	PASS
ESCO1	114799	broad.mit.edu	37	18	19116092	19116092	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19116092G>C	uc002kth.1	-	10	3032	c.2098C>G	c.(2098-2100)CTA>GTA	p.L700V	ESCO1_uc002kti.1_RNA	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1	700					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						TAGCACATTAGTGGAGCCTGT	0.328													44	170	---	---	---	---	PASS
MKNK2	2872	broad.mit.edu	37	19	2037867	2037867	+	3'UTR	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2037867C>T	uc002lus.2	-	14					MKNK2_uc002luq.1_Intron|MKNK2_uc010xgu.1_3'UTR|MKNK2_uc010xgv.1_3'UTR|MKNK2_uc002lur.2_Intron|MKNK2_uc002lut.1_3'UTR	NM_199054	NP_951009	Q9HBH9	MKNK2_HUMAN	MAP kinase-interacting serine/threonine kinase 2						cell surface receptor linked signaling pathway|intracellular protein kinase cascade|regulation of translation		ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(1)|breast(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAAACGCTGCTAGCCACTCA	0.532													6	9	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10089567	10089567	+	Silent	SNP	C	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10089567C>T	uc002mmq.1	-	40	3050	c.2964G>A	c.(2962-2964)CCG>CCA	p.P988P		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	988	Triple-helical region.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			AGATACTCACCGGGTCCCCAG	0.617													5	39	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602358	10602358	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602358G>A	uc002moq.1	-	3	1376	c.1220C>T	c.(1219-1221)GCC>GTC	p.A407V	KEAP1_uc002mop.1_Missense_Mutation_p.A125V|KEAP1_uc002mor.1_Missense_Mutation_p.A407V	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	407	Kelch 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			GCTCATGGGGGCGCAGGGCGA	0.652													5	17	---	---	---	---	PASS
CLC	1178	broad.mit.edu	37	19	40224986	40224986	+	Silent	SNP	A	G	G	rs384138	byFrequency	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40224986A>G	uc002omh.2	-	3	316	c.240T>C	c.(238-240)AAT>AAC	p.N80N		NM_001828	NP_001819	Q05315	LPPL_HUMAN	Charcot-Leyden crystal protein	80	Galectin.				lipid catabolic process|multicellular organismal development		carboxylesterase activity|lysophospholipase activity|sugar binding				0	all_cancers(60;2.99e-06)|all_lung(34;4.7e-08)|Lung NSC(34;5.46e-08)|Ovarian(47;0.06)	Renal(1328;0.000147)|Hepatocellular(1079;0.0202)|Myeloproliferative disorder(2;0.0255)	Epithelial(26;6.43e-25)|OV - Ovarian serous cystadenocarcinoma(5;1.07e-24)|all cancers(26;8.38e-23)	GBM - Glioblastoma multiforme(1328;4.97e-06)|STAD - Stomach adenocarcinoma(1328;0.00655)		GAAAGGGCATATTCTTGGATT	0.527													4	152	---	---	---	---	PASS
C19orf41	126123	broad.mit.edu	37	19	50662822	50662822	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50662822T>C	uc002prp.1	-	3	410	c.323A>G	c.(322-324)GAA>GGA	p.E108G		NM_152358	NP_689571	Q6UXV1	IZUM2_HUMAN	hypothetical protein LOC126123 precursor	108	Extracellular (Potential).					integral to membrane					0		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00364)|OV - Ovarian serous cystadenocarcinoma(262;0.0052)		CACCAGCTCTTCCAGCAGAGG	0.438													9	87	---	---	---	---	PASS
MYH14	79784	broad.mit.edu	37	19	50726570	50726570	+	Silent	SNP	G	A	A	rs4801822	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50726570G>A	uc002prr.1	+	5	704	c.657G>A	c.(655-657)GCG>GCA	p.A219A	MYH14_uc010enu.1_Silent_p.A219A|MYH14_uc002prq.1_Silent_p.A219A	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	219	Myosin head-like.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CCCACGTGGCGTCGTCTCCAA	0.632													5	8	---	---	---	---	PASS
SIGLEC5	8778	broad.mit.edu	37	19	52132668	52132668	+	Missense_Mutation	SNP	T	C	C	rs34553740	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52132668T>C	uc002pxe.2	-	3	782	c.643A>G	c.(643-645)ATG>GTG	p.M215V		NM_003830	NP_003821	O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5 precursor	215	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion	integral to membrane	sugar binding			skin(2)|breast(1)|central_nervous_system(1)	4		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TGGCGTTTCATCTGACAGGTG	0.637													8	99	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56244522	56244522	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56244522G>T	uc002qly.2	-	2	703	c.675C>A	c.(673-675)TTC>TTA	p.F225L		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	225	NACHT.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CATCCATGATGAACAGAATTC	0.483													5	48	---	---	---	---	PASS
PDYN	5173	broad.mit.edu	37	20	1961214	1961214	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1961214G>A	uc010gaj.2	-	3	762	c.520C>T	c.(520-522)CGC>TGC	p.R174C	uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.R174C|PDYN_uc010zpt.1_Missense_Mutation_p.R19C	NM_024411	NP_077722	P01213	PDYN_HUMAN	beta-neoendorphin-dynorphin preproprotein	174					cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2						CCCCCATAGCGTTTGACCTGC	0.582													7	171	---	---	---	---	PASS
MAPRE1	22919	broad.mit.edu	37	20	31424469	31424469	+	Silent	SNP	A	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31424469A>G	uc002wyh.2	+	4	436	c.297A>G	c.(295-297)GGA>GGG	p.G99G		NM_012325	NP_036457	Q15691	MARE1_HUMAN	microtubule-associated protein, RP/EB family,	99	CH.				cell division|cell proliferation|G2/M transition of mitotic cell cycle|mitotic prometaphase|negative regulation of microtubule polymerization|protein localization to microtubule	centrosome|cortical microtubule cytoskeleton|cytosol	microtubule plus-end binding|protein C-terminus binding				0						TAGTAAAAGGAAAGTTTCAGG	0.398													13	73	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18846232	18846232	+	RNA	SNP	A	G	G	rs571744		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18846232A>G	uc002zoe.2	+	5		c.2594A>G			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		CCCTATGTGCACACCCGGAGG	0.607													3	8	---	---	---	---	PASS
CACNA1I	8911	broad.mit.edu	37	22	40054948	40054948	+	Silent	SNP	T	C	C	rs5757761	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40054948T>C	uc003ayc.2	+	12	2157	c.2157T>C	c.(2155-2157)ATT>ATC	p.I719I	CACNA1I_uc003ayd.2_Silent_p.I684I|CACNA1I_uc003aye.2_Silent_p.I634I|CACNA1I_uc003ayf.2_Silent_p.I599I	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	719	Helical; Name=S3 of repeat II; (Potential).|II.				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	TCTGGGAGATTGTGGGGCAGG	0.672													4	5	---	---	---	---	PASS
TXLNG	55787	broad.mit.edu	37	X	16859875	16859875	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16859875G>C	uc004cxq.1	+	10	1624	c.1573G>C	c.(1573-1575)GAG>CAG	p.E525Q	TXLNG_uc010ney.1_Missense_Mutation_p.E393Q	NM_018360	NP_060830	Q9NUQ3	TXLNG_HUMAN	gamma-taxilin	525					cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane				lung(1)	1						TCCGGCCATCGAGTCGGTTGA	0.483													32	63	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48674947	48674947	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48674947T>G	uc011mmi.1	+	19	1793	c.1698T>G	c.(1696-1698)TTT>TTG	p.F566L	HDAC6_uc004dks.1_Missense_Mutation_p.F566L|HDAC6_uc010nig.1_Missense_Mutation_p.F414L|HDAC6_uc004dkt.1_Missense_Mutation_p.F566L|HDAC6_uc011mmk.1_Missense_Mutation_p.F547L|HDAC6_uc004dkv.1_Missense_Mutation_p.F214L|HDAC6_uc004dkw.1_Missense_Mutation_p.F214L|HDAC6_uc004dkx.1_5'Flank	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	566	Histone deacetylase 2.				aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	GTTCCAACTTTGACTCCATCT	0.592													16	22	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48674948	48674948	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48674948G>C	uc011mmi.1	+	19	1794	c.1699G>C	c.(1699-1701)GAC>CAC	p.D567H	HDAC6_uc004dks.1_Missense_Mutation_p.D567H|HDAC6_uc010nig.1_Missense_Mutation_p.D415H|HDAC6_uc004dkt.1_Missense_Mutation_p.D567H|HDAC6_uc011mmk.1_Missense_Mutation_p.D548H|HDAC6_uc004dkv.1_Missense_Mutation_p.D215H|HDAC6_uc004dkw.1_Missense_Mutation_p.D215H|HDAC6_uc004dkx.1_5'Flank	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	567	Histone deacetylase 2.				aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	TTCCAACTTTGACTCCATCTA	0.592													16	21	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	21039807	21039808	+	Intron	INS	-	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21039807_21039808insA	uc001bdr.3	-						KIF17_uc001bds.3_Intron	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a						microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		tttttttaattaaaaaaaaaaa	0.257													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31128349	31128366	+	IGR	DEL	TGGTGGTGGTGGTGGTGG	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128349_31128366delTGGTGGTGGTGGTGGTGG								None (None upstream) : MATN1 (55760 downstream)																							acggtggtgatggtggtggtggtggtggtggtggtggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	61509502	61509505	+	IGR	DEL	ACAC	-	-	rs71830791		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61509502_61509505delACAC								C1orf87 (970076 upstream) : NFIA (33441 downstream)																							TTTCCCCCCAacacacacacacac	0.466													6	3	---	---	---	---	
CACHD1	57685	broad.mit.edu	37	1	65138814	65138832	+	Intron	DEL	TGAGGGGCATAACTTGTTT	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65138814_65138832delTGAGGGGCATAACTTGTTT	uc001dbo.1	+						CACHD1_uc001dbp.1_Intron|CACHD1_uc001dbq.1_Intron|CACHD1_uc010opa.1_Intron	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1						calcium ion transport	integral to membrane				ovary(2)	2						CTGATATGAATGAGGGGCATAACTTGTTTTGGTACAGGT	0.443													244	7	---	---	---	---	
LOC400759	400759	broad.mit.edu	37	1	89887499	89887499	+	Intron	DEL	G	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89887499delG	uc009wcy.1	+							NR_003133				Homo sapiens cDNA, FLJ17004.												0						aaaaaaaaaagaaTTACAGGG	0.204													7	4	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151214277	151214277	+	Intron	DEL	A	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151214277delA	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron|PIP5K1A_uc010pcv.1_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			actccatctcaaaaaaaaaaa	0.184													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	186115162	186115162	+	Intron	DEL	A	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186115162delA	uc001grq.1	+						HMCN1_uc001grs.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GTGGAATTAGAAAAAAAAAAA	0.313													5	4	---	---	---	---	
GPATCH2	55105	broad.mit.edu	37	1	217745364	217745365	+	Intron	INS	-	AGGA	AGGA			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217745364_217745365insAGGA	uc001hlf.1	-							NM_018040	NP_060510	Q9NW75	GPTC2_HUMAN	G patch domain containing 2							intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		ggaaggaaggaagggaggtagg	0.139													4	2	---	---	---	---	
PRKD3	23683	broad.mit.edu	37	2	37481336	37481336	+	Intron	DEL	T	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37481336delT	uc002rqd.2	-							NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				AGAGATTACATTTTTTTTTAC	0.363													98	7	---	---	---	---	
IRS1	3667	broad.mit.edu	37	2	227661593	227661593	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227661593delG	uc002voh.3	-	1	1914	c.1862delC	c.(1861-1863)CCAfs	p.P621fs		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	621					fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		ACTGGGCACTGGGGCCACCCC	0.632											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	98	21	---	---	---	---	
TATDN2	9797	broad.mit.edu	37	3	10302551	10302551	+	Intron	DEL	T	-	-	rs35507180		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10302551delT	uc003bvg.2	+						TATDN2_uc003bvf.2_Intron|TATDN2_uc011atr.1_Intron|TATDN2_uc011ats.1_Intron|TATDN2_uc011att.1_Intron	NM_014760	NP_055575	Q93075	TATD2_HUMAN	TatD DNase domain containing 2							nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2						AACTAAGTGCTTTTTTTTTTT	0.199													4	2	---	---	---	---	
C3orf49	132200	broad.mit.edu	37	3	63824203	63824203	+	Intron	DEL	A	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63824203delA	uc003dls.3	+						THOC7_uc003dlt.3_Intron|THOC7_uc003dlu.3_Intron	NR_026866				RecName: Full=Putative uncharacterized protein C3orf49;												0						AAACCAAAATAAAGATATTTG	0.308													64	15	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196281881	196281882	+	Intron	INS	-	AGGTAGAATTA	AGGTAGAATTA	rs147559216	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196281881_196281882insAGGTAGAATTA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AGAGTGCGGTTAGGTAGAATTA	0.371													6	4	---	---	---	---	
PDE6B	5158	broad.mit.edu	37	4	661872	661873	+	Intron	DEL	AG	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:661872_661873delAG	uc003gap.2	+						PDE6B_uc003gao.3_Intron|PDE6B_uc011buy.1_Intron|PDE6B_uc011buz.1_Intron	NM_000283	NP_000274	P35913	PDE6B_HUMAN	phosphodiesterase 6B isoform 1						cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0						GGCACAGAGCAGAGTTAAAATG	0.584													44	10	---	---	---	---	
ABLIM2	84448	broad.mit.edu	37	4	8021782	8021782	+	Intron	DEL	A	-	-	rs35828218		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8021782delA	uc003gko.2	-						ABLIM2_uc003gkk.2_Intron|ABLIM2_uc003gkl.2_Intron|ABLIM2_uc003gkj.3_Intron|ABLIM2_uc003gkm.3_Intron|ABLIM2_uc003gkp.2_Intron|ABLIM2_uc003gkq.2_Intron|ABLIM2_uc003gkr.2_Intron|ABLIM2_uc003gks.3_Intron	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2						axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						GGTTTTAAAGAAATCTCAGTG	0.532													4	4	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48608294	48608294	+	Intron	DEL	A	-	-	rs78643963		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48608294delA	uc003gyh.1	-						FRYL_uc003gyk.2_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						tgtctcaaggaaaaaaaaaaa	0.109													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																							tccattccgttccggtccattccat	0.000													158	8	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79101922	79101922	+	Intron	DEL	T	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79101922delT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						AATGACAGTCTTTTTTTTTTT	0.343													6	3	---	---	---	---	
PARP8	79668	broad.mit.edu	37	5	49962737	49962738	+	Intron	INS	-	CCT	CCT	rs151280834	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49962737_49962738insCCT	uc003jon.3	+						PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_5'Flank|PARP8_uc003jop.2_5'Flank	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				GCCGAcctccccctcctcctcc	0.450													3	7	---	---	---	---	
SSBP2	23635	broad.mit.edu	37	5	80911495	80911498	+	Intron	DEL	TATC	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80911495_80911498delTATC	uc003kho.2	-						SSBP2_uc003khn.2_Intron|SSBP2_uc003khp.2_Intron|SSBP2_uc011ctp.1_Intron|SSBP2_uc011ctq.1_Intron|SSBP2_uc011ctr.1_Intron	NM_012446	NP_036578	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2						regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		TCAGAACAGATATCTATCTGAAAG	0.294													2	5	---	---	---	---	
CDYL	9425	broad.mit.edu	37	6	4952678	4952679	+	Intron	INS	-	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4952678_4952679insA	uc003mwi.2	+						CDYL_uc003mwj.2_Intron|CDYL_uc003mwk.2_Intron|CDYL_uc011dhx.1_Intron|CDYL_uc011dhy.1_Intron	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		CGTTACTTTTTAAAAAATAGAA	0.441													66	15	---	---	---	---	
FAM65B	9750	broad.mit.edu	37	6	24875813	24875814	+	Intron	INS	-	G	G	rs2255337	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24875813_24875814insG	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron|FAM65B_uc003nep.2_Intron|FAM65B_uc011djt.1_Intron	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						GGGGAGGAGGCCGGGGGGCGGT	0.441													4	2	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51889183	51889184	+	Intron	INS	-	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51889183_51889184insA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTGATAAAAATAAAAAAAATCT	0.317													4	2	---	---	---	---	
HS3ST5	222537	broad.mit.edu	37	6	114405998	114405998	+	Intron	DEL	T	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114405998delT	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		ttttcttttcttttttttttt	0.189													4	2	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123786155	123786155	+	Intron	DEL	A	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123786155delA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron|uc003pzm.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		TAGGAATTGGAAAAAAAAAAG	0.398													8	4	---	---	---	---	
GTF2H5	404672	broad.mit.edu	37	6	158613375	158613375	+	3'UTR	DEL	A	-	-	rs3841147		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158613375delA	uc003qrd.2	+	3						NM_207118	NP_997001	Q6ZYL4	TF2H5_HUMAN	general transcription factor IIH, polypeptide 5						nucleotide-excision repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;5.98e-18)|BRCA - Breast invasive adenocarcinoma(81;2.83e-05)		CATAGAATTTAAAAAAAAAAA	0.333								Direct_reversal_of_damage|NER					4	2	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	6836648	6836649	+	Intron	INS	-	TT	TT	rs72410970		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6836648_6836649insTT	uc003sqw.1	+						RSPH10B2_uc010ktk.1_Intron|RSPH10B2_uc010ktl.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						ttctagttttattttttttttt	0.000													3	3	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48597748	48597751	+	Intron	DEL	TCCC	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48597748_48597751delTCCC	uc003toq.2	+						ABCA13_uc010kys.1_Intron|ABCA13_uc010kyt.1_Intron|ABCA13_uc010kyu.1_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						cctttctccatccctccctccctc	0.000													4	2	---	---	---	---	
ADAM22	53616	broad.mit.edu	37	7	87772153	87772153	+	Intron	DEL	A	-	-	rs144525827		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87772153delA	uc003ujn.2	+						ADAM22_uc003ujk.1_Intron|ADAM22_uc003ujl.1_Intron|ADAM22_uc003ujm.2_Intron|ADAM22_uc003ujo.2_Intron|ADAM22_uc003ujp.1_Intron	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			actccgtctcaaaaaaaaaaa	0.100													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3432693	3432694	+	Intron	DEL	AA	-	-	rs71850597		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3432693_3432694delAA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TAATCACAGTAAAAAAAAAAAA	0.381													6	5	---	---	---	---	
DENND3	22898	broad.mit.edu	37	8	142200356	142200357	+	Intron	DEL	GT	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142200356_142200357delGT	uc003yvy.2	+						DENND3_uc010mep.2_Intron|DENND3_uc003ywa.1_Intron|DENND3_uc003ywb.2_Intron	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3											ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			CAAGTTAAAGGTGTGTGTGTGT	0.515													180	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	43998495	43998495	+	IGR	DEL	C	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43998495delC								FAM75A6 (367765 upstream) : FAM27C (991741 downstream)																							GCTCCCGGGACCCAGCGGCAC	0.592													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99685055	99685056	+	IGR	INS	-	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99685055_99685056insA								LOC441454 (12319 upstream) : FAM22G (5536 downstream)																							gactccgtctcaaaaaaaaaaa	0.178													11	5	---	---	---	---	
FKBP15	23307	broad.mit.edu	37	9	115934078	115934079	+	Intron	INS	-	T	T			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115934078_115934079insT	uc004bgs.2	-						FKBP15_uc004bgr.2_Intron|FKBP15_uc011lxc.1_Intron|FKBP15_uc011lxd.1_Intron	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						CATCAAGTCTCTTTTTTTTTTT	0.287													4	3	---	---	---	---	
CEP110	11064	broad.mit.edu	37	9	123924715	123924715	+	Intron	DEL	T	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123924715delT	uc004bkx.1	+						CEP110_uc004blb.1_Intron|CEP110_uc010mvp.1_Intron	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa						cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						TCCTTCTAGCTTTTTTTTTTT	0.209													3	3	---	---	---	---	
PKN3	29941	broad.mit.edu	37	9	131479396	131479396	+	Intron	DEL	C	-	-	rs116943300		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131479396delC	uc004bvw.2	+						PKN3_uc010myh.2_Intron|PKN3_uc011mbk.1_Intron	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta						signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						cattaggtttctttttttttt	0.000													5	3	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137709530	137709531	+	Intron	DEL	CA	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137709530_137709531delCA	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCCTGCAGGCCACACACACACA	0.688													10	5	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140218010	140218010	+	Intron	DEL	C	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140218010delC	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						TCACCCCGGACCCACGAGGGA	0.677													21	9	---	---	---	---	
WDR85	92715	broad.mit.edu	37	9	140459788	140459789	+	Intron	INS	-	CT	CT	rs67456698		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140459788_140459789insCT	uc004cnk.1	-						WDR85_uc004cnj.1_5'Flank|WDR85_uc004cnl.1_Intron|WDR85_uc004cnm.1_Intron|WDR85_uc004cnn.1_Intron|WDR85_uc010ncl.1_5'Flank	NM_138778	NP_620133	Q9BTV6	WDR85_HUMAN	WD repeat domain 85						peptidyl-diphthamide biosynthetic process from peptidyl-histidine						0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.00029)|Epithelial(140;0.000509)		CCCCGGGGTGACTGTCTGTGAG	0.614													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42384710	42384710	+	IGR	DEL	T	-	-	rs151222414		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42384710delT								None (None upstream) : LOC441666 (442605 downstream)																							ttgaacggaatcgaatggaat	0.000													214	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385728	42385743	+	IGR	DEL	AATCATCATCAAATCA	-	-	rs67183761		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385728_42385743delAATCATCATCAAATCA								None (None upstream) : LOC441666 (441572 downstream)																							cattaaatggaatcatcatcaaatcaaatctaatgg	0.042													27	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42529391	42529391	+	IGR	DEL	G	-	-	rs71210893		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42529391delG								None (None upstream) : LOC441666 (297924 downstream)																							attatatgaagaaatcccgtt	0.000													267	8	---	---	---	---	
C10orf79	80217	broad.mit.edu	37	10	105924158	105924158	+	Intron	DEL	T	-	-	rs140844875		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105924158delT	uc001kxw.2	-						C10orf79_uc009xxq.2_Intron	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217												0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		ATTCCACAAAttttttttttt	0.149													5	3	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121104451	121104454	+	Intron	DEL	CCTC	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121104451_121104454delCCTC	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		ccttccttttcctccctccctccc	0.137													4	2	---	---	---	---	
CLEC1B	51266	broad.mit.edu	37	12	10149204	10149204	+	Intron	DEL	T	-	-	rs67059054		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10149204delT	uc001qwu.2	-						CLEC1B_uc009zhd.2_Intron	NM_016509	NP_057593	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B isoform						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity				0						TGACCCACTATGTACCTGAGC	0.408													3	4	---	---	---	---	
CACNB3	784	broad.mit.edu	37	12	49212875	49212875	+	Intron	DEL	G	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49212875delG	uc001rsl.1	+						CACNB3_uc010slx.1_Intron|CACNB3_uc010sly.1_Intron|CACNB3_uc010slz.1_Intron|CACNB3_uc001rsk.1_Intron	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3						axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	AGGGTTTGTAGGGGGGCGCTC	0.617													2	6	---	---	---	---	
MPHOSPH9	10198	broad.mit.edu	37	12	123682630	123682631	+	Intron	INS	-	A	A	rs75736501		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123682630_123682631insA	uc001uel.2	-						MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_Intron|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9						M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		gactccgtctcaaaaaaaaaaa	0.129													1	5	---	---	---	---	
TMEM132B	114795	broad.mit.edu	37	12	125833807	125833808	+	Intron	DEL	TG	-	-	rs145483970		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125833807_125833808delTG	uc001uhe.1	+							NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CTCCCCACTCTGTGCTGTCTTT	0.465													5	4	---	---	---	---	
SUCLA2	8803	broad.mit.edu	37	13	48563348	48563349	+	Intron	INS	-	T	T	rs34344844		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48563348_48563349insT	uc001vbs.2	-						SUCLA2_uc010tgb.1_Intron|SUCLA2_uc010tgc.1_Intron|SUCLA2_uc010tgd.1_Intron|SUCLA2_uc001vbt.1_Intron|SUCLA2_uc001vbu.1_Intron	NM_003850	NP_003841	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit						succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	TAAACCAtttcttttttttttt	0.149													6	5	---	---	---	---	
TEP1	7011	broad.mit.edu	37	14	20874170	20874171	+	Intron	INS	-	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20874170_20874171insA	uc001vxe.2	-						TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Intron	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1						telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		gactccatctcaaaaaaaaaaa	0.059													3	4	---	---	---	---	
WDHD1	11169	broad.mit.edu	37	14	55422594	55422595	+	Intron	INS	-	TTCAGA	TTCAGA	rs140324706	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55422594_55422595insTTCAGA	uc001xbm.1	-						WDHD1_uc010aom.1_Intron|WDHD1_uc001xbn.1_Intron	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1							cytoplasm|nucleoplasm	DNA binding			skin(1)	1						AAAAACTACACTTCAGATTCCA	0.168													2	4	---	---	---	---	
RHOJ	57381	broad.mit.edu	37	14	63757403	63757404	+	Intron	INS	-	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63757403_63757404insA	uc001xgb.1	+							NM_020663	NP_065714	Q9H4E5	RHOJ_HUMAN	ras homolog gene family, member J precursor						actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		tacaaaaatacaaaaaaaaaaa	0.228													4	2	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105694880	105694881	+	Intron	INS	-	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105694880_105694881insA	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axj.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		ggctgttcctcaaaaaaaaaaa	0.272													3	3	---	---	---	---	
ZNF609	23060	broad.mit.edu	37	15	64937304	64937305	+	Intron	INS	-	CCTT	CCTT	rs7163358	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64937304_64937305insCCTT	uc002ann.2	+							NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						ctccctccctcccttccttcct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46404945	46404970	+	IGR	DEL	TTCGACGATGATTCCATTCGATTCCG	-	-	rs61126254		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46404945_46404970delTTCGACGATGATTCCATTCGATTCCG								None (None upstream) : ANKRD26P1 (98279 downstream)																							ttcaattccattcgacgatgattccattcgattccgtttgatgatt	0.000													109	7	---	---	---	---	
ZNRF1	84937	broad.mit.edu	37	16	75127283	75127283	+	Intron	DEL	A	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75127283delA	uc002fdk.2	+						ZNRF1_uc010vmz.1_Intron|ZNRF1_uc002fdl.1_Intron|ZNRF1_uc010cgr.1_Intron	NM_032268	NP_115644	Q8ND25	ZNRF1_HUMAN	zinc and ring finger protein 1							cell junction|endosome|lysosome|synaptic vesicle membrane	ligase activity|protein binding|zinc ion binding				0						acttcgtctcaaaaaaaaaaa	0.224													6	3	---	---	---	---	
P2RX5	5026	broad.mit.edu	37	17	3595042	3595042	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3595042delG	uc002fwi.2	-	2	468	c.184delC	c.(184-186)CTGfs	p.L62fs	P2RX5_uc002fwd.2_RNA|P2RX5_uc002fwh.1_Frame_Shift_Del_p.L62fs|P2RX5_uc010vrx.1_Frame_Shift_Del_p.L26fs|P2RX5_uc002fwj.2_Frame_Shift_Del_p.L62fs|P2RX5_uc002fwk.2_Frame_Shift_Del_p.L62fs|P2RX5_uc002fwl.2_Frame_Shift_Del_p.L62fs|P2RX5_uc002fwm.1_Frame_Shift_Del_p.L62fs	NM_002561	NP_002552	Q93086	P2RX5_HUMAN	purinergic receptor P2X5 isoform A	62	Extracellular (Potential).				nervous system development|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						GCACTCTGCAGGGAGGTGTCG	0.592													215	39	---	---	---	---	
MEIS3P1	4213	broad.mit.edu	37	17	15690295	15690297	+	In_Frame_Del	DEL	CTT	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15690295_15690297delCTT	uc002gpc.2	+	1	132_134	c.111_113delCTT	c.(109-114)CCCTTC>CCC	p.F39del		NR_002211				RecName: Full=Homeobox protein Meis3; AltName: Full=Meis1-related protein 2;												0						CTGAGAGGCCCTTCTTCTCCTCC	0.591													3	3	---	---	---	---	
FOXN1	8456	broad.mit.edu	37	17	26851370	26851371	+	Intron	INS	-	CTT	CTT	rs138715148	by1000genomes	TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26851370_26851371insCTT	uc010crm.2	+						FOXN1_uc002hbj.2_Intron	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1						defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					TGAAATCGGGGCCAAGGGTAGG	0.574													4	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	33893886	33893887	+	IGR	INS	-	A	A			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33893886_33893887insA								SLFN14 (8776 upstream) : SNORD7 (6789 downstream)																							CCTTTCATTTCAAAAAAAAAAA	0.386													10	7	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													8	4	---	---	---	---	
CD300LB	124599	broad.mit.edu	37	17	72527561	72527561	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72527561delG	uc002jkx.2	-	1	53	c.40delC	c.(40-42)CAGfs	p.Q14fs	CD300LB_uc010wqz.1_Frame_Shift_Del_p.Q14fs	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	Error:Variant_position_missing_in_A8K4G0_after_alignment						integral to membrane|plasma membrane	receptor activity			ovary(1)	1						GATGCACTCTGGAAGTTCTGC	0.542													105	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75921951	75921952	+	IGR	INS	-	AAGG	AAGG	rs28641037		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75921951_75921952insAAGG								FLJ45079 (41782 upstream) : TNRC6C (78366 downstream)																							aaaaagaaagaaaggaaggaag	0.144													4	2	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79428906	79428907	+	In_Frame_Ins	INS	-	CAG	CAG			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79428906_79428907insCAG	uc002kaf.2	+	24	7217_7218	c.7217_7218insCAG	c.(7216-7218)CCC>CCCAGC	p.2410_2411insS	BAHCC1_uc002kae.2_In_Frame_Ins_p.1640_1641insS	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	2410_2411							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			GGCTCAGGCCCCAGCAGCAGCA	0.688													9	4	---	---	---	---	
P4HB	5034	broad.mit.edu	37	17	79812762	79812762	+	Intron	DEL	A	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79812762delA	uc002kbn.1	-						P4HB_uc002kbm.1_Intron	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor						cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			ATCATAATTGAAAAAAAAAAA	0.303													4	4	---	---	---	---	
ASPSCR1	79058	broad.mit.edu	37	17	79967497	79967497	+	Intron	DEL	G	-	-	rs111699244		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79967497delG	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Intron|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron	NM_024083	NP_076988	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GGGGCCCCCCGTGAGGTCTGT	0.652			T	TFE3	alveolar soft part sarcoma								4	2	---	---	---	---	
SBNO2	22904	broad.mit.edu	37	19	1147432	1147432	+	Intron	DEL	G	-	-			TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1147432delG	uc002lrk.3	-						SBNO2_uc010dse.2_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1						macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGGGAGATGGGGGGGGGGG	0.687													51	10	---	---	---	---	
CYP4F3	4051	broad.mit.edu	37	19	15769843	15769843	+	Intron	DEL	G	-	-	rs111660338		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15769843delG	uc002nbj.2	+						CYP4F3_uc010xok.1_Intron|CYP4F3_uc010xol.1_Intron|CYP4F3_uc010xom.1_Intron|CYP4F3_uc002nbk.2_Intron|CYP4F3_uc010xon.1_Intron	NM_000896	NP_000887	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding			ovary(3)	3						GGTCTAGGCTGGGGGGTTGGA	0.577													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22646636	22646651	+	IGR	DEL	GTGTGTGTGTGTGTGT	-	-	rs67204169		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22646636_22646651delGTGTGTGTGTGTGTGT								ZNF98 (41488 upstream) : ZNF492 (170475 downstream)																							TGGCTACCTGgtgtgtgtgtgtgtgtgtgtgtgtgt	0.227													9	4	---	---	---	---	
SLC1A5	6510	broad.mit.edu	37	19	47287187	47287189	+	Intron	DEL	GAG	-	-	rs139412466		TCGA-CH-5792-01	TCGA-CH-5792-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47287187_47287189delGAG	uc002pfs.2	-						SLC1A5_uc010xyh.1_Intron|SLC1A5_uc002pfq.2_Intron|SLC1A5_uc002pfr.2_Intron	NM_005628	NP_005619	Q15758	AAAT_HUMAN	solute carrier family 1 member 5 isoform 1						cellular nitrogen compound metabolic process	integral to plasma membrane|melanosome|membrane fraction	neutral amino acid transmembrane transporter activity|protein binding|receptor activity|sodium:dicarboxylate symporter activity				0		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	GGTGGGAAAAGAGGGGACAAAGT	0.537													4	3	---	---	---	---	
