Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NPHP4	261734	broad.mit.edu	37	1	5964828	5964828	+	Silent	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5964828C>T	uc001alq.1	-	16	2258	c.1992G>A	c.(1990-1992)AAG>AAA	p.K664K	NPHP4_uc001als.1_RNA|NPHP4_uc009vlt.1_RNA|NPHP4_uc001alt.1_RNA|NPHP4_uc009vlu.1_RNA	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	664					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		AATACACAGTCTTTGGCCATG	0.577													18	124	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	13634777	13634777	+	RNA	SNP	G	T	T	rs140981411	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13634777G>T	uc001auz.3	+	4		c.990G>T								Homo sapiens PRAME family member 10, mRNA (cDNA clone MGC:138413 IMAGE:8327676), complete cds.																		CTAGCTGATCGGGACATGGAG	0.507													3	57	---	---	---	---	PASS
C1orf89	79363	broad.mit.edu	37	1	16559013	16559013	+	Silent	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16559013G>T	uc001ayd.2	-	4	941	c.519C>A	c.(517-519)ATC>ATA	p.I173I		NM_030907	NP_112169	Q9BU20	RSG1_HUMAN	hypothetical protein LOC79363	173	Small GTPase-like.				cellular protein localization|cilium assembly|exocytosis|protein transport|regulation of exocytosis|regulation of vesicle fusion|small GTPase mediated signal transduction	cilium|microtubule basal body	GTP binding				0		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;3.2e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0114)|READ - Rectum adenocarcinoma(331;0.0649)		ACTTGGAGCCGATGACCATCC	0.592													3	50	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918794	16918794	+	Translation_Start_Site	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918794G>A	uc009vos.1	-	6	713	c.-175C>T	c.(-177--173)CACGC>CATGC		NBPF1_uc010oce.1_Translation_Start_Site	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGTGGCCAGCGTGCCAGGTAA	0.502													3	16	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17085872	17085872	+	Missense_Mutation	SNP	A	G	G	rs1806514	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17085872A>G	uc010ock.1	-	8	949	c.949T>C	c.(949-951)TGG>CGG	p.W317R	CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						TCGAGGTTCCAGCAGAAGTTC	0.662													3	42	---	---	---	---	PASS
HP1BP3	50809	broad.mit.edu	37	1	21103089	21103089	+	Splice_Site	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21103089C>G	uc001bdw.1	-	4	490	c.350_splice	c.e4+1	p.D117_splice	HP1BP3_uc001bdv.1_Splice_Site_p.D79_splice|HP1BP3_uc010odh.1_Splice_Site_p.D79_splice|HP1BP3_uc001bdy.1_Splice_Site_p.D117_splice|HP1BP3_uc001bdz.2_Splice_Site|HP1BP3_uc001bea.2_Splice_Site_p.D116_splice|HP1BP3_uc001beb.2_Splice_Site_p.E117_splice	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74						nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TAACTCCTTACTCCTTTTTGG	0.368													46	243	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22216543	22216543	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22216543T>A	uc001bfj.2	-	6	545	c.505A>T	c.(505-507)ATC>TTC	p.I169F	HSPG2_uc009vqd.2_Missense_Mutation_p.I169F|HSPG2_uc009vqe.1_Silent_p.S67S	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	169	SEA.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CCGCTGGAGATGACCCTGAGC	0.617													18	147	---	---	---	---	PASS
SLC22A15	55356	broad.mit.edu	37	1	116519322	116519322	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116519322C>A	uc001egb.3	+	1	204	c.74C>A	c.(73-75)GCC>GAC	p.A25D	SLC22A15_uc001ega.2_Missense_Mutation_p.A25D	NM_018420	NP_060890	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	25	Helical; (Potential).				ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TTCCTGCTGGCCGTGCTGCTG	0.716													3	36	---	---	---	---	PASS
MTX1	4580	broad.mit.edu	37	1	155178660	155178660	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155178660G>A	uc001fjb.2	+	1	171	c.65G>A	c.(64-66)AGT>AAT	p.S22N	RAG1AP1_uc010pey.1_Intron|THBS3_uc001fix.2_5'Flank|THBS3_uc009wqi.2_5'Flank|THBS3_uc001fiz.2_5'Flank|THBS3_uc001fiy.2_5'Flank|THBS3_uc010pfu.1_5'Flank|THBS3_uc010pfv.1_5'Flank|THBS3_uc001fja.2_Intron|THBS3_uc009wqj.1_Intron|MTX1_uc001fjc.2_Missense_Mutation_p.S22N	NM_002455	NP_002446	Q13505	MTX1_HUMAN	metaxin 1 isoform 1	22					protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane	protein binding			skin(1)	1	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCCTGGAGCAGTACAGGCCAC	0.697													5	26	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155448258	155448258	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155448258C>A	uc009wqq.2	-	3	4883	c.4403G>T	c.(4402-4404)AGT>ATT	p.S1468I	ASH1L_uc001fkt.2_Missense_Mutation_p.S1468I|ASH1L_uc009wqr.1_Missense_Mutation_p.S1468I	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1468					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AGGAGGAACACTGGGGTAGGT	0.488													35	175	---	---	---	---	PASS
OR6N1	128372	broad.mit.edu	37	1	158735740	158735740	+	Missense_Mutation	SNP	A	G	G	rs857826	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158735740A>G	uc010piq.1	-	1	733	c.733T>C	c.(733-735)TTC>CTC	p.F245L		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					ACCACAGTGAAGTGGGAGGCA	0.537													7	294	---	---	---	---	PASS
FASLG	356	broad.mit.edu	37	1	172635069	172635069	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172635069T>G	uc001gis.2	+	4	916	c.759T>G	c.(757-759)AGT>AGG	p.S253R	FASLG_uc001git.2_3'UTR	NM_000639	NP_000630	P48023	TNFL6_HUMAN	fas ligand	253	Extracellular (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of necroptosis by extracellular signals|induction of necroptosis of activated-T cells|necrotic cell death|negative regulation of angiogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane	cytokine activity			lung(2)|breast(1)	3						ATCTTACCAGTGCTGATCATT	0.473													37	208	---	---	---	---	PASS
NMNAT2	23057	broad.mit.edu	37	1	183273886	183273886	+	Intron	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183273886G>T	uc001gqc.1	-						NMNAT2_uc001gqb.1_5'UTR	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						TATTTGTCTGGTTTTTGCAGC	0.498													6	73	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276291	186276291	+	Silent	SNP	A	G	G	rs151267614	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276291A>G	uc001gru.3	+	7	1491	c.1440A>G	c.(1438-1440)AAA>AAG	p.K480K	PRG4_uc001grt.3_Silent_p.K439K|PRG4_uc009wyl.2_Silent_p.K387K|PRG4_uc009wym.2_Silent_p.K346K|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	480	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|18; approximate.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CCACTCCCAAAGAGCCTGCAC	0.662													6	85	---	---	---	---	PASS
PLXNA2	5362	broad.mit.edu	37	1	208390820	208390820	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208390820C>T	uc001hgz.2	-	2	1206	c.448G>A	c.(448-450)GAG>AAG	p.E150K	PLXNA2_uc001hha.3_Missense_Mutation_p.E204K	NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	150	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TGGGATGGCTCCACCAGGATG	0.582													8	274	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222802376	222802376	+	Missense_Mutation	SNP	A	G	G	rs2936052	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222802376A>G	uc001hnl.2	+	4	1823	c.1814A>G	c.(1813-1815)AAA>AGA	p.K605R	MIA3_uc009xea.1_Missense_Mutation_p.K441R	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	605	Extracellular (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		AATGGGGCCAAACTGCACACG	0.473													5	210	---	---	---	---	PASS
C1orf131	128061	broad.mit.edu	37	1	231362412	231362412	+	Intron	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231362412C>T	uc001hun.1	-						C1orf131_uc001hul.2_Intron|C1orf131_uc001hum.2_Intron|C1orf131_uc010pwd.1_3'UTR	NM_152379	NP_689592	Q8NDD1	CA131_HUMAN	hypothetical protein LOC128061											central_nervous_system(1)|skin(1)	2	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				GCAGCGGCTTCCGGCATTCCA	0.473													13	65	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1168808	1168808	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1168808G>T	uc002qwq.2	+	8	658	c.530G>T	c.(529-531)AGT>ATT	p.S177I	SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	177					central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GACCACAGCAGTGGGGCCTCC	0.488													47	335	---	---	---	---	PASS
FBXO11	80204	broad.mit.edu	37	2	48045734	48045734	+	Intron	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48045734C>T	uc010fbl.2	-						FBXO11_uc002rwe.2_Intron|FBXO11_uc002rwf.2_Intron|FBXO11_uc002rwg.1_3'UTR|FBXO11_uc010fbk.2_Intron	NM_025133	NP_079409	Q86XK2	FBX11_HUMAN	F-box only protein 11 isoform 1						ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|ubiquitin ligase complex	protein binding|protein-arginine N-methyltransferase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CCAGTGGCTTCTGTCCTCACC	0.413													4	12	---	---	---	---	PASS
PROKR1	10887	broad.mit.edu	37	2	68873392	68873392	+	Missense_Mutation	SNP	T	A	A	rs35335568		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68873392T>A	uc010yqj.1	+	1	439	c.439T>A	c.(439-441)TCT>ACT	p.S147T	PROKR1_uc002ses.2_RNA	NM_138964	NP_620414	Q8TCW9	PKR1_HUMAN	G protein-coupled receptor 73	147	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1						GCGCACTGTCTCTCTCTATGT	0.592													8	213	---	---	---	---	PASS
ANKRD39	51239	broad.mit.edu	37	2	97513860	97513860	+	3'UTR	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97513860C>A	uc002sxd.3	-	4						NM_016466	NP_057550	Q53RE8	ANR39_HUMAN	ankyrin repeat domain 39												0						TCTGTCCAGTCTTAAACACTT	0.353													5	6	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98377388	98377388	+	Intron	SNP	A	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98377388A>G	uc002syh.3	-						TMEM131_uc002syg.2_Missense_Mutation_p.S7P	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6						CTTGAAAAAGAAGCAAAGAGA	0.547													8	121	---	---	---	---	PASS
MRPS9	64965	broad.mit.edu	37	2	105706377	105706377	+	Splice_Site	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105706377G>C	uc002tcn.3	+	7	644	c.576_splice	c.e7-1	p.R192_splice		NM_182640	NP_872578	P82933	RT09_HUMAN	mitochondrial ribosomal protein S9 precursor						DNA damage response, detection of DNA damage|translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0						TATTTTAACAGAGACGTGATT	0.303													17	56	---	---	---	---	PASS
RGPD4	285190	broad.mit.edu	37	2	108507263	108507263	+	3'UTR	SNP	A	G	G	rs138225123	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108507263A>G	uc010ywk.1	+	23					RGPD4_uc002tdu.2_3'UTR|RGPD4_uc010ywl.1_RNA	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4						intracellular transport		binding			skin(2)	2						TGGAAGGAATATTTTTATTAA	0.318													3	76	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179438165	179438165	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179438165T>C	uc010zfg.1	-	275	65214	c.64990A>G	c.(64990-64992)ACA>GCA	p.T21664A	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T15359A|TTN_uc010zfi.1_Missense_Mutation_p.T15292A|TTN_uc010zfj.1_Missense_Mutation_p.T15167A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22591							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTAATAGTTGTCACTTCAGGG	0.458													38	183	---	---	---	---	PASS
AAMP	14	broad.mit.edu	37	2	219129209	219129209	+	3'UTR	SNP	T	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219129209T>G	uc002vhk.2	-	11					AAMP_uc002vhj.2_3'UTR|AAMP_uc010fvo.2_3'UTR|AAMP_uc002vhl.2_3'UTR	NM_001087	NP_001078	Q13685	AAMP_HUMAN	angio-associated, migratory cell protein						angiogenesis|cell differentiation|positive regulation of endothelial cell migration|smooth muscle cell migration	cell surface|cytoplasm|plasma membrane	heparin binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGGCAGGGGTCCCTTCGTCC	0.587													12	40	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234366000	234366000	+	Intron	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234366000G>T	uc002vui.1	+						DGKD_uc002vuj.1_Intron|DGKD_uc010fyh.1_Missense_Mutation_p.G736V|DGKD_uc010fyi.1_Intron	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GAGCGGGTGGGCCTGAGCTCA	0.507													7	73	---	---	---	---	PASS
NGLY1	55768	broad.mit.edu	37	3	25792603	25792603	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25792603C>G	uc003cdl.2	-	4	752	c.644G>C	c.(643-645)AGA>ACA	p.R215T	NGLY1_uc010hfg.2_Missense_Mutation_p.R215T|NGLY1_uc003cdm.2_Missense_Mutation_p.R215T|NGLY1_uc011awo.1_Missense_Mutation_p.R173T|NGLY1_uc003cdk.2_RNA	NM_018297	NP_060767	Q96IV0	NGLY1_HUMAN	N-glycanase 1 isoform 1	215					glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding			breast(1)	1						ATCCAATTTTCTAGCTCTCGA	0.308													15	82	---	---	---	---	PASS
XCR1	2829	broad.mit.edu	37	3	46063159	46063159	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46063159C>G	uc003cpe.2	-	3	505	c.281G>C	c.(280-282)GGC>GCC	p.G94A	uc003cpd.1_5'Flank|XCR1_uc003cpf.2_Missense_Mutation_p.G94A	NM_005283	NP_005274	P46094	XCR1_HUMAN	XC chemokine receptor 1	94	Extracellular (Potential).				chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CAGCACCCAGCCCCAGTGGTA	0.547													10	60	---	---	---	---	PASS
HYAL1	3373	broad.mit.edu	37	3	50340402	50340402	+	5'UTR	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50340402C>G	uc003czp.2	-	2					HYAL1_uc003czm.2_Intron|HYAL1_uc003czo.2_Intron|HYAL1_uc003czq.2_5'UTR|HYAL1_uc003czr.2_5'UTR|HYAL1_uc003czn.2_Intron|HYAL1_uc003czs.2_5'UTR|HYAL1_uc003czt.2_5'UTR	NM_033159	NP_149349	Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1 isoform 1							extracellular space|lysosome	hyalurononglucosaminidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)	Hyaluronidase(DB00070)	CGGGACTGGTCGAGGACAACC	0.612													13	46	---	---	---	---	PASS
ITIH3	3699	broad.mit.edu	37	3	52836783	52836783	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52836783T>A	uc003dfv.2	+	13	1706	c.1670T>A	c.(1669-1671)CTC>CAC	p.L557H	ITIH3_uc011bek.1_Intron	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	557					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		ATTGAGCGGCTCTGGGCCTAC	0.607													10	48	---	---	---	---	PASS
EAF2	55840	broad.mit.edu	37	3	121563355	121563355	+	Silent	SNP	T	C	C	rs9884018	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121563355T>C	uc003een.2	+	2	261	c.162T>C	c.(160-162)GGT>GGC	p.G54G	EAF2_uc003eeo.2_5'UTR	NM_018456	NP_060926	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	54	Necessary for interaction with ELL.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding				0				GBM - Glioblastoma multiforme(114;0.0972)		TTGAGGTTGGTGAAGGTGAAC	0.323													7	183	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13601501	13601501	+	Silent	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13601501G>A	uc003gmz.1	-	10	7140	c.7023C>T	c.(7021-7023)TCC>TCT	p.S2341S	BOD1L_uc010idr.1_Silent_p.S1678S	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	2341							DNA binding			ovary(5)|breast(1)	6						CAATGCTGGCGGAAATTGGCA	0.522													10	53	---	---	---	---	PASS
NDST3	9348	broad.mit.edu	37	4	119161795	119161795	+	Silent	SNP	G	A	A	rs617430	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119161795G>A	uc003ibx.2	+	11	2638	c.2235G>A	c.(2233-2235)CCG>CCA	p.P745P		NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	745	Lumenal (Potential).|Heparan sulfate N-sulfotransferase 3.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						GTTTGGTCCCGGGGTGGTATG	0.488													4	118	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175897499	175897499	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175897499G>T	uc003iuc.2	+	5	1493	c.823G>T	c.(823-825)GAG>TAG	p.E275*	ADAM29_uc003iud.2_Nonsense_Mutation_p.E275*|ADAM29_uc010irr.2_Nonsense_Mutation_p.E275*|ADAM29_uc011cki.1_Nonsense_Mutation_p.E275*	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	275	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GTGGAAGTCGGAGAACATTAC	0.413													10	373	---	---	---	---	PASS
LOC285501	285501	broad.mit.edu	37	4	178897079	178897079	+	RNA	SNP	T	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178897079T>A	uc010iru.2	+	5		c.748T>A				NR_028342				Homo sapiens cDNA clone IMAGE:4828874.												0		all_lung(41;6.03e-08)|Lung NSC(41;4.26e-07)|Breast(14;0.00066)|Melanoma(52;0.00168)|Prostate(90;0.0129)|all_hematologic(60;0.0202)|Renal(120;0.0246)|Colorectal(36;0.0508)|Hepatocellular(41;0.236)		all cancers(43;9.24e-25)|Epithelial(43;6.28e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.29e-10)|LUSC - Lung squamous cell carcinoma(1;2.61e-05)|Lung(1;3.22e-05)|GBM - Glioblastoma multiforme(59;0.000185)|Colorectal(24;0.000244)|STAD - Stomach adenocarcinoma(60;0.000777)|COAD - Colon adenocarcinoma(29;0.000884)		CTCTGAAGTATATTTTTTCTA	0.363													13	303	---	---	---	---	PASS
CDH6	1004	broad.mit.edu	37	5	31267702	31267702	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31267702C>G	uc003jhe.1	+	2	448	c.122C>G	c.(121-123)TCT>TGT	p.S41C	CDH6_uc003jhd.1_Missense_Mutation_p.S41C	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein	41					adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						CTGGAGCTCTCTGGAAACAGC	0.483													23	164	---	---	---	---	PASS
CRHBP	1393	broad.mit.edu	37	5	76259198	76259198	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76259198G>T	uc003ker.2	+	6	1004	c.724G>T	c.(724-726)GAC>TAC	p.D242Y		NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	242					female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		GGGAATAGGAGACTTTGTGGA	0.473													64	307	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79041206	79041206	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79041206G>A	uc003kgc.2	+	4	10968	c.10896G>A	c.(10894-10896)ATG>ATA	p.M3632I		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3632	B-box coiled-coil; BBC.|Potential.|Amphipathic helix H2.					perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGCAGAGCATGGACACTGCCA	0.488													19	104	---	---	---	---	PASS
LOX	4015	broad.mit.edu	37	5	121413182	121413182	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121413182C>T	uc003ksu.2	-	1	874	c.499G>A	c.(499-501)GTG>ATG	p.V167M	LOX_uc010jcq.2_5'Flank|LOX_uc011cwk.1_5'Flank|LOX_uc010jcr.2_5'Flank	NM_002317	NP_002308	P28300	LYOX_HUMAN	lysyl oxidase preproprotein	167					protein modification process	extracellular space	copper ion binding|protein-lysine 6-oxidase activity			lung(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		TCGTCGCCCACCATGCCGTCC	0.622													26	133	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140514934	140514934	+	5'UTR	SNP	A	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140514934A>T	uc003liq.2	+	1						NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTCAAGAAAGATCGGATTCGC	0.468													11	36	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149225491	149225491	+	Intron	SNP	A	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149225491A>C	uc003lrc.2	+						PPARGC1B_uc003lrb.1_Missense_Mutation_p.K995N|PPARGC1B_uc003lrd.2_Intron|PPARGC1B_uc003lrf.2_Intron|PPARGC1B_uc003lre.1_Missense_Mutation_p.K974N	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor						estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			AGCCCCTGAAACCCAGCCACA	0.567													13	61	---	---	---	---	PASS
HRH2	3274	broad.mit.edu	37	5	175110224	175110224	+	5'UTR	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175110224G>A	uc003mdd.2	+	1					HRH2_uc003mdc.3_5'UTR	NM_022304	NP_071640	P25021	HRH2_HUMAN	histamine receptor H2 isoform 2						G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)	GGACTGAGCCGTAGAGTCCCA	0.557													54	362	---	---	---	---	PASS
C6orf218	221718	broad.mit.edu	37	6	10430136	10430136	+	RNA	SNP	T	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10430136T>G	uc003myz.2	-	3		c.900A>C				NR_027793				Homo sapiens chromosome 6 open reading frame 218, mRNA (cDNA clone IMAGE:3917693).												0	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.124)				TACGCTTAAGTGTGATCACAG	0.483											OREG0017184	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	58	330	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12124855	12124855	+	Missense_Mutation	SNP	G	A	A	rs2228213	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12124855G>A	uc003nac.2	+	4	5006	c.4827G>A	c.(4825-4827)ATG>ATA	p.M1609I	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1609					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TTGACAGCATGTCTAATTCGC	0.458													7	268	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32023935	32023935	+	Silent	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32023935G>T	uc003nzl.2	-	24	8362	c.8160C>A	c.(8158-8160)ACC>ACA	p.T2720T		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	2778					actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						TGGGGCTGGGGGTCTCTTCCT	0.627													9	66	---	---	---	---	PASS
MDGA1	266727	broad.mit.edu	37	6	37622688	37622688	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37622688C>G	uc003onu.1	-	5	1779	c.600G>C	c.(598-600)AAG>AAC	p.K200N	MDGA1_uc003onw.3_5'Flank	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing	200	Ig-like 2.				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						GGTTCTTCAGCTTCAGGACCT	0.612													15	82	---	---	---	---	PASS
FAM83B	222584	broad.mit.edu	37	6	54735287	54735287	+	Silent	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54735287T>C	uc003pck.2	+	2	359	c.243T>C	c.(241-243)GAT>GAC	p.D81D		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	81										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					GTACTGATGATTCCTGTGATG	0.433													53	329	---	---	---	---	PASS
FUT9	10690	broad.mit.edu	37	6	96651187	96651187	+	Silent	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96651187C>T	uc003pop.3	+	3	497	c.156C>T	c.(154-156)AAC>AAT	p.N52N		NM_006581	NP_006572	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3)	52	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			skin(4)|ovary(1)	5		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		AAATGAAAAACTTCTTTTCCA	0.423													33	163	---	---	---	---	PASS
TIAM2	26230	broad.mit.edu	37	6	155451342	155451342	+	Silent	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155451342C>T	uc003qqb.2	+	6	2258	c.985C>T	c.(985-987)CTG>TTG	p.L329L	TIAM2_uc003qqe.2_Silent_p.L329L	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	329					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GCATGCCAGCCTGAGCAACCG	0.577													15	88	---	---	---	---	PASS
SLC22A3	6581	broad.mit.edu	37	6	160864677	160864677	+	Silent	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160864677G>A	uc003qti.2	+	9	1440	c.1413G>A	c.(1411-1413)TCG>TCA	p.S471S	SLC22A3_uc011efx.1_RNA	NM_021977	NP_068812	O75751	S22A3_HUMAN	solute carrier family 22 member 3	471	Helical; (Potential).					integral to plasma membrane|membrane fraction	protein binding|quaternary ammonium group transmembrane transporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)		TCGGAGTTTCGCTCTGTTCAG	0.378													5	139	---	---	---	---	PASS
UNC93A	54346	broad.mit.edu	37	6	167709633	167709633	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167709633A>T	uc003qvq.2	+	3	558	c.383A>T	c.(382-384)AAG>ATG	p.K128M	UNC93A_uc003qvr.2_Missense_Mutation_p.K128M	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1	128						integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		AAGGCGGGAAAGCGTGGCAAA	0.552													30	219	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168226924	168226924	+	5'Flank	SNP	T	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168226924T>A	uc003qwd.2	+						MLLT4_uc003qwb.1_5'Flank|MLLT4_uc003qwc.1_5'Flank|C6orf124_uc003qwa.2_RNA	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GCCCATCGGATCCGGCGCCGC	0.692			T	MLL	AL								15	177	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	3681627	3681627	+	Silent	SNP	A	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3681627A>T	uc003smx.2	+	4	742	c.603A>T	c.(601-603)ACA>ACT	p.T201T		NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	201	Ig-like C2-type 2.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGAGGAAAACAGTTTCTCAAG	0.463													7	203	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55273231	55273231	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55273231G>T	uc003tqk.2	+	28	3800	c.3554G>T	c.(3553-3555)GGC>GTC	p.G1185V	EGFR_uc011kco.1_Missense_Mutation_p.G1132V	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	1185	Cytoplasmic (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AAGCCAAATGGCATCTTTAAG	0.527		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			9	74	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117432054	117432054	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117432054G>A	uc003vjf.2	-	4	1288	c.1196C>T	c.(1195-1197)CCC>CTC	p.P399L		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	399	Pro-rich.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GGGAAGTGGGGGTGTGCTACT	0.527													92	272	---	---	---	---	PASS
ANKRD7	56311	broad.mit.edu	37	7	117864870	117864870	+	5'UTR	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117864870G>A	uc003vji.2	+	1						NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7						male gonad development						0						GGGAAAGGCTGCAGCCTGCAC	0.557													25	80	---	---	---	---	PASS
ARHGEF10	9639	broad.mit.edu	37	8	1851472	1851472	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1851472G>A	uc003wpr.2	+	16	1854	c.1676G>A	c.(1675-1677)GGC>GAC	p.G559D	ARHGEF10_uc003wpq.1_Missense_Mutation_p.G583D|ARHGEF10_uc003wps.2_Missense_Mutation_p.G521D|ARHGEF10_uc003wpt.2_Missense_Mutation_p.G435D|ARHGEF10_uc003wpv.2_Missense_Mutation_p.G292D|ARHGEF10_uc010lre.2_Missense_Mutation_p.G239D	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	584	DH.				centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		ACCTCCAAAGGCCACCCCGAC	0.537													43	221	---	---	---	---	PASS
FLJ10661	286042	broad.mit.edu	37	8	8096026	8096026	+	RNA	SNP	T	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8096026T>G	uc011kwt.1	+	8		c.1221T>G			FLJ10661_uc010lrq.2_Intron|FLJ10661_uc003wsf.3_Intron	NR_024362				Homo sapiens cDNA FLJ60033 complete cds, highly similar to Protein FAM86A.												0						TGACCCCTGATGCATAGCCCT	0.667													4	4	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62490754	62490754	+	Intron	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62490754G>T	uc011leg.1	-						ASPH_uc003xuj.2_Intron|ASPH_uc003xuo.2_Intron|uc003xuk.2_5'UTR	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	GGTTCGGCCCGCCTGCCTCCA	0.463													2	4	---	---	---	---	PASS
KCNS2	3788	broad.mit.edu	37	8	99440309	99440309	+	Silent	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99440309G>T	uc003yin.2	+	2	452	c.102G>T	c.(100-102)ACG>ACT	p.T34T		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	34	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			GCTCGCACACGCTGCTGCGCT	0.672													3	71	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32541532	32541532	+	Silent	SNP	A	G	G	rs12348918	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32541532A>G	uc003zrb.2	-	3	3158	c.2991T>C	c.(2989-2991)GAT>GAC	p.D997D	TOPORS_uc003zrc.2_Silent_p.D930D	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	997					DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		CTTCTCTTACATCGAGAGTTT	0.423													8	363	---	---	---	---	PASS
ZCCHC7	84186	broad.mit.edu	37	9	37126633	37126633	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37126633A>G	uc003zzq.2	+	2	477	c.304A>G	c.(304-306)AGA>GGA	p.R102G	ZCCHC7_uc011lqh.1_Intron|ZCCHC7_uc011lqi.1_Missense_Mutation_p.R101G|ZCCHC7_uc010mlt.2_Missense_Mutation_p.R101G|ZCCHC7_uc003zzs.1_Missense_Mutation_p.R101G	NM_032226	NP_115602	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	102							nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(29;0.0137)		CAGTATTTATAGATGTAAAGG	0.393													13	448	---	---	---	---	PASS
HSDL2	84263	broad.mit.edu	37	9	115200783	115200783	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115200783T>C	uc004bga.1	+	7	764	c.671T>C	c.(670-672)ATT>ACT	p.I224T	HSDL2_uc011lwv.1_Missense_Mutation_p.I103T|HSDL2_uc004bgb.1_Intron|HSDL2_uc004bgc.1_Missense_Mutation_p.I151T|HSDL2_uc011lww.1_Missense_Mutation_p.I19T	NM_032303	NP_115679	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	224						peroxisome	oxidoreductase activity|sterol binding				0						GTTGATATCATTGCAGATGCA	0.368													21	126	---	---	---	---	PASS
C9orf117	286207	broad.mit.edu	37	9	130473624	130473624	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130473624C>A	uc004brn.1	+	4	744	c.704C>A	c.(703-705)ACC>AAC	p.T235N	PTRH1_uc004brm.2_Intron|C9orf117_uc010mxl.1_RNA	NM_001012502	NP_001012520	Q5JU67	CI117_HUMAN	hypothetical protein LOC286207	235											0						AACGGCATTACCCTGCAGATG	0.557													11	93	---	---	---	---	PASS
LCN2	3934	broad.mit.edu	37	9	130913928	130913928	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130913928G>A	uc004bto.1	+	3	360	c.287G>A	c.(286-288)TGT>TAT	p.C96Y	LCN2_uc011map.1_Missense_Mutation_p.C96Y	NM_005564	NP_005555	P80188	NGAL_HUMAN	lipocalin 2 precursor	96					apoptosis|innate immune response|regulation of apoptosis|siderophore transport		iron ion binding|transporter activity				0						AAAAAGAAGTGTGACTACTGG	0.582													21	117	---	---	---	---	PASS
RAPGEF1	2889	broad.mit.edu	37	9	134501446	134501446	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134501446G>C	uc004cbc.2	-	10	1644	c.1514C>G	c.(1513-1515)GCG>GGG	p.A505G	RAPGEF1_uc004cbb.2_Missense_Mutation_p.A523G|RAPGEF1_uc010mzm.2_RNA|RAPGEF1_uc010mzn.2_Missense_Mutation_p.A510G|RAPGEF1_uc004cbd.2_Missense_Mutation_p.A510G	NM_005312	NP_005303	Q13905	RPGF1_HUMAN	guanine nucleotide-releasing factor 2 isoform a	505					activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		AGCAAAGGGCGCGTAGGGGAC	0.582													17	92	---	---	---	---	PASS
C10orf47	254427	broad.mit.edu	37	10	11908743	11908743	+	Missense_Mutation	SNP	G	A	A	rs142957936		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11908743G>A	uc001ikx.2	+	3	506	c.352G>A	c.(352-354)GGG>AGG	p.G118R	uc001iky.1_Intron	NM_153256	NP_694988	Q86WR7	CJ047_HUMAN	hypothetical protein LOC254427	118										central_nervous_system(1)	1						ACCTGGCGCCGGGGAAGCCGA	0.637													20	64	---	---	---	---	PASS
RASSF4	83937	broad.mit.edu	37	10	45467201	45467201	+	Intron	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45467201G>C	uc001jbo.2	+						RASSF4_uc001jbp.2_Missense_Mutation_p.V46L|RASSF4_uc009xmn.2_Intron|RASSF4_uc001jbq.2_Intron	NM_032023	NP_114412	Q9H2L5	RASF4_HUMAN	Ras association domain family 4						cell cycle|signal transduction		protein binding			large_intestine(1)	1						AGGAGTACATGTGTGTCTTTC	0.383													16	101	---	---	---	---	PASS
ANXA8	653145	broad.mit.edu	37	10	47133556	47133556	+	Intron	SNP	A	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47133556A>T	uc001jed.3	-						uc001jef.2_Intron|LOC728643_uc001jeg.2_RNA			P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						tcattaccaaatccattacag	0.119													6	83	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48389852	48389852	+	Silent	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48389852C>T	uc001jez.2	-	1	1140	c.1026G>A	c.(1024-1026)ACG>ACA	p.T342T		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	342	4 X approximate tandem repeats.|2.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	GGTCCACCAGCGTGTAGTAGT	0.637													17	82	---	---	---	---	PASS
SUPV3L1	6832	broad.mit.edu	37	10	70954956	70954956	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70954956T>G	uc001jpe.1	+	7	921	c.866T>G	c.(865-867)GTA>GGA	p.V289G	SUPV3L1_uc010qjd.1_Missense_Mutation_p.V158G	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor	289	Helicase ATP-binding.				DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						GAAGTGGCTGTAATTGATGAA	0.363													12	60	---	---	---	---	PASS
NEUROG3	50674	broad.mit.edu	37	10	71332506	71332506	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71332506G>T	uc001jpp.2	-	2	452	c.294C>A	c.(292-294)AAC>AAA	p.N98K		NM_020999	NP_066279	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	98	Helix-loop-helix motif.			N -> D (in Ref. 1; CAB45384).	central nervous system development|endocrine pancreas development|peripheral nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	transcription coactivator activity				0						CCGAGTTGAGGTTGTGCATTC	0.642													7	44	---	---	---	---	PASS
CSNK2A1P	283106	broad.mit.edu	37	11	11374269	11374269	+	Missense_Mutation	SNP	A	G	G	rs2071460	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11374269A>G	uc001mjp.2	-	1	636	c.398T>C	c.(397-399)ATT>ACT	p.I133T	GALNTL4_uc001mjo.2_Intron	NM_177559	NP_808227			casein kinase II alpha 1 subunit isoform a												0						GTAAAATCGAATATCATAGTC	0.408													5	253	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57069703	57069703	+	Intron	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57069703T>C	uc001njr.2	-						TNKS1BP1_uc001njp.2_Intron|TNKS1BP1_uc001njq.2_Splice_Site_p.Q134_splice|TNKS1BP1_uc001njs.2_Intron	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1						nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				GGTGTCCTGCTTGGGGCAATG	0.652													6	29	---	---	---	---	PASS
SLC43A3	29015	broad.mit.edu	37	11	57182087	57182087	+	Splice_Site	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57182087C>A	uc001nkg.2	-	11	1470	c.1060_splice	c.e11+1	p.G354_splice	PRG2_uc001nke.2_Splice_Site_p.G253_splice|SLC43A3_uc001nkh.2_Splice_Site_p.G354_splice|SLC43A3_uc010rjr.1_Splice_Site_p.G367_splice|SLC43A3_uc009yme.2_Splice_Site_p.G354_splice|SLC43A3_uc001nki.2_Splice_Site_p.G354_splice	NM_014096	NP_054815	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3						transmembrane transport	integral to membrane				central_nervous_system(1)	1						CCGCATCTCACCTGTCTTTCT	0.512													19	253	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58979678	58979678	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58979678G>A	uc001nnu.3	-	1	817	c.661C>T	c.(661-663)CTC>TTC	p.L221F		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	221	MACPF.|Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				GAGGCCCTGAGGTGGTCCTCC	0.572													12	98	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65271551	65271551	+	RNA	SNP	A	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65271551A>G	uc010roh.1	+	1		c.6319A>G			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TATTGACCTTATATAGGGAAG	0.368													7	45	---	---	---	---	PASS
ACTN3	89	broad.mit.edu	37	11	66314404	66314404	+	5'UTR	SNP	T	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66314404T>A	uc001oio.1	+	1					ACTN3_uc010rpi.1_Intron|ZDHHC24_uc001oim.1_5'Flank|ZDHHC24_uc009yrg.1_5'Flank|ZDHHC24_uc001oin.1_5'Flank	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3						focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0						AGGAGCCCGATCGAGATGATG	0.557													5	13	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85435730	85435730	+	Intron	SNP	C	T	T	rs550404	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85435730C>T	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Silent_p.P590P|SYTL2_uc001pbb.2_Silent_p.P590P|SYTL2_uc001pbc.2_Silent_p.P590P|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CAGTTATTAACGGAGCCTCGG	0.438													6	206	---	---	---	---	PASS
LOC100288778	100288778	broad.mit.edu	37	12	90953	90953	+	3'UTR	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90953C>G	uc010scy.1	+	10					LOC100288778_uc010scz.1_RNA|LOC100288778_uc010sdd.1_3'UTR|LOC100288778_uc010sde.1_3'UTR|LOC100288778_uc010sdf.1_3'UTR|LOC100288778_uc010sdg.1_3'UTR|LOC100288778_uc010sdh.1_RNA					SubName: Full=Actin nucleation promoting factor; Flags: Fragment;												0						ACCTTCCCCCCCAGACCCAGA	0.627													5	21	---	---	---	---	PASS
ART4	420	broad.mit.edu	37	12	14993378	14993378	+	Splice_Site	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14993378C>A	uc001rcl.1	-	2	1219	c.853_splice	c.e2+1	p.A285_splice	ART4_uc009zid.1_Intron|ART4_uc009zie.1_Intron|ART4_uc001rcm.1_Missense_Mutation_p.G285V	NM_021071	NP_066549	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 precursor						arginine metabolic process|protein ADP-ribosylation	anchored to membrane|plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity				0						ATAAAGAATACCTTTTAGCAG	0.388													17	109	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49443872	49443872	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49443872C>A	uc001rta.3	-	11	3499	c.3499G>T	c.(3499-3501)GAG>TAG	p.E1167*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1167	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GGGTAGACCTCCATAGGGGTC	0.617			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			28	148	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53449548	53449548	+	Intron	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53449548G>C	uc001sbp.2	+						uc001sbk.1_5'Flank|TENC1_uc001sbl.2_Intron|TENC1_uc001sbm.2_Missense_Mutation_p.C267S|TENC1_uc001sbn.2_Intron|TENC1_uc001sbo.1_Intron|TENC1_uc001sbq.2_5'Flank|TENC1_uc001sbr.2_5'Flank	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase						intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						CCTCATCCCTGTCTCTCTGTC	0.597													9	390	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62946846	62946846	+	Silent	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62946846G>A	uc001sre.2	+	24	3493	c.3102G>A	c.(3100-3102)GTG>GTA	p.V1034V	MON2_uc009zqj.2_Silent_p.V1034V|MON2_uc010ssl.1_Silent_p.V962V|MON2_uc010ssm.1_Silent_p.V1011V|MON2_uc010ssn.1_Silent_p.V1034V|MON2_uc001srf.2_Silent_p.V797V	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	1035					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		AACTATGTGTGGATCCCCGTC	0.453													8	326	---	---	---	---	PASS
HELB	92797	broad.mit.edu	37	12	66725338	66725338	+	Silent	SNP	A	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66725338A>G	uc001sti.2	+	12	3103	c.3075A>G	c.(3073-3075)GTA>GTG	p.V1025V	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	1025					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		CTGATGGAGTAGATACAGATG	0.438													26	133	---	---	---	---	PASS
GRIP1	23426	broad.mit.edu	37	12	66765694	66765694	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66765694G>A	uc001stk.2	-	22	2877	c.2636C>T	c.(2635-2637)TCG>TTG	p.S879L	GRIP1_uc010sta.1_Missense_Mutation_p.S823L|GRIP1_uc001stj.2_Missense_Mutation_p.S646L|GRIP1_uc001stl.1_Missense_Mutation_p.S756L|GRIP1_uc001stm.2_Missense_Mutation_p.S864L	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	931					androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CGTGCTCCCCGACATGATTGT	0.517													24	110	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114804033	114804033	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114804033G>T	uc001tvo.2	-	8	1414	c.919C>A	c.(919-921)CCA>ACA	p.P307T	TBX5_uc001tvp.2_Missense_Mutation_p.P307T|TBX5_uc001tvq.2_Missense_Mutation_p.P257T|TBX5_uc010syv.1_Missense_Mutation_p.P307T	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	307					cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GGGTTGGGTGGAGGCAGGAGG	0.532													25	109	---	---	---	---	PASS
XPO4	64328	broad.mit.edu	37	13	21417991	21417991	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21417991A>C	uc001unq.3	-	5	527	c.491T>G	c.(490-492)TTG>TGG	p.L164W	XPO4_uc010tcr.1_Missense_Mutation_p.L90W	NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4	164					protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		AAATTCACTCAATAGCGCAGT	0.348													32	165	---	---	---	---	PASS
TPTE2P3	220115	broad.mit.edu	37	13	53151292	53151292	+	RNA	SNP	A	C	C	rs146809843	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53151292A>C	uc001vgw.2	+	20		c.2057A>C				NR_002793				Homo sapiens TPTE and PTEN homologous inositol lipid phosphatase pseudogene, mRNA (cDNA clone IMAGE:5298506), with apparent retained intron.												0						TAAAAAGATTAGTTATTTATT	0.358													3	5	---	---	---	---	PASS
TPTE2P3	220115	broad.mit.edu	37	13	53151293	53151293	+	RNA	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53151293G>A	uc001vgw.2	+	20		c.2058G>A				NR_002793				Homo sapiens TPTE and PTEN homologous inositol lipid phosphatase pseudogene, mRNA (cDNA clone IMAGE:5298506), with apparent retained intron.												0						AAAAAGATTAGTTATTTATTC	0.358													3	5	---	---	---	---	PASS
C14orf166B	145497	broad.mit.edu	37	14	77302633	77302633	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77302633A>T	uc001xsx.2	+	4	588	c.474A>T	c.(472-474)CAA>CAT	p.Q158H	C14orf166B_uc010asn.1_Translation_Start_Site|C14orf166B_uc001xsw.2_RNA|C14orf166B_uc010aso.1_RNA|C14orf166B_uc010tvg.1_RNA|C14orf166B_uc010tvh.1_RNA	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	158											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		AGATGCTACAAGAGAACTACT	0.552													8	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	96103099	96103099	+	IGR	SNP	A	G	G	rs4905366	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96103099A>G								GLRX5 (92044 upstream) : TCL6 (13736 downstream)																							TCACCTCACCATCTGCTCAGG	0.567													24	907	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102505453	102505453	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102505453G>T	uc001yks.2	+	60	11486	c.11322G>T	c.(11320-11322)AAG>AAT	p.K3774N		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	3774	Potential.|AAA 5 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						AGAACCTGAAGAGAGAGGCTG	0.537													21	130	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369362	22369362	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369362C>A	uc010tzu.1	+	1	787	c.787C>A	c.(787-789)CCA>ACA	p.P263T	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TTATGCTCGCCCATTTGACTC	0.418													39	616	---	---	---	---	PASS
USP8	9101	broad.mit.edu	37	15	50792946	50792946	+	3'UTR	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50792946C>T	uc001zym.3	+	21					USP8_uc001zyl.3_3'UTR|USP8_uc001zyn.3_3'UTR|USP8_uc010ufh.1_3'UTR|USP8_uc001zyp.3_3'UTR|USP50_uc001zyq.3_3'UTR	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8						cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		CTCACTGACTCGTGTGTTATC	0.433													4	16	---	---	---	---	PASS
RAB11A	8766	broad.mit.edu	37	15	66169865	66169865	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66169865C>A	uc002apk.2	+	2	364	c.236C>A	c.(235-237)GCA>GAA	p.A79E	RAB11A_uc010ujk.1_Missense_Mutation_p.A79E	NM_004663	NP_004654	P62491	RB11A_HUMAN	Ras-related protein Rab-11A	79					cell cycle|cytokinesis|neuron projection development|plasma membrane to endosome transport|protein localization in plasma membrane|small GTPase mediated signal transduction|vesicle-mediated transport	cleavage furrow|plasma membrane|recycling endosome membrane|trans-Golgi network	GTP binding|GTPase activity|syntaxin binding				0						ATAACATCAGCGTAAGTCTCA	0.393													4	69	---	---	---	---	PASS
LMAN1L	79748	broad.mit.edu	37	15	75111702	75111702	+	Intron	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75111702T>C	uc002ayt.1	+						LMAN1L_uc010bkd.2_3'UTR|LMAN1L_uc010ulo.1_3'UTR|LMAN1L_uc010bke.1_Intron	NM_021819	NP_068591	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like precursor							ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding				0						TGGGGTGGCGTCAGCCACTTC	0.388													6	38	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85055915	85055915	+	RNA	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85055915T>C	uc002bkm.2	-	6		c.645A>G				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						TCCTGTCTCCTGTTCAGGAGA	0.527													3	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	15023280	15023280	+	Splice_Site	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15023280T>C	uc010uzk.1	+	6	1123	c.847_splice	c.e6+2	p.G283_splice	NPIP_uc002dcx.3_Splice_Site					SubName: Full=cDNA FLJ57488, highly similar to Polycystin-1;																		CGCTGGCGGGTGAGGAGATCG	0.701													4	20	---	---	---	---	PASS
GPR139	124274	broad.mit.edu	37	16	20043984	20043984	+	Silent	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20043984G>T	uc002dgu.1	-	2	297	c.135C>A	c.(133-135)ATC>ATA	p.I45I	GPR139_uc010vaw.1_5'UTR	NM_001002911	NP_001002911	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	45	Helical; Name=1; (Potential).					integral to membrane|plasma membrane				ovary(2)	2						TCACTGTCAAGATATTTGCTG	0.478													4	48	---	---	---	---	PASS
GSG1L	146395	broad.mit.edu	37	16	27802719	27802719	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27802719T>G	uc002doz.2	-	7	1053	c.968A>C	c.(967-969)CAG>CCG	p.Q323P	GSG1L_uc010bya.1_Missense_Mutation_p.Q272P|GSG1L_uc010bxz.1_Missense_Mutation_p.Q186P|GSG1L_uc002doy.2_Missense_Mutation_p.Q168P	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1	323						integral to membrane				ovary(1)	1						GACCCAGCACTGTCGGTTCAG	0.642													14	96	---	---	---	---	PASS
GSG1L	146395	broad.mit.edu	37	16	27802748	27802748	+	Silent	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27802748G>C	uc002doz.2	-	7	1024	c.939C>G	c.(937-939)TCC>TCG	p.S313S	GSG1L_uc010bya.1_Silent_p.S262S|GSG1L_uc010bxz.1_Silent_p.S176S|GSG1L_uc002doy.2_Silent_p.S158S	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1	313						integral to membrane				ovary(1)	1						CTTCCTGTGCGGAGCTCCGGG	0.637													9	72	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46712857	46712857	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46712857G>C	uc002eef.3	-	6	817	c.718C>G	c.(718-720)CAG>GAG	p.Q240E	VPS35_uc002eed.2_Missense_Mutation_p.Q61E|VPS35_uc002eee.2_Missense_Mutation_p.Q201E	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	240					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				ATATAAACCTGTTTGTAACGT	0.308													39	188	---	---	---	---	PASS
CDH5	1003	broad.mit.edu	37	16	66432423	66432423	+	Missense_Mutation	SNP	T	C	C	rs1049970	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66432423T>C	uc002eom.3	+	10	1706	c.1550T>C	c.(1549-1551)ATC>ACC	p.I517T		NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	517	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		TTCAAATTCATCTTGAATACT	0.368													3	87	---	---	---	---	PASS
GLOD4	51031	broad.mit.edu	37	17	674590	674590	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:674590G>A	uc002frv.2	-	6	639	c.563C>T	c.(562-564)GCT>GTT	p.A188V	GLOD4_uc002frt.2_Missense_Mutation_p.A117V|GLOD4_uc002fru.2_Missense_Mutation_p.A173V|GLOD4_uc010vqc.1_Missense_Mutation_p.A164V	NM_016080	NP_057164	Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4	188						mitochondrion					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GCCCAGCAAAGCCCTTTGCTT	0.343													51	396	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7673934	7673934	+	Silent	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7673934G>A	uc002giu.1	+	25	4172	c.4158G>A	c.(4156-4158)AAG>AAA	p.K1386K		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1386	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TACCCTACAAGGATAAGGGCC	0.552													42	182	---	---	---	---	PASS
CCDC144B	284047	broad.mit.edu	37	17	18528456	18528456	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18528456G>T	uc002gub.1	-	1	390	c.305C>A	c.(304-306)CCT>CAT	p.P102H	CCDC144B_uc002gua.3_RNA|CCDC144B_uc010vyc.1_RNA|CCDC144B_uc002guc.1_Missense_Mutation_p.P102H	NM_182568	NP_872374			coiled-coil domain containing 144B											ovary(1)|skin(1)	2						AGTGTCTCCAGGAGCCAAGAC	0.637													23	272	---	---	---	---	PASS
CCDC144B	284047	broad.mit.edu	37	17	18528457	18528457	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18528457G>T	uc002gub.1	-	1	389	c.304C>A	c.(304-306)CCT>ACT	p.P102T	CCDC144B_uc002gua.3_RNA|CCDC144B_uc010vyc.1_RNA|CCDC144B_uc002guc.1_Missense_Mutation_p.P102T	NM_182568	NP_872374			coiled-coil domain containing 144B											ovary(1)|skin(1)	2						GTGTCTCCAGGAGCCAAGACG	0.637													21	272	---	---	---	---	PASS
FAM18B	51030	broad.mit.edu	37	17	18708981	18708981	+	3'UTR	SNP	C	T	T	rs56889377	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18708981C>T	uc002gum.2	+	7					FAM18B_uc002gun.2_3'UTR	NM_016078	NP_057162	Q9NYZ1	F18B1_HUMAN	hypothetical protein LOC51030							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (53;0.0872)|READ - Rectum adenocarcinoma(1115;0.0967)		GGAGTGTTGGCTTTGTTTTTC	0.343													3	85	---	---	---	---	PASS
FAM27L	284123	broad.mit.edu	37	17	21826233	21826233	+	RNA	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21826233G>T	uc002gyz.2	+	2		c.343G>T				NR_028336				Homo sapiens family with sequence similarity 27-like, mRNA (cDNA clone MGC:35151 IMAGE:5169482), complete cds.												0				UCEC - Uterine corpus endometrioid carcinoma (53;0.11)|BRCA - Breast invasive adenocarcinoma(1;0.00463)		GCCACACCACGATACAGTCTT	0.542													14	85	---	---	---	---	PASS
ANKRD13B	124930	broad.mit.edu	37	17	27934857	27934857	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27934857G>A	uc002hei.2	+	2	325	c.212G>A	c.(211-213)GGC>GAC	p.G71D	ANKRD13B_uc002heh.2_5'UTR|ANKRD13B_uc002hej.2_RNA	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	71	ANK 1.										0						CTGGCGCACGGCGCAGACGTG	0.701													16	72	---	---	---	---	PASS
TAF15	8148	broad.mit.edu	37	17	34174030	34174030	+	3'UTR	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34174030C>G	uc002hkd.2	+	16					TAF15_uc002hkc.2_3'UTR	NM_139215	NP_631961	Q92804	RBP56_HUMAN	TBP-associated factor 15 isoform 1						positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TTCCTCGTGGCCTCTTCTTGG	0.438			T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								13	88	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	39565994	39565994	+	RNA	SNP	T	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39565994T>G	uc002hwo.1	+	2		c.1415T>G								Homo sapiens cDNA FLJ41849 fis, clone NT2RI3003409.																		GGGGTCTGGGTCAATGACATC	0.458													2	6	---	---	---	---	PASS
MAPT	4137	broad.mit.edu	37	17	44067382	44067382	+	Missense_Mutation	SNP	T	C	C	rs2258689		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44067382T>C	uc002ijr.3	+	8	1641	c.1321T>C	c.(1321-1323)TAC>CAC	p.Y441H	MAPT_uc010dau.2_Missense_Mutation_p.Y441H|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1	441					cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				CTCTCCTAAATACGTCTCTTC	0.542													8	418	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60140573	60140573	+	Silent	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60140573G>A	uc002izo.2	-	2	233	c.156C>T	c.(154-156)CCC>CCT	p.P52P		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	52					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						TGCTCAAAATGGGGTCTTCTT	0.453													67	287	---	---	---	---	PASS
CSH1	1442	broad.mit.edu	37	17	61973754	61973754	+	Intron	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61973754C>G	uc002jcs.1	-						CSH2_uc002jck.2_Intron|CSH1_uc002jcp.1_5'Flank|CSH1_uc002jcq.1_5'Flank|CSH1_uc002jcr.1_5'UTR|CSH1_uc002jct.1_Intron|CSH1_uc002jcu.1_Intron|CSH1_uc002jcv.1_Intron|CSH1_uc002jcw.2_Intron|CSH1_uc002jcy.2_Intron	NM_001317	NP_001308	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 1 isoform 1						female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding			skin(1)	1						TGGCGATACTCACATTCATAA	0.527									Russell-Silver_syndrome				13	45	---	---	---	---	PASS
SSTR2	6752	broad.mit.edu	37	17	71165834	71165834	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71165834C>G	uc002jje.2	+	2	736	c.376C>G	c.(376-378)CAG>GAG	p.Q126E		NM_001050	NP_001041	P30874	SSR2_HUMAN	somatostatin receptor 2	126	Helical; Name=3; (Potential).				digestion|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	PDZ domain binding|somatostatin receptor activity				0			LUSC - Lung squamous cell carcinoma(166;0.197)			TGGCATCAATCAGTTCACCAG	0.587													25	104	---	---	---	---	PASS
C17orf86	654434	broad.mit.edu	37	17	75085556	75085556	+	Intron	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75085556G>C	uc002jtk.3	+						SCARNA16_uc002jtl.2_RNA	NR_027058				Homo sapiens clone FLB3442 PRO0872 mRNA, complete cds.												0						TGATGATCATGTATGATACTG	0.398													35	145	---	---	---	---	PASS
NPTX1	4884	broad.mit.edu	37	17	78449346	78449346	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78449346G>T	uc002jyp.1	-	2	775	c.617C>A	c.(616-618)ACC>AAC	p.T206N		NM_002522	NP_002513	Q15818	NPTX1_HUMAN	neuronal pentraxin I precursor	206					central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GTGCAGGGAGGTCAGGGCGGT	0.687													6	46	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5445182	5445182	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5445182T>G	uc002kmt.1	-	4	529	c.443A>C	c.(442-444)AAA>ACA	p.K148T	EPB41L3_uc010wzh.1_Missense_Mutation_p.K148T|EPB41L3_uc002kmu.1_Missense_Mutation_p.K148T|EPB41L3_uc010dkq.1_Missense_Mutation_p.K39T|EPB41L3_uc010dks.1_Missense_Mutation_p.K170T|EPB41L3_uc002kmv.1_Missense_Mutation_p.K39T	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	148	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						AAAGTAGTCTTTCTCTAGCAA	0.408													48	278	---	---	---	---	PASS
AQP4	361	broad.mit.edu	37	18	24436133	24436133	+	3'UTR	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24436133C>G	uc002kwa.2	-	5					AQP4_uc002kvz.2_3'UTR	NM_001650	NP_001641	P55087	AQP4_HUMAN	aquaporin 4 isoform a						cellular response to interferon-gamma|excretion|nervous system development	cytoplasm|external side of plasma membrane|integral to plasma membrane	water channel activity				0	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					AATCTGAGGACAGTTCTAAGG	0.398													35	197	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42530401	42530401	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42530401G>A	uc010dni.2	+	4	1392	c.1096G>A	c.(1096-1098)GAA>AAA	p.E366K		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	366						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGACAATACAGAAGGGAAAAG	0.453									Schinzel-Giedion_syndrome				33	149	---	---	---	---	PASS
MRO	83876	broad.mit.edu	37	18	48327815	48327815	+	Silent	SNP	G	A	A	rs2276186	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48327815G>A	uc002lew.3	-	6	783	c.489C>T	c.(487-489)GCC>GCT	p.A163A	MRO_uc010xdn.1_Intron|MRO_uc010dpa.2_Silent_p.A177A|MRO_uc010dpb.2_Intron|MRO_uc010dpc.2_Intron|MRO_uc002lex.3_Silent_p.A163A	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a	163	HEAT.					nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		ATTTCCTCCCGGCAAAGGCAG	0.463													10	350	---	---	---	---	PASS
PIP5K1C	23396	broad.mit.edu	37	19	3643243	3643243	+	Silent	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3643243G>A	uc002lyj.1	-	13	1704	c.1647C>T	c.(1645-1647)TAC>TAT	p.Y549Y	PIP5K1C_uc010xhq.1_Silent_p.Y549Y|PIP5K1C_uc010xhr.1_Silent_p.Y549Y	NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	549					axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		TCGCCCACCTGTACCGCGGCT	0.657													14	64	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8212299	8212299	+	Silent	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8212299G>A	uc002mjf.2	-	1	87	c.66C>T	c.(64-66)GCC>GCT	p.A22A		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	22						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						TGCACAACAGGGCCGACCAGG	0.692													4	16	---	---	---	---	PASS
ZNF85	7639	broad.mit.edu	37	19	21132414	21132414	+	Missense_Mutation	SNP	C	A	A	rs144723751	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21132414C>A	uc002npg.3	+	4	1221	c.1094C>A	c.(1093-1095)ACT>AAT	p.T365N	ZNF85_uc010ecn.2_Missense_Mutation_p.T300N|ZNF85_uc010eco.2_Missense_Mutation_p.T313N|ZNF85_uc002npi.2_Missense_Mutation_p.T306N	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	365						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1						GTAATTCATACTGGAGAGAAA	0.358													4	106	---	---	---	---	PASS
CLIP3	25999	broad.mit.edu	37	19	36508303	36508303	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36508303C>T	uc010eeq.1	-	11	1783	c.1501G>A	c.(1501-1503)GTG>ATG	p.V501M	uc002ocy.2_Intron|CLIP3_uc002ocz.1_Missense_Mutation_p.V501M	NM_015526	NP_056341	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	501	GoLD.				chaperone-mediated protein transport|fat cell differentiation|membrane biogenesis|negative regulation of microtubule polymerization|peptidyl-L-cysteine S-palmitoylation|positive regulation of apoptosis|positive regulation of endocytosis|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose transport|positive regulation of protein phosphorylation	early endosome membrane|Golgi stack|membrane raft|microsome|plasma membrane|recycling endosome membrane|trans-Golgi network membrane	ganglioside binding|microtubule binding			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			ACTTGATGCACTTTTTTGGCT	0.547													3	79	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40384050	40384050	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40384050C>G	uc002omp.3	-	21	9568	c.9560G>C	c.(9559-9561)GGC>GCC	p.G3187A		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	3187	TIL 7.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCACTGGCAGCCCTCCACACA	0.662													22	48	---	---	---	---	PASS
BCKDHA	593	broad.mit.edu	37	19	41903833	41903833	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41903833C>A	uc002oqq.2	+	1	130	c.101C>A	c.(100-102)GCT>GAT	p.A34D	CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron|EXOSC5_uc002oqo.2_5'Flank|BCKDHA_uc002oqp.1_5'UTR|BCKDHA_uc002oqr.2_Missense_Mutation_p.A34D|BCKDHA_uc010xvz.1_Intron	NM_000709	NP_000700	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha	34					branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0						CGGGGACTGGCTAGATCTGTG	0.602													6	57	---	---	---	---	PASS
CEACAM4	1089	broad.mit.edu	37	19	42125660	42125660	+	3'UTR	SNP	T	C	C	rs1041994	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42125660T>C	uc002orh.1	-	7						NM_001817	NP_001808	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to plasma membrane|membrane fraction					0						CTGGGAGCTTTGGGGACGCTC	0.577													6	144	---	---	---	---	PASS
DMRTC2	63946	broad.mit.edu	37	19	42354650	42354650	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42354650G>C	uc002ors.2	+	8	956	c.873G>C	c.(871-873)CAG>CAC	p.Q291H	DMRTC2_uc002orr.1_Missense_Mutation_p.Q219H|DMRTC2_uc010xwe.1_Missense_Mutation_p.Q342H	NM_001040283	NP_001035373	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	291	Pro-rich.				cell differentiation|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0						GGCAGCTGCAGCAAGAGGCAG	0.632													8	94	---	---	---	---	PASS
ATP1A3	478	broad.mit.edu	37	19	42492276	42492276	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42492276T>C	uc002osg.2	-	4	323	c.169A>G	c.(169-171)AAA>GAA	p.K57E	ATP1A3_uc010xwf.1_Missense_Mutation_p.K68E|ATP1A3_uc010xwg.1_Missense_Mutation_p.K27E|ATP1A3_uc010xwh.1_Missense_Mutation_p.K70E|ATP1A3_uc002osh.2_Missense_Mutation_p.K57E	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	57	Cytoplasmic (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2						TCCTGGGCTTTGCTGTGGGTC	0.627													20	113	---	---	---	---	PASS
BCAM	4059	broad.mit.edu	37	19	45316807	45316807	+	Silent	SNP	C	T	T	rs3810140	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45316807C>T	uc002ozu.2	+	6	758	c.714C>T	c.(712-714)GCC>GCT	p.A238A	BCAM_uc002ozt.1_Silent_p.A238A	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	238	Extracellular (Potential).|Ig-like V-type 2.				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				TCCACTGCGCCGCCCACTACA	0.697													4	93	---	---	---	---	PASS
GLTSCR1	29998	broad.mit.edu	37	19	48176998	48176998	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48176998C>A	uc002phh.3	+	4	257	c.63C>A	c.(61-63)GAC>GAA	p.D21E		NM_015711	NP_056526	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	21							protein binding			pancreas(3)	3		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CCCTCAATGACTTCTTGCATG	0.353													28	132	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52619794	52619794	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52619794G>C	uc002pym.2	-	4	906	c.623C>G	c.(622-624)ACT>AGT	p.T208S	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	208					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		TTTCTCTGTAGTATGTATCCT	0.393													6	294	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54725995	54725995	+	Silent	SNP	G	A	A	rs61187720	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54725995G>A	uc002qef.1	-	4	474	c.363C>T	c.(361-363)TAC>TAT	p.Y121Y	LILRB3_uc002qee.1_Silent_p.Y121Y|LILRB3_uc002qeh.1_Silent_p.Y121Y|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Silent_p.Y121Y|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Silent_p.Y121Y|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	121	Extracellular (Potential).|Ig-like C2-type 2.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGGTTTGCTGTAGGCTCCTA	0.602													4	8	---	---	---	---	PASS
ZNF17	7565	broad.mit.edu	37	19	57931923	57931923	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57931923G>A	uc002qoo.1	+	3	1294	c.1063G>A	c.(1063-1065)GAA>AAA	p.E355K	ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Missense_Mutation_p.E357K	NM_006959	NP_008890	P17021	ZNF17_HUMAN	zinc finger protein 17	355					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		TCACACTGGAGAAAGGCCTTT	0.388													42	187	---	---	---	---	PASS
STK35	140901	broad.mit.edu	37	20	2083973	2083973	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2083973C>T	uc010gak.2	+	2	854	c.854C>T	c.(853-855)TCG>TTG	p.S285L	STK35_uc010zpu.1_Missense_Mutation_p.S152L|STK35_uc002wfw.3_Missense_Mutation_p.S152L	NM_080836	NP_543026	Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	285	Protein kinase.					cytoplasm|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						AACAAGAGCTCGCAGCTTTAC	0.647													6	63	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29633992	29633992	+	Intron	SNP	A	G	G			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633992A>G	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TAAAATATTCAGAGGAAATGC	0.308													6	76	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32379198	32379198	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32379198G>T	uc002wzy.2	+	15	2460	c.2440G>T	c.(2440-2442)GAG>TAG	p.E814*	ZNF341_uc002wzx.2_Nonsense_Mutation_p.E807*|ZNF341_uc010geq.2_Nonsense_Mutation_p.E724*|ZNF341_uc010ger.2_RNA|ZNF341_uc002wzz.2_Nonsense_Mutation_p.E241*	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	814					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CGCGGAAACTGAGCTGGTGGT	0.711													7	69	---	---	---	---	PASS
CYYR1	116159	broad.mit.edu	37	21	27840880	27840880	+	Silent	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27840880G>T	uc002ymd.2	-	4	727	c.405C>A	c.(403-405)ACC>ACA	p.T135T	CYYR1_uc011ack.1_RNA|CYYR1_uc002yme.2_Silent_p.T136T	NM_052954	NP_443186	Q96J86	CYYR1_HUMAN	cysteine and tyrosine-rich 1 protein precursor	135	Cytoplasmic (Potential).					integral to membrane					0						GACCCTGTGGGGTGGGGGAGT	0.532													20	101	---	---	---	---	PASS
GGT5	2687	broad.mit.edu	37	22	24621251	24621251	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24621251C>T	uc002zzo.3	-	10	1882	c.1465G>A	c.(1465-1467)GGG>AGG	p.G489R	GGT5_uc002zzp.3_Missense_Mutation_p.G490R|GGT5_uc002zzr.3_Missense_Mutation_p.G457R|GGT5_uc002zzq.3_Missense_Mutation_p.G457R|GGT5_uc011ajm.1_Missense_Mutation_p.G413R	NM_004121	NP_004112	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform b	489	Extracellular (Potential).				glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3						CCGCCAGCCCCGCCAATCACT	0.622													26	92	---	---	---	---	PASS
TOM1	10043	broad.mit.edu	37	22	35742925	35742925	+	Silent	SNP	T	G	G	rs743810	byFrequency	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35742925T>G	uc003ann.2	+	14	1412	c.1287T>G	c.(1285-1287)GGT>GGG	p.G429G	TOM1_uc011ami.1_Silent_p.G396G|TOM1_uc011amj.1_Silent_p.G272G|TOM1_uc003ans.2_Silent_p.G272G|TOM1_uc011amk.1_Silent_p.G391G|TOM1_uc003anp.2_Silent_p.G429G|TOM1_uc011aml.1_Silent_p.G384G|TOM1_uc003ano.2_RNA|TOM1_uc003anq.2_Silent_p.G423G|TOM1_uc003anr.2_Silent_p.G272G	NM_005488	NP_005479	O60784	TOM1_HUMAN	target of myb1 isoform 1	429					endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1						CTTCCCAGGGTAATGATGCGG	0.662													5	224	---	---	---	---	PASS
APOL1	8542	broad.mit.edu	37	22	36661373	36661373	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36661373G>T	uc003apf.2	+	6	659	c.491G>T	c.(490-492)GGG>GTG	p.G164V	APOL1_uc011amn.1_Missense_Mutation_p.G41V|APOL1_uc003apc.2_RNA|APOL1_uc003ape.2_Missense_Mutation_p.G180V|APOL1_uc011amo.1_Missense_Mutation_p.G41V|APOL1_uc011amp.1_Missense_Mutation_p.G164V|APOL1_uc011amq.1_Missense_Mutation_p.G146V|APOL1_uc010gwx.2_Missense_Mutation_p.G41V	NM_003661	NP_003652	O14791	APOL1_HUMAN	apolipoprotein L1 isoform a precursor	164					cholesterol metabolic process|cytolysis|innate immune response|killing of cells of other organism|lipid transport|lipoprotein metabolic process	high-density lipoprotein particle|very-low-density lipoprotein particle	chloride channel activity|lipid binding|protein binding			breast(2)|ovary(1)	3						CTTGCAGATGGGGTTCAGAAG	0.522													39	215	---	---	---	---	PASS
TBC1D22A	25771	broad.mit.edu	37	22	47432981	47432981	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47432981C>T	uc003bib.2	+	11	1351	c.1216C>T	c.(1216-1218)CAC>TAC	p.H406Y	TBC1D22A_uc010haf.2_Missense_Mutation_p.H376Y|TBC1D22A_uc003bic.2_Missense_Mutation_p.H347Y|TBC1D22A_uc003bie.2_Missense_Mutation_p.H328Y|TBC1D22A_uc003bid.2_RNA|TBC1D22A_uc010hag.2_RNA|TBC1D22A_uc003bif.2_Missense_Mutation_p.H359Y	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	406	Rab-GAP TBC.					intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		AGTGCACCGGCACCTGGACCA	0.597													17	110	---	---	---	---	PASS
SSX8	280659	broad.mit.edu	37	X	52662529	52662529	+	RNA	SNP	A	G	G	rs150583046	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52662529A>G	uc011mob.1	+	8		c.978A>G				NR_027250				Homo sapiens cDNA FLJ56587 complete cds, highly similar to Protein SSX8.												0						TGTTCACAACAGTGAAAAGTT	0.438													3	31	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73046744	73046744	+	RNA	SNP	T	C	C			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73046744T>C	uc004ebn.2	+	1		c.34705T>C			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						TCTTAAGACTTCTAACTCAAG	0.502													43	70	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73046745	73046745	+	RNA	SNP	C	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73046745C>T	uc004ebn.2	+	1		c.34706C>T			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						CTTAAGACTTCTAACTCAAGC	0.502													46	68	---	---	---	---	PASS
MAGEA11	4110	broad.mit.edu	37	X	148798036	148798036	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148798036T>A	uc004fdq.2	+	5	992	c.890T>A	c.(889-891)CTC>CAC	p.L297H	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Missense_Mutation_p.L268H	NM_005366	NP_005357	P43364	MAGAB_HUMAN	melanoma antigen family A, 11 isoform a	297	MAGE.					cytoplasm|nucleus	protein binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					TCCCTCAACCTCTCTTATGAT	0.498													56	78	---	---	---	---	PASS
PRAMEF16	654348	broad.mit.edu	37	1	13497435	13497435	+	Intron	DEL	G	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13497435delG	uc001aux.2	+							NM_001045480	NP_001038945	Q5VWM1	PRA16_HUMAN	PRAME family member 16												0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCATTGCAGGTTACTACAA	0.473													11	5	---	---	---	---	
EPB41	2035	broad.mit.edu	37	1	29338635	29338635	+	Intron	DEL	T	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29338635delT	uc001brm.1	+						EPB41_uc001brg.1_Intron|EPB41_uc001brh.1_Intron|EPB41_uc001bri.1_Intron|EPB41_uc001brj.1_Intron|EPB41_uc009vtk.1_Intron|EPB41_uc001brk.2_Intron|EPB41_uc001brl.1_Intron|EPB41_uc009vtl.1_Intron|EPB41_uc009vtm.1_Intron	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		ATTTTGTTGATTTTTTTTTTT	0.358													4	2	---	---	---	---	
AK2	204	broad.mit.edu	37	1	33486747	33486747	+	Intron	DEL	A	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33486747delA	uc001bwp.1	-						uc001bwn.2_Intron|AK2_uc001bwo.1_Intron|AK2_uc010ohq.1_Intron|AK2_uc009vud.1_Intron|AK2_uc010ohr.1_Intron|AK2_uc001bwq.1_Intron	NM_001625	NP_001616	P54819	KAD2_HUMAN	adenylate kinase 2 isoform a						nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				actcccatctaaaaaaaaaaa	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	47668232	47668232	+	IGR	DEL	A	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47668232delA								PDZK1IP1 (12461 upstream) : TAL1 (13731 downstream)																							ACCAAAAAACAAAAAAAAAAA	0.189													4	2	---	---	---	---	
TTC4	7268	broad.mit.edu	37	1	55186887	55186893	+	Frame_Shift_Del	DEL	CCTGCCA	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55186887_55186893delCCTGCCA	uc001cxx.3	+	4	496_502	c.443_449delCCTGCCA	c.(442-450)CCCTGCCACfs	p.P148fs	C1orf175_uc001cxq.2_RNA|TTC4_uc001cxw.3_Frame_Shift_Del_p.P148fs|TTC4_uc001cxv.2_Frame_Shift_Del_p.P159fs	NM_004623	NP_004614	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	148_150	TPR 2.						binding				0						AAGCTAAAACCCTGCCACCTCAAAGCA	0.357													85	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	104210776	104210778	+	IGR	DEL	CTG	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104210776_104210778delCTG								AMY1A (3604 upstream) : None (None downstream)																							GAATATGGGACTGCTGGAAAGTC	0.414													35	7	---	---	---	---	
KIAA1324	57535	broad.mit.edu	37	1	109726258	109726259	+	Intron	INS	-	CTTCCTTT	CTTCCTTT	rs150843023	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109726258_109726259insCTTCCTTT	uc001dwq.2	+						KIAA1324_uc009wex.1_Intron|KIAA1324_uc009wey.2_Intron|KIAA1324_uc010ovg.1_Intron	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor						macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		ttccttccttcctAacagagtc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121484808	121484808	+	IGR	DEL	T	-	-	rs66514954		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121484808delT								LOC647121 (171122 upstream) : None (None downstream)																							gaacgttcccttagacagagc	0.000													1194	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121484810	121484813	+	IGR	DEL	AGAC	-	-	rs28810386		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121484810_121484813delAGAC								LOC647121 (171124 upstream) : None (None downstream)																							acgttcccttagacagagcagatt	0.000													1187	8	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145579572	145579573	+	Intron	INS	-	T	T	rs66680279		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145579572_145579573insT	uc001emp.3	+						PIAS3_uc010oyy.1_Intron|PIAS3_uc001eoc.1_Intron|PIAS3_uc001eod.1_5'Flank	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		Cttcttttttgttttttttttt	0.188													9	4	---	---	---	---	
RASAL2	9462	broad.mit.edu	37	1	178433459	178433461	+	In_Frame_Del	DEL	CAG	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178433459_178433461delCAG	uc001glr.2	+	13	3001_3003	c.2876_2878delCAG	c.(2875-2880)ACAGCA>ACA	p.A961del	RASAL2_uc001glq.2_In_Frame_Del_p.A1102del|RASAL2_uc009wxc.2_In_Frame_Del_p.A475del	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	961					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						GTAGAGAGGACAGCAGCCTGGGT	0.483													103	14	---	---	---	---	
EPRS	2058	broad.mit.edu	37	1	220207221	220207222	+	Intron	INS	-	T	T	rs71871201		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220207221_220207222insT	uc001hly.1	-						EPRS_uc010puf.1_Intron|EPRS_uc001hlz.1_Intron|EPRS_uc009xdt.1_Intron	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase						glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	ATGCTTTCTGCTTTTTTTTTTT	0.322													3	4	---	---	---	---	
LCLAT1	253558	broad.mit.edu	37	2	30785373	30785374	+	Intron	INS	-	AAAAC	AAAAC	rs148957012	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30785373_30785374insAAAAC	uc002rnj.2	+						LCLAT1_uc010ymp.1_Intron|LCLAT1_uc002rnk.1_Intron|LCLAT1_uc002rnl.2_Intron|LCLAT1_uc010ymq.1_Intron	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1						multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2						ttcatctcAAAaaaacaaaaca	0.000													4	2	---	---	---	---	
UGP2	7360	broad.mit.edu	37	2	64082655	64082655	+	Intron	DEL	T	-	-	rs71393335		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64082655delT	uc002scm.2	+						UGP2_uc002scl.2_Intron|UGP2_uc010ypx.1_Intron	NM_006759	NP_006750	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2 isoform a						glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0						tctttttctgttttttttttt	0.159													5	3	---	---	---	---	
ATOH8	84913	broad.mit.edu	37	2	85990944	85990945	+	Intron	INS	-	GT	GT	rs138097885	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85990944_85990945insGT	uc002sqn.2	+						ATOH8_uc002sqm.3_Intron	NM_032827	NP_116216	Q96SQ7	ATOH8_HUMAN	atonal homolog 8						cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						GATGAGCTGACgtgtgtgtgtg	0.386													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95528084	95528084	+	IGR	DEL	T	-	-	rs11332663		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95528084delT								ANKRD20B (5264 upstream) : TEKT4 (9148 downstream)																							GTGGGTACTGTTAAGATTTAA	0.552													1	6	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100055101	100055102	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100055101_100055102insT	uc002tad.2	-	6	1386_1387	c.1174_1175insA	c.(1174-1176)ATGfs	p.M392fs	REV1_uc002tac.2_Frame_Shift_Ins_p.M392fs|REV1_uc002tae.1_Frame_Shift_Ins_p.M371fs	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1	392					DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						GCCTGTTTTCATTTTTTTTAAC	0.351								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					263	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133018715	133018715	+	IGR	DEL	T	-	-	rs66735050		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133018715delT								NCRNA00164 (3173 upstream) : GPR39 (155432 downstream)																							GGCGGGGTGGTGGGGGGTGCC	0.532													5	3	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141298313	141298314	+	Intron	INS	-	C	C	rs148238992	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141298313_141298314insC	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTAGTGCACAACAGGAGGGTAA	0.396										TSP Lung(27;0.18)			5	4	---	---	---	---	
UBP1	7342	broad.mit.edu	37	3	33453380	33453380	+	Intron	DEL	T	-	-	rs150973041		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33453380delT	uc003cfq.3	-						UBP1_uc003cfr.3_Intron|UBP1_uc010hga.2_Intron	NM_014517	NP_055332	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a) isoform a						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			kidney(2)	2						TTGTATTTCATTTTTTTTAAG	0.209													3	4	---	---	---	---	
LRRC2	79442	broad.mit.edu	37	3	46575394	46575394	+	Intron	DEL	T	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46575394delT	uc010hji.2	-						LRRC2_uc003cpu.3_Intron	NM_024512	NP_078788	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2											ovary(1)	1		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		ctttcttttctttttttttta	0.000													4	2	---	---	---	---	
RAD54L2	23132	broad.mit.edu	37	3	51694293	51694294	+	Intron	INS	-	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51694293_51694294insT	uc011bdt.1	+						RAD54L2_uc003dbh.2_Intron|RAD54L2_uc011bdu.1_Intron|RAD54L2_uc003dbj.2_Intron	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2							nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		TTTTTGTGTGGTTTTTTTTTTT	0.163													3	3	---	---	---	---	
DNAH1	25981	broad.mit.edu	37	3	52384744	52384744	+	Intron	DEL	C	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52384744delC	uc011bef.1	+						DNAH1_uc003ddt.1_Intron	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1						ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATTTCAGAGGCCAGGGCTCCA	0.622													4	2	---	---	---	---	
MRPS22	56945	broad.mit.edu	37	3	139075854	139075864	+	3'UTR	DEL	TAAAAATATTT	-	-	rs15155		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139075854_139075864delTAAAAATATTT	uc003etb.2	+	8					MRPS22_uc003etc.2_RNA|MRPS22_uc003etd.2_3'UTR|MRPS22_uc003ete.2_3'UTR	NM_020191	NP_064576	P82650	RT22_HUMAN	mitochondrial ribosomal protein S22							mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(2)|skin(1)	3						TGCAGCTTCCtaaaaatattttaaaaataca	0.308													100	11	---	---	---	---	
SDAD1	55153	broad.mit.edu	37	4	76888458	76888458	+	Frame_Shift_Del	DEL	C	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76888458delC	uc003hje.3	-	12	1136	c.1017delG	c.(1015-1017)TTGfs	p.L339fs	SDAD1_uc003hjf.3_Frame_Shift_Del_p.L242fs|SDAD1_uc011cbr.1_Frame_Shift_Del_p.L302fs	NM_018115	NP_060585	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	339					protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GAAACCTTTGCAAAAAGGGAT	0.418													60	15	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	100009952	100009953	+	5'Flank	INS	-	GG	GG	rs145470085	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100009952_100009953insGG	uc003hui.2	-						ADH5_uc003huk.1_5'Flank|uc003hum.1_5'Flank|uc003hul.1_5'Flank	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	GGGCGGGGCGTGGGGGGGGCTT	0.723													12	7	---	---	---	---	
CCNA2	890	broad.mit.edu	37	4	122742456	122742457	+	Intron	INS	-	AA	AA			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122742456_122742457insAA	uc003iec.3	-							NM_001237	NP_001228	P20248	CCNA2_HUMAN	cyclin A						cell division|mitosis|mitotic cell cycle G2/M transition DNA damage checkpoint|Ras protein signal transduction|regulation of cyclin-dependent protein kinase activity	cytoplasm|nucleoplasm	protein kinase binding			ovary(1)	1						GTTAATGAGGGAAAAAAAAAAA	0.332													5	3	---	---	---	---	
HSPA4L	22824	broad.mit.edu	37	4	128724723	128724724	+	Intron	INS	-	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128724723_128724724insT	uc003ifm.2	+						HSPA4L_uc010iny.1_Intron|HSPA4L_uc011cgr.1_Intron	NM_014278	NP_055093	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like						protein folding|response to unfolded protein	cytoplasm|nucleus	ATP binding|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						aGAGGTTTTTCTTTTTTTTTTG	0.302													103	7	---	---	---	---	
CCDC127	133957	broad.mit.edu	37	5	217077	217079	+	Intron	DEL	AAG	-	-	rs72398211		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:217077_217079delAAG	uc003jam.1	-						SDHA_uc003jan.2_5'Flank|SDHA_uc011clv.1_5'Flank|SDHA_uc003jao.3_5'Flank|SDHA_uc011clw.1_5'Flank|SDHA_uc003jap.3_5'Flank	NM_145265	NP_660308	Q96BQ5	CC127_HUMAN	coiled-coil domain containing 127												0			all cancers(22;0.0236)|Lung(60;0.113)			acgggattcaaagaagaaaaaaa	0.044													5	5	---	---	---	---	
MOCS2	4338	broad.mit.edu	37	5	52394685	52394685	+	Intron	DEL	T	-	-	rs3842048		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52394685delT	uc011cqf.1	-						MOCS2_uc003joz.2_Intron	NM_176806	NP_789776	O96033	MOC2A_HUMAN	molybdopterin synthase small subunit MOCS2A						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex	nucleotide binding				0		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				GTTTTAAACATTTTTTTTTCT	0.343													4	2	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70820367	70820368	+	Intron	INS	-	AAT	AAT	rs146090263	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70820367_70820368insAAT	uc003kbp.1	+						BDP1_uc003kbo.2_Intron|BDP1_uc003kbq.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AGTGTAACAACGAGAGAAATCT	0.327													3	3	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131306104	131306105	+	Intron	INS	-	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131306104_131306105insT	uc010jdo.1	-						ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Intron|ACSL6_uc003kvy.1_Intron|ACSL6_uc003kwb.2_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Intron|ACSL6_uc003kvw.1_Intron|ACSL6_uc010jdn.1_Intron	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAGAAGTGCTAttttttttttt	0.257													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15125392	15125393	+	IGR	INS	-	G	G	rs56663577		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15125392_15125393insG								CD83 (988246 upstream) : JARID2 (120341 downstream)																							gaaggaaggaaggaaggaagga	0.000													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32547001	32547001	+	Intron	DEL	C	-	-	rs67419769		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32547001delC	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TCCTGAGTCTCCCCTGAGCCA	0.448													5	3	---	---	---	---	
ENPP3	5169	broad.mit.edu	37	6	132004313	132004313	+	Intron	DEL	A	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132004313delA	uc003qcu.3	+						ENPP3_uc010kfq.2_Intron|ENPP3_uc003qcv.2_Intron	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		GTATGCTTTTAAAAAACATTC	0.338													156	21	---	---	---	---	
ICA1	3382	broad.mit.edu	37	7	8192427	8192429	+	Intron	DEL	CCA	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8192427_8192429delCCA	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		accatcacctccaccaccaccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61968770	61968770	+	IGR	DEL	G	-	-	rs61713499		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61968770delG								None (None upstream) : LOC643955 (782902 downstream)																							ttgaaacactgtttttgcgga	0.000													130	9	---	---	---	---	
ZP3	7784	broad.mit.edu	37	7	76070128	76070129	+	Intron	INS	-	T	T	rs11459370		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76070128_76070129insT	uc003ufd.3	+						ZP3_uc003ufc.3_Intron|ZP3_uc003ufe.2_Intron	NM_001110354	NP_001103824	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 isoform 1						binding of sperm to zona pellucida|blastocyst formation|egg coat formation|humoral immune response mediated by circulating immunoglobulin|intracellular protein transport|negative regulation of binding of sperm to zona pellucida|negative regulation of transcription, DNA-dependent|oocyte development|phosphatidylinositol-mediated signaling|positive regulation of acrosomal vesicle exocytosis|positive regulation of acrosome reaction|positive regulation of antral ovarian follicle growth|positive regulation of calcium ion import|positive regulation of calcium ion transport via store-operated calcium channel activity|positive regulation of humoral immune response|positive regulation of interferon-gamma production|positive regulation of interleukin-4 production|positive regulation of leukocyte migration|positive regulation of ovarian follicle development|positive regulation of phosphatidylinositol biosynthetic process|positive regulation of protein kinase activity|positive regulation of protein kinase B signaling cascade|positive regulation of T cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of type IV hypersensitivity|protein kinase C signaling cascade	endoplasmic reticulum|extracellular space|Golgi apparatus|integral to membrane|multivesicular body|outer acrosomal membrane|perinuclear region of cytoplasm|plasma membrane|proteinaceous extracellular matrix	acrosin binding|manganese ion transmembrane transporter activity|receptor activity|sugar binding				0						GGCAGCCAGGGAGATCTGCTGT	0.421													4	3	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100230357	100230357	+	Intron	DEL	G	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100230357delG	uc003uvv.1	-						TFR2_uc010lhc.1_Intron|TFR2_uc003uvu.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					aaaaaaaaaagaacctttttt	0.000													8	4	---	---	---	---	
CTTNBP2	83992	broad.mit.edu	37	7	117396508	117396508	+	Intron	DEL	G	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117396508delG	uc003vjf.2	-							NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2											ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AGCACAGGGTGGGGGGGCTTG	0.542													48	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30778987	30778987	+	IGR	DEL	A	-	-	rs146807720		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30778987delA								TEX15 (32765 upstream) : PURG (74334 downstream)																							TGATTTCTACAAAAAAAAAAA	0.159													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50103352	50103355	+	IGR	DEL	CCTC	-	-	rs77568781		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50103352_50103355delCCTC								C8orf22 (114711 upstream) : SNTG1 (718994 downstream)																							ttctttccttcctccctccctccc	0.098													5	5	---	---	---	---	
PXDNL	137902	broad.mit.edu	37	8	52412401	52412415	+	Intron	DEL	AATTGCTTCAGCTGA	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52412401_52412415delAATTGCTTCAGCTGA	uc003xqu.3	-							NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AAGAATTAGCAATTGCTTCAGCTGAAATTATGAAT	0.363													94	10	---	---	---	---	
SLC30A8	169026	broad.mit.edu	37	8	118165350	118165350	+	Intron	DEL	A	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118165350delA	uc003yoh.2	+						SLC30A8_uc010mcz.2_Intron|SLC30A8_uc011lia.1_Intron|SLC30A8_uc003yog.2_Intron	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8						insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TAGAGTGAGCAATAACAGCAG	0.493													60	9	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141799738	141799753	+	Intron	DEL	TGATTTCTTTAAAAAT	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141799738_141799753delTGATTTCTTTAAAAAT	uc003yvu.2	-						PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TTTAGATACGTGATTTCTTTAAAAATTGGATTCTAC	0.394													71	12	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20995360	20995360	+	Intron	DEL	A	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20995360delA	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		AGGGTAACTTAAAAAAAAAAA	0.239													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69845788	69845788	+	IGR	DEL	T	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69845788delT								LOC100133920 (180839 upstream) : FOXD4L5 (329921 downstream)																							TAATTTGTTATTTTTATTTCT	0.299													4	2	---	---	---	---	
GAPVD1	26130	broad.mit.edu	37	9	128113082	128113086	+	Frame_Shift_Del	DEL	TGCGC	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128113082_128113086delTGCGC	uc010mwx.2	+	23	3880_3884	c.3554_3558delTGCGC	c.(3553-3558)ATGCGCfs	p.M1185fs	GAPVD1_uc004bpp.2_Frame_Shift_Del_p.M1194fs|GAPVD1_uc004bpq.2_Frame_Shift_Del_p.M1167fs|GAPVD1_uc004bpr.2_Frame_Shift_Del_p.M1146fs|GAPVD1_uc004bps.2_Frame_Shift_Del_p.M1140fs|GAPVD1_uc004bpt.2_Frame_Shift_Del_p.M200fs	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1185_1186					endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CAAGAAACAATGCGCTGTGTGTGCC	0.361													264	32	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385340	42385362	+	IGR	DEL	GAATTATCTAATGCAATCGAATA	-	-	rs66510027		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385340_42385362delGAATTATCTAATGCAATCGAATA								None (None upstream) : LOC441666 (441953 downstream)																							gaatcgaagggaattatctaatgcaatcgaatagaattatcga	0.000													156	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385707	42385722	+	IGR	DEL	AATGGAATCATCATTA	-	-	rs33914712		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385707_42385722delAATGGAATCATCATTA								None (None upstream) : LOC441666 (441593 downstream)																							aatggaatcgaatggaatcatcattaaatggaatca	0.042													70	8	---	---	---	---	
FAM99B	100132464	broad.mit.edu	37	11	1707866	1707881	+	5'Flank	DEL	CTTCTTCCCTCCCTCA	-	-	rs113231874		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1707866_1707881delCTTCTTCCCTCCCTCA	uc010qxa.1	-						uc001ltz.1_5'Flank	NR_026642				Homo sapiens family with sequence similarity 99, member B (FAM99B), non-coding RNA.												0						tccttccttccttcttccctccctcacttccttcct	0.236													4	2	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14101781	14101782	+	Intron	INS	-	T	T	rs11432678		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14101781_14101782insT	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		TAttttttttcttttttttttt	0.163													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	92026148	92026148	+	IGR	DEL	C	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92026148delC								None (None upstream) : FAT3 (59114 downstream)																							ttgtgaatagccacagcctgg	0.005													4	2	---	---	---	---	
VWF	7450	broad.mit.edu	37	12	6166774	6166775	+	Intron	INS	-	T	T	rs71973052		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6166774_6166775insT	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	cctcggTAGACTTTTTTTTTTT	0.252													3	3	---	---	---	---	
PDE3A	5139	broad.mit.edu	37	12	20706079	20706080	+	Intron	INS	-	T	T	rs145227642		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20706079_20706080insT	uc001reh.1	+							NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	GTTTGTCTTCCttttttttttt	0.342													2	4	---	---	---	---	
LARP4	113251	broad.mit.edu	37	12	50847189	50847190	+	Intron	INS	-	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50847189_50847190insT	uc001rwp.1	+						LARP4_uc001rwo.1_Intron|LARP4_uc001rwq.1_Intron|LARP4_uc001rwr.1_Intron|LARP4_uc001rws.1_Intron|LARP4_uc009zlr.1_Intron|LARP4_uc001rwt.1_Intron|LARP4_uc001rwm.2_Intron|LARP4_uc001rwn.2_Intron	NM_052879	NP_443111	Q71RC2	LARP4_HUMAN	c-Mpl binding protein isoform a								nucleotide binding|RNA binding			ovary(1)	1						aattaaatgtattttttaaaat	0.252													36	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	89462620	89462623	+	IGR	DEL	AAGG	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89462620_89462623delAAGG								KITLG (488382 upstream) : DUSP6 (279216 downstream)																							ggaaggaagaaaggaaggaaggaa	0.118													8	5	---	---	---	---	
BRCA2	675	broad.mit.edu	37	13	32910661	32910662	+	Frame_Shift_Ins	INS	-	A	A			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32910661_32910662insA	uc001uub.1	+	11	2396_2397	c.2169_2170insA	c.(2167-2172)AGCAAAfs	p.S723fs		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	723_724	Interaction with NPM1.				cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ATCCAAAAAGCAAAAAAGTTTC	0.376			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			87	25	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50299782	50299783	+	Intron	INS	-	T	T	rs35089210		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50299782_50299783insT	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GCCAACCCTACttttttttttt	0.178													4	3	---	---	---	---	
MTMR10	54893	broad.mit.edu	37	15	31251013	31251024	+	Intron	DEL	AGTTACACAACA	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31251013_31251024delAGTTACACAACA	uc001zfh.1	-						MTMR10_uc010azx.1_Intron|MTMR10_uc001zfi.1_Intron|MTMR10_uc001zfj.2_Intron|MTMR10_uc001zfk.2_Intron	NM_017762	NP_060232	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10								phosphatase activity			ovary(1)	1		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		AACTCACTGTAGTTACACAACAAGTAAAACTA	0.363													88	22	---	---	---	---	
SGK269	79834	broad.mit.edu	37	15	77407550	77407566	+	Frame_Shift_Del	DEL	CAGCAAGGAAATGACCA	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77407550_77407566delCAGCAAGGAAATGACCA	uc002bcm.2	-	6	4481_4497	c.4173_4189delTGGTCATTTCCTTGCTG	c.(4171-4191)TGTGGTCATTTCCTTGCTGAAfs	p.C1391fs		NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	1391_1397	Protein kinase.				cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		TTAGGGACTTCAGCAAGGAAATGACCACAGTCCTGCT	0.479													218	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46391827	46391849	+	IGR	DEL	GATGATTCCACTCGAGTCCATTC	-	-	rs9708865		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46391827_46391849delGATGATTCCACTCGAGTCCATTC								None (None upstream) : ANKRD26P1 (111400 downstream)																							tccattcgatgatgattccactcgagtccattcgatgattcca	0.000													57	7	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58540061	58540062	+	Intron	DEL	TC	-	-	rs72499708		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58540061_58540062delTC	uc002eno.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc002enm.2_Intron|NDRG4_uc010vif.1_Intron|NDRG4_uc010cdk.2_Intron|NDRG4_uc010vig.1_Intron|NDRG4_uc010vih.1_Intron|NDRG4_uc010vii.1_Intron|NDRG4_uc002enp.2_Intron|NDRG4_uc002enq.1_5'UTR	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						tgtgtgtgtgtctgtgtgtgtg	0.307													4	4	---	---	---	---	
GSDMB	55876	broad.mit.edu	37	17	38062942	38062943	+	Intron	INS	-	C	C	rs35196450		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38062942_38062943insC	uc010cwj.2	-						GSDMB_uc010cwi.2_Intron|GSDMB_uc010cwk.2_Intron|GSDMB_uc010cwl.2_Intron|GSDMB_uc010cwm.2_Intron|GSDMB_uc002htg.2_Intron|GSDMB_uc002hth.2_Intron|GSDMB_uc010wem.1_Intron	NM_001042471	NP_001035936	Q8TAX9	GSDMB_HUMAN	gasdermin B isoform 1							cytoplasm				breast(1)|pancreas(1)	2						tgtccaggccacacccccacaa	0.045													3	4	---	---	---	---	
GOSR2	9570	broad.mit.edu	37	17	45097005	45097006	+	Intron	DEL	TA	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45097005_45097006delTA	uc010wkh.1	+						uc010wki.1_RNA	NM_004287	NP_004278	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2 isoform A						cellular membrane fusion|ER to Golgi vesicle-mediated transport|protein transport	Golgi membrane|integral to membrane	transporter activity			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(9;0.102)			GATAAGGCTTTAACTGCACCAG	0.470													233	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	45128348	45128349	+	5'Flank	INS	-	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45128348_45128349insT	uc010wkl.1	-											Homo sapiens cDNA FLJ38031 fis, clone CTONG2013348.																		gaagtcaggagtttgagaccag	0.050													2	4	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64794508	64794509	+	Intron	INS	-	GAC	GAC			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64794508_64794509insGAC	uc002jfp.1	+							NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	Gtggtggtggtggtggtggtgg	0.178													5	3	---	---	---	---	
MAP2K6	5608	broad.mit.edu	37	17	67532020	67532021	+	Intron	INS	-	AC	AC	rs138344495	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67532020_67532021insAC	uc002jij.2	+							NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					AAAAGGAAAGTacacacacaca	0.267													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75864764	75864765	+	IGR	DEL	TG	-	-	rs113869156		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75864764_75864765delTG								SEPT9 (368088 upstream) : FLJ45079 (10344 downstream)																							GCCCAGACTCtgtgtgtgtgtg	0.307													5	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544277	80544278	+	Intron	INS	-	A	A	rs149999499	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544277_80544278insA	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gaaaggtgggcgggggggaaag	0.000													10	5	---	---	---	---	
CCDC105	126402	broad.mit.edu	37	19	15131120	15131120	+	Intron	DEL	A	-	-	rs112998351		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15131120delA	uc002nae.2	+							NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105						microtubule cytoskeleton organization	microtubule				ovary(1)	1						attttgtctcaaaaaaaaaaa	0.194													5	3	---	---	---	---	
C19orf42	79086	broad.mit.edu	37	19	16770671	16770672	+	Intron	INS	-	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16770671_16770672insT	uc002ner.2	-						TMEM38A_uc002nes.2_5'Flank|C19orf42_uc002neo.1_Intron|C19orf42_uc002nep.1_Intron	NM_024104	NP_077009	Q9BQ49	CS042_HUMAN	hypothetical protein LOC79086 precursor							integral to membrane					0						GGGCCTGCGGCTTGGGGGCGGG	0.678													4	3	---	---	---	---	
FAM129C	199786	broad.mit.edu	37	19	17662889	17662890	+	Intron	INS	-	T	T	rs34537214		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17662889_17662890insT	uc010xpr.1	+							NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a												0						ctttattttaattttttttttt	0.000													4	2	---	---	---	---	
ZNF737	100129842	broad.mit.edu	37	19	20735139	20735139	+	Intron	DEL	A	-	-	rs146002311		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20735139delA	uc002npa.2	-							NM_001159293	NP_001152765	C9JHM3	C9JHM3_HUMAN	zinc finger protein 737						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						TTTaaaaaagaaaaaaaaaaa	0.284													2	8	---	---	---	---	
ZNF626	199777	broad.mit.edu	37	19	20806607	20806607	+	3'UTR	DEL	A	-	-	rs138949164		TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20806607delA	uc002npb.1	-	4					ZNF626_uc002npc.1_3'UTR	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						actccatctcaaaaaaaaaaa	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45085945	45085947	+	IGR	DEL	GAG	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45085945_45085947delGAG								CEACAM22P (25795 upstream) : PVR (61151 downstream)																							ggaaggggaagaggaggaggagg	0.000													4	2	---	---	---	---	
DEFB119	245932	broad.mit.edu	37	20	29965453	29965454	+	Intron	INS	-	TG	TG	rs151207116	by1000genomes	TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29965453_29965454insTG	uc002wvt.2	-						DEFB119_uc002wvs.2_Intron	NM_153289	NP_695021	Q8N690	DB119_HUMAN	defensin, beta 119 isoform a precursor						defense response to bacterium	extracellular region					0	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			gtgtgtgtatatgtgtgtgtgt	0.020													4	2	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41424003	41424003	+	Frame_Shift_Del	DEL	A	-	-			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41424003delA	uc002yyq.1	-	30	5519	c.5067delT	c.(5065-5067)GCTfs	p.A1689fs	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1689	Cytoplasmic (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CTCCAAAGTCAGCATCCGTCA	0.532													168	19	---	---	---	---	
TCF20	6942	broad.mit.edu	37	22	42611473	42611474	+	5'Flank	INS	-	T	T			TCGA-EJ-5495-01	TCGA-EJ-5495-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42611473_42611474insT	uc003bcj.1	-						TCF20_uc003bck.1_5'Flank|TCF20_uc003bnt.2_5'Flank	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						TTGAAtttctattttttttttt	0.193													11	5	---	---	---	---	
