Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16918727	16918727	+	5'UTR	SNP	G	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918727G>C	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CGAGGTGCCTGAACTCAGAGC	0.463													3	31	---	---	---	---	PASS
GBP1	2633	broad.mit.edu	37	1	89523762	89523762	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89523762C>T	uc001dmx.2	-	6	1007	c.787G>A	c.(787-789)GTG>ATG	p.V263M		NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,	263					interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		ACTTGTTGCACAAATTCGGGG	0.473													23	351	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91846539	91846539	+	Missense_Mutation	SNP	G	A	A	rs146051438		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91846539G>A	uc001doa.3	-	7	903	c.803C>T	c.(802-804)CCG>CTG	p.P268L	HFM1_uc010osu.1_Intron|HFM1_uc010osv.1_Intron|HFM1_uc001doc.1_Missense_Mutation_p.P268L	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	268							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AAATTTTGCCGCTTACAATAA	0.209													14	108	---	---	---	---	PASS
KCND3	3752	broad.mit.edu	37	1	112524316	112524316	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112524316C>T	uc001ebu.1	-	2	1513	c.1033G>A	c.(1033-1035)GGC>AGC	p.G345S	KCND3_uc001ebv.1_Missense_Mutation_p.G345S	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	345						sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		GCCGAGGAGCCCTTCTCGGCA	0.527													35	39	---	---	---	---	PASS
LOC100286793	100286793	broad.mit.edu	37	1	143744418	143744418	+	RNA	SNP	C	T	T	rs71661951		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143744418C>T	uc001ejp.3	-	1		c.170G>A			LOC100286793_uc001ejr.3_RNA|LOC100286793_uc009whx.2_RNA|LOC100286793_uc009why.2_RNA					Homo sapiens cDNA FLJ39739 fis, clone SMINT2016440.												0						CAAGTGGTTTCGGAAGTGATC	0.403													3	13	---	---	---	---	PASS
FAM72D	728833	broad.mit.edu	37	1	143912402	143912402	+	5'UTR	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143912402C>T	uc002qvn.1	-	1					FAM72D_uc010evy.1_5'UTR	NM_207418	NP_997301	Q6L9T8	FA72D_HUMAN	hypothetical protein LOC653573												0						GGACCTAGAGCTTTTCTAAGT	0.408													7	78	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	145015938	145015938	+	Silent	SNP	C	T	T	rs144857876	byFrequency	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145015938C>T	uc001elx.3	-	3	485	c.150G>A	c.(148-150)CCG>CCA	p.P50P	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_5'UTR|PDE4DIP_uc001eln.3_Silent_p.P50P|PDE4DIP_uc001elo.2_Silent_p.P121P|PDE4DIP_uc001emh.2_Silent_p.P121P|uc001emj.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	Error:Variant_position_missing_in_Q5VU43_after_alignment					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCTGCACAAACGGGACCTTTT	0.443			T	PDGFRB	MPD								73	518	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	210977309	210977309	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210977309C>A	uc001hib.2	-	8	1832	c.1662G>T	c.(1660-1662)AAG>AAT	p.K554N	KCNH1_uc001hic.2_Missense_Mutation_p.K527N	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	554	Cytoplasmic (Potential).				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	p.K554N(1)		ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TCCTCCTTACCTTCTCTGTGT	0.413													68	113	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240371112	240371112	+	Silent	SNP	G	T	T	rs71646889		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371112G>T	uc010pyd.1	+	5	3225	c.3000G>T	c.(2998-3000)CCG>CCT	p.P1000P	FMN2_uc010pye.1_Silent_p.P1004P	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1000	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TACCCCCTCCGCCCCCACTTC	0.716													3	9	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210968826	210968826	+	Splice_Site	SNP	A	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210968826A>C	uc002vds.2	-	4	1636	c.1428_splice	c.e4+1	p.Q476_splice	C2orf67_uc002vdt.2_Splice_Site_p.Q476_splice|C2orf67_uc002vdw.2_Splice_Site_p.Q476_splice|C2orf67_uc002vdv.2_Splice_Site_p.Q476_splice|C2orf67_uc002vdx.1_Splice_Site_p.Q476_splice	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		CTTTGACTTTACCTGTTTTTC	0.368													7	79	---	---	---	---	PASS
SLC25A20	788	broad.mit.edu	37	3	48896044	48896044	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48896044T>G	uc003cva.3	-	8	914	c.739A>C	c.(739-741)AAT>CAT	p.N247H	SLC25A20_uc011bbw.1_Missense_Mutation_p.N197H|SLC25A20_uc010hkj.2_Missense_Mutation_p.N174H	NM_000387	NP_000378	O43772	MCAT_HUMAN	carnitine/acylcarnitine translocase	247	Solcar 3.|Mitochondrial matrix (Potential).				carnitine shuttle|cellular lipid metabolic process|regulation of fatty acid oxidation	integral to membrane|mitochondrial inner membrane	acyl carnitine transporter activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000168)|Kidney(197;0.00231)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	L-Carnitine(DB00583)	CTGAAACCATTAGGATATTTC	0.493													82	126	---	---	---	---	PASS
OR5K1	26339	broad.mit.edu	37	3	98188485	98188485	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98188485A>T	uc003dsm.2	+	1	65	c.65A>T	c.(64-66)GAG>GTG	p.E22V		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						GATCACCCTGAGCTGAAGACT	0.413													109	128	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	121137219	121137219	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121137219C>A	uc003eec.3	+	27	3474	c.3334C>A	c.(3334-3336)CTT>ATT	p.L1112I	STXBP5L_uc011bji.1_Missense_Mutation_p.L1088I	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	1112					exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		ATCCCGCAGCCTTGCGCAACA	0.483													4	42	---	---	---	---	PASS
VPS8	23355	broad.mit.edu	37	3	184647413	184647413	+	Silent	SNP	T	C	C	rs4643688	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184647413T>C	uc003fpb.1	+	32	2925	c.2754T>C	c.(2752-2754)GAT>GAC	p.D918D	VPS8_uc010hyd.1_Silent_p.D828D|VPS8_uc010hye.1_Silent_p.D347D	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	920							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			ACCAATATGATAAAATTATTG	0.343													2	5	---	---	---	---	PASS
SLC26A1	10861	broad.mit.edu	37	4	983809	983809	+	Silent	SNP	C	T	T	rs4690221	byFrequency	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:983809C>T	uc003gcb.2	-	4	1296	c.918G>A	c.(916-918)TCG>TCA	p.S306S	SLC26A1_uc003gbx.2_Intron|IDUA_uc003gby.2_Intron|IDUA_uc003gbz.2_Intron|IDUA_uc003gca.2_Intron|SLC26A1_uc003gcc.2_Silent_p.S306S	NM_213613	NP_998778	Q9H2B4	S26A1_HUMAN	solute carrier family 26, member 1 isoform a	306	Helical; (Potential).					integral to membrane|plasma membrane	secondary active sulfate transmembrane transporter activity			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCCCGAAGTGCGACACGAGTG	0.667													6	3	---	---	---	---	PASS
FAM190A	401145	broad.mit.edu	37	4	91229663	91229663	+	Silent	SNP	T	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91229663T>C	uc003hsv.3	+	2	568	c.228T>C	c.(226-228)AGT>AGC	p.S76S	FAM190A_uc003hsu.3_Silent_p.S76S|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Silent_p.S76S	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1	76										large_intestine(1)|ovary(1)	2						AGAAGGGGAGTGAGCCTAAGC	0.458													53	86	---	---	---	---	PASS
FST	10468	broad.mit.edu	37	5	52780040	52780040	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52780040C>A	uc003jpd.2	+	4	665	c.638C>A	c.(637-639)ACC>AAC	p.T213N	FST_uc003jpc.2_Missense_Mutation_p.T213N	NM_013409	NP_037541	P19883	FST_HUMAN	follistatin isoform FST344 precursor	213	Kazal-like 2.				hemopoietic progenitor cell differentiation|negative regulation of activin receptor signaling pathway|negative regulation of follicle-stimulating hormone secretion|negative regulation of transcription from RNA polymerase II promoter|positive regulation of hair follicle development	extracellular region	activin binding|protein binding|signal transducer activity				0		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				GATGGAGTCACCTACTCCAGT	0.502													13	95	---	---	---	---	PASS
SGCD	6444	broad.mit.edu	37	5	156184679	156184679	+	Silent	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156184679C>T	uc003lwd.3	+	7	1136	c.660C>T	c.(658-660)TGC>TGT	p.C220C	SGCD_uc003lwb.2_Silent_p.C221C|SGCD_uc003lwc.3_Silent_p.C221C	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	220	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGCCACCTGCAGGACAGAGC	0.512													7	12	---	---	---	---	PASS
GFPT2	9945	broad.mit.edu	37	5	179731798	179731798	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179731798C>T	uc003mlw.1	-	17	1914	c.1816G>A	c.(1816-1818)GCC>ACC	p.A606T		NM_005110	NP_005101	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	606	SIS 2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	TGCTGCAGGGCGTTCTGGCAT	0.607													23	292	---	---	---	---	PASS
ZSCAN23	222696	broad.mit.edu	37	6	28403808	28403808	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28403808G>A	uc003nli.3	-	2	417	c.236C>T	c.(235-237)CCA>CTA	p.P79L	ZSCAN23_uc003nlh.2_RNA|ZSCAN23_uc010jrf.1_Intron|ZSCAN23_uc011dli.1_Missense_Mutation_p.P79L	NM_001012455	NP_001012458	Q3MJ62	ZSC23_HUMAN	zinc finger protein 390	79	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GTGCATCTCTGGTCTCAGCCA	0.587													5	43	---	---	---	---	PASS
HLA-DQB1	3119	broad.mit.edu	37	6	32627906	32627906	+	3'UTR	SNP	T	C	C	rs1063349	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32627906T>C	uc003obw.2	-	5					HLA-DQB1_uc010juc.1_3'UTR|HLA-DQB1_uc003obv.2_3'UTR|HLA-DQB1_uc011dqd.1_3'UTR	NM_002123	NP_002114	P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CTGTAGGACTTTGATCTCAGG	0.542									Melanoma_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia|T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|Sj_gren_syndrome				5	17	---	---	---	---	PASS
HLA-DQB1	3119	broad.mit.edu	37	6	32627923	32627923	+	3'UTR	SNP	A	G	G	rs9273462	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32627923A>G	uc003obw.2	-	5					HLA-DQB1_uc010juc.1_3'UTR|HLA-DQB1_uc003obv.2_3'UTR|HLA-DQB1_uc011dqd.1_3'UTR	NM_002123	NP_002114	P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CAGGGGGACAAGCTGACACAG	0.532									Melanoma_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia|T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|Sj_gren_syndrome				4	20	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146243842	146243842	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146243842C>G	uc003qlf.2	-	19	4075	c.3676G>C	c.(3676-3678)GCA>CCA	p.A1226P	SHPRH_uc003qld.2_Missense_Mutation_p.A1230P|SHPRH_uc003qle.2_Missense_Mutation_p.A1230P|SHPRH_uc003qlg.1_Missense_Mutation_p.A782P|SHPRH_uc003qlh.2_Missense_Mutation_p.A151P|SHPRH_uc003qli.1_Missense_Mutation_p.A151P	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	1226					DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding	p.V1226D(1)		ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CAGACTGTTGCAGACTCAATA	0.408													14	49	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152832185	152832185	+	Silent	SNP	T	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152832185T>A	uc010kiw.2	-	7	965	c.363A>T	c.(361-363)ATA>ATT	p.I121I	SYNE1_uc003qot.3_Silent_p.I128I|SYNE1_uc003qou.3_Silent_p.I121I|SYNE1_uc010kjb.1_Silent_p.I121I|SYNE1_uc003qpa.1_Silent_p.I121I	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	121	Actin-binding.|Cytoplasmic (Potential).|CH 1.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATCCAAGAACTATTGAGGGTC	0.373										HNSCC(10;0.0054)			27	155	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91712644	91712644	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91712644T>G	uc003ulg.2	+	33	8546	c.8321T>G	c.(8320-8322)CTG>CGG	p.L2774R	AKAP9_uc003ulf.2_Missense_Mutation_p.L2766R|AKAP9_uc003uli.2_Missense_Mutation_p.L2397R|AKAP9_uc003ulj.2_Missense_Mutation_p.L544R|AKAP9_uc003ulk.2_Missense_Mutation_p.L49R	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2786					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCTATAAAACTGAGTAAGAGC	0.388			T	BRAF	papillary thyroid								10	63	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	102158198	102158198	+	5'UTR	SNP	G	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102158198G>C	uc010lia.1	-	1					uc003uzt.1_5'UTR|uc003uzu.1_5'UTR|POLR2J3_uc011kku.1_Intron|uc010lib.1_5'UTR	NM_006989	NP_008920			RAS p21 protein activator 4 isoform 1																		ACCGGGGTCCGGGGTGGCGGG	0.537													3	11	---	---	---	---	PASS
TRY6	154754	broad.mit.edu	37	7	142479940	142479940	+	Silent	SNP	C	T	T	rs58649169	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142479940C>T	uc011ksq.1	+	2	155	c.72C>T	c.(70-72)ATC>ATT	p.I24I	uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_RNA|uc003wan.1_Intron|TRY6_uc011kso.1_RNA|TRY6_uc011ksr.1_RNA	NR_001296				SubName: Full=Protease, serine, 3; Flags: Fragment;												0						ATGACAAGATCGTTGGGGGCT	0.557													5	63	---	---	---	---	PASS
GIMAP7	168537	broad.mit.edu	37	7	150217708	150217708	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150217708C>T	uc003whk.2	+	2	776	c.646C>T	c.(646-648)CGG>TGG	p.R216W		NM_153236	NP_694968	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	216							GTP binding			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGAAACAACGGGAAGAGGT	0.403													28	43	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3265577	3265577	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3265577C>T	uc011kwk.1	-	14	2308	c.1918G>A	c.(1918-1920)GCG>ACG	p.A640T	CSMD1_uc011kwj.1_Missense_Mutation_p.A32T	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	640	Extracellular (Potential).|CUB 4.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCCTTGACCGCGAGAAAGTCA	0.453													8	30	---	---	---	---	PASS
LRP12	29967	broad.mit.edu	37	8	105509611	105509611	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105509611G>T	uc003yma.2	-	5	1264	c.1169C>A	c.(1168-1170)ACT>AAT	p.T390N	LRP12_uc003ymb.2_Missense_Mutation_p.T371N|LRP12_uc003ylz.2_5'Flank	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	390	Extracellular (Potential).|LDL-receptor class A 3.				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTGCTGCTCAGTATAACACCC	0.453													23	176	---	---	---	---	PASS
ROR2	4920	broad.mit.edu	37	9	94486842	94486842	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94486842T>C	uc004arj.1	-	9	2133	c.1934A>G	c.(1933-1935)TAC>TGC	p.Y645C	ROR2_uc004ari.1_Missense_Mutation_p.Y505C	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	645	Cytoplasmic (Potential).|Protein kinase.				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						CAGCTTGTAGTAATCGGCGGC	0.562													23	24	---	---	---	---	PASS
PTPN3	5774	broad.mit.edu	37	9	112185102	112185102	+	Silent	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112185102C>T	uc004bed.2	-	13	1144	c.1032G>A	c.(1030-1032)GTG>GTA	p.V344V	PTPN3_uc004beb.2_Silent_p.V213V|PTPN3_uc004bec.2_Intron|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Intron|PTPN3_uc011lwh.1_Intron|PTPN3_uc011lwe.1_Silent_p.V57V|PTPN3_uc011lwf.1_Intron	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	344					negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						TCCCGCCAATCACCTTTTTGC	0.463													78	117	---	---	---	---	PASS
RAPGEF1	2889	broad.mit.edu	37	9	134497351	134497351	+	Silent	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134497351C>T	uc004cbc.2	-	11	1816	c.1686G>A	c.(1684-1686)TCG>TCA	p.S562S	RAPGEF1_uc004cbb.2_Silent_p.S580S|RAPGEF1_uc010mzm.2_RNA|RAPGEF1_uc010mzn.2_Silent_p.S567S|RAPGEF1_uc004cbd.2_Silent_p.S567S|RAPGEF1_uc010mzs.1_Silent_p.S8S|RAPGEF1_uc010mzl.1_Silent_p.S8S|RAPGEF1_uc010mzo.1_Silent_p.S8S|RAPGEF1_uc010mzp.1_Silent_p.S8S|RAPGEF1_uc010mzq.1_Silent_p.S8S|RAPGEF1_uc010mzr.1_Silent_p.S8S	NM_005312	NP_005303	Q13905	RPGF1_HUMAN	guanine nucleotide-releasing factor 2 isoform a	562					activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GCTGCGGCTCCGAGTAGTCCT	0.587													10	17	---	---	---	---	PASS
SLIT1	6585	broad.mit.edu	37	10	98761035	98761035	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98761035G>A	uc001kmw.2	-	37	4691	c.4439C>T	c.(4438-4440)ACG>ATG	p.T1480M		NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	1480	CTCK.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CAGGGGGCGCGTGGTCTGGCA	0.657													60	85	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													4	63	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105804548	105804548	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105804548G>A	uc001pix.2	+	14	2593	c.2147G>A	c.(2146-2148)CGC>CAC	p.R716H	GRIA4_uc001piw.2_Missense_Mutation_p.R716H|GRIA4_uc010rvm.1_RNA|GRIA4_uc009yxl.1_RNA	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	716	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	GCTCGTGTCCGCAAATCCAAG	0.458													5	41	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108192065	108192065	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108192065G>A	uc001pkb.1	+	45	6875	c.6490G>A	c.(6490-6492)GAG>AAG	p.E2164K	ATM_uc009yxr.1_Missense_Mutation_p.E2164K|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.E816K|ATM_uc001pkg.1_Missense_Mutation_p.E521K	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2164	FAT.		E -> K (in T-prolymphocytic leukemia).		cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	p.E2164K(1)		haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		GCGCAGCCTTGAGTCTGTGTA	0.413			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			66	131	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133790584	133790584	+	Silent	SNP	G	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133790584G>T	uc001qgx.3	-	18	3267	c.3036C>A	c.(3034-3036)ATC>ATA	p.I1012I		NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1012	Pro-rich.|Cytoplasmic (Potential).					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TCTCCTCGGGGATGGTGGGGT	0.672													8	109	---	---	---	---	PASS
EPS8	2059	broad.mit.edu	37	12	15774164	15774164	+	3'UTR	SNP	G	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15774164G>C	uc009zif.2	-	21					EPS8_uc001rdb.2_3'UTR|EPS8_uc009zig.2_3'UTR|EPS8_uc010shv.1_3'UTR	NM_004447	NP_004438	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway						cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CAAGAAAAATGAATCTGACAT	0.323													6	8	---	---	---	---	PASS
HSPH1	10808	broad.mit.edu	37	13	31728657	31728657	+	Intron	SNP	T	C	C	rs4943165	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31728657T>C	uc001utj.2	-						HSPH1_uc001utk.2_Intron|HSPH1_uc010aaw.2_Intron|HSPH1_uc001utl.2_Intron|HSPH1_uc010tds.1_Intron|HSPH1_uc010tdt.1_Intron|HSPH1_uc010aax.1_Intron|HSPH1_uc010aay.1_3'UTR	NM_006644	NP_006635	Q92598	HS105_HUMAN	heat shock 105kD						positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding				0		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		TACAGTCCAGTAGAACACGGT	0.363													3	28	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58207456	58207456	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58207456G>T	uc001vhq.1	+	1	1668	c.776G>T	c.(775-777)GGT>GTT	p.G259V	PCDH17_uc010aec.1_Missense_Mutation_p.G259V	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	259	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GCTCCGCTGGGTACAGTGGTC	0.582													35	51	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85326137	85326137	+	Silent	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85326137G>A	uc002bld.2	+	4	567	c.231G>A	c.(229-231)GAG>GAA	p.E77E	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	77					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCCGCCAGGAGTCATTTGAAG	0.527													9	83	---	---	---	---	PASS
FAM100A	124402	broad.mit.edu	37	16	4659659	4659659	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4659659T>G	uc002cwx.2	-	3	638	c.509A>C	c.(508-510)CAC>CCC	p.H170P	FAM100A_uc010btv.1_Missense_Mutation_p.H149P	NM_145253	NP_660296	Q8TB05	F100A_HUMAN	hypothetical protein LOC124402	170	Pro-rich.										0						CATGGCAGGGTGGGCCCTGGG	0.711													9	31	---	---	---	---	PASS
ZNF500	26048	broad.mit.edu	37	16	4810588	4810588	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4810588A>C	uc002cxp.1	-	5	912	c.665T>G	c.(664-666)GTG>GGG	p.V222G	ZNF500_uc002cxo.1_Missense_Mutation_p.V14G|ZNF500_uc010uxt.1_Missense_Mutation_p.V222G	NM_021646	NP_067678	O60304	ZN500_HUMAN	zinc finger protein 500	222					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						GTTCACGGGCACCTGCCAGAA	0.637													10	33	---	---	---	---	PASS
NPIP	9284	broad.mit.edu	37	16	15045883	15045883	+	3'UTR	SNP	G	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15045883G>T	uc002dcy.3	+	8					NPIP_uc002dcx.3_RNA	NM_006985	NP_008916	Q9UND3	NPIP_HUMAN	nuclear pore complex interacting protein						mRNA transport|protein transport|transmembrane transport	nuclear membrane|nuclear pore					0						AAGAAACTAAGGAAGaataaa	0.408													7	82	---	---	---	---	PASS
C16orf86	388284	broad.mit.edu	37	16	67702586	67702586	+	3'UTR	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67702586C>T	uc002ety.2	+	4					C16orf48_uc002etw.1_5'Flank|C16orf48_uc010cem.1_5'Flank|C16orf86_uc002etx.1_3'UTR|C16orf86_uc002etz.2_RNA	NM_001012984	NP_001013002	Q6ZW13	CP086_HUMAN	hypothetical protein LOC388284												0		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CCTCTGGTGGCGGGGGCAAAT	0.532											OREG0023886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	11	---	---	---	---	PASS
TIMM22	29928	broad.mit.edu	37	17	904502	904502	+	3'UTR	SNP	T	C	C	rs333646	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:904502T>C	uc002fsc.2	+	4						NM_013337	NP_037469	Q9Y584	TIM22_HUMAN	translocase of inner mitochondrial membrane 22						transmembrane transport	integral to membrane|mitochondrial inner membrane	protein transporter activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GCCTTTGGGGTAGCCACACTT	0.552													3	3	---	---	---	---	PASS
MFAP4	4239	broad.mit.edu	37	17	19290477	19290477	+	5'UTR	SNP	T	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19290477T>C	uc002gvt.2	-	1					MFAP4_uc002gvr.2_5'Flank|MFAP4_uc002gvs.2_5'UTR	NM_002404	NP_002395	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4 precursor						cell adhesion|signal transduction	microfibril	receptor binding				0	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					ATGCTGTCAGTTCTGCTCAGA	0.682													16	37	---	---	---	---	PASS
MYO1D	4642	broad.mit.edu	37	17	30986138	30986138	+	Silent	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30986138G>A	uc002hho.1	-	17	2352	c.2340C>T	c.(2338-2340)TTC>TTT	p.F780F	MYO1D_uc002hhp.1_Silent_p.F780F	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID	780						myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			CTTACCTATTGAAAATCGTCT	0.493											OREG0024311	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	34233761	34233761	+	RNA	SNP	A	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34233761A>G	uc010ctx.1	-	1		c.3193T>C								Homo sapiens cDNA FLJ43944 fis, clone TESTI4014392.																		CTGAGAGCTGAGCTGTAGCCT	0.537													8	11	---	---	---	---	PASS
GRB7	2886	broad.mit.edu	37	17	37898891	37898891	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37898891T>G	uc002hsr.2	+	3	478	c.228T>G	c.(226-228)AGT>AGG	p.S76R	GRB7_uc002hss.2_Missense_Mutation_p.S76R|GRB7_uc010cwc.2_Missense_Mutation_p.S76R|GRB7_uc002hst.2_Missense_Mutation_p.S76R	NM_005310	NP_005301	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	76					blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AGCTCTGCAGTCCTCCCTCAC	0.632													60	109	---	---	---	---	PASS
ETV4	2118	broad.mit.edu	37	17	41611325	41611325	+	Silent	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41611325G>A	uc002idw.2	-	6	413	c.285C>T	c.(283-285)ATC>ATT	p.I95I	ETV4_uc010wih.1_Silent_p.I95I|ETV4_uc010czh.2_Silent_p.I94I|ETV4_uc010wii.1_Silent_p.I56I|ETV4_uc002idx.2_Silent_p.I95I|ETV4_uc010wij.1_Silent_p.I56I|ETV4_uc002idy.1_Silent_p.I56I	NM_001986	NP_001977	P43268	ETV4_HUMAN	ets variant gene 4 (E1A enhancer binding	95					positive regulation of transcription, DNA-dependent	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/ETV4(6)	bone(4)|soft_tissue(2)|ovary(1)	7		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		GCTCCTTCTTGATCCTGGTGG	0.627			T	EWSR1|TMPRSS2|DDX5|KLK2|CANT1	Ewing sarcoma|Prostate carcinoma								37	18	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42635479	42635479	+	Silent	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42635479C>T	uc002igx.1	+	1	555	c.423C>T	c.(421-423)TTC>TTT	p.F141F		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	141	FZ.|Extracellular (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCGAGCACTTCCCGCGCCACG	0.592													36	45	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42635653	42635653	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42635653C>A	uc002igx.1	+	1	729	c.597C>A	c.(595-597)TTC>TTA	p.F199L		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	199	Extracellular (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		AGCACCCCTTCCACTGCCCGC	0.393													4	5	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42635702	42635702	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42635702C>G	uc002igx.1	+	1	778	c.646C>G	c.(646-648)CTG>GTG	p.L216V		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	216	Extracellular (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CTACAAGTTTCTGGGCGAGCG	0.537													22	22	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42636061	42636061	+	Nonsense_Mutation	SNP	C	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42636061C>G	uc002igx.1	+	1	1137	c.1005C>G	c.(1003-1005)TAC>TAG	p.Y335*		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	335	Helical; Name=3; (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TGATGCTCTACTTCTTCAGCA	0.617													33	71	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42636173	42636173	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42636173C>T	uc002igx.1	+	1	1249	c.1117C>T	c.(1117-1119)CAC>TAC	p.H373Y		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	373	Helical; Name=4; (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TCAGTACTTCCACCTGGCCGC	0.662													52	90	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42636211	42636211	+	Silent	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42636211C>T	uc002igx.1	+	1	1287	c.1155C>T	c.(1153-1155)ATC>ATT	p.I385I		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	385	Helical; Name=4; (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TCAAGACCATCACCATCCTGG	0.677													53	93	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42636499	42636499	+	Silent	SNP	C	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42636499C>T	uc002igx.1	+	1	1575	c.1443C>T	c.(1441-1443)TTC>TTT	p.F481F		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	481	Helical; Name=6; (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CTTGCTACTTCTACGAGCAGG	0.647													23	36	---	---	---	---	PASS
CHST8	64377	broad.mit.edu	37	19	34180279	34180279	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34180279G>A	uc002nus.3	+	3	617	c.112G>A	c.(112-114)GCC>ACC	p.A38T	CHST8_uc002nut.3_Missense_Mutation_p.A38T|CHST8_uc002nuu.2_Missense_Mutation_p.A38T	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)	38	Lumenal (Potential).				carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)					TACGGAGCTCGCCCCCCAGCA	0.632													50	103	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41595959	41595959	+	Silent	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41595959G>A	uc002opt.2	+	3	360	c.351G>A	c.(349-351)GCG>GCA	p.A117A		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	117				A->V: Increases phenacetin O-deethylation activity 5 fold.	xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	CAGGCGTGGCGTTCAGCAACG	0.697													3	26	---	---	---	---	PASS
ZNF761	388561	broad.mit.edu	37	19	53950475	53950475	+	5'UTR	SNP	G	T	T	rs8111707	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53950475G>T	uc010eqp.2	+	4					ZNF761_uc002qbr.2_RNA|ZNF761_uc010ydy.1_5'UTR|ZNF761_uc002qbs.2_RNA|ZNF761_uc002qbt.1_5'Flank	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		CTCTTGGTACGTGAGGAAGAA	0.438													5	80	---	---	---	---	PASS
FOXA2	3170	broad.mit.edu	37	20	22563512	22563512	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22563512G>A	uc002wsn.2	-	3	540	c.350C>T	c.(349-351)GCG>GTG	p.A117V	FOXA2_uc002wsm.2_Missense_Mutation_p.A123V	NM_153675	NP_710141	Q9Y261	FOXA2_HUMAN	forkhead box A2 isoform 2	117					cell differentiation in hindbrain|central nervous system myelin formation|chromatin modification|dorsal/ventral neural tube patterning|ectoderm formation|endocrine pancreas development|endoderm development|epithelial tube branching involved in lung morphogenesis|in utero embryonic development|lung epithelial cell differentiation|negative regulation of neuron differentiation|neuron fate specification|oligodendrocyte cell fate commitment|positive regulation of embryonic development|positive regulation of gastrulation|positive regulation of neuron differentiation|primitive streak formation|regulation of blood coagulation|regulation of sequence-specific DNA binding transcription factor activity|response to interleukin-6	cytoplasm|transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|kidney(1)|central_nervous_system(1)	4	Lung NSC(19;0.188)					GGCCCCGGCCGCCTGCCCCCC	0.781													11	17	---	---	---	---	PASS
TH1L	51497	broad.mit.edu	37	20	57564072	57564072	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57564072T>A	uc002yag.2	+	5	554	c.527T>A	c.(526-528)GTT>GAT	p.V176D	TH1L_uc010zzu.1_Missense_Mutation_p.V176D|TH1L_uc002yaf.1_RNA|TH1L_uc002yah.2_Missense_Mutation_p.V176D	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	TH1-like protein	176					negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)			AACTTCACCGTTAAGGTAGGA	0.408													5	89	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25023444	25023444	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25023444G>T	uc003aan.1	+	12	1553	c.1066G>T	c.(1066-1068)GCC>TCC	p.A356S	GGT1_uc003aas.1_Missense_Mutation_p.A356S|GGT1_uc003aat.1_Missense_Mutation_p.A356S|GGT1_uc003aau.1_Missense_Mutation_p.A356S|GGT1_uc003aav.1_Missense_Mutation_p.A356S|GGT1_uc003aaw.1_Missense_Mutation_p.A356S|GGT1_uc003aax.1_Missense_Mutation_p.A356S|GGT1_uc003aay.1_Missense_Mutation_p.A12S	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	356	Extracellular (Potential).			A -> S (in Ref. 10; AAI28240).	glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	CCAGCTCCGGGCCCAGATCTC	0.652													6	72	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25023459	25023459	+	Missense_Mutation	SNP	G	C	C	rs138813205		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25023459G>C	uc003aan.1	+	12	1568	c.1081G>C	c.(1081-1083)GAC>CAC	p.D361H	GGT1_uc003aas.1_Missense_Mutation_p.D361H|GGT1_uc003aat.1_Missense_Mutation_p.D361H|GGT1_uc003aau.1_Missense_Mutation_p.D361H|GGT1_uc003aav.1_Missense_Mutation_p.D361H|GGT1_uc003aaw.1_Missense_Mutation_p.D361H|GGT1_uc003aax.1_Missense_Mutation_p.D361H|GGT1_uc003aay.1_Missense_Mutation_p.D17H	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	361	Extracellular (Potential).			D -> H (in Ref. 10; AAI28240).	glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	GATCTCTGACGACACCACTCA	0.642													5	80	---	---	---	---	PASS
CXorf58	254158	broad.mit.edu	37	X	23934359	23934359	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23934359T>C	uc004daz.1	+	5	681	c.337T>C	c.(337-339)TTC>CTC	p.F113L	CXorf58_uc011mju.1_Missense_Mutation_p.F113L	NM_152761	NP_689974	Q96LI9	CX058_HUMAN	hypothetical protein LOC254158	113											0						GTTTCCACCTTTCATCGTGTT	0.338													19	7	---	---	---	---	PASS
KLHL13	90293	broad.mit.edu	37	X	117053579	117053579	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117053579G>C	uc004eql.2	-	4	537	c.475C>G	c.(475-477)CTT>GTT	p.L159V	KLHL13_uc004eqk.2_Missense_Mutation_p.L108V|KLHL13_uc011mtn.1_5'UTR|KLHL13_uc011mto.1_Missense_Mutation_p.L153V|KLHL13_uc011mtp.1_Missense_Mutation_p.L161V|KLHL13_uc004eqm.2_Missense_Mutation_p.L108V|KLHL13_uc011mtq.1_Missense_Mutation_p.L143V	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	159	BTB.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						TCCATATTAAGAGAAAGCTTT	0.378													6	80	---	---	---	---	PASS
FGGY	55277	broad.mit.edu	37	1	59805628	59805629	+	Splice_Site	DEL	AG	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59805628_59805629delAG	uc001czi.3	+	3	414	c.202_splice	c.e3-1	p.K68_splice	FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Splice_Site|FGGY_uc009wac.2_Splice_Site_p.K68_splice|FGGY_uc001czj.3_Splice_Site_p.K68_splice|FGGY_uc001czk.3_Splice_Site|FGGY_uc001czl.3_Intron	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					TTTTTAAAACAGAAAGTTGTAC	0.342													37	9	---	---	---	---	
DOCK7	85440	broad.mit.edu	37	1	63018702	63018703	+	Intron	DEL	AC	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63018702_63018703delAC	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001dam.2_Intron	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						TAAAAAATATACtttttttttt	0.139													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121484566	121484566	+	IGR	DEL	A	-	-	rs4115066		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121484566delA								LOC647121 (170880 upstream) : None (None downstream)																							atcttcgtataaaaactagac	0.000													1228	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121484633	121484633	+	IGR	DEL	T	-	-	rs4898120		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121484633delT								LOC647121 (170947 upstream) : None (None downstream)																							agagtttaacttttcttttca	0.000													1859	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121484665	121484668	+	IGR	DEL	TGTT	-	-	rs71221555		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121484665_121484668delTGTT								LOC647121 (170979 upstream) : None (None downstream)																							ggaaacactctgtttgtaaagtct	0.000													1741	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143391935	143391936	+	IGR	INS	-	TG	TG			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143391935_143391936insTG								None (None upstream) : LOC100286793 (255703 downstream)																							ATATATATATATAAAGAGATTG	0.252													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	144043905	144043906	+	Intron	INS	-	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144043905_144043906insG	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		tcgctcacgctggagctgtaga	0.109													29	7	---	---	---	---	
SOAT1	6646	broad.mit.edu	37	1	179310671	179310672	+	Intron	INS	-	TTT	TTT			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179310671_179310672insTTT	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	TTACGTTGAACttttttttttt	0.149													4	2	---	---	---	---	
ARID4B	51742	broad.mit.edu	37	1	235345290	235345317	+	Frame_Shift_Del	DEL	CACTGGGTGAACAACTCTCCTCTTCAGC	-	-	rs148934238	byFrequency	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235345290_235345317delCACTGGGTGAACAACTCTCCTCTTCAGC	uc001hwq.2	-	20	3415_3442	c.2917_2944delGCTGAAGAGGAGAGTTGTTCACCCAGTG	c.(2917-2946)GCTGAAGAGGAGAGTTGTTCACCCAGTGTAfs	p.A973fs	ARID4B_uc001hwr.2_Frame_Shift_Del_p.A887fs|ARID4B_uc001hws.3_Frame_Shift_Del_p.A887fs|ARID4B_uc001hwp.2_RNA|ARID4B_uc001hwt.3_Frame_Shift_Del_p.A654fs	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	973_982					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TCTAGTTCTACACTGGGTGAACAACTCTCCTCTTCAGCCACAGTCTGC	0.487													202	21	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11725179	11725180	+	Intron	INS	-	A	A	rs78338846		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11725179_11725180insA	uc002rbk.1	+						GREB1_uc002rbl.2_Intron|GREB1_uc002rbn.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TCTGTGATTAGAAAAAAAAAAA	0.302													5	3	---	---	---	---	
VPS54	51542	broad.mit.edu	37	2	64196132	64196132	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64196132delA	uc002scq.2	-						VPS54_uc002scp.2_Intron|VPS54_uc010fct.2_Intron	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1						protein transport|retrograde transport, endosome to Golgi						0						TTATCTATTTAAAAAAGAAGG	0.289													66	32	---	---	---	---	
CLEC4F	165530	broad.mit.edu	37	2	71037772	71037775	+	Intron	DEL	AAGT	-	-	rs58138583		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71037772_71037775delAAGT	uc002shf.2	-						CLEC4F_uc010yqv.1_Intron	NM_173535	NP_775806	Q8N1N0	CLC4F_HUMAN	C-type lectin, superfamily member 13						endocytosis	integral to membrane	receptor activity|sugar binding			ovary(5)	5						aaaaaaaaaaaaGTATTTCCCATT	0.147													4	2	---	---	---	---	
TMEM87B	84910	broad.mit.edu	37	2	112870703	112870706	+	Intron	DEL	TACT	-	-	rs142414944		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112870703_112870706delTACT	uc002thm.2	+							NM_032824	NP_116213	Q96K49	TM87B_HUMAN	transmembrane protein 87B precursor							integral to membrane					0						ACAAGATAAATACTTACTGGTATG	0.294													6	5	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179425049	179425050	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179425049_179425050insT	uc010zfg.1	-	275	78329_78330	c.78105_78106insA	c.(78103-78108)AAACCAfs	p.K26035fs	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Frame_Shift_Ins_p.K19730fs|TTN_uc010zfi.1_Frame_Shift_Ins_p.K19663fs|TTN_uc010zfj.1_Frame_Shift_Ins_p.K19538fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26962_26963							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATAAACTGGTTTTTTGTTTA	0.406													98	15	---	---	---	---	
ARPC2	10109	broad.mit.edu	37	2	219118832	219118832	+	3'UTR	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219118832delA	uc002vhd.2	+	11					ARPC2_uc002vhe.2_3'UTR|ARPC2_uc002vhf.2_3'UTR	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCCAAGAATTAAAAAAAAAAA	0.368													6	4	---	---	---	---	
COL4A3	1285	broad.mit.edu	37	2	228118588	228118589	+	Intron	INS	-	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228118588_228118589insA	uc002vom.1	+						COL4A3_uc002von.1_Intron|COL4A3_uc002voo.1_Intron|COL4A3_uc002vop.1_Intron|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor						activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AGACTTCATTTAAAAAAAAAAA	0.366													7	6	---	---	---	---	
DGKD	8527	broad.mit.edu	37	2	234296911	234296912	+	Frame_Shift_Ins	INS	-	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234296911_234296912insA	uc002vui.1	+	2	177_178	c.165_166insA	c.(163-168)ATCAAAfs	p.I55fs	DGKD_uc002vuj.1_Frame_Shift_Ins_p.I11fs	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	55_56	PH.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	AGACCATCATCAAAGAGGGGAT	0.441													159	15	---	---	---	---	
EPHA3	2042	broad.mit.edu	37	3	89448278	89448278	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89448278delA	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		gactttgtctaaaaaaaaaaa	0.109										TSP Lung(6;0.00050)			5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	111197863	111197868	+	IGR	DEL	CACACA	-	-	rs7650195		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111197863_111197868delCACACA								PVRL3 (285490 upstream) : CD96 (63058 downstream)																							CGAACAGCCTcacacacacacacaca	0.442													4	2	---	---	---	---	
ABHD10	55347	broad.mit.edu	37	3	111705862	111705863	+	Frame_Shift_Ins	INS	-	ACCTTAG	ACCTTAG			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111705862_111705863insACCTTAG	uc003dyk.3	+	4	621_622	c.540_541insACCTTAG	c.(538-543)GATACCfs	p.D180fs	ABHD10_uc011bhq.1_Frame_Shift_Ins_p.D23fs	NM_018394	NP_060864	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10 precursor	180_181						mitochondrion	serine-type peptidase activity				0						CAGCTGCAGATACCTTAGTGAC	0.441													135	12	---	---	---	---	
PPARGC1A	10891	broad.mit.edu	37	4	23825732	23825732	+	Intron	DEL	T	-	-	rs56881226	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23825732delT	uc003gqs.2	-						PPARGC1A_uc003gqt.2_Intron|PPARGC1A_uc011bxp.1_Intron|PPARGC1A_uc010ier.1_Intron	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor						androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				tttttattagttttttttttt	0.303													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																							tccattccgttccggtccattccat	0.000													149	10	---	---	---	---	
MIR1269	100302177	broad.mit.edu	37	4	67142261	67142262	+	5'Flank	INS	-	G	G	rs7437072	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67142261_67142262insG	hsa-mir-1269|MI0006406	+																							0						ctgggtgtgtcggggggggtgt	0.025													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	72745204	72745205	+	IGR	DEL	AT	-	-	rs144769363		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72745204_72745205delAT								GC (75446 upstream) : NPFFR2 (152316 downstream)																							acacacacacaTGCATATATGG	0.193													4	2	---	---	---	---	
NEK1	4750	broad.mit.edu	37	4	170522990	170522990	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170522990delA	uc003isb.1	-						NEK1_uc003isc.1_Intron|NEK1_uc003isd.1_Intron|NEK1_uc003ise.1_Intron|NEK1_uc003isf.1_Intron|NEK1_uc003isg.1_5'Flank	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1						cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		gtctcaatttaaaaaaaaaaa	0.139													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179874837	179874839	+	IGR	DEL	CAT	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179874837_179874839delCAT								LOC285501 (962934 upstream) : None (None downstream)																							ccaccatcaccatcaccaccatc	0.000													4	2	---	---	---	---	
SDHA	6389	broad.mit.edu	37	5	251704	251704	+	Intron	DEL	G	-	-	rs111797600		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:251704delG	uc003jao.3	+						SDHA_uc011clv.1_Frame_Shift_Del_p.A639fs|SDHA_uc011clw.1_Intron|SDHA_uc003jap.3_Intron|SDHA_uc003jaq.3_Intron|SDHA_uc003jar.3_Intron	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TCCAAAAAATGCCTTTTTCCC	0.517									Familial_Paragangliomas				4	2	---	---	---	---	
NDUFS6	4726	broad.mit.edu	37	5	1801427	1801428	+	5'Flank	INS	-	G	G	rs150444980	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1801427_1801428insG	uc003jcy.2	+						MRPL36_uc003jcx.3_5'Flank	NM_004553	NP_004544	O75380	NDUS6_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 6,						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1					NADH(DB00157)	GCGCTCCCCGCCCCCAGGGCGA	0.644													5	4	---	---	---	---	
SV2C	22987	broad.mit.edu	37	5	75577223	75577223	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75577223delA	uc003kei.1	+							NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TATGCAAAGTAAAAAAAAAAA	0.313													4	2	---	---	---	---	
LARS	51520	broad.mit.edu	37	5	145518604	145518604	+	Intron	DEL	A	-	-	rs112008700		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145518604delA	uc003lnx.1	-						LARS_uc011dbq.1_Intron|LARS_uc011dbr.1_Intron|LARS_uc011dbs.1_Intron	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase						leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	TGGATTTGTGaaaaaaaaaaa	0.194													5	3	---	---	---	---	
RPS14	6208	broad.mit.edu	37	5	149826951	149826952	+	Intron	INS	-	T	T	rs141773002	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149826951_149826952insT	uc003lsh.2	-						RPS14_uc003lsi.2_Intron|RPS14_uc003lsj.2_Intron	NM_001025071	NP_001020242	P62263	RS14_HUMAN	ribosomal protein S14						endocrine pancreas development|erythrocyte differentiation|maturation of SSU-rRNA|negative regulation of transcription from RNA polymerase II promoter|ribosomal small subunit assembly|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	mRNA 5'-UTR binding|protein binding|structural constituent of ribosome|translation regulator activity			central_nervous_system(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCATCACGCTGTAAGGACGAAG	0.381													5	5	---	---	---	---	
ZKSCAN3	80317	broad.mit.edu	37	6	28327932	28327932	+	Intron	DEL	T	-	-	rs113424723		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28327932delT	uc003nle.3	+						ZKSCAN3_uc010jrc.2_Intron|ZKSCAN3_uc003nlf.3_Intron	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3						positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						ctcagaataatttttttttta	0.050													4	4	---	---	---	---	
MRPS18B	28973	broad.mit.edu	37	6	30585855	30585855	+	Intron	DEL	C	-	-	rs3214308		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30585855delC	uc003nqo.2	+						PPP1R10_uc003nqn.1_5'Flank|PPP1R10_uc010jsc.1_5'Flank|MRPS18B_uc011dml.1_Intron|MRPS18B_uc010jsd.1_Intron	NM_014046	NP_054765	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B precursor						translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(1)	1						CTTCCTGCAACCCCCCCCCCA	0.512													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58776580	58776581	+	IGR	INS	-	A	A	rs4394245		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58776580_58776581insA								GUSBL2 (488856 upstream) : None (None downstream)																							tatctccccataaaaccaagac	0.000													355	9	---	---	---	---	
AGR2	10551	broad.mit.edu	37	7	16834393	16834394	+	Intron	INS	-	AG	AG	rs143338824	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16834393_16834394insAG	uc003str.2	-							NM_006408	NP_006399	O95994	AGR2_HUMAN	anterior gradient 2 homolog precursor						mucus secretion	endoplasmic reticulum|extracellular region	protein binding				0	Lung NSC(10;0.0376)|all_lung(11;0.0855)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		ctgagatggaaagagtgtgatt	0.119													5	4	---	---	---	---	
RASA4	10156	broad.mit.edu	37	7	102246649	102246649	+	Intron	DEL	C	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102246649delC	uc003vae.2	-						UPK3BL_uc003uzy.2_Intron|RASA4_uc011kla.1_Intron|RASA4_uc010lig.2_Intron|RASA4_uc003vaf.2_Intron|RASA4_uc011klb.1_Intron|RASA4_uc010lih.2_Intron|RASA4_uc011kld.1_Intron	NM_006989	NP_008920	O43374	RASL2_HUMAN	RAS p21 protein activator 4 isoform 1						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0						aagtcagtgacctggggcctg	0.090													6	3	---	---	---	---	
FAM3C	10447	broad.mit.edu	37	7	121023197	121023197	+	Intron	DEL	A	-	-	rs35702337		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121023197delA	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)					CATTGGCATTAAAAAAAAAAA	0.209													4	2	---	---	---	---	
STC1	6781	broad.mit.edu	37	8	23709570	23709571	+	Intron	DEL	TG	-	-	rs113294965		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23709570_23709571delTG	uc003xdw.1	-							NM_003155	NP_003146	P52823	STC1_HUMAN	stanniocalcin 1 precursor						cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity			skin(3)|upper_aerodigestive_tract(1)	4		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		TGAGTGCCTCtgtgtgtgtgtg	0.431													4	2	---	---	---	---	
ELP3	55140	broad.mit.edu	37	8	28016335	28016335	+	Intron	DEL	T	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28016335delT	uc003xgo.3	+						ELP3_uc003xgn.3_Intron|ELP3_uc011laq.1_Intron|ELP3_uc011lar.1_Intron|ELP3_uc011las.1_Intron|ELP3_uc011lat.1_Intron	NM_018091	NP_060561	Q9H9T3	ELP3_HUMAN	elongation protein 3 homolog						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	histone acetyltransferase activity|iron-sulfur cluster binding|metal ion binding|phosphorylase kinase regulator activity|protein binding				0		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		AAGAGCCAGGTTAGGAAAACG	0.284													4	2	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121823372	121823372	+	Intron	DEL	C	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823372delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGCCACCCTTCCCCCCCCCCC	0.622													2	7	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386780	33386781	+	Intron	INS	-	A	A	rs144468472	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386780_33386781insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		aatggtaggtcggggggcccag	0.257													6	3	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	92007622	92007625	+	Intron	DEL	TTCT	-	-	rs67832119		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92007622_92007625delTTCT	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						TGTCTTCTAGTTCTTTCTTTTTCG	0.265													5	4	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126520256	126520256	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126520256delA	uc004bnz.1	-						DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						TAAGCTAGTTaaaaaaaaaaa	0.343													5	3	---	---	---	---	
SETX	23064	broad.mit.edu	37	9	135140564	135140565	+	Intron	INS	-	A	A	rs147820832	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135140564_135140565insA	uc004cbk.2	-						SETX_uc004cbj.2_Intron|SETX_uc010mzt.2_Intron	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin						cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GTCCCATTCCTAAAAATAAGAC	0.208													4	3	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137618916	137618917	+	Intron	INS	-	GGAC	GGAC	rs139171326	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137618916_137618917insGGAC	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		gatggatggatggatggatggG	0.238													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30900648	30900652	+	IGR	DEL	AAAGA	-	-	rs137937328		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30900648_30900652delAAAGA								MAP3K8 (149887 upstream) : LYZL2 (57 downstream)																							agaaagaaagaaagaaaagaaaaga	0.093													2	4	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32329555	32329560	+	Intron	DEL	ACACAC	-	-	rs145271745		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32329555_32329560delACACAC	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				ACACCCTAAAacacacacacacacac	0.233													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385235	42385235	+	IGR	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385235delA								None (None upstream) : LOC441666 (442080 downstream)																							aatggtctcgaatggaatcat	0.000													1915	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385707	42385722	+	IGR	DEL	AATGGAATCATCATTA	-	-	rs33914712		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385707_42385722delAATGGAATCATCATTA								None (None upstream) : LOC441666 (441593 downstream)																							aatggaatcgaatggaatcatcattaaatggaatca	0.042													129	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42396712	42396712	+	IGR	DEL	T	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42396712delT								None (None upstream) : LOC441666 (430603 downstream)																							ttgaacggaatcaaatggaat	0.000													236	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42599640	42599640	+	IGR	DEL	A	-	-	rs145203825		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42599640delA								None (None upstream) : LOC441666 (227675 downstream)																							aatggaaatgaaaggagtcat	0.000													1687	14	---	---	---	---	
BRSK2	9024	broad.mit.edu	37	11	1432631	1432631	+	Intron	DEL	C	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1432631delC	uc001lti.2	+						BRSK2_uc009ycv.1_Intron|BRSK2_uc001lth.1_Intron|BRSK2_uc001ltj.2_Intron|BRSK2_uc001ltk.2_Intron|BRSK2_uc001ltl.2_Intron|BRSK2_uc001ltm.2_5'UTR	NM_003957	NP_003948	Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2						establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		ACCAGCCTCACCCCATGAGCC	0.701													30	21	---	---	---	---	
TRIM48	79097	broad.mit.edu	37	11	55033274	55033274	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55033274delA	uc010rid.1	+							NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48							intracellular	zinc ion binding				0						TCTGGGAGTCAAAAAAAAAAA	0.343													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	86736370	86736371	+	IGR	INS	-	C	C	rs138581182	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86736370_86736371insC								FZD4 (69937 upstream) : TMEM135 (12694 downstream)																							agagtgagactccatctcaaaa	0.134													5	3	---	---	---	---	
C11orf63	79864	broad.mit.edu	37	11	122805948	122805949	+	Intron	INS	-	T	T	rs113946401		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122805948_122805949insT	uc001pym.2	+							NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1											ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		AAAGAGTCCACttttttttttt	0.248													9	5	---	---	---	---	
VWF	7450	broad.mit.edu	37	12	6166813	6166814	+	Intron	INS	-	G	G			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6166813_6166814insG	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TGGCCTGTGGCGGGCGCCCAAT	0.371													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	24737258	24737263	+	5'Flank	DEL	CCCCCA	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24737258_24737263delCCCCCA	uc001rgb.1	-											Homo sapiens cDNA FLJ32894 fis, clone TESTI2004994.																		CTTCGATTAGcccccacccccacccc	0.432													4	3	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100774908	100774915	+	Intron	DEL	CATCTCAG	-	-	rs68046331		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774908_100774915delCATCTCAG	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TAGCTCCTCCcatctcagcatctcagca	0.221													5	3	---	---	---	---	
RFX4	5992	broad.mit.edu	37	12	107080945	107080946	+	Intron	INS	-	TC	TC	rs57545359		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107080945_107080946insTC	uc001tlr.2	+						RFX4_uc010swv.1_Intron|RFX4_uc001tls.2_Intron|RFX4_uc001tlt.2_Intron|RFX4_uc001tlv.2_Intron|uc001tlu.3_5'Flank	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						ctctgtctctatctctctctct	0.218													24	8	---	---	---	---	
TMEM132B	114795	broad.mit.edu	37	12	126075578	126075583	+	Intron	DEL	TGTGTT	-	-	rs71967161		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126075578_126075583delTGTGTT	uc001uhe.1	+							NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		tgtgtgtgtgtgtgtttgtgtgtgtg	0.325													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19408019	19408019	+	IGR	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19408019delA								OR11H12 (29447 upstream) : POTEG (145346 downstream)																							CTGTGGAGCCAAAAAAAAAAT	0.393													4	2	---	---	---	---	
SUPT16H	11198	broad.mit.edu	37	14	21837538	21837539	+	Intron	INS	-	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21837538_21837539insT	uc001wao.2	-							NM_007192	NP_009123	Q9Y5B9	SP16H_HUMAN	chromatin-specific transcription elongation						DNA repair|DNA replication|nucleosome disassembly|positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding				0	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		CAGAAATAAAGTAACACTTACT	0.431													62	43	---	---	---	---	
RALGAPA1	253959	broad.mit.edu	37	14	36159331	36159331	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36159331delA	uc001wti.2	-						RALGAPA1_uc001wtj.2_Intron|RALGAPA1_uc010tpv.1_Intron|RALGAPA1_uc010tpw.1_Intron|RALGAPA1_uc001wtk.1_Intron	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1						activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						AAGCTCAATGAAAAAAAAATC	0.249													3	3	---	---	---	---	
CCNDBP1	23582	broad.mit.edu	37	15	43481303	43481304	+	Intron	INS	-	AAAA	AAAA			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43481303_43481304insAAAA	uc001zqv.2	+						CCNDBP1_uc001zqu.2_Intron|CCNDBP1_uc010bdc.2_Intron|CCNDBP1_uc010bdb.2_Intron|CCNDBP1_uc010udl.1_Intron|CCNDBP1_uc001zqw.2_Intron|CCNDBP1_uc001zqx.2_Intron|CCNDBP1_uc010bdd.2_Intron|CCNDBP1_uc001zqy.2_Intron	NM_012142	NP_036274	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1 isoform 1						cell cycle	cytoplasm|nucleus	protein binding			ovary(1)|kidney(1)	2		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		aaaaaaaaaagaaaaagaaaga	0.149													11	7	---	---	---	---	
DMXL2	23312	broad.mit.edu	37	15	51787202	51787205	+	Intron	DEL	CAAA	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51787202_51787205delCAAA	uc002abf.2	-						DMXL2_uc010ufy.1_Intron|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		TGCAAAGCTTCAAACAGTGAGTGA	0.417													42	27	---	---	---	---	
FLYWCH1	84256	broad.mit.edu	37	16	2988609	2988609	+	Intron	DEL	T	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2988609delT	uc002csd.2	+						FLYWCH1_uc002csb.2_Intron|FLYWCH1_uc002csc.2_Intron|FLYWCH1_uc010bsv.2_Intron|FLYWCH1_uc002cse.2_Intron	NM_032296	NP_115672	Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1 isoform a							nucleus	DNA binding|metal ion binding				0						CCAGtctttgttttttttttt	0.224													5	4	---	---	---	---	
SEC14L5	9717	broad.mit.edu	37	16	5040971	5040971	+	Intron	DEL	T	-	-	rs74005453		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5040971delT	uc002cye.2	+							NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5							integral to membrane|intracellular	transporter activity				0						gcatgacccctggcaagaccc	0.289													4	3	---	---	---	---	
KIAA0430	9665	broad.mit.edu	37	16	15705303	15705304	+	Intron	INS	-	A	A	rs11398605		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15705303_15705304insA	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1							peroxisome	nucleotide binding|RNA binding				0						gactccgtctcaaaaaaaaaaa	0.104													5	3	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19041330	19041331	+	Intron	INS	-	C	C	rs138006371	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19041330_19041331insC	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						gagccaccttgcccggccCACC	0.079													2	4	---	---	---	---	
CCL22	6367	broad.mit.edu	37	16	57392507	57392508	+	5'Flank	INS	-	G	G	rs141715185	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57392507_57392508insG	uc002elh.2	+							NM_002990	NP_002981	O00626	CCL22_HUMAN	small inducible cytokine A22 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|response to virus|signal transduction	extracellular space	chemokine activity				0						GACAGAGTTGAGGGGGGGTCCC	0.470													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	7858584	7858585	+	IGR	DEL	AA	-	-	rs78611358		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7858584_7858585delAA								CNTROB (5689 upstream) : GUCY2D (47403 downstream)																							ctgtctcaagaaaaaaaaaaaa	0.168													4	2	---	---	---	---	
TLCD1	116238	broad.mit.edu	37	17	27051350	27051370	+	3'UTR	DEL	AATAAAGGACAAGGACTTCAG	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27051350_27051370delAATAAAGGACAAGGACTTCAG	uc002hco.2	-	4					RPL23A_uc002hci.2_3'UTR|TLCD1_uc010waw.1_3'UTR	NM_138463	NP_612472	Q96CP7	TLCD1_HUMAN	TLC domain containing 1 isoform 1							integral to membrane					0	Lung NSC(42;0.00431)					CCCCTTGCCCAATAAAGGACAAGGACTTCAGAGGAGTACTT	0.538													58	17	---	---	---	---	
CCL7	6354	broad.mit.edu	37	17	32597252	32597259	+	5'UTR	DEL	GAGACCAA	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32597252_32597259delGAGACCAA	uc002hhz.2	+	1					CCL7_uc010ctf.2_RNA	NM_006273	NP_006264	P80098	CCL7_HUMAN	chemokine (C-C motif) ligand 7 precursor						cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity|heparin binding			ovary(1)	1	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		CAGAGGGGCTGAGACCAAACCAGAAACC	0.476													29	9	---	---	---	---	
AP2B1	163	broad.mit.edu	37	17	34037167	34037167	+	Intron	DEL	C	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34037167delC	uc002hjr.2	+						AP2B1_uc002hjq.2_Intron|AP2B1_uc010wci.1_Intron|AP2B1_uc002hjs.2_Intron|AP2B1_uc002hjt.2_Intron|AP2B1_uc010ctv.2_Intron|AP2B1_uc010wcj.1_Intron	NM_001282	NP_001273	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		AGCCAGCATGCCAAAGGAAAA	0.473													8	4	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36358657	36358658	+	Intron	INS	-	A	A			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36358657_36358658insA	uc010wdn.1	-						TBC1D3_uc010cvk.2_5'Flank			Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TATATTCTCTTAATTATTATTT	0.252													12	7	---	---	---	---	
IGF2BP1	10642	broad.mit.edu	37	17	47076718	47076719	+	Intron	INS	-	A	A	rs141190373	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47076718_47076719insA	uc002iom.2	+						IGF2BP1_uc010dbj.2_Intron	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding						CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						TTACAGCTTGTAAAAAAAAAAT	0.441													5	3	---	---	---	---	
ITGA3	3675	broad.mit.edu	37	17	48148009	48148018	+	Intron	DEL	AAAAAAAAAA	-	-	rs72396175		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48148009_48148018delAAAAAAAAAA	uc010dbl.2	+						ITGA3_uc010dbm.2_Intron	NM_002204	NP_002195	P26006	ITA3_HUMAN	integrin alpha 3 isoform a precursor						blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|leukocyte migration	cell surface|integrin complex	protein binding|receptor activity			ovary(2)|pancreas(1)	3						agactgtctcaaaaaaaaaaaaaaaaaaaa	0.033													3	3	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49350959	49350960	+	Intron	INS	-	T	T	rs71355748		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49350959_49350960insT	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			TTATGTTATTGTTTTTTTTTTT	0.238													6	5	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025820	64025821	+	Intron	INS	-	TAAA	TAAA	rs144628903	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025820_64025821insTAAA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gaccctgtctctaaataaacaa	0.114													7	4	---	---	---	---	
ZNF519	162655	broad.mit.edu	37	18	14124177	14124177	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14124177delA	uc002kst.1	-						ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						tgtctcaattaaaaaaaaaaa	0.134													4	2	---	---	---	---	
ARRDC5	645432	broad.mit.edu	37	19	4903031	4903032	+	5'Flank	INS	-	TCACTGGTTCTTTT	TCACTGGTTCTTTT	rs144459964	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4903031_4903032insTCACTGGTTCTTTT	uc002mbm.2	-							NM_001080523	NP_001073992	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5						signal transduction						0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		ACCTGTAGTCCTCACTGGttct	0.302													9	4	---	---	---	---	
ECSIT	51295	broad.mit.edu	37	19	11618097	11618098	+	Intron	INS	-	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11618097_11618098insT	uc002msb.2	-						ZNF653_uc002mrz.1_5'Flank|ECSIT_uc002msa.1_Intron|ECSIT_uc010dyc.1_Intron|ECSIT_uc010dyd.2_Intron|ECSIT_uc010xma.1_Intron	NM_016581	NP_057665	Q9BQ95	ECSIT_HUMAN	evolutionarily conserved signaling intermediate						innate immune response|regulation of oxidoreductase activity	mitochondrion	oxidoreductase activity, acting on NADH or NADPH|protein binding			ovary(1)	1						AGGTTTTTGCCttttttttttt	0.302													3	3	---	---	---	---	
ELOF1	84337	broad.mit.edu	37	19	11664398	11664417	+	3'UTR	DEL	ACACACACACACACACACAC	-	-	rs66953353		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11664398_11664417delACACACACACACACACACAC	uc002mse.1	-	4					ELOF1_uc002msd.1_3'UTR	NM_032377	NP_115753	P60002	ELOF1_HUMAN	elongation factor 1 homolog (ELF1, S.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding				0						cacacccactacacacacacacacacacacacacacacac	0.350													8	4	---	---	---	---	
ZNF788	388507	broad.mit.edu	37	19	12220984	12220985	+	Intron	INS	-	AG	AG	rs151290507	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12220984_12220985insAG	uc002mtd.2	+							NR_027049				RecName: Full=Zinc finger protein 788;												0						TGAGTATAGGCAGCGTAAGAGG	0.416													8	5	---	---	---	---	
ZSWIM4	65249	broad.mit.edu	37	19	13915461	13915461	+	Intron	DEL	A	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13915461delA	uc002mxh.1	+						ZSWIM4_uc010xng.1_5'Flank	NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4								zinc ion binding			central_nervous_system(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			attttgtttcaaaaaaaaaaa	0.234													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27732215	27732216	+	IGR	INS	-	C	C	rs74197760		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27732215_27732216insC								None (None upstream) : LOC148189 (549186 downstream)																							agaaaaggaaatatcttcgtat	0.000													1203	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27732326	27732329	+	IGR	DEL	TGTT	-	-	rs74211006		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27732326_27732329delTGTT								None (None upstream) : LOC148189 (549073 downstream)																							ggaaacactctgtttgtaaaatct	0.000													212	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27736453	27736453	+	IGR	DEL	T	-	-	rs4567863		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27736453delT								None (None upstream) : LOC148189 (544949 downstream)																							tggaaacgggtttttttcttg	0.000													309	10	---	---	---	---	
CDK5RAP1	51654	broad.mit.edu	37	20	31981971	31981971	+	Intron	DEL	T	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31981971delT	uc010gek.2	-						CDK5RAP1_uc002wyy.2_Intron|CDK5RAP1_uc002wyz.2_Intron|CDK5RAP1_uc002wza.2_Intron|CDK5RAP1_uc010gel.2_Intron|CDK5RAP1_uc010gem.2_Intron|CDK5RAP1_uc002wzc.1_Intron|CDK5RAP1_uc010gen.2_Intron	NM_016408	NP_057492	Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1						brain development|negative regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation|tRNA modification	cytoplasm	4 iron, 4 sulfur cluster binding|metal ion binding|neuronal Cdc2-like kinase binding|transferase activity			ovary(2)|skin(2)|lung(1)	5						ttttttttccttttttttttt	0.154													32	7	---	---	---	---	
ZNF335	63925	broad.mit.edu	37	20	44586694	44586695	+	Intron	INS	-	T	T			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44586694_44586695insT	uc002xqw.2	-						ZNF335_uc010zxk.1_Intron	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				aaccacttttcttttttttttt	0.074													16	11	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074004	62074006	+	Intron	DEL	CAC	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074004_62074006delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccaaaaccatcaccaccaccatc	0.025													12	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085832	11085834	+	Intron	DEL	CAC	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085832_11085834delCAC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccaccaccatcaccatcaccacc	0.000													4	2	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						GTGTCTCtgtgtgcgtgcgtgcgt	0.270													6	4	---	---	---	---	
AGPAT3	56894	broad.mit.edu	37	21	45398160	45398161	+	Intron	INS	-	TTGTT	TTGTT	rs141651711	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45398160_45398161insTTGTT	uc002zdv.2	+						AGPAT3_uc002zdw.2_Intron|AGPAT3_uc002zdx.2_Intron|AGPAT3_uc002zdy.2_Intron	NM_020132	NP_064517	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		tcttctttctgttgttttgttt	0.243													6	3	---	---	---	---	
PCNT	5116	broad.mit.edu	37	21	47810134	47810136	+	Intron	DEL	AGG	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47810134_47810136delAGG	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					aggctgaggcaggaggattgctt	0.030													7	6	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	23104624	23104625	+	Intron	INS	-	C	C	rs139399913	by1000genomes	TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23104624_23104625insC	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						CAAAGGTGATGCCCCCAACCCT	0.609													4	2	---	---	---	---	
CELSR1	9620	broad.mit.edu	37	22	46877682	46877682	+	Intron	DEL	T	-	-	rs112110956		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46877682delT	uc003bhw.1	-							NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TTTCTAAAtcttttttttttt	0.274													4	2	---	---	---	---	
PRRG1	5638	broad.mit.edu	37	X	37300899	37300899	+	Intron	DEL	T	-	-			TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37300899delT	uc004ddn.2	+						PRRG1_uc004ddo.2_Intron|PRRG1_uc010ngx.1_RNA	NM_000950	NP_000941	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1							extracellular region|integral to plasma membrane	calcium ion binding			ovary(1)|breast(1)	2						GGCCTTCTACTTCGACCGGGA	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13478034	13478034	+	IGR	DEL	A	-	-	rs76437112		TCGA-EJ-5511-01	TCGA-EJ-5511-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13478034delA								None (None upstream) : None (None downstream)																							GCAAAAGCCGAGAGGACTGGG	0.672													4	2	---	---	---	---	
