Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PLA2G5	5322	broad.mit.edu	37	1	20411351	20411351	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20411351T>G	uc001bcy.2	+	2	296	c.28T>G	c.(28-30)TTC>GTC	p.F10V	PLA2G5_uc001bcw.2_RNA|PLA2G5_uc001bcx.2_Missense_Mutation_p.F41V	NM_000929	NP_000920	P39877	PA2G5_HUMAN	phospholipase A2, group V precursor	10					lipid catabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		ACTGGCTTGGTTCCTGGCTTG	0.403													4	129	---	---	---	---	PASS
AK2	204	broad.mit.edu	37	1	33476292	33476292	+	3'UTR	SNP	A	G	G	rs74066439		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33476292A>G	uc001bwo.1	-	7					uc001bwn.2_Intron|AK2_uc010ohq.1_3'UTR|AK2_uc009vud.1_3'UTR	NM_013411	NP_037543	P54819	KAD2_HUMAN	adenylate kinase 2 isoform b						nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TGTTGTTCCAAGTATTCCTCT	0.473													6	20	---	---	---	---	PASS
KCNA2	3737	broad.mit.edu	37	1	111147494	111147494	+	Translation_Start_Site	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111147494C>T	uc001dzu.2	-	2	407	c.-89G>A	c.(-91--87)CTGTG>CTATG		KCNA2_uc009wfv.1_Translation_Start_Site|KCNA2_uc009wfw.2_Translation_Start_Site	NM_004974	NP_004965	P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related							juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(1)	1		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)		CCAGGAAGCACAGGAGCATTG	0.582													13	48	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114483187	114483187	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114483187A>G	uc001eem.2	+	2	343	c.182A>G	c.(181-183)CAG>CGG	p.Q61R	HIPK1_uc001eel.2_Missense_Mutation_p.Q61R|HIPK1_uc001een.2_Missense_Mutation_p.Q61R	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	61					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCTCTCACCAGGTAGCAAAT	0.537													15	227	---	---	---	---	PASS
KIRREL	55243	broad.mit.edu	37	1	158064571	158064571	+	Silent	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158064571C>T	uc001frn.3	+	15	2339	c.1935C>T	c.(1933-1935)AGC>AGT	p.S645S	KIRREL_uc010pib.1_Silent_p.S545S|KIRREL_uc009wsq.2_Silent_p.S481S|KIRREL_uc001fro.3_Silent_p.S459S|uc001frp.2_5'Flank	NM_018240	NP_060710	Q96J84	KIRR1_HUMAN	kin of IRRE like precursor	645	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)					CCCACTCCAGCGGCTATGCCC	0.672													6	39	---	---	---	---	PASS
OR10Z1	128368	broad.mit.edu	37	1	158577155	158577155	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158577155G>T	uc010pio.1	+	1	927	c.927G>T	c.(925-927)TTG>TTT	p.L309F		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	309	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)					GAGGGAGATTGCTGGGTAAAG	0.478													11	241	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190129810	190129810	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190129810A>G	uc001gse.1	-	7	1404	c.1172T>C	c.(1171-1173)CTG>CCG	p.L391P	FAM5C_uc010pot.1_Missense_Mutation_p.L289P	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	391						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TTGTCTTGGCAGGCTGATGAG	0.373													13	135	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228399482	228399482	+	5'UTR	SNP	C	G	G	rs11804508	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228399482C>G	uc009xez.1	+	2					OBSCN_uc001hsn.2_5'UTR|uc001hsm.1_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CGCCGCCACCCTCATGGATCA	0.662													3	5	---	---	---	---	PASS
OR2B11	127623	broad.mit.edu	37	1	247614412	247614412	+	Silent	SNP	G	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247614412G>T	uc010pyx.1	-	1	873	c.873C>A	c.(871-873)CCC>CCA	p.P291P		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	291	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGTAGGTGAAGGGATTGAGAG	0.488													6	423	---	---	---	---	PASS
OR2T3	343173	broad.mit.edu	37	1	248637353	248637353	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248637353T>A	uc001iel.1	+	1	702	c.702T>A	c.(700-702)AAT>AAA	p.N234K		NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACAGGATGAATTCTGCCGCCG	0.562													13	143	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15378658	15378658	+	Silent	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15378658C>T	uc002rcc.1	-	45	5903	c.5877G>A	c.(5875-5877)GAG>GAA	p.E1959E	NBAS_uc002rcb.1_5'UTR|NBAS_uc010exl.1_Silent_p.E1031E|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1959										ovary(2)|liver(1)|skin(1)	4						CAAGTGATTTCTCCAGATGAT	0.408													9	110	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25505422	25505422	+	Silent	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25505422G>A	uc002rgc.2	-	4	593	c.336C>T	c.(334-336)GGC>GGT	p.G112G	DNMT3A_uc002rgd.2_Silent_p.G112G|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rge.2_Silent_p.G109G|DNMT3A_uc002rgf.2_Silent_p.G112G	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	112					regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGGGGCCCCGCCCTTCTGCC	0.667			Mis|F|N|S		AML								4	96	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54785909	54785909	+	Intron	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54785909G>A	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron|SPTBN1_uc002rxx.2_5'UTR	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			GCGTTACGCCGGGCATAATGG	0.637													4	159	---	---	---	---	PASS
NPAS2	4862	broad.mit.edu	37	2	101607290	101607290	+	Silent	SNP	C	T	T	rs146215582	byFrequency	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101607290C>T	uc002tap.1	+	19	2353	c.2067C>T	c.(2065-2067)GAC>GAT	p.D689D	NPAS2_uc010yvt.1_Silent_p.D754D|NPAS2_uc010fit.1_Intron	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	689					central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						GGTCCTGTGACGCAAGGCAGC	0.607													8	46	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114355998C>G	uc002tkh.2	+	5	674	c.616C>G	c.(616-618)CAC>GAC	p.H206D	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCAAGGTGGGCACTTGATGTC	0.612													3	2	---	---	---	---	PASS
SLC35F5	80255	broad.mit.edu	37	2	114501368	114501368	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114501368C>T	uc002tku.1	-	6	908	c.484G>A	c.(484-486)GAA>AAA	p.E162K	SLC35F5_uc002tkt.2_RNA|SLC35F5_uc002tkv.2_Missense_Mutation_p.E156K|SLC35F5_uc002tkw.2_Missense_Mutation_p.E162K	NM_025181	NP_079457	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	162					transport	integral to membrane					0						TACAGAGGTTCACTCTGGAAT	0.323													69	196	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179580256	179580256	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179580256C>T	uc010zfg.1	-	86	22377	c.22153G>A	c.(22153-22155)GGC>AGC	p.G7385S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G4046S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8312							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGGCACTGCCTGCTGCATTG	0.478													12	85	---	---	---	---	PASS
WDFY1	57590	broad.mit.edu	37	2	224749392	224749392	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224749392C>A	uc002vnq.2	-	9	957	c.906G>T	c.(904-906)TGG>TGT	p.W302C		NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	302	FYVE-type.					cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		TCTTGGTGTCCCACATCTGCT	0.463													5	366	---	---	---	---	PASS
CHRND	1144	broad.mit.edu	37	2	233394757	233394757	+	Missense_Mutation	SNP	G	A	A	rs148869069	byFrequency	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233394757G>A	uc002vsw.2	+	7	732	c.728G>A	c.(727-729)CGC>CAC	p.R243H	CHRND_uc010zmg.1_Missense_Mutation_p.R228H|CHRND_uc010fyc.2_Missense_Mutation_p.R116H|CHRND_uc010zmh.1_Intron	NM_000751	NP_000742	Q07001	ACHD_HUMAN	nicotinic acetylcholine receptor delta	243	Extracellular (Potential).				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity	p.R243H(1)		ovary(1)|breast(1)|skin(1)	3		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)		CTCATCATCCGCCGCAAGCCC	0.607													18	57	---	---	---	---	PASS
PDCD1	5133	broad.mit.edu	37	2	242794944	242794944	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242794944G>T	uc002wcq.3	-	2	333	c.265C>A	c.(265-267)CCC>ACC	p.P89T	PDCD1_uc010fzs.2_Missense_Mutation_p.P20T|PDCD1_uc010fzt.2_Intron	NM_005018	NP_005009	Q15116	PDCD1_HUMAN	programmed cell death 1 precursor	89	Ig-like V-type.|Extracellular (Potential).				apoptosis|humoral immune response|multicellular organismal development|T cell costimulation	integral to membrane	protein tyrosine phosphatase activity|signal transducer activity			ovary(1)	1		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0219)		TCCTGGCCGGGCTGGCTGCGG	0.642													8	41	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38991766	38991766	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38991766G>A	uc011ays.1	-	1	287	c.88C>T	c.(88-90)CGG>TGG	p.R30W		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	30					response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	ATGGCAATCCGCTTCTCAATT	0.517													9	216	---	---	---	---	PASS
RTP3	83597	broad.mit.edu	37	3	46542309	46542309	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46542309A>G	uc003cps.1	+	2	687	c.619A>G	c.(619-621)ATC>GTC	p.I207V		NM_031440	NP_113628	Q9BQQ7	RTP3_HUMAN	transmembrane protein 7	207	Cytoplasmic (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste|protein targeting to membrane	cytoplasm|integral to membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		CCAAAACCACATCTGTAGGAA	0.383													34	151	---	---	---	---	PASS
ACOX2	8309	broad.mit.edu	37	3	58490904	58490904	+	3'UTR	SNP	A	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58490904A>G	uc003dkl.2	-	15						NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		CCATAGTACCATTATCACATG	0.234													9	151	---	---	---	---	PASS
C3orf15	89876	broad.mit.edu	37	3	119426141	119426141	+	Intron	SNP	G	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119426141G>T	uc010hqx.1	+						C3orf15_uc003edc.2_Intron|C3orf15_uc010hqy.1_Intron|C3orf15_uc003ede.3_Intron|C3orf15_uc010hqz.2_Intron|C3orf15_uc011bjd.1_Intron|C3orf15_uc011bje.1_Intron|C3orf15_uc010hra.1_5'UTR			Q7Z4T9	AAT1_HUMAN	RecName: Full=AMY-1-associating protein expressed in testis 1;          Short=AAT-1;							mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		CTCTTCTTATGCTGTATACAT	0.353													9	27	---	---	---	---	PASS
PPP2R3A	5523	broad.mit.edu	37	3	135801246	135801246	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135801246C>T	uc003eqv.1	+	8	3336	c.2771C>T	c.(2770-2772)TCT>TTT	p.S924F	PPP2R3A_uc011blz.1_Missense_Mutation_p.S188F|PPP2R3A_uc003eqw.1_Missense_Mutation_p.S303F|PPP2R3A_uc011bma.1_RNA	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	924					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						GCCGATCTGTCTCGATACAAT	0.348													12	166	---	---	---	---	PASS
HLTF	6596	broad.mit.edu	37	3	148760005	148760005	+	Silent	SNP	A	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148760005A>T	uc003ewq.1	-	19	2363	c.2145T>A	c.(2143-2145)ATT>ATA	p.I715I	HLTF_uc003ewr.1_Silent_p.I715I|HLTF_uc003ews.1_Silent_p.I714I|HLTF_uc010hve.1_Silent_p.I714I	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	715					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TATGGCAACAAATTTGCCGCA	0.373													42	113	---	---	---	---	PASS
AADAC	13	broad.mit.edu	37	3	151545615	151545615	+	Silent	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151545615C>T	uc003eze.2	+	5	945	c.855C>T	c.(853-855)TCC>TCT	p.S285S		NM_001086	NP_001077	P22760	AAAD_HUMAN	arylacetamide deacetylase	285	Lumenal (Potential).				positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity			skin(2)	2		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ATTGGAGTTCCCTGCTCCCTG	0.383													9	200	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126371608	126371608	+	Nonsense_Mutation	SNP	T	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126371608T>A	uc003ifj.3	+	9	9437	c.9437T>A	c.(9436-9438)TTA>TAA	p.L3146*	FAT4_uc011cgp.1_Nonsense_Mutation_p.L1444*|FAT4_uc003ifi.1_Nonsense_Mutation_p.L624*	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3146	Cadherin 30.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						ACAGGTATATTAACACTAGCC	0.398													4	145	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126371768	126371768	+	Silent	SNP	T	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126371768T>C	uc003ifj.3	+	9	9597	c.9597T>C	c.(9595-9597)TAT>TAC	p.Y3199Y	FAT4_uc011cgp.1_Silent_p.Y1497Y|FAT4_uc003ifi.1_Silent_p.Y677Y	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3199	Cadherin 31.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CTGATGACTATTTCCCTACTG	0.418													9	141	---	---	---	---	PASS
FNIP2	57600	broad.mit.edu	37	4	159790453	159790453	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159790453C>T	uc003iqe.3	+	13	2848	c.2665C>T	c.(2665-2667)CGA>TGA	p.R889*		NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	889	Interaction with PRKAA1.				DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		AGACATTCCCCGAAATGAAAG	0.592													3	27	---	---	---	---	PASS
CPE	1363	broad.mit.edu	37	4	166405633	166405633	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166405633G>A	uc003irg.3	+	5	1127	c.850G>A	c.(850-852)GCA>ACA	p.A284T		NM_001873	NP_001864	P16870	CBPE_HUMAN	carboxypeptidase E preproprotein	284					cardiac left ventricle morphogenesis|neuropeptide signaling pathway|protein modification process	extracellular region|nucleus|plasma membrane	metallocarboxypeptidase activity|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	Glucagon recombinant(DB00040)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CTTGGCCCGGGCATACTCTTC	0.498													5	417	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177083293	177083293	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177083293G>A	uc003iuj.2	+	22	3046	c.2890G>A	c.(2890-2892)GCA>ACA	p.A964T	WDR17_uc003iuk.2_Missense_Mutation_p.A940T|WDR17_uc003ium.3_Missense_Mutation_p.A940T|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.A183T	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	964										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		AGTACTAGCCGCATGTTGCCA	0.353													15	62	---	---	---	---	PASS
PLEKHG4B	153478	broad.mit.edu	37	5	163205	163205	+	Silent	SNP	G	C	C	rs3810870	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163205G>C	uc003jak.2	+	11	2000	c.1950G>C	c.(1948-1950)GCG>GCC	p.A650A		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	650					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GGGAACCTGCGCAACCACTGT	0.677													2	7	---	---	---	---	PASS
MRPS27	23107	broad.mit.edu	37	5	71516691	71516691	+	3'UTR	SNP	T	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71516691T>C	uc003kbz.3	-	11					MRPS27_uc003kca.3_3'UTR|MRPS27_uc011cse.1_3'UTR|MRPS27_uc011csd.1_3'UTR	NM_015084	NP_055899	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27							mitochondrion|ribosome					0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		TGGCACGGGGTTGAGTGAAGT	0.562													23	83	---	---	---	---	PASS
FCHO2	115548	broad.mit.edu	37	5	72370579	72370579	+	Silent	SNP	G	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72370579G>T	uc003kcl.2	+	20	1706	c.1590G>T	c.(1588-1590)CGG>CGT	p.R530R	FCHO2_uc011csl.1_Silent_p.R497R|FCHO2_uc010izb.2_5'UTR|FCHO2_uc011csn.1_5'UTR	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a	530										ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		GTGTGTCACGGGGTCCCAGCC	0.408													3	37	---	---	---	---	PASS
BHMT	635	broad.mit.edu	37	5	78427020	78427020	+	3'UTR	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78427020C>T	uc003kfu.3	+	8					BHMT_uc011cti.1_3'UTR	NM_001713	NP_001704	Q93088	BHMT1_HUMAN	betaine-homocysteine methyltransferase						protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GGTTAAAAAGCAGTGCTTTCA	0.318													5	37	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156592755	156592755	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156592755A>G	uc003lwn.2	-	1	525	c.425T>C	c.(424-426)CTG>CCG	p.L142P		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	142						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGCGAGTTTCAGGCGCAGCTG	0.493													3	109	---	---	---	---	PASS
NIPAL4	348938	broad.mit.edu	37	5	156899410	156899410	+	Silent	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156899410C>T	uc003lwx.3	+	6	959	c.843C>T	c.(841-843)TAC>TAT	p.Y281Y	ADAM19_uc003lww.1_Intron|NIPAL4_uc011ddq.1_Silent_p.Y262Y	NM_001099287	NP_001092757	Q0D2K0	NIPA4_HUMAN	ichthyin protein	281	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						CCCCACGTTACGGGCAAAGGA	0.512											OREG0016979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	302	---	---	---	---	PASS
OR2V2	285659	broad.mit.edu	37	5	180582179	180582179	+	Silent	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180582179G>A	uc011dhj.1	+	1	237	c.237G>A	c.(235-237)GTG>GTA	p.V79V		NM_206880	NP_996763	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V,	79	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTACCAATGTGCCAAAGATGG	0.517													14	245	---	---	---	---	PASS
RXRB	6257	broad.mit.edu	37	6	33165658	33165658	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33165658C>T	uc003odb.2	-	4	880	c.701G>A	c.(700-702)CGC>CAC	p.R234H	RXRB_uc003odc.2_Missense_Mutation_p.R234H|RXRB_uc003odd.2_Missense_Mutation_p.R138H|RXRB_uc011dqr.1_Missense_Mutation_p.R44H|RXRB_uc011dqs.1_Missense_Mutation_p.R117H|RXRB_uc003ode.1_Missense_Mutation_p.R98H|RXRB_uc011dqt.1_Missense_Mutation_p.R234H|RXRB_uc011dqu.1_Missense_Mutation_p.R138H|SLC39A7_uc003odf.2_5'Flank|SLC39A7_uc003odg.2_5'Flank|SLC39A7_uc011dqv.1_5'Flank	NM_021976	NP_068811	P28702	RXRB_HUMAN	retinoid X receptor, beta	234	Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			ovary(3)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)	AAGGTCTTTGCGGATGGTGCG	0.542													3	73	---	---	---	---	PASS
PPARD	5467	broad.mit.edu	37	6	35389697	35389697	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35389697G>A	uc003okm.2	+	5	695	c.386G>A	c.(385-387)CGC>CAC	p.R129H	PPARD_uc003okl.2_Missense_Mutation_p.R129H|PPARD_uc003okn.2_Missense_Mutation_p.R129H|PPARD_uc011dtb.1_Missense_Mutation_p.R90H|PPARD_uc011dtc.1_Intron|PPARD_uc010jvv.1_RNA	NM_006238	NP_006229	Q03181	PPARD_HUMAN	peroxisome proliferative activated receptor,	129	Nuclear receptor.|NR C4-type.				apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	CAGTACTGCCGCTTCCAGAAG	0.572													9	50	---	---	---	---	PASS
CDC40	51362	broad.mit.edu	37	6	110547378	110547378	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110547378C>T	uc003pua.2	+	13	1373	c.1349C>T	c.(1348-1350)CCT>CTT	p.P450L		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	450	WD 4.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		AGGGATATCCCTGTGGATTTC	0.323													25	88	---	---	---	---	PASS
TMEM195	392636	broad.mit.edu	37	7	15458194	15458194	+	Missense_Mutation	SNP	T	C	C	rs146442781	byFrequency	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15458194T>C	uc003stb.1	-	5	768	c.598A>G	c.(598-600)ATC>GTC	p.I200V		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	200					ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						TCTGTATGGATCCAAAATTGG	0.348													19	38	---	---	---	---	PASS
TPST1	8460	broad.mit.edu	37	7	65751577	65751577	+	Missense_Mutation	SNP	G	A	A	rs142506783		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65751577G>A	uc003tuw.2	+	3	1277	c.925G>A	c.(925-927)GAT>AAT	p.D309N	TPST1_uc010kzy.2_RNA|TPST1_uc010kzz.2_Missense_Mutation_p.D309N|TPST1_uc010laa.2_Missense_Mutation_p.D309N	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	309	Lumenal (Potential).				inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						GATACCGCCAGATGTTTTACA	0.423													9	106	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88966117	88966117	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88966117C>A	uc011khi.1	+	4	4359	c.3821C>A	c.(3820-3822)ACC>AAC	p.T1274N		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1274						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GTAGCTGCTACCCCCTTCCAC	0.468										HNSCC(36;0.09)			7	316	---	---	---	---	PASS
ERMP1	79956	broad.mit.edu	37	9	5798848	5798848	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5798848A>C	uc003zjm.1	-	12	2282	c.2228T>G	c.(2227-2229)CTT>CGT	p.L743R	ERMP1_uc011lme.1_RNA|ERMP1_uc010mhs.1_Missense_Mutation_p.L357R	NM_024896	NP_079172	Q7Z2K6	ERMP1_HUMAN	aminopeptidase Fxna	743	Extracellular (Potential).				proteolysis	endoplasmic reticulum membrane|integral to membrane	metal ion binding|metallopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		AAAACCACAAAGAGGTGCATT	0.403													5	72	---	---	---	---	PASS
PRKACG	5568	broad.mit.edu	37	9	71628979	71628979	+	Silent	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71628979G>A	uc004agy.2	-	1	61	c.30C>T	c.(28-30)ACC>ACT	p.T10T		NM_002732	NP_002723	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic,	10					activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|gluconeogenesis|intracellular protein kinase cascade|male gonad development|nerve growth factor receptor signaling pathway|regulation of insulin secretion|spermatogenesis|transmembrane transport|triglyceride catabolic process|water transport	cytosol|nucleoplasm	ATP binding|cAMP-dependent protein kinase activity			ovary(1)|pancreas(1)|skin(1)	3						CCTCCTGCTCGGTGTCCTTCT	0.413													5	44	---	---	---	---	PASS
TAL2	6887	broad.mit.edu	37	9	108424812	108424812	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108424812G>C	uc004bct.2	+	1	75	c.35G>C	c.(34-36)CGG>CCG	p.R12P		NM_005421	NP_005412	Q16559	TAL2_HUMAN	T-cell acute lymphocytic leukemia 2	12	Basic motif.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						ACCAGGGAGCGGTGGAGGCAG	0.502			T	TRB@	T-ALL								13	63	---	---	---	---	PASS
ST6GALNAC6	30815	broad.mit.edu	37	9	130653032	130653032	+	Silent	SNP	G	A	A	rs140405426		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130653032G>A	uc004bso.1	-	5	707	c.588C>T	c.(586-588)CTC>CTT	p.L196L	ST6GALNAC6_uc004bsn.1_Silent_p.L162L|ST6GALNAC6_uc011man.1_Intron|ST6GALNAC6_uc004bsp.1_Silent_p.L196L|ST6GALNAC6_uc004bsq.1_Silent_p.L162L|ST6GALNAC6_uc004bsr.2_Silent_p.L162L|ST6GALNAC6_uc010mxp.1_RNA	NM_013443	NP_038471	Q969X2	SIA7F_HUMAN	sialytransferase 7F	196	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane|plasma membrane					0						TCACACGCACGAGGCTGCCCT	0.637													9	75	---	---	---	---	PASS
FAM35A	54537	broad.mit.edu	37	10	88912541	88912541	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88912541T>G	uc001kei.3	+	3	1544	c.1430T>G	c.(1429-1431)ATT>AGT	p.I477S		NM_019054	NP_061927	Q86V20	FA35A_HUMAN	hypothetical protein LOC54537	477										ovary(2)|skin(2)	4						GTTACAGTAATTGATCAATCA	0.378													4	167	---	---	---	---	PASS
GOT1	2805	broad.mit.edu	37	10	101163490	101163490	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101163490C>A	uc001kpr.2	-	6	992	c.784G>T	c.(784-786)GGG>TGG	p.G262W	GOT1_uc009xwh.2_RNA|GOT1_uc001kpq.1_Intron	NM_002079	NP_002070	P17174	AATC_HUMAN	aspartate aminotransferase 1	262					aspartate catabolic process|cellular response to insulin stimulus|gluconeogenesis|response to glucocorticoid stimulus	cytosol	L-aspartate:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding				0		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	CTGTAGAGCCCGAAGTTCTTG	0.537													3	111	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134942117	134942117	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134942117C>T	uc001llx.3	+	7	1221	c.785C>T	c.(784-786)ACG>ATG	p.T262M	GPR123_uc001llw.2_Missense_Mutation_p.T981M	NM_001083909	NP_001077378	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	262	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		GCCGCCTTCACGCTGTTCCTG	0.692													5	13	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1092910	1092910	+	Missense_Mutation	SNP	G	A	A	rs142666807	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1092910G>A	uc001lsx.1	+	31	11842	c.11815G>A	c.(11815-11817)GGC>AGC	p.G3939S		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	3939						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.234													3	12	---	---	---	---	PASS
OR51F1	256892	broad.mit.edu	37	11	4791052	4791052	+	Silent	SNP	A	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4791052A>T	uc010qyl.1	-	1	96	c.96T>A	c.(94-96)CCT>CCA	p.P32P		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	32						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		AACAACAGAAAGGAATGGAGA	0.453													11	41	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116729309	116729309	+	Missense_Mutation	SNP	T	C	C	rs141671439	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116729309T>C	uc001ppy.2	-	20	2590	c.2554A>G	c.(2554-2556)ACA>GCA	p.T852A	SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron|SIK3_uc001ppw.2_Intron|SIK3_uc001ppx.2_Intron|SIK3_uc001pqb.2_Missense_Mutation_p.T155A	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	852	Gln-rich.					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						CCCACTCCTGTTGAAGGGCTG	0.582													45	133	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116767026	116767026	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116767026T>C	uc001ppy.2	-	6	670	c.634A>G	c.(634-636)AAT>GAT	p.N212D	SIK3_uc001ppz.2_Missense_Mutation_p.N111D|SIK3_uc001pqa.2_Missense_Mutation_p.N212D	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	212	Protein kinase.					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						GCCCGCAGATTCTGCAGTGTG	0.507													6	116	---	---	---	---	PASS
PTPN6	5777	broad.mit.edu	37	12	7061281	7061281	+	Silent	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7061281C>T	uc001qsb.2	+	3	509	c.267C>T	c.(265-267)CGC>CGT	p.R89R	PTPN6_uc001qsa.1_Silent_p.R91R|PTPN6_uc010sfr.1_Silent_p.R50R|PTPN6_uc009zfl.1_Silent_p.R89R|PTPN6_uc010sfs.1_Silent_p.R77R	NM_002831	NP_002822	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type	89	SH2 1.				apoptosis|cell junction assembly|G-protein coupled receptor protein signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|negative regulation of peptidyl-tyrosine phosphorylation|platelet activation|positive regulation of cell proliferation|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of G1/S transition of mitotic cell cycle|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol|membrane|nucleus	protein binding|protein tyrosine phosphatase activity			breast(1)	1						TGCAGGACCGCGACGGCACCA	0.587													12	132	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	9713438	9713438	+	RNA	SNP	T	C	C	rs76076453	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9713438T>C	uc001qwb.1	+	5		c.633T>C								Homo sapiens mRNA; cDNA DKFZp686A1124 (from clone DKFZp686A1124).																		TTTTAAGACATTGGAGAGAAT	0.353													3	14	---	---	---	---	PASS
SLCO1C1	53919	broad.mit.edu	37	12	20890188	20890188	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20890188C>A	uc001rej.3	+	12	1885	c.1530C>A	c.(1528-1530)AAC>AAA	p.N510K	SLCO1C1_uc010sii.1_Missense_Mutation_p.N510K|SLCO1C1_uc010sij.1_Missense_Mutation_p.N461K|SLCO1C1_uc009zip.2_Missense_Mutation_p.N344K|SLCO1C1_uc001rei.2_Missense_Mutation_p.N510K|SLCO1C1_uc010sik.1_Missense_Mutation_p.N392K	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	510	Extracellular (Potential).|Kazal-like.				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					AAACCTCCAACAGGAGTGGAA	0.413													14	100	---	---	---	---	PASS
NEUROD4	58158	broad.mit.edu	37	12	55420976	55420976	+	Silent	SNP	C	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55420976C>A	uc001sgp.3	+	2	1131	c.753C>A	c.(751-753)GGC>GGA	p.G251G		NM_021191	NP_067014	Q9HD90	NDF4_HUMAN	neurogenic differentiation 4	251					amacrine cell differentiation|positive regulation of cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4						CTTATGAGGGCCCACTCACTC	0.502													23	159	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	102047576	102047576	+	Silent	SNP	C	T	T	rs145910377	byFrequency	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102047576C>T	uc001vox.1	-	3	438	c.249G>A	c.(247-249)ACG>ACA	p.T83T	NALCN_uc001voy.2_5'UTR|NALCN_uc001voz.2_Silent_p.T83T|NALCN_uc001vpa.2_Silent_p.T83T	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	83	Helical; Name=S2 of repeat I; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity	p.T83T(1)		ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCATCTCTGCCGTGTAGAGAA	0.403													18	95	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105413230	105413230	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105413230T>G	uc010axc.1	-	7	8678	c.8558A>C	c.(8557-8559)CAA>CCA	p.Q2853P	AHNAK2_uc001ypx.2_Missense_Mutation_p.Q2753P	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2853						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AAGATCCCCTTGCATGGAGGG	0.622													19	230	---	---	---	---	PASS
ZFYVE19	84936	broad.mit.edu	37	15	41099720	41099720	+	5'UTR	SNP	G	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41099720G>T	uc001zmt.1	+	1					DNAJC17_uc001zms.1_5'Flank|DNAJC17_uc010bbz.1_5'Flank|DNAJC17_uc010bca.1_5'Flank|DNAJC17_uc010bcb.1_5'Flank|ZFYVE19_uc001zmu.1_5'UTR|ZFYVE19_uc001zmv.1_5'UTR|ZFYVE19_uc001zmw.1_5'Flank|ZFYVE19_uc001zmx.1_5'Flank|ZFYVE19_uc010bcc.1_5'Flank	NM_001077268	NP_001070736	Q96K21	ZFY19_HUMAN	zinc finger, FYVE domain containing 19								zinc ion binding				0		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TCCGAGCGGCGCCTAGCCCTC	0.607													5	35	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42150888	42150888	+	Missense_Mutation	SNP	G	A	A	rs890503	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42150888G>A	uc001zos.2	-	49	8366	c.8033C>T	c.(8032-8034)ACA>ATA	p.T2678I		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2713	Spectrin 24.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin		p.T2713I(1)		ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CAGCATGGCTGTGTCCAGCAA	0.632													7	7	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42681231	42681231	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42681231T>G	uc001zpn.1	+	5	1044	c.738T>G	c.(736-738)AGT>AGG	p.S246R	CAPN3_uc001zpk.1_Missense_Mutation_p.S19R|CAPN3_uc001zpl.1_Missense_Mutation_p.S159R|CAPN3_uc010udf.1_Missense_Mutation_p.S159R|CAPN3_uc010udg.1_Missense_Mutation_p.S159R|CAPN3_uc001zpo.1_Missense_Mutation_p.S246R|CAPN3_uc001zpp.1_Missense_Mutation_p.S246R	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	246	Calpain catalytic.				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		ATGCTCCTAGTGACATGTACA	0.542													17	194	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48580269	48580269	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48580269C>T	uc001zwn.3	+	22	2875	c.2659C>T	c.(2659-2661)CAT>TAT	p.H887Y	SLC12A1_uc001zwq.3_Missense_Mutation_p.H658Y|SLC12A1_uc001zwr.3_Missense_Mutation_p.H614Y	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	887	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	CCAGTCGATGCATGTGGGAGA	0.403													7	25	---	---	---	---	PASS
DPP8	54878	broad.mit.edu	37	15	65790302	65790302	+	Silent	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65790302G>A	uc002aov.2	-	5	2241	c.663C>T	c.(661-663)TGC>TGT	p.C221C	DPP8_uc002aow.2_Silent_p.C221C|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Silent_p.C205C|DPP8_uc002aoy.2_Silent_p.C221C|DPP8_uc002aoz.2_Silent_p.C205C|DPP8_uc010bhj.2_Silent_p.C221C|DPP8_uc002apa.2_Silent_p.C118C	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1	221					immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						GATCAGCAGGGCATAATTTTG	0.383													4	154	---	---	---	---	PASS
KIF23	9493	broad.mit.edu	37	15	69708370	69708370	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69708370G>A	uc002asb.2	+	2	166	c.49G>A	c.(49-51)GGG>AGG	p.G17R	KIF23_uc002asc.2_Missense_Mutation_p.G17R|KIF23_uc010bii.2_5'UTR|KIF23_uc010bih.1_RNA	NM_138555	NP_612565	Q02241	KIF23_HUMAN	kinesin family member 23 isoform 1	17	Kinesin-motor.				blood coagulation|cytokinesis|microtubule-based movement|mitosis|mitotic spindle elongation	cytosol|kinesin complex|microtubule|midbody|nucleoplasm|spindle	ATP binding|microtubule motor activity|protein binding				0						CGTGAAAAAAGGGTCCCAAAC	0.378													3	42	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20335248	20335248	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20335248C>A	uc002dgv.2	-	3	508	c.425G>T	c.(424-426)AGT>ATT	p.S142I	GP2_uc002dgw.2_Missense_Mutation_p.S142I|GP2_uc002dgx.2_Intron|GP2_uc002dgy.2_Intron	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	142						anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						GCAGTTGCCACTCCAATGGGC	0.592													3	83	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66947138	66947138	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66947138G>A	uc002eql.2	-	9	1023	c.950C>T	c.(949-951)GCG>GTG	p.A317V	CDH16_uc010cdy.2_Missense_Mutation_p.A317V|CDH16_uc002eqm.2_Missense_Mutation_p.A220V	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	317	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		CAGAGGGGCCGCATAGTCCTC	0.622													5	173	---	---	---	---	PASS
FUK	197258	broad.mit.edu	37	16	70506907	70506907	+	Silent	SNP	T	C	C	rs7192865	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70506907T>C	uc002eyy.2	+	15	1486	c.1428T>C	c.(1426-1428)CCT>CCC	p.P476P	FUK_uc010cft.2_Silent_p.P508P|FUK_uc002eyz.2_5'UTR	NM_145059	NP_659496	Q8N0W3	FUK_HUMAN	fucokinase	476						cytoplasm	ATP binding|fucokinase activity			ovary(1)	1		Ovarian(137;0.0694)				TGTGGGACCCTGAGACGCTGC	0.647													5	9	---	---	---	---	PASS
AMAC1L3	643664	broad.mit.edu	37	17	7386366	7386366	+	3'UTR	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7386366G>A	uc010cmj.1	+	2					ZBTB4_uc002ghd.3_Intron|POLR2A_uc002ghe.2_5'Flank|POLR2A_uc002ghf.3_5'Flank	NM_001102614	NP_001096084	P0C7Q6	AMCL3_HUMAN	acyl-malonyl condensing enzyme 1-like 3							integral to membrane					0		Prostate(122;0.173)				GGGATAAATAGAGGCAAAGAC	0.537													3	32	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	T	T	rs28934575		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577548C>T	uc002gim.2	-	7	927	c.733G>A	c.(733-735)GGC>AGC	p.G245S	TP53_uc002gig.1_Missense_Mutation_p.G245S|TP53_uc002gih.2_Missense_Mutation_p.G245S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G113S|TP53_uc010cng.1_Missense_Mutation_p.G113S|TP53_uc002gii.1_Missense_Mutation_p.G113S|TP53_uc010cnh.1_Missense_Mutation_p.G245S|TP53_uc010cni.1_Missense_Mutation_p.G245S|TP53_uc002gij.2_Missense_Mutation_p.G245S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G152S|TP53_uc002gio.2_Missense_Mutation_p.G113S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	245	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> A (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G245S(274)|p.G245D(93)|p.G245V(50)|p.G245C(47)|p.G245R(10)|p.G245A(8)|p.0?(7)|p.G245G(3)|p.G245fs*2(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.G245fs*22(1)|p.M243fs*18(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGGTTCATGCCGCCCATGCAG	0.577	G245S(SKLMS1_SOFT_TISSUE)|G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKMEL2_SKIN)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			12	49	---	---	---	---	PASS
C17orf63	55731	broad.mit.edu	37	17	27085367	27085367	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27085367G>T	uc002hct.1	-	3	1877	c.1610C>A	c.(1609-1611)GCC>GAC	p.A537D	C17orf63_uc010wax.1_Missense_Mutation_p.A537D|C17orf63_uc010way.1_Missense_Mutation_p.A537D|C17orf63_uc002hcw.2_Missense_Mutation_p.A409D	NM_018182	NP_060652	Q8WU58	CQ063_HUMAN	hypothetical protein LOC55731	537										ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)			GGCTCGGTGGGCCTTGCTCAG	0.577													5	42	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33680037	33680037	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33680037C>T	uc010ctp.2	-	7	2486	c.2044G>A	c.(2044-2046)GGG>AGG	p.G682R	SLFN11_uc010ctq.2_Missense_Mutation_p.G682R|SLFN11_uc002hjh.3_Missense_Mutation_p.G682R|SLFN11_uc002hjg.3_Missense_Mutation_p.G682R|SLFN11_uc010ctr.2_Missense_Mutation_p.G682R	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	682						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTTGCCTTCCCATACCAGTCC	0.468													4	241	---	---	---	---	PASS
TOM1L1	10040	broad.mit.edu	37	17	53007460	53007460	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53007460G>T	uc002iud.2	+	8	922	c.747G>T	c.(745-747)ATG>ATT	p.M249I	TOM1L1_uc002iuc.2_Missense_Mutation_p.M249I|TOM1L1_uc010dca.1_Missense_Mutation_p.M249I|TOM1L1_uc010wnb.1_Missense_Mutation_p.M242I|TOM1L1_uc010wnc.1_Missense_Mutation_p.M172I|TOM1L1_uc010dbz.2_Missense_Mutation_p.M172I|TOM1L1_uc010wnd.1_Missense_Mutation_p.M137I|TOM1L1_uc010dcb.1_RNA	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1	249	GAT.				intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						GTCGGGAGATGCAGGAGAGGA	0.418													29	111	---	---	---	---	PASS
USP32	84669	broad.mit.edu	37	17	58288802	58288802	+	Silent	SNP	A	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58288802A>G	uc002iyo.1	-	20	2539	c.2253T>C	c.(2251-2253)TGT>TGC	p.C751C	USP32_uc002iyn.1_Silent_p.C421C	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	751					protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			TGTTACTAACACACTGGATGC	0.433													3	166	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5397388	5397388	+	Missense_Mutation	SNP	G	A	A	rs143141379		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5397388G>A	uc002kmt.1	-	18	2596	c.2510C>T	c.(2509-2511)ACG>ATG	p.T837M	EPB41L3_uc010wzh.1_Missense_Mutation_p.T668M|EPB41L3_uc002kmu.1_Missense_Mutation_p.T615M|EPB41L3_uc010dkq.1_Missense_Mutation_p.T506M|EPB41L3_uc002kms.1_Missense_Mutation_p.T72M|EPB41L3_uc010wze.1_Missense_Mutation_p.T142M|EPB41L3_uc010wzf.1_Missense_Mutation_p.T134M|EPB41L3_uc010wzg.1_Missense_Mutation_p.T109M|EPB41L3_uc010dkr.2_Missense_Mutation_p.T229M	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	837	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						GGTGGGTTCCGTCTCTATTCC	0.542													5	62	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65179121	65179121	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65179121A>G	uc002lke.1	-	2	3979	c.2755T>C	c.(2755-2757)TCA>CCA	p.S919P		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	909						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				CGGATATCTGACACCTTCCAT	0.423													5	138	---	---	---	---	PASS
PRR22	163154	broad.mit.edu	37	19	5784048	5784048	+	Silent	SNP	T	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5784048T>C	uc002mdb.1	-	1	563	c.204A>G	c.(202-204)CCA>CCG	p.P68P	PRR22_uc010xiv.1_Silent_p.P70P	NM_153359	NP_699190	Q8IZ63	PRR22_HUMAN	proline rich 22 isoform 2	68											0						AGCACCCGCATGGGGCCATCT	0.677													3	45	---	---	---	---	PASS
ICAM1	3383	broad.mit.edu	37	19	10394818	10394818	+	Silent	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10394818G>A	uc002mnq.2	+	4	1066	c.747G>A	c.(745-747)CAG>CAA	p.Q249Q	ICAM1_uc010xle.1_Silent_p.Q27Q|ICAM4_uc002mnr.1_5'Flank|ICAM4_uc002mns.1_5'Flank|ICAM4_uc002mnt.1_5'Flank	NM_000201	NP_000192	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1 precursor	249	Ig-like C2-type 3.|Extracellular (Potential).				adhesion to symbiont|heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking|positive regulation of cellular extravasation|regulation of immune response|regulation of leukocyte mediated cytotoxicity|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell|virion attachment, binding of host cell surface receptor	extracellular space|integral to plasma membrane	integrin binding|transmembrane receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Natalizumab(DB00108)|Simvastatin(DB00641)	CGGAGGCCCAGGTCCACCTGG	0.647													4	55	---	---	---	---	PASS
S1PR5	53637	broad.mit.edu	37	19	10625418	10625418	+	Silent	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10625418G>A	uc002mot.1	-	2	327	c.270C>T	c.(268-270)GCC>GCT	p.A90A	S1PR5_uc002mou.1_Silent_p.A90A	NM_030760	NP_110387	Q9H228	S1PR5_HUMAN	endothelial differentiation, sphingolipid	90	Helical; Name=2; (By similarity).					integral to membrane|plasma membrane	lysosphingolipid and lysophosphatidic acid receptor activity			central_nervous_system(1)|pancreas(1)	2						GGATGTTGGCGGCGTAGGCGG	0.672													5	4	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31770341	31770341	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31770341C>T	uc002nsy.3	-	2	423	c.358G>A	c.(358-360)GCC>ACC	p.A120T		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	120					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					TTGTACACGGCCTTCATCTGC	0.488													4	75	---	---	---	---	PASS
FERMT1	55612	broad.mit.edu	37	20	6077614	6077614	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6077614C>T	uc002wmr.2	-	8	1813	c.1024G>A	c.(1024-1026)GAA>AAA	p.E342K	FERMT1_uc002wmq.2_5'Flank|FERMT1_uc010gbt.2_Missense_Mutation_p.E85K|FERMT1_uc002wms.2_Missense_Mutation_p.E342K|FERMT1_uc002wmt.2_Missense_Mutation_p.E85K	NM_017671	NP_060141	Q9BQL6	FERM1_HUMAN	kindlin-1	342	FERM.				cell adhesion|establishment of epithelial cell polarity|keratinocyte migration|keratinocyte proliferation	cytosol|focal adhesion|ruffle membrane	binding			ovary(1)|pancreas(1)|skin(1)	3						GCTTCTATTTCATCAACCTCG	0.418													8	393	---	---	---	---	PASS
RRBP1	6238	broad.mit.edu	37	20	17622555	17622555	+	Nonsense_Mutation	SNP	T	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17622555T>A	uc002wpv.1	-	6	1126	c.772A>T	c.(772-774)AAG>TAG	p.K258*	RRBP1_uc002wpu.2_Nonsense_Mutation_p.K32*|RRBP1_uc002wpw.1_Nonsense_Mutation_p.K258*|RRBP1_uc010gcl.1_Nonsense_Mutation_p.K32*	NM_001042576	NP_001036041	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	691	Cytoplasmic (Potential).				protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						GGGTCACCCTTCTGAGTGGCC	0.557													10	192	---	---	---	---	PASS
L3MBTL	26013	broad.mit.edu	37	20	42161556	42161556	+	Silent	SNP	T	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42161556T>C	uc010zwh.1	+	12	1408	c.1362T>C	c.(1360-1362)TAT>TAC	p.Y454Y	L3MBTL_uc002xkl.2_Silent_p.Y386Y|L3MBTL_uc002xkm.2_Silent_p.Y386Y|L3MBTL_uc010ggl.2_Silent_p.Y386Y|L3MBTL_uc002xkn.1_Silent_p.Y145Y|L3MBTL_uc002xko.2_Silent_p.Y38Y	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	386	MBT 2.|Interaction with monomethylated and dimethylated peptides.			Y->L: Abolishes binding to p53/TP53 monomethylated at 'Lys-382'.	chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			ATGATACTTATGACTACTGGT	0.572													7	77	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41465774	41465774	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41465774C>T	uc002yyq.1	-	21	4176	c.3724G>A	c.(3724-3726)GAC>AAC	p.D1242N	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1242	Fibronectin type-III 4.|Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GAAAACGAGTCGGGAGAGGCC	0.478													22	33	---	---	---	---	PASS
CECR1	51816	broad.mit.edu	37	22	17663641	17663641	+	Silent	SNP	A	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17663641A>C	uc002zmk.1	-	7	1304	c.1092T>G	c.(1090-1092)GGT>GGG	p.G364G	CECR1_uc010gqu.1_Silent_p.G364G|CECR1_uc011agi.1_Silent_p.G322G|CECR1_uc002zmj.1_Silent_p.G123G	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1	364					adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				CTATGGAAGTACCCTGCCAGT	0.557													6	28	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25016296	25016296	+	Silent	SNP	G	A	A	rs4049844	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016296G>A	uc003aan.1	+	8	871	c.384G>A	c.(382-384)GGG>GGA	p.G128G	GGT1_uc003aas.1_Silent_p.G128G|GGT1_uc003aat.1_Silent_p.G128G|GGT1_uc003aau.1_Silent_p.G128G|GGT1_uc003aav.1_Silent_p.G128G|GGT1_uc003aaw.1_Silent_p.G128G|GGT1_uc003aax.1_Silent_p.G128G	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	128	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	TCTCCCCAGGGGGGCTGTCGG	0.642													4	28	---	---	---	---	PASS
LIMK2	3985	broad.mit.edu	37	22	31663865	31663865	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31663865G>C	uc003akh.2	+	10	1377	c.1232G>C	c.(1231-1233)GGC>GCC	p.G411A	LIMK2_uc003akg.2_Missense_Mutation_p.G328A|LIMK2_uc003aki.2_Missense_Mutation_p.G165A|LIMK2_uc003akj.2_Missense_Mutation_p.G390A|LIMK2_uc003akk.2_Missense_Mutation_p.G390A|LIMK2_uc011aln.1_Missense_Mutation_p.G328A	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	411	Protein kinase.					mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						ATTGAGGGGGGCACACTGAAG	0.527													6	113	---	---	---	---	PASS
YWHAH	7533	broad.mit.edu	37	22	32346379	32346379	+	Intron	SNP	C	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32346379C>T	uc003alz.2	+						YWHAH_uc010gwl.2_5'UTR|YWHAH_uc003ama.2_Intron|YWHAH_uc010gwm.2_Intron	NM_003405	NP_003396	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan						glucocorticoid catabolic process|glucocorticoid receptor signaling pathway|intracellular protein transport|negative regulation of dendrite morphogenesis|positive regulation of transcription, DNA-dependent|regulation of synaptic plasticity	cytoplasm	enzyme binding|glucocorticoid receptor binding|insulin-like growth factor receptor binding|protein domain specific binding			central_nervous_system(1)	1						CGCCCCTACTCCTGGCTGCAG	0.522													25	90	---	---	---	---	PASS
APOBEC3F	200316	broad.mit.edu	37	22	39448875	39448875	+	3'UTR	SNP	C	T	T	rs5757452	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39448875C>T	uc003aww.2	+	7						NM_145298	NP_660341	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic						base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding				0	Melanoma(58;0.04)					CTCTCCCAGGCTCTTCCTGCA	0.607													4	6	---	---	---	---	PASS
UBQLN2	29978	broad.mit.edu	37	X	56591153	56591153	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56591153G>A	uc004dus.2	+	1	1082	c.847G>A	c.(847-849)GCA>ACA	p.A283T	UBQLN2_uc011moq.1_Missense_Mutation_p.A283T	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	283						cytoplasm|nucleus|plasma membrane	binding			ovary(1)|skin(1)	2						GCTGAATGCCGCACAAGAGCA	0.517													3	39	---	---	---	---	PASS
CLIC2	1193	broad.mit.edu	37	X	154528413	154528413	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154528413G>C	uc004fnf.2	-	2	353	c.103C>G	c.(103-105)CGC>GGC	p.R35G	CLIC2_uc010nvj.1_Missense_Mutation_p.R53G	NM_001289	NP_001280	O15247	CLIC2_HUMAN	chloride intracellular channel 2	35	Helical; Note=After insertion into the membrane; (Potential).|N-terminal.|Required for insertion into the membrane (By similarity).				signal transduction	chloride channel complex|cytoplasm|nucleus	voltage-gated chloride channel activity			large_intestine(1)|ovary(1)|skin(1)	3	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ATGAAAAGGCGTTGGCAAAAG	0.363													18	87	---	---	---	---	PASS
FUCA1	2517	broad.mit.edu	37	1	24175455	24175456	+	Intron	INS	-	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24175455_24175456insT	uc001bie.2	-							NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor						fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		TGCTGTTTTAAttttttttttt	0.183													6	4	---	---	---	---	
CYP4A11	1579	broad.mit.edu	37	1	47396871	47396872	+	Intron	DEL	TG	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47396871_47396872delTG	uc001cqp.3	-							NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,						long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	CCTCCACCTCTGCCTGCCACAT	0.594													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120495937	120495937	+	Intron	DEL	A	-	-	rs72047996		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120495937delA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		actctgtgtcaaaaaaaaaaa	0.070			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121484885	121484885	+	IGR	DEL	G	-	-	rs58810765		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121484885delG								LOC647121 (171199 upstream) : None (None downstream)																							gtcaatggcagaaaaggaaat	0.000													1219	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121485005	121485008	+	IGR	DEL	TGTT	-	-	rs28831473		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121485005_121485008delTGTT								LOC647121 (171319 upstream) : None (None downstream)																							ggaaacgctctgtttgtaaagtct	0.000													1316	9	---	---	---	---	
KLHDC8A	55220	broad.mit.edu	37	1	205320730	205320733	+	Intron	DEL	CAAA	-	-	rs143420341		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205320730_205320733delCAAA	uc001hcf.1	-						KLHDC8A_uc010prg.1_Intron|KLHDC8A_uc001hcg.1_Intron	NM_018203	NP_060673	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A											ovary(1)	1	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTGTAATAGTCaaaaaaaaaaaaa	0.186													6	3	---	---	---	---	
GPATCH2	55105	broad.mit.edu	37	1	217787609	217787609	+	Intron	DEL	A	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217787609delA	uc001hlf.1	-						GPATCH2_uc001hlg.3_Intron	NM_018040	NP_060510	Q9NW75	GPTC2_HUMAN	G patch domain containing 2							intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		GTAAAATTTTAAAGAGACATG	0.353													58	14	---	---	---	---	
PRKD3	23683	broad.mit.edu	37	2	37481437	37481438	+	Intron	DEL	GG	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37481437_37481438delGG	uc002rqd.2	-							NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				CAATTGCTAAGGGAAAAGACAA	0.396													80	14	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43808704	43808704	+	Intron	DEL	A	-	-	rs74506936		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43808704delA	uc002rsw.3	-						THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc002rsz.2_Intron|THADA_uc002rta.2_Intron|THADA_uc002rtb.1_Intron|THADA_uc002rtc.3_Intron|THADA_uc002rtd.2_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				aaaagaaaagaaaaaaaaaaa	0.194													6	3	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	133636237	133636238	+	Intron	DEL	AC	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133636237_133636238delAC	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						acgcacgcatacacacacacac	0.252													4	2	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	138000234	138000234	+	Intron	DEL	T	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138000234delT	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGTGAGCACCTTTTTTTTTTT	0.393													10	5	---	---	---	---	
SATB2	23314	broad.mit.edu	37	2	200173273	200173274	+	Intron	DEL	AC	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200173273_200173274delAC	uc002uuy.1	-						SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Intron|SATB2_uc002uva.1_Intron	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						GTGTGTGcatacacacacacac	0.347													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CATGTGTGGAGTTTTATAACTC	0.589													8	5	---	---	---	---	
RPN1	6184	broad.mit.edu	37	3	128339057	128339057	+	3'UTR	DEL	A	-	-	rs3182459	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128339057delA	uc003ekr.1	-	10					RPN1_uc011bkq.1_3'UTR	NM_002950	NP_002941	P04843	RPN1_HUMAN	ribophorin I precursor						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.189)		ttctttttttaaaaaaaaaaa	0.318			T	EVI1	AML								4	2	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176768285	176768286	+	Frame_Shift_Ins	INS	-	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176768285_176768286insA	uc003fiw.3	-	6	800_801	c.540_541insT	c.(538-543)GTTAGTfs	p.V180fs	TBL1XR1_uc003fix.3_Frame_Shift_Ins_p.V180fs|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	180_181	WD 1.				canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			AGGAGATCACTAACAGGGTTCC	0.361													64	15	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195690462	195690463	+	Intron	INS	-	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195690462_195690463insG	uc003fvy.2	-						SDHAP1_uc003fvx.3_Intron					Homo sapiens full length insert cDNA clone ZC24D06.												0						catgcgcaacaggggactgtaa	0.045													5	3	---	---	---	---	
SENP5	205564	broad.mit.edu	37	3	196625703	196625703	+	Intron	DEL	A	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196625703delA	uc003fwz.3	+						SENP5_uc011bty.1_Intron	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5						cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		gattgcattcaattcattcga	0.020													643	7	---	---	---	---	
NAP1L5	266812	broad.mit.edu	37	4	89618484	89618486	+	In_Frame_Del	DEL	TCC	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89618484_89618486delTCC	uc003hrx.2	-	1	538_540	c.420_422delGGA	c.(418-423)GAGGAA>GAA	p.140_141EE>E	HERC3_uc003hrw.1_Intron|HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_153757	NP_715638	Q96NT1	NP1L5_HUMAN	nucleosome assembly protein 1-like 5	140_141	Glu-rich.				nucleosome assembly	nucleus	protein binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000181)		gtactcctcttcctcctcctcct	0.369													109	7	---	---	---	---	
PRDM5	11107	broad.mit.edu	37	4	121720793	121720795	+	Intron	DEL	AAC	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121720793_121720795delAAC	uc003idn.2	-						PRDM5_uc003ido.2_Intron|PRDM5_uc010ine.2_Intron	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5						histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						TATCACTATAAACAAAAAAAGTA	0.197													61	22	---	---	---	---	
NSUN2	54888	broad.mit.edu	37	5	6610179	6610179	+	Intron	DEL	T	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6610179delT	uc003jdu.2	-						NSUN2_uc003jdt.2_Intron|NSUN2_uc011cmk.1_Intron|NSUN2_uc003jdv.2_Intron	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2							cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TAAACTTAAAttttttttttt	0.164													8	4	---	---	---	---	
REEP5	7905	broad.mit.edu	37	5	112237915	112237915	+	Intron	DEL	G	-	-	rs141436136		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112237915delG	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		gcATTtttttgtttttgtttt	0.104													5	4	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127707202	127707203	+	Intron	INS	-	TCCT	TCCT	rs12518130	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127707202_127707203insTCCT	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ccctccctccatccttccttcc	0.005													6	3	---	---	---	---	
CPEB4	80315	broad.mit.edu	37	5	173317315	173317316	+	Frame_Shift_Ins	INS	-	G	G			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173317315_173317316insG	uc003mcs.3	+	1	1985_1986	c.579_580insG	c.(577-582)GGAGGGfs	p.G193fs	CPEB4_uc010jju.1_Frame_Shift_Ins_p.G193fs|CPEB4_uc010jjv.2_Frame_Shift_Ins_p.G193fs|CPEB4_uc011dfg.1_Frame_Shift_Ins_p.G193fs|CPEB4_uc003mct.3_5'Flank|CPEB4_uc003mcu.3_5'Flank	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	193_194							nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TTCACCAGGGAGGGGTCCCTGC	0.505													157	15	---	---	---	---	
PAK1IP1	55003	broad.mit.edu	37	6	10703034	10703035	+	Intron	INS	-	T	T	rs79574852		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10703034_10703035insT	uc003mzg.2	+							NM_017906	NP_060376	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1						negative regulation of signal transduction	nucleolus|plasma membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				TGttttctttcttttttttttg	0.163													4	2	---	---	---	---	
MRPL2	51069	broad.mit.edu	37	6	43023098	43023098	+	Intron	DEL	A	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43023098delA	uc003ots.1	-						CUL7_uc011dvb.1_5'Flank|CUL7_uc003otq.2_5'Flank|CUL7_uc010jyh.2_5'Flank|KLC4_uc003otr.1_Intron	NM_015950	NP_057034	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2 precursor						translation	mitochondrion|ribosome	structural constituent of ribosome				0		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		ctctgtctcgaaaaaaaaaaa	0.204													5	3	---	---	---	---	
COL19A1	1310	broad.mit.edu	37	6	70866387	70866388	+	Intron	DEL	GA	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70866387_70866388delGA	uc003pfc.1	+						COL19A1_uc010kam.1_Intron	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						tatgtatatGgagagagagaga	0.262													4	2	---	---	---	---	
HINT3	135114	broad.mit.edu	37	6	126298856	126298867	+	3'UTR	DEL	GTTCAGCATGAA	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126298856_126298867delGTTCAGCATGAA	uc003qal.3	+	5					HINT3_uc010keu.2_3'UTR	NM_138571	NP_612638	Q9NQE9	HINT3_HUMAN	histidine triad nucleotide binding protein 3							mitochondrion|nucleolus	hydrolase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.153)|GBM - Glioblastoma multiforme(226;0.0321)		TCTAATCTTGGTTCAGCATGAAGTGGTATTTA	0.311													151	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61970266	61970266	+	IGR	DEL	T	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61970266delT								None (None upstream) : LOC643955 (781406 downstream)																							actcacagagtttaacctttc	0.000													279	17	---	---	---	---	
LRWD1	222229	broad.mit.edu	37	7	102106858	102106861	+	Intron	DEL	TTTA	-	-	rs66463732		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106858_102106861delTTTA	uc003uzn.2	+						ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_Intron	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain						chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GATGTGCTACtttatttatttatt	0.260													4	4	---	---	---	---	
WASL	8976	broad.mit.edu	37	7	123336467	123336467	+	Intron	DEL	A	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123336467delA	uc003vkz.2	-							NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein						actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						CAGCTGCCTTAAAAAAAAAAA	0.289													4	2	---	---	---	---	
NUP205	23165	broad.mit.edu	37	7	135256159	135256160	+	Intron	INS	-	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135256159_135256160insA	uc003vsw.2	+						NUP205_uc011kqa.1_Intron	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						cCTAAACGCTTAAAAAAAAAAA	0.050													4	3	---	---	---	---	
MKRN1	23608	broad.mit.edu	37	7	140158897	140158897	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140158897delG	uc003vvt.2	-	4	906	c.681delC	c.(679-681)AACfs	p.N227fs	MKRN1_uc003vvs.2_Frame_Shift_Del_p.N163fs|MKRN1_uc011krd.1_Intron|MKRN1_uc003vvv.3_Frame_Shift_Del_p.N227fs|MKRN1_uc003vvu.3_Frame_Shift_Del_p.N163fs	NM_013446	NP_038474	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1 isoform 1	227	C3H1-type 3.						ligase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.00956)					GATACACACAGTTCTCCCCGT	0.522													233	19	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaaaactgggacacatacacacacacac	0.000			N		medulloblastoma								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30778987	30778987	+	IGR	DEL	A	-	-	rs146807720		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30778987delA								TEX15 (32765 upstream) : PURG (74334 downstream)																							TGATTTCTACAAAAAAAAAAA	0.159													6	3	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38092287	38092288	+	Intron	INS	-	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38092287_38092288insT	uc003xlb.2	+						DDHD2_uc003xla.2_Intron|DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			TTATTTTCAGAttttttttttt	0.149													4	2	---	---	---	---	
NDRG1	10397	broad.mit.edu	37	8	134292668	134292669	+	Intron	INS	-	T	T	rs34104549		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134292668_134292669insT	uc003yuh.2	-						NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			ttccttttctcttttttttttt	0.208													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67791249	67791250	+	5'Flank	DEL	AC	-	-	rs74992488		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67791249_67791250delAC	uc004aes.1	+											Homo sapiens cDNA FLJ36039 fis, clone TESTI2017311.																		agaatgggagacacacacacac	0.064													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68455229	68455230	+	IGR	INS	-	AC	AC			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68455229_68455230insAC								FAM27B (661040 upstream) : MIR1299 (547009 downstream)																							GGGAGACTTCTGTGCAGAGGCT	0.584													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	79183353	79183360	+	IGR	DEL	AAGGAAGA	-	-	rs71354664		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79183353_79183360delAAGGAAGA								GCNT1 (61023 upstream) : PRUNE2 (42933 downstream)																							ggaaggaaggaaggaagaaaggaaggaa	0.000													4	2	---	---	---	---	
PRPF4	9128	broad.mit.edu	37	9	116052507	116052508	+	Intron	INS	-	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116052507_116052508insA	uc004bgx.2	+						PRPF4_uc004bgy.2_Intron	NM_004697	NP_004688	O43172	PRP4_HUMAN	PRP4 pre-mRNA processing factor 4 homolog							Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding			ovary(2)|pancreas(1)	3						ctcaaaagaagaaaaaaaaaaa	0.188													2	4	---	---	---	---	
NDUFA8	4702	broad.mit.edu	37	9	124914833	124914834	+	Intron	INS	-	AT	AT	rs10659040		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124914833_124914834insAT	uc004blv.2	-							NM_014222	NP_055037	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1					NADH(DB00157)	TCATAATAATAAtttttttttt	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42387303	42387303	+	IGR	DEL	C	-	-	rs139851125		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42387303delC								None (None upstream) : LOC441666 (440012 downstream)																							aatcattgaacagaattgaat	0.000													818	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42387774	42387774	+	IGR	DEL	C	-	-	rs141701904		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42387774delC								None (None upstream) : LOC441666 (439541 downstream)																							aatcattgaacggaattgaat	0.000													538	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42390479	42390479	+	IGR	DEL	G	-	-	rs72505278		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42390479delG								None (None upstream) : LOC441666 (436836 downstream)																							AAcatcgaatggaatcgaatg	0.040													35	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42599640	42599640	+	IGR	DEL	A	-	-	rs145203825		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42599640delA								None (None upstream) : LOC441666 (227675 downstream)																							aatggaaatgaaaggagtcat	0.000													2484	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89385933	89385937	+	Intron	DEL	TATTT	-	-	rs148851366		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89385933_89385937delTATTT	uc001pcz.2	+											Homo sapiens mRNA for hypothetical protein, partial cds, clone:Hsa11-digit35-15-11-R.																		ATATTGATTATATTTTATTAATGGT	0.141													4	3	---	---	---	---	
GOLGA3	2802	broad.mit.edu	37	12	133374766	133374766	+	Intron	DEL	G	-	-	rs33920278		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133374766delG	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GATGAGGGGTGGGGGGGGGGT	0.567													4	3	---	---	---	---	
FRY	10129	broad.mit.edu	37	13	32793136	32793136	+	Intron	DEL	A	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32793136delA	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CTCAAAAGTTAAAAAAAAAAG	0.289													4	2	---	---	---	---	
LOC220429	220429	broad.mit.edu	37	13	50464697	50464698	+	5'UTR	INS	-	G	G	rs140429392	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50464697_50464698insG	uc001vdk.2	+	1						NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						CCTGGGTTACTGCGGCCACCGC	0.639													4	4	---	---	---	---	
CATSPERB	79820	broad.mit.edu	37	14	92090986	92090986	+	Intron	DEL	A	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92090986delA	uc001xzs.1	-						CATSPERB_uc010aub.1_Intron	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ctccattgccaaaaaaaaaaa	0.124													4	2	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30020390	30020390	+	Intron	DEL	T	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30020390delT	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CATACTTCCCTTTTTTTTTTT	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84858138	84858139	+	IGR	INS	-	T	T	rs71453232		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84858138_84858139insT								ADAMTSL3 (149547 upstream) : LOC388152 (9461 downstream)																							TGGGGAGCTGGTGCAGAGGCCT	0.599													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32126912	32126912	+	IGR	DEL	A	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32126912delA								ZNF267 (198286 upstream) : HERC2P4 (35698 downstream)																							TATTTTGCCCACCCGCCGCCG	0.602													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46391827	46391849	+	IGR	DEL	GATGATTCCACTCGAGTCCATTC	-	-	rs9708865		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46391827_46391849delGATGATTCCACTCGAGTCCATTC								None (None upstream) : ANKRD26P1 (111400 downstream)																							tccattcgatgatgattccactcgagtccattcgatgattcca	0.000													33	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46417207	46417216	+	IGR	DEL	TTCGAATGGA	-	-	rs60768439		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46417207_46417216delTTCGAATGGA								None (None upstream) : ANKRD26P1 (86033 downstream)																							tggAATCATCTtcgaatggaattgaatgga	0.052													32	11	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	165325	165325	+	Intron	DEL	T	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:165325delT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		GTCCCTGTGCTCCCACCTCCA	0.577													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	5620724	5620725	+	IGR	INS	-	TCCT	TCCT	rs150953364	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5620724_5620725insTCCT								NLRP1 (132892 upstream) : WSCD1 (351712 downstream)																							tccttctttcctccttccttcc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32560352	32560353	+	IGR	INS	-	AGAA	AGAA	rs140694482	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32560352_32560353insAGAA								ACCN1 (76527 upstream) : CCL2 (21943 downstream)																							gaaagagagagagaaagaaaga	0.000													3	3	---	---	---	---	
APOH	350	broad.mit.edu	37	17	64221995	64221995	+	Intron	DEL	A	-	-	rs78723189		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64221995delA	uc002jfn.3	-							NM_000042	NP_000033	P02749	APOH_HUMAN	apolipoprotein H precursor						blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding				0			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			actccgtctcaaaaaaaaaaa	0.154													3	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544132	80544132	+	Intron	DEL	G	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544132delG	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			aaggtgggccggggggggaaa	0.144													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11625378	11625379	+	IGR	INS	-	A	A			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11625378_11625379insA								FAM38B (923399 upstream) : GNAL (63757 downstream)																							CTCTTCCCCCGAAAAATGACAA	0.317													3	4	---	---	---	---	
DUS3L	56931	broad.mit.edu	37	19	5789039	5789040	+	Intron	INS	-	ACCAGAGTGGG	ACCAGAGTGGG	rs140764504	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5789039_5789040insACCAGAGTGGG	uc002mdc.2	-						DUS3L_uc002mdd.2_Intron|DUS3L_uc010duk.2_Intron|DUS3L_uc010xiw.1_Intron	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like isoform 1						tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0						TTTCTGTCCCCACCTCCTGAGG	0.381													4	2	---	---	---	---	
SIGLEC14	100049587	broad.mit.edu	37	19	52148952	52148953	+	Intron	INS	-	ACAC	ACAC	rs141777694	by1000genomes	TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52148952_52148953insACAC	uc002pxf.3	-							NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor						cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		CTCTCTCTTCTacacacacaca	0.505													8	5	---	---	---	---	
C20orf26	26074	broad.mit.edu	37	20	20243448	20243449	+	Intron	INS	-	T	T	rs57744107		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20243448_20243449insT	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CTGTTTTTGTGTTTTTTTTTTT	0.233													4	2	---	---	---	---	
DYNLRB1	83658	broad.mit.edu	37	20	33122618	33122618	+	Intron	DEL	C	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33122618delC	uc002xal.2	+						DYNLRB1_uc010zuk.1_Frame_Shift_Del_p.S89fs|DYNLRB1_uc002xam.2_Intron|DYNLRB1_uc002xan.2_Intron	NM_014183	NP_054902	Q9NP97	DLRB1_HUMAN	Roadblock-1						microtubule-based movement|transport|visual behavior	centrosome|cytoplasmic dynein complex|microtubule	microtubule motor activity				0						TCTTCTACCTCCCCATGTAGG	0.532													51	7	---	---	---	---	
ZNF335	63925	broad.mit.edu	37	20	44586694	44586695	+	Intron	INS	-	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44586694_44586695insT	uc002xqw.2	-						ZNF335_uc010zxk.1_Intron	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				aaccacttttcttttttttttt	0.074													9	4	---	---	---	---	
NCAM2	4685	broad.mit.edu	37	21	22658654	22658655	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22658654_22658655insT	uc002yld.1	+	4	652_653	c.403_404insT	c.(403-405)GTTfs	p.V135fs	NCAM2_uc011acb.1_Intron|NCAM2_uc011acc.1_Frame_Shift_Ins_p.V160fs	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	135	Ig-like C2-type 2.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TGCAGAAGTGGTTTGCCGAGTT	0.376													87	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151841	20151842	+	IGR	INS	-	CAC	CAC	rs10627070		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151841_20151842insCAC								ZDHHC8 (16312 upstream) : LOC150197 (42013 downstream)																							accaccaccatcaccaccacca	0.025													5	3	---	---	---	---	
MKL1	57591	broad.mit.edu	37	22	40984032	40984032	+	Intron	DEL	T	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40984032delT	uc003ayw.1	-						MKL1_uc010gye.1_Intron|MKL1_uc010gyf.1_Intron|MKL1_uc003ayy.1_Intron	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein						positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CACTCCAACAttttttttttt	0.229			T	RBM15	acute megakaryocytic leukemia								3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48542882	48542883	+	IGR	DEL	AC	-	-	rs148439461		TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48542882_48542883delAC								TBC1D22A (973160 upstream) : FAM19A5 (342405 downstream)																							CCAACCAACGacacacacacac	0.470													4	2	---	---	---	---	
TAF1	6872	broad.mit.edu	37	X	70626767	70626767	+	Intron	DEL	T	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70626767delT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				AGAAAGTGGAttttttttttt	0.174													4	2	---	---	---	---	
CD40LG	959	broad.mit.edu	37	X	135730223	135730223	+	5'Flank	DEL	C	-	-			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135730223delC	uc004faa.2	+						CD40LG_uc010nsd.2_5'Flank|CD40LG_uc010nse.1_5'Flank	NM_000074	NP_000065	P29965	CD40L_HUMAN	CD40 ligand						anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)	aaaaaaaaaacaaaaaaCCTT	0.343									Immune_Deficiency_with_Hyper-IgM				4	2	---	---	---	---	
MTM1	4534	broad.mit.edu	37	X	149761308	149761309	+	Intron	INS	-	T	T			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149761308_149761309insT	uc004fef.3	+						MTM1_uc011mxx.1_Intron|MTM1_uc011mxy.1_Intron|MTM1_uc011mxz.1_Intron|MTM1_uc010nte.2_Intron	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin						endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TCTAGAAAAGCttttttttttt	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	M	12384	12385	+	RNA	INS	-	C	C			TCGA-EJ-5521-01	TCGA-EJ-5521-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:12384_12385insC	uc004cox.3	+	1		c.48_49insC			uc004coy.2_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		ACTTCCCTAATTCCCCCCATCC	0.416													27	11	---	---	---	---	
