Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KLHL17	339451	broad.mit.edu	37	1	897452	897452	+	Intron	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:897452C>T	uc001aca.1	+						NOC2L_uc001abz.3_5'Flank|NOC2L_uc009vjq.2_5'Flank|NOC2L_uc009vjr.1_5'Flank|KLHL17_uc001acb.1_Missense_Mutation_p.R122C|KLHL17_uc010nya.1_Missense_Mutation_p.R122C|KLHL17_uc001acc.1_5'Flank|KLHL17_uc010nyb.1_5'Flank	NM_198317	NP_938073	Q6TDP4	KLH17_HUMAN	kelch-like 17						actin cytoskeleton organization	actin cytoskeleton|cell junction|postsynaptic density|postsynaptic membrane	protein complex scaffold				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GCCCAGCCCTCGCCccccacc	0.542													13	12	---	---	---	---	PASS
KIAA0754	643314	broad.mit.edu	37	1	39879328	39879328	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39879328G>A	uc009vvt.1	+	1	4153	c.3391G>A	c.(3391-3393)GCC>ACC	p.A1131T	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	995	Ala-rich.|10.										0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGGAGCCCGCCTCCCCAGC	0.711													3	19	---	---	---	---	PASS
ATG4C	84938	broad.mit.edu	37	1	63307165	63307165	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63307165T>C	uc001dat.2	+	10	1318	c.1156T>C	c.(1156-1158)TTT>CTT	p.F386L	ATG4C_uc001dau.2_Missense_Mutation_p.F386L	NM_178221	NP_835739	Q96DT6	ATG4C_HUMAN	APG4 autophagy 4 homolog C isoform 8	386					autophagic vacuole assembly|protein targeting to membrane|proteolysis	cytosol|extracellular region	cysteine-type endopeptidase activity			ovary(1)	1						TACAATAGGATTTTACTGTCG	0.303													4	137	---	---	---	---	PASS
DEPDC1	55635	broad.mit.edu	37	1	68947728	68947728	+	Splice_Site	SNP	C	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68947728C>A	uc001dem.3	-	8	1879	c.1762_splice	c.e8+1	p.S588_splice	DEPDC1_uc001dej.3_5'UTR|DEPDC1_uc001dek.3_Intron|DEPDC1_uc001del.3_Intron	NM_001114120	NP_001107592	Q5TB30	DEP1A_HUMAN	DEP domain containing 1 isoform a						intracellular signal transduction|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	GTPase activator activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		AACAGCCTTACTTTGTGTGCC	0.353													87	111	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92185486	92185486	+	Silent	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92185486C>T	uc001doh.2	-	9	1843	c.1377G>A	c.(1375-1377)GAG>GAA	p.E459E	TGFBR3_uc009wde.2_Silent_p.E236E|TGFBR3_uc010osy.1_Silent_p.E417E|TGFBR3_uc001doi.2_Silent_p.E458E|TGFBR3_uc001doj.2_Silent_p.E458E	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	459	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CGATCATCTTCTCATTGTCAC	0.502													7	221	---	---	---	---	PASS
REG4	83998	broad.mit.edu	37	1	120342381	120342381	+	Silent	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120342381C>T	uc001eig.2	-	5	710	c.270G>A	c.(268-270)CAG>CAA	p.Q90Q	REG4_uc001eif.2_Silent_p.Q90Q	NM_001159352	NP_001152824	Q9BYZ8	REG4_HUMAN	regenerating islet-derived family, member 4	90	C-type lectin.					extracellular region	sugar binding			ovary(1)	1	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)		TCCATATCGGCTGGCTTCTCT	0.522													20	322	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152187774	152187774	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152187774C>T	uc001ezt.1	-	3	6407	c.6331G>A	c.(6331-6333)GAG>AAG	p.E2111K		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2111	23.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGCTAGACTCGTGGTGACCA	0.587													19	258	---	---	---	---	PASS
PGLYRP3	114771	broad.mit.edu	37	1	153274900	153274900	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153274900C>A	uc001fbn.1	-	5	766	c.713G>T	c.(712-714)TGT>TTT	p.C238F		NM_052891	NP_443123	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3 precursor	238					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCCAATGTCACAAAAGTTCCG	0.473													104	469	---	---	---	---	PASS
RPS27	6232	broad.mit.edu	37	1	153963249	153963249	+	5'UTR	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153963249G>T	uc001fdv.2	+	1						NM_001030	NP_001021	P42677	RS27_HUMAN	ribosomal protein S27						cell proliferation|endocrine pancreas development|mitotic prometaphase|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleus	DNA binding|structural constituent of ribosome|zinc ion binding				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTTTCCGGCGGTGACGACCTA	0.532													49	151	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161512867	161512867	+	Nonsense_Mutation	SNP	G	A	A	rs1042207	byFrequency	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161512867G>A	uc001gat.3	-	6	837	c.700C>T	c.(700-702)CGA>TGA	p.R234*	FCGR3A_uc001gar.2_Nonsense_Mutation_p.R270*|FCGR3A_uc001gas.2_Nonsense_Mutation_p.R269*|FCGR3A_uc009wuh.2_Nonsense_Mutation_p.R233*|FCGR3A_uc009wui.2_Nonsense_Mutation_p.R234*	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	234	Cytoplasmic (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GTTGAGCTTCGAATGTTTGTC	0.443													4	154	---	---	---	---	PASS
CFHR3	10878	broad.mit.edu	37	1	196759282	196759282	+	Missense_Mutation	SNP	C	T	T	rs138675433	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196759282C>T	uc001gtl.2	+	5	808	c.721C>T	c.(721-723)CCC>TCC	p.P241S	CFHR3_uc010poy.1_Missense_Mutation_p.P180S|CFHR1_uc001gtm.2_Intron	NM_021023	NP_066303	Q02985	FHR3_HUMAN	complement factor H-related 3 precursor	241	Sushi 4.			P -> S (in Ref. 1; CAA48639).		extracellular space					0						CCAATGCCAGCCCTACTATGA	0.428													6	29	---	---	---	---	PASS
PM20D1	148811	broad.mit.edu	37	1	205817085	205817085	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205817085G>T	uc001hdj.2	-	2	229	c.184C>A	c.(184-186)CCA>ACA	p.P62T	PM20D1_uc009xbr.2_RNA	NM_152491	NP_689704	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1 precursor	62						extracellular region	metal ion binding|peptidase activity			skin(1)	1	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GTCACTGTTGGAATCTGGATG	0.398													57	84	---	---	---	---	PASS
CABC1	56997	broad.mit.edu	37	1	227153070	227153070	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227153070C>T	uc001hqm.1	+	8	3966	c.547C>T	c.(547-549)CAG>TAG	p.Q183*	CABC1_uc010pvp.1_Nonsense_Mutation_p.Q146*|CABC1_uc001hqn.1_Nonsense_Mutation_p.Q183*|CABC1_uc009xeq.1_Nonsense_Mutation_p.Q131*|CABC1_uc010pvq.1_Intron|CABC1_uc010pvr.1_5'Flank	NM_020247	NP_064632	Q8NI60	ADCK3_HUMAN	chaperone, ABC1 activity of bc1 complex like	183					cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)				GAAGGCCCGGCAGGCTAAGGC	0.617													30	3	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235490233	235490233	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235490233A>C	uc001hwq.2	-	2	500	c.2T>G	c.(1-3)ATG>AGG	p.M1R	ARID4B_uc001hwr.2_Missense_Mutation_p.M1R|ARID4B_uc001hws.3_Missense_Mutation_p.M1R|ARID4B_uc001hwu.1_Missense_Mutation_p.M1R|GGPS1_uc001hwv.2_5'Flank|GGPS1_uc001hww.2_5'Flank|GGPS1_uc001hwx.2_5'Flank|GGPS1_uc001hwy.2_5'Flank	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	1					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TCTTACCTTCATGATGACTCT	0.522													136	28	---	---	---	---	PASS
IWS1	55677	broad.mit.edu	37	2	128262862	128262862	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128262862G>A	uc002ton.2	-	3	920	c.617C>T	c.(616-618)CCT>CTT	p.P206L	IWS1_uc010yzl.1_RNA|IWS1_uc010fma.2_RNA	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	206	Glu-rich.				transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		ACTCATTCGAGGTTTGGGAGG	0.493													101	250	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128391873	128391873	+	Intron	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128391873G>A	uc002top.2	+						MYO7B_uc002tos.1_5'UTR|MYO7B_uc002tot.2_5'UTR	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGGTGGGCCGGGCTGGGGCTG	0.677													3	8	---	---	---	---	PASS
CXCR2P1	3580	broad.mit.edu	37	2	218925510	218925510	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218925510G>A	uc002vgx.2	-	1	504	c.211C>T	c.(211-213)CGG>TGG	p.R71W	RUFY4_uc002vgw.2_Intron	NR_002712				Homo sapiens interleukin 8 receptor, beta pseudogene, mRNA (cDNA clone IMAGE:5450999), with apparent retained intron.												0						GGCAGGATCCGTAACAGCATC	0.522													71	44	---	---	---	---	PASS
UGT1A8	54576	broad.mit.edu	37	2	234526363	234526363	+	Missense_Mutation	SNP	A	G	G	rs150485330		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234526363A>G	uc002vup.2	+	1	73	c.10A>G	c.(10-12)ACA>GCA	p.T4A	UGT1A8_uc010zmv.1_Missense_Mutation_p.T4A	NM_019076	NP_061949	Q9HAW9	UD18_HUMAN	UDP glycosyltransferase 1 family, polypeptide A8	4					drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)		CATGGCTCGCACAGGGTGGAC	0.562													3	69	---	---	---	---	PASS
CXCR7	57007	broad.mit.edu	37	2	237489879	237489879	+	Silent	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237489879C>T	uc010fyq.2	+	3	1001	c.771C>T	c.(769-771)TAC>TAT	p.Y257Y	CXCR7_uc002vwd.2_Silent_p.Y257Y	NM_020311	NP_064707	P25106	CXCR7_HUMAN	chemokine orphan receptor 1	257	Helical; Name=6; (Potential).				interspecies interaction between organisms	integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3		Breast(86;0.000182)|Renal(207;0.00339)|all_hematologic(139;0.0048)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|all_lung(227;0.147)|all_neural(83;0.223)		Epithelial(121;8.35e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.09e-11)|Kidney(56;1.11e-07)|KIRC - Kidney renal clear cell carcinoma(57;3.03e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000176)|Lung(119;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.118)		TCTTCTCCTACGTGGTGGTCT	0.582													164	133	---	---	---	---	PASS
KIF1A	547	broad.mit.edu	37	2	241658536	241658536	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241658536G>A	uc002vzy.2	-	45	4944	c.4798C>T	c.(4798-4800)CGG>TGG	p.R1600W	KIF1A_uc010fzk.2_Missense_Mutation_p.R1701W|KIF1A_uc002vzw.2_Missense_Mutation_p.R261W|KIF1A_uc002vzx.2_Missense_Mutation_p.R327W	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles	1600	PH.				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TAGGGGCGCCGCACCACCACG	0.622													51	192	---	---	---	---	PASS
CTNNB1	1499	broad.mit.edu	37	3	41266097	41266097	+	Missense_Mutation	SNP	G	C	C	rs28931588		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41266097G>C	uc010hia.1	+	4	250	c.94G>C	c.(94-96)GAC>CAC	p.D32H	CTNNB1_uc003ckp.2_Missense_Mutation_p.D32H|CTNNB1_uc003ckq.2_Missense_Mutation_p.D32H|CTNNB1_uc003ckr.2_Missense_Mutation_p.D32H|CTNNB1_uc011azf.1_Missense_Mutation_p.D25H|CTNNB1_uc011azg.1_Intron|uc010hib.1_RNA	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	32			Missing (in hepatocellular carcinoma).|D -> A (in hepatocellular carcinoma).|D -> G (in PTR and hepatocellular carcinoma).		adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	p.D32Y(110)|p.A5_A80del(63)|p.D32N(58)|p.D32G(53)|p.D32H(37)|p.D32V(20)|p.D32A(12)|p.H24_S47del(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.WQQQSYLD25?(5)|p.Q28_H134del(5)|p.W25_D32del(4)|p.W25_I140del(4)|p.S23_S33del(3)|p.V22_G38del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.D32E(2)|p.D32_S47del(2)|p.W25_H36del(2)|p.Y30_S33del(2)|p.V22_S33del(2)|p.V22_L139>V(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.?(2)|p.L10_N141del(2)|p.D6_A43del(1)|p.E9_S47del(1)|p.Q28_Q61del(1)|p.A20_R151del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.D17_P128del(1)|p.H24_M131del(1)|p.L7_I140del(1)|p.K19_Y142>V(1)|p.A20_L148del(1)|p.V22_A80del(1)|p.W25_I35del(1)|p.V22_G80>NNNNN(1)|p.A5_I35del(1)|p.A20_Q143del(1)|p.A13_R151del(1)|p.D32del(1)|p.S23_I140del(1)|p.M1_A87del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.D6_I140del(1)|p.Q28_I140del(1)|p.E9_A80del(1)|p.M14_S45del(1)|p.M8_G50del(1)|p.A5_G80>(1)|p.D32_H36>D(1)|p.P16_K133del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.A5_R90del(1)|p.V22_Y64del(1)|p.M8_A80del(1)|p.E9_I140del(1)|p.D32_S33insS(1)|p.Y30_T40del(1)|p.M1_T42del(1)|p.A5_Q143>E(1)|p.A5_Q72del(1)|p.Q28_D32>H(1)|p.Y30_A80del(1)|p.D32fs*9(1)|p.D6_K133del(1)|p.A5_T42del(1)|p.A5_D144>D(1)|p.A5_T40del(1)|p.D17_A126del(1)|p.A5_E54del(1)|p.S23_I35del(1)|p.V22_S71>A(1)|p.W25_A80del(1)|p.A20_Q72del(1)|p.A20_S111del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	GTCTTACCTGGACTCTGGAAT	0.478	D32N(KE39_STOMACH)	15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				19	31	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48677786	48677786	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48677786G>A	uc003cul.2	-	34	9513	c.9232C>T	c.(9232-9234)CGG>TGG	p.R3078W	CELSR3_uc003cuf.1_Missense_Mutation_p.R3176W|CELSR3_uc010hkf.2_Missense_Mutation_p.R368W|CELSR3_uc010hkg.2_Missense_Mutation_p.R1061W	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	3078	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTCAGTTGCCGCCGGAGGAGC	0.647													51	81	---	---	---	---	PASS
SENP7	57337	broad.mit.edu	37	3	101066717	101066717	+	Missense_Mutation	SNP	T	A	A	rs2433031	byFrequency	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101066717T>A	uc003dut.2	-	13	1947	c.1836A>T	c.(1834-1836)CAA>CAT	p.Q612H	SENP7_uc003duu.2_Missense_Mutation_p.Q547H|SENP7_uc003duv.2_Missense_Mutation_p.Q579H|SENP7_uc003duw.2_Missense_Mutation_p.Q546H|SENP7_uc003dux.2_Missense_Mutation_p.Q448H	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	612					proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						TATACTCACATTGCTGGCTTA	0.294													5	202	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122247075	122247075	+	3'UTR	SNP	G	A	A	rs114569472	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122247075G>A	uc010hri.2	-	11					PARP9_uc003eff.3_3'UTR|PARP9_uc011bjs.1_3'UTR|PARP9_uc003efg.2_3'UTR|PARP9_uc003efi.2_3'UTR|PARP9_uc003efh.2_3'UTR	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9						cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		TATGTGGCTAGTCCTTTCAAT	0.428													5	13	---	---	---	---	PASS
ACAD11	84129	broad.mit.edu	37	3	132297900	132297900	+	Intron	SNP	T	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132297900T>C	uc003eov.3	-						ACAD11_uc011blr.1_3'UTR	NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase							peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						CAGGCTGTGATCTGGAACAGA	0.348													7	9	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	A	A	rs121913273		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936082G>A	uc003fjk.2	+	10	1781	c.1624G>A	c.(1624-1626)GAA>AAA	p.E542K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TCCTCTCTCTGAAATCACTGA	0.333	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			60	61	---	---	---	---	PASS
OTOP1	133060	broad.mit.edu	37	4	4204211	4204211	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4204211G>A	uc003ghp.1	-	4	724	c.694C>T	c.(694-696)CGG>TGG	p.R232W		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	232					biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GTGATGAGCCGTTCCTTGTGC	0.507													6	192	---	---	---	---	PASS
NAAA	27163	broad.mit.edu	37	4	76861916	76861916	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76861916C>G	uc003hjb.2	-	1	251	c.187G>C	c.(187-189)GCG>CCG	p.A63P	NAAA_uc003hja.2_Missense_Mutation_p.A63P|NAAA_uc003hjc.3_Missense_Mutation_p.A63P|NAAA_uc003hjd.3_RNA|NAAA_uc011cbq.1_5'Flank|NAAA_uc010iiz.1_Missense_Mutation_p.A63P	NM_014435	NP_055250	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase isoform 1	63					lipid metabolic process	lysosome	hydrolase activity			skin(1)	1						TGCGCCATCGCGGCGCGCACC	0.706													14	53	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100534280	100534280	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100534280C>A	uc003hvc.3	+	16	2456	c.2200C>A	c.(2200-2202)CTA>ATA	p.L734I	MTTP_uc011cej.1_Missense_Mutation_p.L761I	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	734					lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	ACTTATTCTGCTAATAGATCA	0.264													39	34	---	---	---	---	PASS
TACR3	6870	broad.mit.edu	37	4	104511030	104511030	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104511030C>T	uc003hxe.1	-	5	1350	c.1207G>A	c.(1207-1209)GTG>ATG	p.V403M		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	403	Cytoplasmic (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		ATTCTGGTCACGGTGTACATA	0.498													166	232	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114186063	114186063	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114186063C>T	uc003ibe.3	+	14	1497	c.1397C>T	c.(1396-1398)ACG>ATG	p.T466M	ANK2_uc003ibd.3_Missense_Mutation_p.T445M|ANK2_uc003ibf.3_Missense_Mutation_p.T466M|ANK2_uc003ibc.2_Missense_Mutation_p.T442M|ANK2_uc011cgb.1_Missense_Mutation_p.T481M	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	466	ANK 14.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CGTGGTGAGACGGCACTACAC	0.517													3	5	---	---	---	---	PASS
MAML3	55534	broad.mit.edu	37	4	141074098	141074098	+	Silent	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141074098G>T	uc003ihz.1	-	1	1136	c.384C>A	c.(382-384)GGC>GGA	p.G128G	MAML3_uc011chd.1_Silent_p.G128G	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	128					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					GTTTGCCGGTGCCGGCGCCCG	0.677													5	31	---	---	---	---	PASS
ENPP6	133121	broad.mit.edu	37	4	185012266	185012266	+	3'UTR	SNP	T	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185012266T>G	uc003iwc.2	-	8						NM_153343	NP_699174	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		AAAATGAAAATCATCTGGCTT	0.358													32	37	---	---	---	---	PASS
MEF2C	4208	broad.mit.edu	37	5	88027676	88027676	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88027676A>G	uc003kjj.2	-	7	1353	c.680T>C	c.(679-681)GTC>GCC	p.V227A	MEF2C_uc003kji.2_Missense_Mutation_p.V227A|MEF2C_uc003kjk.2_Missense_Mutation_p.V227A|MEF2C_uc003kjm.2_Missense_Mutation_p.V225A|MEF2C_uc003kjl.2_Missense_Mutation_p.V245A	NM_002397	NP_002388	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C isoform 1	227					apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		ACCAGGTGAGACCAGCAGACC	0.413										HNSCC(66;0.2)			28	45	---	---	---	---	PASS
PPP1R2P3	153743	broad.mit.edu	37	5	156277620	156277620	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156277620A>G	uc003lwf.1	+	1	72	c.47A>G	c.(46-48)AAG>AGG	p.K16R		NR_002168				RecName: Full=Putative protein phosphatase inhibitor 2-like protein 3; AltName: Full=Protein phosphatase 1, regulatory subunit 2 pseudogene 3;												0						GGGATCTTGAAGAACAAGACC	0.637													11	12	---	---	---	---	PASS
TRIM41	90933	broad.mit.edu	37	5	180651243	180651243	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180651243T>G	uc003mne.1	+	1	938	c.244T>G	c.(244-246)TGG>GGG	p.W82G	uc003mnb.1_3'UTR|TRIM41_uc003mnc.1_Missense_Mutation_p.W82G|TRIM41_uc003mnd.1_Missense_Mutation_p.W82G|TRIM41_uc003mnf.1_RNA	NM_033549	NP_291027	Q8WV44	TRI41_HUMAN	tripartite motif-containing 41 isoform 1	82	Glu-rich.					cytoplasm|nucleus	ligase activity|protein binding|zinc ion binding				0	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCGCGGGGTGGGACACCCC	0.493													8	77	---	---	---	---	PASS
PIM1	5292	broad.mit.edu	37	6	37139130	37139130	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37139130A>C	uc003onk.2	+	4	900	c.470A>C	c.(469-471)CAC>CCC	p.H157P	PIM1_uc011dtw.1_5'Flank	NM_002648	NP_002639	P11309	PIM1_HUMAN	non-specific serine/threonine protein kinase	248	Protein kinase.				cell cycle|cell proliferation|multicellular organismal development|negative regulation of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|protein autophosphorylation	cytoplasm|nucleus|plasma membrane	ATP binding|manganese ion binding|protein binding|protein binding|protein serine/threonine kinase activity|transcription factor binding			large_intestine(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCCGTGCGGCACTGCCACAAC	0.617			T	BCL6	NHL								12	81	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	106969054	106969054	+	Nonsense_Mutation	SNP	T	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106969054T>A	uc003prh.2	+	2	3234	c.2747T>A	c.(2746-2748)TTG>TAG	p.L916*		NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	916							sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CACTCCAGTTTGAAAAGTCCA	0.423													11	167	---	---	---	---	PASS
DCBLD1	285761	broad.mit.edu	37	6	117824981	117824981	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117824981C>G	uc003pxs.2	+	2	289	c.164C>G	c.(163-165)TCT>TGT	p.S55C	GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Missense_Mutation_p.S55C	NM_173674	NP_775945	Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	55	CUB.|Extracellular (Potential).				cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		ACAATGACATCTAAGAATTAT	0.428													65	99	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132195477	132195477	+	Silent	SNP	A	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132195477A>G	uc011ecf.1	+	16	1655	c.1635A>G	c.(1633-1635)CAA>CAG	p.Q545Q	ENPP1_uc003qcy.2_Silent_p.Q175Q	NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	545	Phosphodiesterase.|Extracellular (Potential).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	CAAATATGCAAGTGAGTAAAC	0.279													10	252	---	---	---	---	PASS
EYA4	2070	broad.mit.edu	37	6	133849973	133849973	+	3'UTR	SNP	T	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133849973T>A	uc003qec.3	+	20					EYA4_uc011ecq.1_3'UTR|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_3'UTR|EYA4_uc003qee.3_3'UTR|EYA4_uc011ecs.1_3'UTR|uc003qeg.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a						anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		ATCCATTTTTTATATTTCAAG	0.368													67	114	---	---	---	---	PASS
CLK2P	1197	broad.mit.edu	37	7	23625497	23625497	+	5'UTR	SNP	C	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23625497C>A	uc003swk.2	-	1						NR_002711				SubName: Full=cDNA FLJ61616, highly similar to Dual specificity protein kinase CLK2 (EC 2.7.12.1); SubName: Full=CDC-like kinase 2, isoform CRA_c; SubName: Full=Putative uncharacterized protein CLK2;												0						AGTCAAACATCTGGACACAGA	0.473													23	31	---	---	---	---	PASS
OSBPL3	26031	broad.mit.edu	37	7	24874112	24874112	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24874112T>C	uc003sxf.2	-	15	2144	c.1739A>G	c.(1738-1740)GAA>GGA	p.E580G	OSBPL3_uc003sxd.2_RNA|OSBPL3_uc003sxe.2_RNA|OSBPL3_uc003sxg.2_Missense_Mutation_p.E544G|OSBPL3_uc003sxh.2_Missense_Mutation_p.E549G|OSBPL3_uc003sxi.2_Missense_Mutation_p.E513G|OSBPL3_uc003sxj.1_Missense_Mutation_p.E309G|OSBPL3_uc003sxk.1_Missense_Mutation_p.E278G	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform	580					lipid transport		lipid binding|protein binding			skin(1)	1						CACCATCCTTTCCAGGGGGCT	0.642													66	116	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51287624	51287624	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51287624C>G	uc003tpr.3	-	2	244	c.59G>C	c.(58-60)CGT>CCT	p.R20P	COBL_uc003tps.2_Missense_Mutation_p.R20P|COBL_uc011kcl.1_Missense_Mutation_p.R20P|COBL_uc010kzc.2_Missense_Mutation_p.R20P|COBL_uc003tpt.2_Missense_Mutation_p.R20P	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	20										skin(3)|ovary(2)	5	Glioma(55;0.08)					TGGGGGAGCACGAGCCTTCAT	0.547													5	21	---	---	---	---	PASS
FKBP6	8468	broad.mit.edu	37	7	72715109	72715109	+	Intron	SNP	T	C	C	rs2261212		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72715109T>C	uc003twz.2	+						uc011keu.1_RNA	NM_001135211	NP_001128683	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform b						protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				TCCAAGACCCTAGGGGCTCGA	0.587													5	28	---	---	---	---	PASS
TNKS	8658	broad.mit.edu	37	8	9605603	9605603	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9605603A>T	uc003wss.2	+	18	2718	c.2713A>T	c.(2713-2715)ACT>TCT	p.T905S	TNKS_uc011kww.1_Missense_Mutation_p.T668S|TNKS_uc010lrt.1_RNA	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related	905	ANK 15.				mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		GTGGGCGTTTACTCCCCTCCA	0.478													63	36	---	---	---	---	PASS
PRSS55	203074	broad.mit.edu	37	8	10388864	10388864	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10388864T>C	uc003wta.2	+	3	422	c.407T>C	c.(406-408)ATA>ACA	p.I136T	uc010lru.2_Intron|PRSS55_uc003wtb.2_RNA	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	136	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1						TCCATGGAAATAAAGGAGGTC	0.517													169	63	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10464916	10464916	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10464916G>A	uc003wtc.2	-	4	6921	c.6692C>T	c.(6691-6693)CCG>CTG	p.P2231L		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2231					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		TTCAGCCTCCGGGGTCTCTAC	0.612													128	52	---	---	---	---	PASS
NEFM	4741	broad.mit.edu	37	8	24775968	24775968	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24775968A>T	uc003xed.3	+	3	2633	c.2600A>T	c.(2599-2601)GAT>GTT	p.D867V	NEFM_uc011lac.1_Missense_Mutation_p.D649V|NEFM_uc010lue.2_Missense_Mutation_p.D491V	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	867	Tail.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GAGGGGGGAGATGGTGCTACC	0.438													55	14	---	---	---	---	PASS
CYP7B1	9420	broad.mit.edu	37	8	65537016	65537016	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65537016C>A	uc003xvj.2	-	2	407	c.203G>T	c.(202-204)AGG>ATG	p.R68M		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,	68					bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TTTCATGAACCTTAAGGGGTC	0.383													84	383	---	---	---	---	PASS
CCNE2	9134	broad.mit.edu	37	8	95895044	95895044	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95895044T>G	uc003yhc.2	-	10	1017	c.908A>C	c.(907-909)CAT>CCT	p.H303P	CCNE2_uc003yhd.2_Missense_Mutation_p.H303P	NM_057749	NP_477097	O96020	CCNE2_HUMAN	cyclin E2	303					cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)					GGAGGTAAAATGGCACAAGGC	0.383													89	371	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116426955	116426955	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116426955C>T	uc003ynz.2	-	6	3601	c.3142G>A	c.(3142-3144)GAT>AAT	p.D1048N	TRPS1_uc011lhy.1_Missense_Mutation_p.D1052N|TRPS1_uc003yny.2_Missense_Mutation_p.D1061N|TRPS1_uc010mcy.2_Missense_Mutation_p.D1048N	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	1048	Mediates interaction with RNF4 (By similarity).				negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TTTCCTGGATCTCCAGTACTT	0.438									Langer-Giedion_syndrome				8	519	---	---	---	---	PASS
KHDRBS3	10656	broad.mit.edu	37	8	136554944	136554944	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136554944G>T	uc003yuv.2	+	3	649	c.255G>T	c.(253-255)AAG>AAT	p.K85N	KHDRBS3_uc003yuw.2_Missense_Mutation_p.K85N	NM_006558	NP_006549	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal	85	KH.				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			ATTCTCTGAAGCGTTTACAAG	0.368													87	366	---	---	---	---	PASS
KHDRBS3	10656	broad.mit.edu	37	8	136554945	136554945	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136554945C>T	uc003yuv.2	+	3	650	c.256C>T	c.(256-258)CGT>TGT	p.R86C	KHDRBS3_uc003yuw.2_Missense_Mutation_p.R86C	NM_006558	NP_006549	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal	86	KH.				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			TTCTCTGAAGCGTTTACAAGA	0.368													87	369	---	---	---	---	PASS
ZNF517	340385	broad.mit.edu	37	8	146033227	146033227	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146033227G>A	uc003zed.1	+	5	1033	c.926G>A	c.(925-927)CGC>CAC	p.R309H	ZNF517_uc010mgd.1_Missense_Mutation_p.R215H|ZNF517_uc003zee.1_RNA|ZNF517_uc011llm.1_Missense_Mutation_p.R215H|ZNF517_uc003zef.1_Intron	NM_213605	NP_998770	Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	309	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GAGCACGGCCGCATCCACAGC	0.682													3	34	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790187	78790187	+	Intron	SNP	G	C	C	rs10118321		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790187G>C	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.W681S|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						ggaatggaatggaatcgaatc	0.119													4	14	---	---	---	---	PASS
TBC1D2	55357	broad.mit.edu	37	9	100991289	100991289	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100991289A>C	uc011lvb.1	-	5	1103	c.923T>G	c.(922-924)GTG>GGG	p.V308G	TBC1D2_uc004ayq.2_Missense_Mutation_p.V308G|TBC1D2_uc004ayr.2_Missense_Mutation_p.V90G|TBC1D2_uc004ayo.3_Missense_Mutation_p.V308G	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	308	Potential.|Interaction with RAC1.					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		CAAGGCTGCCACTTTCTCCTG	0.542													61	88	---	---	---	---	PASS
OR13F1	138805	broad.mit.edu	37	9	107266833	107266833	+	Missense_Mutation	SNP	G	T	T	rs79177442	byFrequency	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107266833G>T	uc011lvm.1	+	1	290	c.290G>T	c.(289-291)TGC>TTC	p.C97F		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	97	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3						TTCTCAGGGTGCGCCACTCAG	0.527													64	89	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	117068939	117068939	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117068939T>C	uc011lxl.1	+	58	5078	c.5078T>C	c.(5077-5079)CTC>CCC	p.L1693P	COL27A1_uc004bii.2_RNA|COL27A1_uc011lxn.1_5'Flank	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	1693	Fibrillar collagen NC1.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						TGCAGGGACCTCATGGACTGT	0.582											OREG0019417	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	58	---	---	---	---	PASS
DPM2	8818	broad.mit.edu	37	9	130697931	130697931	+	3'UTR	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130697931C>T	uc004bsv.2	-	4						NM_003863	NP_003854	O94777	DPM2_HUMAN	dolichyl-phosphate mannosyltransferase 2						C-terminal protein lipidation|dolichol-linked oligosaccharide biosynthetic process|preassembly of GPI anchor in ER membrane|protein N-linked glycosylation via asparagine|protein O-linked mannosylation|regulation of protein stability	dolichol-phosphate-mannose synthase complex|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to endoplasmic reticulum membrane	protein binding				0						GTTCTGCAGGCTCCCCCACTT	0.627													13	18	---	---	---	---	PASS
WDR34	89891	broad.mit.edu	37	9	131396015	131396015	+	3'UTR	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131396015G>A	uc004bvq.1	-	9					WDR34_uc004bvs.1_3'UTR|WDR34_uc004bvr.1_3'UTR	NM_052844	NP_443076	Q96EX3	WDR34_HUMAN	WD repeat domain 34							cytoplasm				central_nervous_system(2)|skin(1)	3						CCCGCCTCCCGGGACCCCTCA	0.587													175	249	---	---	---	---	PASS
ASB6	140459	broad.mit.edu	37	9	132400168	132400168	+	Silent	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132400168C>T	uc004byf.1	-	6	1333	c.1167G>A	c.(1165-1167)CCG>CCA	p.P389P	ASB6_uc004bye.1_Silent_p.P314P|ASB6_uc004byg.1_3'UTR|ASB6_uc011mbt.1_Silent_p.P310P|ASB6_uc010myx.1_Silent_p.P360P	NM_017873	NP_060343	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box-containing 6 isoform	389	SOCS box.				intracellular signal transduction	cytoplasm					0		Ovarian(14;0.00556)				CCACAGGCCACGGCTGAAGGT	0.597													48	63	---	---	---	---	PASS
FAM171A1	221061	broad.mit.edu	37	10	15254774	15254774	+	3'UTR	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15254774G>A	uc001iob.2	-	8						NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor							integral to membrane				ovary(2)|breast(1)|skin(1)	4						CATTTACACGGCAAACAGGAA	0.507													3	39	---	---	---	---	PASS
CACNB2	783	broad.mit.edu	37	10	18629833	18629833	+	Intron	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18629833G>T	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc009xkb.1_5'UTR|CACNB2_uc010qcm.1_5'UTR|CACNB2_uc001ipz.2_5'UTR|CACNB2_uc001ipy.2_5'UTR	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TGGAGTGCTGGGCGCACTTGG	0.483													100	160	---	---	---	---	PASS
ACBD5	91452	broad.mit.edu	37	10	27497258	27497258	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27497258C>A	uc010qdp.1	-	10	1512	c.1321G>T	c.(1321-1323)GCC>TCC	p.A441S	ACBD5_uc010qdm.1_Missense_Mutation_p.A439S|ACBD5_uc010qdn.1_Missense_Mutation_p.A332S|ACBD5_uc010qdo.1_Missense_Mutation_p.A264S|ACBD5_uc001ito.2_Missense_Mutation_p.A406S|ACBD5_uc001itp.2_Missense_Mutation_p.A332S|ACBD5_uc001itq.2_Missense_Mutation_p.A332S|ACBD5_uc001itr.1_Missense_Mutation_p.A230S	NM_145698	NP_663736	Q5T8D3	ACBD5_HUMAN	acyl-Coenzyme A binding domain containing 5	450	Potential.				transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding				0						AGCACGAGGGCGATCTGCTCA	0.572													129	190	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50854677	50854677	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50854677A>T	uc001jhz.2	+	8	1391	c.1238A>T	c.(1237-1239)TAC>TTC	p.Y413F	CHAT_uc001jhv.1_Missense_Mutation_p.Y295F|CHAT_uc001jhx.1_Missense_Mutation_p.Y295F|CHAT_uc001jhy.1_Missense_Mutation_p.Y295F|CHAT_uc001jia.2_Missense_Mutation_p.Y295F|CHAT_uc010qgs.1_Missense_Mutation_p.Y295F	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	413					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	GGCGGAGGCTACAGCAAGAAC	0.632													33	48	---	---	---	---	PASS
GOLGA7B	401647	broad.mit.edu	37	10	99623791	99623791	+	Silent	SNP	C	T	T	rs138920879	byFrequency	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99623791C>T	uc001kos.2	+	3	308	c.243C>T	c.(241-243)TGC>TGT	p.C81C		NM_001010917	NP_001010917	Q2TAP0	GOG7B_HUMAN	golgi autoantigen, golgin subfamily a, 7B	81						Golgi membrane					0						GCCTGGCCTGCGCCACGGCCT	0.617													26	57	---	---	---	---	PASS
VAX1	11023	broad.mit.edu	37	10	118897601	118897601	+	5'UTR	SNP	A	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118897601A>T	uc009xyx.2	-	1					VAX1_uc001ldb.1_5'UTR	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)		gaaaggaaaaaaaaagcaaaa	0.463													16	21	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134942935	134942935	+	Silent	SNP	T	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134942935T>C	uc001llx.3	+	7	2039	c.1603T>C	c.(1603-1605)TTG>CTG	p.L535L	GPR123_uc001llw.2_Silent_p.L1254L	NM_001083909	NP_001077378	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	535	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CAAGGGTAAATTGCTAGAAGG	0.632													16	18	---	---	---	---	PASS
LOC653544	653544	broad.mit.edu	37	10	135491021	135491021	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135491021C>T	uc010qvi.1	+	1	743	c.632C>T	c.(631-633)CCG>CTG	p.P211L		NM_001127389	NP_001120861	F5GZ66	F5GZ66_HUMAN	double homeobox, 4-like	211						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GCCAGGCACCCGGGACAGGGT	0.721													5	59	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1093512	1093512	+	Silent	SNP	C	A	A	rs34493663	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1093512C>A	uc001lsx.1	+	31	12444	c.12417C>A	c.(12415-12417)ACC>ACA	p.T4139T		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4139						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ctacgatgaccccaaccccaa	0.129													3	13	---	---	---	---	PASS
GTF2H1	2965	broad.mit.edu	37	11	18362866	18362866	+	Silent	SNP	A	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18362866A>G	uc001moi.2	+	7	1360	c.666A>G	c.(664-666)ACA>ACG	p.T222T	GTF2H1_uc001moh.2_Silent_p.T222T|GTF2H1_uc009yhm.2_Silent_p.T106T	NM_001142307	NP_001135779	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1,	222	BSD 2.				mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0						AATTCTGGACACGTTTTTTCC	0.363								NER					53	99	---	---	---	---	PASS
PRRG4	79056	broad.mit.edu	37	11	32852172	32852172	+	Missense_Mutation	SNP	G	A	A	rs33962176	byFrequency	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32852172G>A	uc001mtx.2	+	2	350	c.97G>A	c.(97-99)GAA>AAA	p.E33K		NM_024081	NP_076986	Q9BZD6	TMG4_HUMAN	proline rich Gla (G-carboxyglutamic acid) 4	33						extracellular region|Golgi apparatus|integral to membrane	calcium ion binding				0	Breast(20;0.206)					GCATGCGGGAGAAGAAGGTAA	0.488													5	180	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47738903	47738903	+	3'UTR	SNP	T	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47738903T>A	uc009ylv.2	-	17					AGBL2_uc001ngg.2_5'Flank|AGBL2_uc010rhq.1_5'Flank|AGBL2_uc001ngh.1_5'Flank|FNBP4_uc001ngi.2_3'UTR|FNBP4_uc001ngj.2_3'UTR	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						TATTTGACAATAAAACTGGTT	0.284													12	14	---	---	---	---	PASS
OR9Q2	219957	broad.mit.edu	37	11	57958582	57958582	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57958582T>G	uc010rka.1	+	1	620	c.620T>G	c.(619-621)ATG>AGG	p.M207R		NM_001005283	NP_001005283	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)|central_nervous_system(1)	4		Breast(21;0.0589)				CTTTTCGTCATGCCTGCCTGT	0.488													57	95	---	---	---	---	PASS
KLC2	64837	broad.mit.edu	37	11	66029325	66029325	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66029325C>T	uc010rov.1	+	3	584	c.341C>T	c.(340-342)GCG>GTG	p.A114V	KLC2_uc010row.1_Missense_Mutation_p.A114V|KLC2_uc009yra.2_Missense_Mutation_p.A114V|KLC2_uc001ohb.2_Missense_Mutation_p.A114V|KLC2_uc010rox.1_Intron|KLC2_uc001ohc.2_Missense_Mutation_p.A114V|KLC2_uc001ohd.2_Intron|KLC2_uc001ohe.1_5'UTR	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	114	Potential.				blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0						GAGGAGCTGGCGGGGACACAG	0.627													3	49	---	---	---	---	PASS
FGFR1OP2	26127	broad.mit.edu	37	12	27109591	27109591	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27109591A>G	uc001rhm.2	+	3	593	c.251A>G	c.(250-252)AAA>AGA	p.K84R	FGFR1OP2_uc001rhl.2_Missense_Mutation_p.K84R|FGFR1OP2_uc001rhn.2_Missense_Mutation_p.K84R	NM_015633	NP_056448	Q9NVK5	FGOP2_HUMAN	FGFR1 oncogene partner 2	84	Potential.					cytoplasm					0	Colorectal(261;0.0847)					CAAGAAAACAAAGGTAAGATA	0.388													35	67	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31242718	31242718	+	Intron	SNP	T	C	C	rs2005898	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242718T>C	uc001rjt.1	+						DDX11_uc010sjw.1_3'UTR|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TTATAGACCCTACCCCATGGA	0.507										Multiple Myeloma(12;0.14)			8	3	---	---	---	---	PASS
ACVRL1	94	broad.mit.edu	37	12	52310003	52310003	+	Missense_Mutation	SNP	G	A	A	rs121909284		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52310003G>A	uc001rzj.2	+	8	1515	c.1232G>A	c.(1231-1233)CGG>CAG	p.R411Q	ACVRL1_uc001rzk.2_Missense_Mutation_p.R411Q|ACVRL1_uc010snm.1_Missense_Mutation_p.R237Q	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor	411	Cytoplasmic (Potential).|Protein kinase.		R -> P (in HHT2).|R -> W (in HHT2).		blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	ATTGCCCGCCGGACCATCGTG	0.627									Hereditary_Hemorrhagic_Telangiectasia				26	37	---	---	---	---	PASS
GLI1	2735	broad.mit.edu	37	12	57864730	57864730	+	Missense_Mutation	SNP	A	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57864730A>T	uc001snx.2	+	12	2285	c.2207A>T	c.(2206-2208)GAA>GTA	p.E736V	GLI1_uc009zpq.2_Missense_Mutation_p.E608V	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	736					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			GGGGGACCTGAAGGGGCAGCA	0.602													69	129	---	---	---	---	PASS
CCDC41	51134	broad.mit.edu	37	12	94763729	94763729	+	Silent	SNP	T	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94763729T>C	uc001tdd.2	-	9	1603	c.1017A>G	c.(1015-1017)AGA>AGG	p.R339R	CCDC41_uc001tde.2_Silent_p.R339R|CCDC41_uc009zsw.1_RNA|CCDC41_uc001tdf.2_Silent_p.R339R	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen	331	Potential.										0						TATTCCTTTCTCTTTCTAGCT	0.333													5	411	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100536424	100536424	+	5'UTR	SNP	C	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100536424C>A	uc001tgq.2	-	1					UHRF1BP1L_uc001tgr.2_5'UTR	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a											ovary(2)	2						GGTACCGAGGCTGGAGACGCC	0.657													12	18	---	---	---	---	PASS
MYO1H	283446	broad.mit.edu	37	12	109849777	109849777	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109849777G>A	uc010sxn.1	+	13	1441	c.1441G>A	c.(1441-1443)GCA>ACA	p.A481T		NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H	Error:Variant_position_missing_in_B4DNW6_after_alignment						myosin complex	motor activity				0						GGGCAAACATGCACACTTCGA	0.398													9	5	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130839528	130839528	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130839528C>T	uc001uik.2	+	11	1357	c.1267C>T	c.(1267-1269)CGA>TGA	p.R423*	PIWIL1_uc001uij.1_Nonsense_Mutation_p.R423*	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	423					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TGAAGTGGGACGACTCATTGA	0.383													114	180	---	---	---	---	PASS
RNF6	6049	broad.mit.edu	37	13	26788080	26788080	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26788080G>A	uc001uqo.2	-	5	2230	c.1939C>T	c.(1939-1941)CAA>TAA	p.Q647*	RNF6_uc001uqn.1_Intron|RNF6_uc010aak.2_Nonsense_Mutation_p.Q647*|RNF6_uc001uqp.2_Nonsense_Mutation_p.Q647*|RNF6_uc001uqq.2_Nonsense_Mutation_p.Q647*|RNF6_uc010tdk.1_Nonsense_Mutation_p.Q291*	NM_183044	NP_898865	Q9Y252	RNF6_HUMAN	ring finger protein 6	647	RING-type.|Required for polyubiquitination (By similarity).				negative regulation of axon extension|positive regulation of transcription, DNA-dependent|protein K27-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|regulation of androgen receptor signaling pathway|ubiquitin-dependent protein catabolic process	axon|cytoplasm|PML body	androgen receptor binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		CAAGGTAATTGCCTGAGCTTG	0.408													82	39	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77718680	77718680	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77718680C>T	uc001vkf.2	-	50	7180	c.7089G>A	c.(7087-7089)ATG>ATA	p.M2363I	MYCBP2_uc010aev.2_Missense_Mutation_p.M1767I	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	2363	Filamin.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CACGGATCAGCATATTCTCAC	0.368													14	106	---	---	---	---	PASS
PROZ	8858	broad.mit.edu	37	13	113824784	113824784	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113824784A>C	uc001vta.1	+	7	638	c.631A>C	c.(631-633)AAT>CAT	p.N211H	PROZ_uc010agr.1_Missense_Mutation_p.N233H	NM_003891	NP_003882	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma	211	Peptidase S1.				blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	AATACGGGAAAATTTTGTACT	0.303													5	70	---	---	---	---	PASS
PSEN1	5663	broad.mit.edu	37	14	73664775	73664775	+	Missense_Mutation	SNP	G	T	T	rs63750900		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73664775G>T	uc001xnr.2	+	8	1090	c.806G>T	c.(805-807)CGT>CTT	p.R269L	PSEN1_uc001xnv.2_Missense_Mutation_p.R265L|PSEN1_uc010ark.2_Missense_Mutation_p.R265L|PSEN1_uc001xnt.1_RNA|PSEN1_uc001xnu.2_RNA	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467	269	Cytoplasmic (Potential).		R -> H (in AD3).|R -> G (in AD3).		amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		GGTCCACTTCGTATGCTGGTT	0.363													3	53	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94004551	94004551	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94004551G>T	uc001ybv.1	+	9	891	c.808G>T	c.(808-810)GAA>TAA	p.E270*	KIAA1409_uc001ybs.1_Nonsense_Mutation_p.E270*|KIAA1409_uc001ybu.1_Nonsense_Mutation_p.E208*	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	447						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		CTGCGCCGTGGAAGCCGTGAT	0.557													16	15	---	---	---	---	PASS
GOLGA9P	283796	broad.mit.edu	37	15	23262294	23262294	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23262294C>T	uc001yvh.1	+	12	1450	c.908C>T	c.(907-909)GCA>GTA	p.A303V	uc001yvl.2_5'Flank|uc001yvm.2_5'Flank	NR_024074				RecName: Full=Putative golgin subfamily A member 6-like protein 11;												0						AACAAGAGCGCACTGCAGTTG	0.577													4	50	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31294406	31294406	+	Silent	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31294406G>A	uc001zfm.2	-	27	4559	c.4431C>T	c.(4429-4431)ATC>ATT	p.I1477I	TRPM1_uc010azy.2_Silent_p.I1384I|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	1477	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GAGAGCGCGTGATCTTTTGAA	0.478													12	452	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52571856	52571856	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52571856C>G	uc010bff.2	-	3	291	c.154G>C	c.(154-156)GTC>CTC	p.V52L	MYO5C_uc010uga.1_RNA|MYO5C_uc010ugb.1_RNA|MYO5C_uc010ugc.1_Missense_Mutation_p.V15L|MIR1266_hsa-mir-1266|MI0006403_5'Flank	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	52	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		TCTGGATTGACAGAATAATCC	0.468													29	30	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	72039268	72039268	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72039268C>A	uc002atb.1	+	12	2207	c.2128C>A	c.(2128-2130)CGC>AGC	p.R710S	THSD4_uc002ate.2_Missense_Mutation_p.R350S	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	710	TSP type-1 2.					proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						GTACGCCAACCGCAGCCTGAC	0.637													3	45	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15198418	15198418	+	Intron	SNP	A	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198418A>T	uc002ddc.2	+						uc010uzr.1_Missense_Mutation_p.D157E|uc010uzs.1_RNA|uc002ddh.2_3'UTR|uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TCTTGAGATTATCATCCGCTG	0.537													53	65	---	---	---	---	PASS
SHCBP1	79801	broad.mit.edu	37	16	46638306	46638306	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46638306G>T	uc002eec.3	-	6	797	c.757C>A	c.(757-759)CAA>AAA	p.Q253K		NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	253										ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				TCCTCACATTGAGACAACAGA	0.388													4	144	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74425732	74425732	+	Missense_Mutation	SNP	G	T	T	rs77563894		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74425732G>T	uc010vmt.1	+	6	904	c.903G>T	c.(901-903)AGG>AGT	p.R301S						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		agaggtggagggtgGATGAGG	0.348													6	44	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74425769	74425769	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74425769C>T	uc010vmt.1	+	6	941	c.940C>T	c.(940-942)CGG>TGG	p.R314W						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		ACCCAAGAGGCGGAGGGCGGA	0.259													4	31	---	---	---	---	PASS
GINS2	51659	broad.mit.edu	37	16	85711728	85711728	+	3'UTR	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85711728G>T	uc002fja.2	-	5						NM_016095	NP_057179	Q9Y248	PSF2_HUMAN	DNA replication complex GINS protein PSF2						DNA strand elongation involved in DNA replication|S phase of mitotic cell cycle	nucleoplasm	protein binding				0						TCATGCATCAGAAGTGTTTCT	0.483													3	58	---	---	---	---	PASS
KIAA0664	23277	broad.mit.edu	37	17	2594218	2594218	+	Intron	SNP	G	A	A	rs2240730	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2594218G>A	uc002fuy.1	-						KIAA0664_uc002fux.1_Intron|KIAA0664_uc010ckc.1_3'UTR	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277								binding			breast(2)	2						CCTGAAGGCGGAAGGTCCCTG	0.662													7	5	---	---	---	---	PASS
AMAC1L3	643664	broad.mit.edu	37	17	7386366	7386366	+	3'UTR	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7386366G>A	uc010cmj.1	+	2					ZBTB4_uc002ghd.3_Intron|POLR2A_uc002ghe.2_5'Flank|POLR2A_uc002ghf.3_5'Flank	NM_001102614	NP_001096084	P0C7Q6	AMCL3_HUMAN	acyl-malonyl condensing enzyme 1-like 3							integral to membrane					0		Prostate(122;0.173)				GGGATAAATAGAGGCAAAGAC	0.537													6	22	---	---	---	---	PASS
WDR16	146845	broad.mit.edu	37	17	9501551	9501551	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9501551T>G	uc002gly.2	+	5	606	c.537T>G	c.(535-537)AAT>AAG	p.N179K	WDR16_uc002glz.2_Missense_Mutation_p.N111K|WDR16_uc010coc.2_Missense_Mutation_p.N189K	NM_145054	NP_659491	Q8N1V2	WDR16_HUMAN	WD40-repeat protein upregulated in HCC isoform	179	WD 3.					cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						TTTTACATAGTGGGACAATTC	0.353													6	76	---	---	---	---	PASS
LRRC37B	114659	broad.mit.edu	37	17	30349140	30349140	+	Silent	SNP	A	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30349140A>C	uc002hgu.2	+	1	986	c.975A>C	c.(973-975)ACA>ACC	p.T325T	LRRC37B_uc010wbx.1_Silent_p.T243T|LRRC37B_uc010csu.2_Silent_p.T325T	NM_052888	NP_443120	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B precursor	325	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				ATGAAGTGACAGTTCAACCTC	0.483													70	105	---	---	---	---	PASS
KRT25	147183	broad.mit.edu	37	17	38905556	38905556	+	Nonsense_Mutation	SNP	G	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38905556G>C	uc002hve.2	-	7	1258	c.1197C>G	c.(1195-1197)TAC>TAG	p.Y399*		NM_181534	NP_853512	Q7Z3Z0	K1C25_HUMAN	keratin 25	399	Tail.					cytoplasm|intermediate filament	structural molecule activity			ovary(2)	2		Breast(137;0.00526)				CTTTAGACTTGTAACCCCCAG	0.348													12	280	---	---	---	---	PASS
C1QL1	10882	broad.mit.edu	37	17	43045338	43045338	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43045338T>G	uc002ihv.2	-	1	307	c.79A>C	c.(79-81)ACC>CCC	p.T27P		NM_006688	NP_006679	O75973	C1QRF_HUMAN	complement component 1, q subcomponent-like 1	27					locomotory behavior	collagen					0		Prostate(33;0.155)				ATGCGGCAGGTGCCCAGCATC	0.612													6	5	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587569	43587569	+	Intron	SNP	G	C	C	rs149697015	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587569G>C	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						aactccgtctgaaaagaaaag	0.144													3	41	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587576	43587576	+	Intron	SNP	A	G	G	rs2684618		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587576A>G	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						tctgaaaagaaaagaaaaaaa	0.154													3	54	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62050100	62050100	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62050100C>G	uc002jds.1	-	1	179	c.102G>C	c.(100-102)GAG>GAC	p.E34D		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	34					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	GGGCCTCCTCCTCCACCGCCC	0.622													16	22	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66041948	66041948	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66041948T>G	uc002jgk.2	+	10	1540	c.1408T>G	c.(1408-1410)TTA>GTA	p.L470V	KPNA2_uc002jgl.2_Missense_Mutation_p.L470V	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	470	ARM 10; atypical.				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATGTGGAGGCTTAGACAAAAT	0.343													5	264	---	---	---	---	PASS
BAHCC1	57597	broad.mit.edu	37	17	79410342	79410342	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79410342G>T	uc002kaf.2	+	3	1967	c.1967G>T	c.(1966-1968)GGT>GTT	p.G656V	BAHCC1_uc002kae.2_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	656							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			GTGGGCCTGGGTGGCCTCAAG	0.652													5	31	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8088781	8088781	+	Silent	SNP	T	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8088781T>A	uc002knn.3	+	11	2291	c.1788T>A	c.(1786-1788)CCT>CCA	p.P596P	PTPRM_uc010dkv.2_Silent_p.P596P|PTPRM_uc010wzl.1_Silent_p.P383P	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	596	Fibronectin type-III 4.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				TTGAGACACCTTTGAATCAAA	0.478													4	157	---	---	---	---	PASS
SMAD4	4089	broad.mit.edu	37	18	48604690	48604690	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48604690T>A	uc010xdp.1	+	12	2050	c.1512T>A	c.(1510-1512)AGT>AGA	p.S504R	SMAD4_uc002lfb.3_Missense_Mutation_p.S349R	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	504	MH2.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(2)|p.S504R(1)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TCAGGATGAGTTTTGTGAAAG	0.488									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				7	69	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1058148	1058148	+	Silent	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1058148C>T	uc002lqw.3	+	37	5260	c.5029C>T	c.(5029-5031)CTG>TTG	p.L1677L	ABCA7_uc002lqy.2_Silent_p.L130L|ABCA7_uc010dsc.2_5'Flank	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	1677					phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGCAGAAGCTGCAGGAGGT	0.612													38	10	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9090531	9090531	+	Silent	SNP	T	C	C	rs12976721	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9090531T>C	uc002mkp.2	-	1	1488	c.1284A>G	c.(1282-1284)GAA>GAG	p.E428E		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	428	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCCTTCTGTTTCCTTTCCAC	0.502													3	111	---	---	---	---	PASS
USHBP1	83878	broad.mit.edu	37	19	17367435	17367435	+	Missense_Mutation	SNP	T	C	C	rs9676419	byFrequency	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17367435T>C	uc002nfs.1	-	9	1428	c.1315A>G	c.(1315-1317)ATG>GTG	p.M439V	USHBP1_uc002nfr.1_Missense_Mutation_p.M65V|USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Missense_Mutation_p.M375V	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	439							PDZ domain binding			ovary(1)	1						AGAATCTTCATTAGAGAACGG	0.612													4	188	---	---	---	---	PASS
MAP1S	55201	broad.mit.edu	37	19	17836873	17836873	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17836873T>A	uc002nhe.1	+	5	689	c.680T>A	c.(679-681)CTG>CAG	p.L227Q	MAP1S_uc010eaz.1_RNA|MAP1S_uc010eba.1_Missense_Mutation_p.L227Q|MAP1S_uc002nhf.1_Intron|MAP1S_uc010xpv.1_Missense_Mutation_p.L201Q	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1	227	Necessary for the microtubule-organizing center localization.				apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						TTCGAGCTGCTGGAGCCCCCG	0.687													32	25	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30934749	30934749	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30934749A>C	uc002nsu.1	+	2	418	c.280A>C	c.(280-282)ACC>CCC	p.T94P	ZNF536_uc010edd.1_Missense_Mutation_p.T94P	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	94					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GGAGGTGGACACCAGCCTCAA	0.657													4	31	---	---	---	---	PASS
MIR641	693226	broad.mit.edu	37	19	40788504	40788504	+	RNA	SNP	A	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40788504A>C	hsa-mir-641|MI0003656	-			c.45A>C			AKT2_uc002onf.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron																	0						TAGAGGACAGAGGACAGAGGT	0.403													4	7	---	---	---	---	PASS
IRGQ	126298	broad.mit.edu	37	19	44099377	44099377	+	Silent	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44099377G>A	uc002oww.2	-	1	232	c.114C>T	c.(112-114)CCC>CCT	p.P38P	IRGQ_uc010eiv.2_Silent_p.P38P|ZNF576_uc002owy.2_5'Flank|ZNF576_uc002owz.2_5'Flank|SRRM5_uc002oxb.2_5'Flank	NM_001007561	NP_001007562	Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	38							protein binding			ovary(1)|pancreas(1)	2		Prostate(69;0.0199)				GCCGTCCCTCGGGGGCCTCGA	0.711													23	48	---	---	---	---	PASS
LILRA4	23547	broad.mit.edu	37	19	54848198	54848198	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54848198G>A	uc002qfj.2	-	6	1226	c.1169C>T	c.(1168-1170)GCG>GTG	p.A390V	LILRA4_uc002qfi.2_Missense_Mutation_p.A324V	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	390	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		GTAGGTCCCCGCGTGGGCTGA	0.622													86	130	---	---	---	---	PASS
ZIK1	284307	broad.mit.edu	37	19	58101497	58101497	+	Silent	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58101497C>T	uc002qpg.2	+	4	415	c.318C>T	c.(316-318)GTC>GTT	p.V106V	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Silent_p.V51V|ZIK1_uc002qpi.2_Silent_p.V93V|ZIK1_uc002qpj.2_Silent_p.V3V	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	106	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGATGTGTGTCCCAGTCCTGA	0.463													50	81	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33575571	33575571	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33575571G>T	uc002xbi.1	+	16	1488	c.1396G>T	c.(1396-1398)GTG>TTG	p.V466L	MIR499_hsa-mir-499|MI0003183_5'Flank	NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	424	Myosin head-like.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CCTCCAGGTGGTGTTTGCTGT	0.662													6	171	---	---	---	---	PASS
TRAPPC10	7109	broad.mit.edu	37	21	45503102	45503102	+	Silent	SNP	T	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45503102T>C	uc002zea.2	+	14	2326	c.2157T>C	c.(2155-2157)GCT>GCC	p.A719A	TRAPPC10_uc010gpo.2_Silent_p.A430A|TRAPPC10_uc011afa.1_Silent_p.A138A	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	719					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CAGGGGTGGCTCTGGAGGAGG	0.572													62	217	---	---	---	---	PASS
KRTAP10-2	386679	broad.mit.edu	37	21	45970406	45970406	+	3'UTR	SNP	C	G	G	rs112247714	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45970406C>G	uc002zfi.1	-	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198693	NP_941966	P60368	KR102_HUMAN	keratin associated protein 10-2							keratin filament				large_intestine(1)	1						GCCCGCCCGGCGGGAGGTCAG	0.692													4	2	---	---	---	---	PASS
KRTAP10-2	386679	broad.mit.edu	37	21	45970417	45970417	+	3'UTR	SNP	A	G	G	rs113903987	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45970417A>G	uc002zfi.1	-	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198693	NP_941966	P60368	KR102_HUMAN	keratin associated protein 10-2							keratin filament				large_intestine(1)	1						GGGAGGTCAGAGAGGAGCCAG	0.692													4	5	---	---	---	---	PASS
KRTAP10-6	386674	broad.mit.edu	37	21	46011688	46011688	+	Missense_Mutation	SNP	C	G	G	rs138841432	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46011688C>G	uc002zfm.2	-	1	699	c.678G>C	c.(676-678)CAG>CAC	p.Q226H	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6	226	29 X 5 AA repeats of C-C-X(3).					keratin filament					0						CGCAGCAGGCCTGCTGGCAGG	0.652													11	270	---	---	---	---	PASS
KLHDC7B	113730	broad.mit.edu	37	22	50987420	50987420	+	Silent	SNP	G	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50987420G>C	uc003bmi.2	+	1	959	c.825G>C	c.(823-825)CGG>CGC	p.R275R		NM_138433	NP_612442	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	275										central_nervous_system(1)	1		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TCAGCCTGCGGACCGGCCGGG	0.746													8	11	---	---	---	---	PASS
MAP7D2	256714	broad.mit.edu	37	X	20033399	20033399	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20033399C>T	uc004czr.1	-	11	1587	c.1568G>A	c.(1567-1569)CGT>CAT	p.R523H	MAP7D2_uc004czq.1_Missense_Mutation_p.R408H|MAP7D2_uc011mji.1_Missense_Mutation_p.R471H|MAP7D2_uc010nfo.1_Missense_Mutation_p.R564H|MAP7D2_uc011mjj.1_Missense_Mutation_p.R478H	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	523										ovary(2)|breast(1)	3						TCTCTCGAGACGCATCTGTTC	0.463													104	21	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48673411	48673411	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48673411C>T	uc011mmi.1	+	14	1197	c.1102C>T	c.(1102-1104)CAC>TAC	p.H368Y	HDAC6_uc004dks.1_Missense_Mutation_p.H368Y|HDAC6_uc010nig.1_Missense_Mutation_p.H216Y|HDAC6_uc004dkt.1_Missense_Mutation_p.H368Y|HDAC6_uc011mmk.1_Missense_Mutation_p.H349Y|HDAC6_uc004dkv.1_5'UTR|HDAC6_uc004dkw.1_5'UTR	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	368	Histone deacetylase 1.				aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	CCAGCTAACCCACCTGCTCAT	0.632													7	6	---	---	---	---	PASS
THAP3	90326	broad.mit.edu	37	1	6693976	6693977	+	Intron	INS	-	A	A	rs3215503		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6693976_6693977insA	uc001aoe.1	+							NM_138350	NP_612359	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated								DNA binding|metal ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		gactcagtctgaaaaaaaaaaC	0.139													5	4	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21307744	21307744	+	Intron	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21307744delT	uc001bec.2	-						EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		aaaaaaaaaattttttttttt	0.363													57	8	---	---	---	---	
GRHL3	57822	broad.mit.edu	37	1	24671731	24671731	+	Intron	DEL	C	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24671731delC	uc001biy.2	+						GRHL3_uc001bix.2_Intron|GRHL3_uc001biz.2_Intron	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform						regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CACACCTGTGCCCCCTCCACA	0.672													4	2	---	---	---	---	
DNASE2B	58511	broad.mit.edu	37	1	84867590	84867590	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84867590delT	uc001djt.1	+	2	165	c.132delT	c.(130-132)ACTfs	p.T44fs		NM_021233	NP_067056	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta isoform 1 precursor	44					DNA metabolic process	lysosome	deoxyribonuclease II activity				0				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		TTAGGTTTACTTTTTATAAGT	0.249								Direct_reversal_of_damage					7	4	---	---	---	---	
CCBL2	56267	broad.mit.edu	37	1	89418562	89418562	+	Intron	DEL	A	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89418562delA	uc001dmp.2	-						CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron	NM_001008661	NP_001008661	Q6YP21	KAT3_HUMAN	kynurenine aminotransferase III isoform 1						biosynthetic process|kynurenine metabolic process|tryptophan catabolic process		cysteine-S-conjugate beta-lyase activity|kynurenine-glyoxylate transaminase activity|kynurenine-oxoglutarate transaminase activity|pyridoxal phosphate binding			ovary(1)	1		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	AATTGTGTTTAAAAAAAAACC	0.214													5	3	---	---	---	---	
AMPD1	270	broad.mit.edu	37	1	115217929	115217930	+	Intron	INS	-	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115217929_115217930insA	uc001efe.1	-						AMPD1_uc001eff.1_Intron	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)						purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CTAAACTTCCCAAAAAAAAAGG	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121485378	121485378	+	IGR	DEL	C	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121485378delC								LOC647121 (171692 upstream) : None (None downstream)																							attcagacctccttgaggcct	0.005													525	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143217265	143217266	+	Intron	INS	-	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143217265_143217266insA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		GTTAGTAAAGCAAAAAAAAAAC	0.282													24	7	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144856960	144856961	+	In_Frame_Ins	INS	-	TTT	TTT			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144856960_144856961insTTT	uc001elw.3	-	40	6815_6816	c.6524_6525insAAA	c.(6523-6525)AAG>AAAAAG	p.2175_2175K>KK	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_In_Frame_Ins_p.2069_2069K>KK|PDE4DIP_uc001elv.3_In_Frame_Ins_p.1182_1182K>KK	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2175					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGCGGCCATGCTTATTGGCAAA	0.480			T	PDGFRB	MPD								134	17	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145109975	145109976	+	Intron	INS	-	C	C	rs11458983		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109975_145109976insC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CAGGAACTTTGCTAAAGATCTA	0.386													6	3	---	---	---	---	
BCL9	607	broad.mit.edu	37	1	147091501	147091501	+	Frame_Shift_Del	DEL	C	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147091501delC	uc001epq.2	+	8	2280	c.1540delC	c.(1540-1542)CCCfs	p.P514fs	BCL9_uc010ozr.1_Frame_Shift_Del_p.P440fs	NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	514	Poly-Pro.|Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					GGTCCGAGGACCCCCCCCTCC	0.582			T	IGH@|IGL@	B-ALL								618	8	---	---	---	---	
PAPOLG	64895	broad.mit.edu	37	2	60997770	60997771	+	Intron	INS	-	A	A	rs10187671	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60997770_60997771insA	uc002sai.2	+						PAPOLG_uc002saj.2_Intron|PAPOLG_uc002sak.2_Intron	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			tttttttttttaatgaagagat	0.109													4	3	---	---	---	---	
RGPD4	285190	broad.mit.edu	37	2	108507150	108507151	+	Intron	INS	-	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108507150_108507151insT	uc010ywk.1	+						RGPD4_uc002tdu.2_Intron|RGPD4_uc010ywl.1_Intron	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4						intracellular transport		binding			skin(2)	2						TCTCTTTTTTCTTTTTTTTTTG	0.317													35	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	112645773	112645774	+	IGR	INS	-	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112645773_112645774insT								ANAPC1 (4032 upstream) : MERTK (10417 downstream)																							tttttttttagttttttttttt	0.183													4	5	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141709343	141709343	+	Intron	DEL	C	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141709343delC	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GATTCCCCTACAAAGTACCTC	0.493										TSP Lung(27;0.18)			21	15	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170068370	170068370	+	Intron	DEL	G	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170068370delG	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GGAAAGGAAAGCTTCATTATG	0.269													70	41	---	---	---	---	
PLEKHA3	65977	broad.mit.edu	37	2	179358603	179358618	+	Frame_Shift_Del	DEL	CTGAAAACCAAAATGT	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179358603_179358618delCTGAAAACCAAAATGT	uc002umn.2	+	4	735_750	c.337_352delCTGAAAACCAAAATGT	c.(337-354)CTGAAAACCAAAATGTCTfs	p.L113fs		NM_019091	NP_061964	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A	113_118						cytoplasm|membrane				ovary(1)|kidney(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			CAGTGAATCGCTGAAAACCAAAATGTCTGAACTTCG	0.333													81	34	---	---	---	---	
NDUFS1	4719	broad.mit.edu	37	2	207006522	207006523	+	Intron	INS	-	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207006522_207006523insA	uc002vbe.2	-						NDUFS1_uc010ziq.1_Intron|NDUFS1_uc010zir.1_Intron|NDUFS1_uc010zis.1_Intron|NDUFS1_uc010zit.1_Intron|NDUFS1_uc010ziu.1_Intron	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,						apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	tccgtcccaccaaaaaaaaaaa	0.124													6	3	---	---	---	---	
EIF4E2	9470	broad.mit.edu	37	2	233429145	233429149	+	Intron	DEL	TATTT	-	-	rs140807446		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233429145_233429149delTATTT	uc002vta.2	+						EIF4E2_uc002vtb.1_Intron|EIF4E2_uc010zmi.1_Intron	NM_004846	NP_004837	O60573	IF4E2_HUMAN	eukaryotic translation initiation factor 4E						regulation of translation	cytoplasm|mRNA cap binding complex	RNA cap binding|translation initiation factor activity|ubiquitin protein ligase binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;2.3e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000912)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AGGTTAAAAGtattttattttattt	0.200													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5124705	5124710	+	IGR	DEL	TTTTTT	-	-	rs72175262		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5124705_5124710delTTTTTT								BHLHE40 (97842 upstream) : ARL8B (39220 downstream)																							CATTTCAGCCtttttttttttttttt	0.461													6	3	---	---	---	---	
GRIP2	80852	broad.mit.edu	37	3	14555758	14555759	+	Intron	INS	-	AGTT	AGTT	rs138623401	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14555758_14555759insAGTT	uc011avi.1	-						GRIP2_uc010heh.2_5'Flank|GRIP2_uc011avh.1_Intron	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						CAGTTTCTCTCAGAGAGTGGCA	0.351													4	7	---	---	---	---	
NR1D2	9975	broad.mit.edu	37	3	24001168	24001168	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24001168delT	uc003ccs.2	+	4	698	c.379delT	c.(379-381)TTTfs	p.F127fs	NR1D2_uc010hfd.2_RNA|NR1D2_uc011awk.1_Frame_Shift_Del_p.F52fs	NM_005126	NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	127	Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding			urinary_tract(1)|kidney(1)|skin(1)	3						TTAGGGTTTCTTTCGGAGAAG	0.358													127	82	---	---	---	---	
SCN11A	11280	broad.mit.edu	37	3	38967978	38967979	+	Intron	INS	-	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38967978_38967979insT	uc011ays.1	-							NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha						response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	aaaaccatgtcttttttttttt	0.015													5	3	---	---	---	---	
ACPP	55	broad.mit.edu	37	3	132061315	132061335	+	Intron	DEL	CAATTGTCTGGCCCAAAATAT	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132061315_132061335delCAATTGTCTGGCCCAAAATAT	uc010htp.2	+						ACPP_uc003eon.3_Intron|ACPP_uc003eop.3_Intron	NM_001099	NP_001090	P15309	PPAP_HUMAN	acid phosphatase, prostate short isoform							extracellular region|lysosomal membrane	5'-nucleotidase activity|acid phosphatase activity			ovary(1)	1						ctacaacaaacaattgtctggcccaaaatatcaataatgct	0.118													43	12	---	---	---	---	
COMMD2	51122	broad.mit.edu	37	3	149470308	149470331	+	5'Flank	DEL	GAGGCTCCGGCGTCGCAGCGTCCG	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149470308_149470331delGAGGCTCCGGCGTCGCAGCGTCCG	uc003exk.2	-							NM_016094	NP_057178	Q86X83	COMD2_HUMAN	COMM domain containing 2								protein binding				0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CCGGCGCCTAGAGGCTCCGGCGTCGCAGCGTCCGGAGCTTTGGG	0.580													5	3	---	---	---	---	
OTOP1	133060	broad.mit.edu	37	4	4204225	4204229	+	Frame_Shift_Del	DEL	TTGAG	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4204225_4204229delTTGAG	uc003ghp.1	-	4	706_710	c.676_680delCTCAA	c.(676-681)CTCAATfs	p.L226fs		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	226_227					biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTTGTGCTCATTGAGTTGGTGCTTT	0.502													232	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																							tccattccgttccggtccattccat	0.000													123	10	---	---	---	---	
THAP9	79725	broad.mit.edu	37	4	83827290	83827290	+	Intron	DEL	A	-	-	rs67110025		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83827290delA	uc003hnt.2	+						THAP9_uc003hns.1_Intron|THAP9_uc003hnu.1_Intron|THAP9_uc003hnv.2_Intron	NM_024672	NP_078948	Q9H5L6	THAP9_HUMAN	THAP domain containing 9								DNA binding|metal ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5		Hepatocellular(203;0.114)				TGTGTAGTGCAAAAAAAAAAA	0.318													4	3	---	---	---	---	
KIAA1712	80817	broad.mit.edu	37	4	175238739	175238739	+	3'UTR	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175238739delT	uc003itr.2	+	12					KIAA1712_uc010iro.2_Intron|KIAA1712_uc003its.2_RNA	NM_001040157	NP_001035247	Q9C0F1	CEP44_HUMAN	HBV PreS1-transactivated protein 3 isoform a							centrosome|midbody|spindle pole					0		Prostate(90;0.00276)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;4.06e-18)|Epithelial(43;1.18e-15)|OV - Ovarian serous cystadenocarcinoma(60;4.65e-09)|GBM - Glioblastoma multiforme(59;0.00098)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0949)		CTTGTGTCACTTTTTTTTTTT	0.299													4	2	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70820367	70820368	+	Intron	INS	-	AAT	AAT	rs146090263	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70820367_70820368insAAT	uc003kbp.1	+						BDP1_uc003kbo.2_Intron|BDP1_uc003kbq.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AGTGTAACAACGAGAGAAATCT	0.327													2	4	---	---	---	---	
GRIA1	2890	broad.mit.edu	37	5	152870805	152870806	+	Intron	INS	-	A	A	rs147526010	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152870805_152870806insA	uc003lva.3	+						GRIA1_uc003luy.3_Intron|GRIA1_uc003luz.3_Intron|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Intron|GRIA1_uc011dcx.1_5'Flank|GRIA1_uc011dcy.1_5'Flank|GRIA1_uc011dcz.1_5'Flank|GRIA1_uc010jia.1_Intron	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CGCTTTGGAGGAAAAAAAAAAT	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177398373	177398396	+	IGR	DEL	AGGACGAAGAGCTGGAGAGCGCCA	-	-	rs145131557		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177398373_177398396delAGGACGAAGAGCTGGAGAGCGCCA								LOC728554 (87106 upstream) : PROP1 (20840 downstream)																							GTCCCCGGGGAGGACGAAGAGCTGGAGAGCGCCAAGGACGACGA	0.531													5	3	---	---	---	---	
HLA-C	3107	broad.mit.edu	37	6	31237526	31237527	+	Intron	INS	-	A	A	rs150596066	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31237526_31237527insA	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_Intron|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						ATGCTGGAATCAGGACCCCAAC	0.515													4	5	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32497712	32497713	+	Intron	INS	-	A	A	rs146725750	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32497712_32497713insA	uc003obj.2	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						GCCCCTTACACAGTCTCATGGA	0.411													6	8	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51923569	51923570	+	Intron	INS	-	TCTA	TCTA	rs144129939	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51923569_51923570insTCTA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTCTCCAGCTCtctatctatct	0.327													6	4	---	---	---	---	
GCM1	8521	broad.mit.edu	37	6	52992826	52992827	+	3'UTR	INS	-	AAAAAAAA	AAAAAAAA	rs71726666		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52992826_52992827insAAAAAAAA	uc003pbp.2	-	6						NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a							transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					gactctgtctcaaaaaaaaaaa	0.084													5	3	---	---	---	---	
AIM1	202	broad.mit.edu	37	6	106966842	106966843	+	Intron	DEL	AT	-	-	rs9486376	byFrequency	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106966842_106966843delAT	uc003prh.2	+							NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1								sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ttaaaaaCACATGTGTGCGcac	0.109													6	4	---	---	---	---	
TMEM195	392636	broad.mit.edu	37	7	15396816	15396817	+	Intron	DEL	GT	-	-	rs149616228		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15396816_15396817delGT	uc003stb.1	-							NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						ATGAATATTCgtgtgtgtgtgt	0.198													4	2	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44260399	44260400	+	Intron	INS	-	C	C			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44260399_44260400insC	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron|CAMK2B_uc003tkn.2_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						GTCCTGCACAGCCCCCCCCCAG	0.634													4	3	---	---	---	---	
ADCY1	107	broad.mit.edu	37	7	45650357	45650359	+	Intron	DEL	GTA	-	-	rs111882564	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45650357_45650359delGTA	uc003tne.3	+						ADCY1_uc003tnd.2_Intron	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	tgatggaggtgtagaggtgatag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61968770	61968770	+	IGR	DEL	G	-	-	rs61713499		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61968770delG								None (None upstream) : LOC643955 (782902 downstream)																							ttgaaacactgtttttgcgga	0.000													116	7	---	---	---	---	
CCDC146	57639	broad.mit.edu	37	7	76796901	76796901	+	Intron	DEL	A	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76796901delA	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GTTTATTTTTATTATTTTCCA	0.264													9	4	---	---	---	---	
COG5	10466	broad.mit.edu	37	7	106871361	106871361	+	Intron	DEL	A	-	-	rs67589272		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106871361delA	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						TCATGAAAATAAAAAAAAAAC	0.264													4	2	---	---	---	---	
SLC26A4	5172	broad.mit.edu	37	7	107338763	107338764	+	Intron	INS	-	T	T	rs80047783		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107338763_107338764insT	uc003vep.2	+						SLC26A4_uc011kmb.1_Intron|SLC26A4_uc011kmc.1_Intron|SLC26A4_uc011kmd.1_Intron	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin						regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						AGCTGAATGTCttttttttttt	0.213									Pendred_syndrome				9	4	---	---	---	---	
SMARCD3	6604	broad.mit.edu	37	7	150945712	150945713	+	5'UTR	INS	-	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150945712_150945713insT	uc003wjs.2	-	1					SMARCD3_uc003wjt.2_Intron|SMARCD3_uc003wju.2_Intron|SMARCD3_uc011kvh.1_5'UTR|SMARCD3_uc010lqa.1_5'UTR	NM_001003801	NP_001003801	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin						cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		cctTTTCTGCCTTTTTTTTTCC	0.530													58	22	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48647674	48647675	+	Intron	DEL	GT	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48647674_48647675delGT	uc003xqd.2	+						KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron|KIAA0146_uc003xqg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				gtgtgtgtgggtgtgtgtgtgt	0.342													40	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56442726	56442726	+	IGR	DEL	G	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56442726delG								XKR4 (4018 upstream) : TMEM68 (208594 downstream)																							aaggaaggaaggaaggaagga	0.149													5	4	---	---	---	---	
TRIM55	84675	broad.mit.edu	37	8	67062909	67062909	+	Intron	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67062909delT	uc003xvv.2	+						TRIM55_uc003xvu.2_Intron|TRIM55_uc003xvw.2_Intron|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1							cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			ATATGGTGCCttttttttttt	0.189													11	7	---	---	---	---	
C8orf34	116328	broad.mit.edu	37	8	69699867	69699867	+	Intron	DEL	A	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69699867delA	uc010lyz.2	+						C8orf34_uc003xyb.2_Intron	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			CAACTTCTGTAAAAAAAAAAA	0.318													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93591561	93591562	+	IGR	INS	-	TTTC	TTTC	rs34835405		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93591561_93591562insTTTC								RUNX1T1 (483855 upstream) : C8orf83 (304303 downstream)																							ctttctttctttttctttcttt	0.000													5	3	---	---	---	---	
INTS8	55656	broad.mit.edu	37	8	95866386	95866387	+	Intron	INS	-	TGAGCTGAAA	TGAGCTGAAA	rs143503531	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95866386_95866387insTGAGCTGAAA	uc003yhb.2	+						INTS8_uc003yha.1_Intron|INTS8_uc011lgq.1_Intron|INTS8_uc011lgr.1_Intron|INTS8_uc010mba.2_Intron	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8						snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					ggaggttggagttgcatcattg	0.040													5	3	---	---	---	---	
RRM2B	50484	broad.mit.edu	37	8	103231227	103231228	+	Intron	DEL	AT	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103231227_103231228delAT	uc003ykn.2	-						RRM2B_uc003yko.2_Intron|RRM2B_uc010mbv.1_Intron|RRM2B_uc010mbw.1_Intron|RRM2B_uc010mbx.1_Intron|RRM2B_uc010mby.1_Intron	NM_015713	NP_056528	Q7LG56	RIR2B_HUMAN	ribonucleotide reductase M2 B (TP53 inducible)						deoxyribonucleoside diphosphate metabolic process|DNA repair|nucleobase, nucleoside and nucleotide interconversion	nucleoplasm	ribonucleoside-diphosphate reductase activity|transition metal ion binding			ovary(2)	2	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)			AAACATTTGCATATATATATAT	0.351								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					232	7	---	---	---	---	
SLC25A32	81034	broad.mit.edu	37	8	104416833	104416834	+	Intron	INS	-	C	C	rs1865855	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104416833_104416834insC	uc003yll.2	-						SLC25A32_uc011lhr.1_Intron	NM_030780	NP_110407	Q9H2D1	MFTC_HUMAN	solute carrier family 25, member 32						folic acid metabolic process|mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding|folic acid transporter activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	caaaaaaaaaaaccaaaaaCCG	0.134													4	6	---	---	---	---	
ADCK5	203054	broad.mit.edu	37	8	145617535	145617549	+	Splice_Site	DEL	GGGGGTGCAAGGTGA	-	-	rs11270020		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145617535_145617549delGGGGGTGCAAGGTGA	uc003zch.2	+	12	1321	c.1267_splice	c.e12+1	p.D423_splice	ADCK5_uc003zcg.2_Intron|ADCK5_uc003zci.2_Splice_Site_p.D12_splice	NM_174922	NP_777582	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5							integral to membrane	protein serine/threonine kinase activity			stomach(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CAGCCGCACTGGGGGTGCAAGGTGAGGGGGTGCAA	0.660													10	5	---	---	---	---	
RECQL4	9401	broad.mit.edu	37	8	145738593	145738594	+	Intron	DEL	GT	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145738593_145738594delGT	uc003zdj.2	-							NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4						DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GGGGGGGGGGGTGCCAACCTGG	0.703			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				31	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67791249	67791250	+	5'Flank	DEL	AC	-	-	rs74992488		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67791249_67791250delAC	uc004aes.1	+											Homo sapiens cDNA FLJ36039 fis, clone TESTI2017311.																		agaatgggagacacacacacac	0.064													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133834072	133834074	+	IGR	DEL	TGT	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133834072_133834074delTGT								FIBCD1 (19617 upstream) : LAMC3 (50430 downstream)																							tcaccaccactgtcatcaccatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42384710	42384710	+	IGR	DEL	T	-	-	rs151222414		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42384710delT								None (None upstream) : LOC441666 (442605 downstream)																							ttgaacggaatcgaatggaat	0.000													453	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42599763	42599763	+	IGR	DEL	T	-	-	rs141771710		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42599763delT								None (None upstream) : LOC441666 (227552 downstream)																							atcgaatgaattgaatgcaat	0.000													1264	11	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72245160	72245161	+	Intron	DEL	TT	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72245160_72245161delTT	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						AGCAAACttctttttttttttt	0.198													4	2	---	---	---	---	
IFITM2	10581	broad.mit.edu	37	11	308975	308975	+	Intron	DEL	G	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:308975delG	uc001lox.3	+							NM_006435	NP_006426	Q01629	IFM2_HUMAN	interferon induced transmembrane protein 2						response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCTCTCAGCTGGGGGATCCTG	0.652													47	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	18886092	18886092	+	IGR	DEL	A	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18886092delA								PTPN5 (72703 upstream) : MRGPRX1 (69269 downstream)																							CTGGGAACACAAAAAAGATGT	0.308													62	30	---	---	---	---	
PDHX	8050	broad.mit.edu	37	11	34938072	34938074	+	5'UTR	DEL	GGC	-	-	rs112032820		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34938072_34938074delGGC	uc001mvt.2	+	1					PDHX_uc010rep.1_Intron|PDHX_uc010req.1_5'UTR|APIP_uc010reo.1_5'Flank|APIP_uc001mvs.2_5'Flank	NM_003477	NP_003468	O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X						pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	acyltransferase activity			kidney(1)	1	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			TGGGTTGGGGGGCGGGGGTTCAA	0.645													3	3	---	---	---	---	
OTUB1	55611	broad.mit.edu	37	11	63765135	63765136	+	3'UTR	INS	-	C	C	rs148251345	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63765135_63765136insC	uc001nyf.1	+	7					OTUB1_uc001nyg.1_3'UTR|OTUB1_uc010rmz.1_3'UTR|OTUB1_uc010rna.1_3'UTR|OTUB1_uc009ypa.2_3'UTR|OTUB1_uc009ypb.1_3'UTR	NM_017670	NP_060140	Q96FW1	OTUB1_HUMAN	otubain 1						protein K48-linked deubiquitination	cytoplasm	NEDD8-specific protease activity|omega peptidase activity|ubiquitin binding|ubiquitin-specific protease activity			breast(1)	1						CTGTCACATGACCCCCCCCCAT	0.599													8	4	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73077165	73077166	+	Intron	DEL	TG	-	-	rs112101560		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73077165_73077166delTG	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						CTAGGATAGTtgtgtgtgtgtg	0.386													4	2	---	---	---	---	
IFT46	56912	broad.mit.edu	37	11	118428830	118428831	+	Intron	INS	-	AGATA	AGATA	rs144781486	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118428830_118428831insAGATA	uc001ptp.1	-						IFT46_uc001pto.1_Intron|IFT46_uc009zaf.1_Intron	NM_020153	NP_064538	Q9NQC8	IFT46_HUMAN	IFT46						flagellum assembly|intraflagellar transport|protein stabilization	microtubule basal body|microtubule-based flagellum|nucleus	protein C-terminus binding				0						TTATTATACATAAAGTATATTC	0.322													3	3	---	---	---	---	
SLC2A14	144195	broad.mit.edu	37	12	7982150	7982151	+	Intron	INS	-	A	A	rs36068117		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7982150_7982151insA	uc001qtk.2	-						SLC2A14_uc001qtl.2_Intron|SLC2A14_uc001qtm.2_Intron|SLC2A14_uc010sgg.1_Intron|SLC2A14_uc001qtn.2_Intron|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Intron	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		aactccctctcaaaaaaaaaaa	0.109													4	2	---	---	---	---	
LRMP	4033	broad.mit.edu	37	12	25250160	25250163	+	Intron	DEL	AAAA	-	-	rs144702666		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25250160_25250163delAAAA	uc001rgh.2	+						LRMP_uc010sja.1_Intron|LRMP_uc010sjb.1_Intron|LRMP_uc001rgi.2_Intron|LRMP_uc010sjc.1_Intron|LRMP_uc010sjd.1_Intron	NM_006152	NP_006143	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein						vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					aaaaaatgttaaaaaaatataata	0.196													4	3	---	---	---	---	
PLBD2	196463	broad.mit.edu	37	12	113820640	113820641	+	Intron	INS	-	TGTG	TGTG	rs78732050		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113820640_113820641insTGTG	uc001tve.2	+						PLBD2_uc001tvf.2_Intron	NM_173542	NP_775813	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2 isoform 1						lipid catabolic process	lysosomal lumen	hydrolase activity				0						tggtggtTTTTtgtgtgtgtgt	0.104													4	2	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122837542	122837542	+	Intron	DEL	A	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122837542delA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_Intron|CLIP1_uc009zxo.1_Intron|CLIP1_uc010tae.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		ccttatatttaaaaaaaaaaa	0.164													4	2	---	---	---	---	
LRCH1	23143	broad.mit.edu	37	13	47256071	47256072	+	Intron	INS	-	TGTG	TGTG	rs151080336	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47256071_47256072insTGTG	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GGGTCGATCTTtgtgtgtgtgt	0.292													3	4	---	---	---	---	
FBXO34	55030	broad.mit.edu	37	14	55818554	55818555	+	Frame_Shift_Ins	INS	-	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55818554_55818555insT	uc001xbu.2	+	2	1691_1692	c.1446_1447insT	c.(1444-1449)TTGTTTfs	p.L482fs	FBXO34_uc001xbv.2_RNA|FBXO34_uc010aoo.2_Frame_Shift_Ins_p.L482fs	NM_017943	NP_060413	Q9NWN3	FBX34_HUMAN	F-box only protein 34	482_483										ovary(2)|lung(2)|skin(1)	5						CAGGGATGTTGTTTTTTTTGCC	0.441													277	7	---	---	---	---	
RBM25	58517	broad.mit.edu	37	14	73538646	73538647	+	Intron	INS	-	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73538646_73538647insT	uc001xno.2	+						RBM25_uc001xnn.3_Intron|RBM25_uc010ttu.1_Intron|RBM25_uc001xnp.2_Intron	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25						apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		TCATCTGGAAATTTTTTTTTTT	0.233													4	2	---	---	---	---	
TGM5	9333	broad.mit.edu	37	15	43528260	43528262	+	Intron	DEL	TTC	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43528260_43528262delTTC	uc001zrd.1	-						TGM5_uc001zrc.1_Intron|TGM5_uc001zre.1_Intron	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1						epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	accattagcattcttcttcttct	0.069													4	2	---	---	---	---	
ZNF280D	54816	broad.mit.edu	37	15	57138420	57138420	+	Intron	DEL	A	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57138420delA	uc002adw.1	-							NM_001002843	NP_001002843	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		gatacactacaaaaaaaaaat	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13966971	13966973	+	IGR	DEL	TGG	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13966971_13966973delTGG								SHISA9 (632699 upstream) : ERCC4 (47041 downstream)																							gtggtggtgatggtggtggtggt	0.177													4	3	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72163921	72163921	+	Intron	DEL	T	-	-	rs67023960		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72163921delT	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron|PMFBP1_uc010cgo.1_5'Flank	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				aatgtttgtattttttttttt	0.000													3	3	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7578242	7578242	+	Frame_Shift_Del	DEL	C	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578242delC	uc002gim.2	-	6	801	c.607delG	c.(607-609)GTGfs	p.V203fs	TP53_uc002gig.1_Frame_Shift_Del_p.V203fs|TP53_uc002gih.2_Frame_Shift_Del_p.V203fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.V71fs|TP53_uc010cng.1_Frame_Shift_Del_p.V71fs|TP53_uc002gii.1_Frame_Shift_Del_p.V71fs|TP53_uc010cnh.1_Frame_Shift_Del_p.V203fs|TP53_uc010cni.1_Frame_Shift_Del_p.V203fs|TP53_uc002gij.2_Frame_Shift_Del_p.V203fs|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Frame_Shift_Del_p.V110fs|TP53_uc002gio.2_Frame_Shift_Del_p.V71fs|TP53_uc010vug.1_Frame_Shift_Del_p.V164fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	203	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		VE -> LV (in a sporadic cancer; somatic mutation).|V -> A (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|V -> L (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.V203E(6)|p.V203L(3)|p.V203fs*44(3)|p.V203V(3)|p.V203fs*6(2)|p.V203M(2)|p.K164_P219del(1)|p.N200fs*4(1)|p.V203A(1)|p.V203_E204>V*(1)|p.V203_E204>LV(1)|p.G199fs*42(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AAATACTCCACACGCAAATTT	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			13	28	---	---	---	---	
CYTSB	92521	broad.mit.edu	37	17	20059591	20059592	+	Intron	INS	-	C	C	rs147154728	by1000genomes	TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20059591_20059592insC	uc002gwq.2	+						CYTSB_uc010cqx.2_Intron|CYTSB_uc002gwr.2_Intron|CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gwt.2_Intron|CYTSB_uc002gwu.2_Intron	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						CCGCAACCCCACCCCCCCTCCA	0.708													4	2	---	---	---	---	
RDM1	201299	broad.mit.edu	37	17	34247460	34247461	+	Intron	INS	-	T	T			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34247460_34247461insT	uc002hkh.2	-						RDM1_uc010cty.2_Intron|RDM1_uc010ctz.2_Intron|RDM1_uc010cua.2_Intron|RDM1_uc002hkg.3_Intron|RDM1_uc010cub.2_Intron|RDM1_uc010cud.2_Intron|RDM1_uc010cuf.2_Intron|RDM1_uc010cue.2_Intron|RDM1_uc010cug.2_Intron|RDM1_uc010cuc.2_Intron	NM_145654	NP_663629	Q8NG50	RDM1_HUMAN	RAD52 motif 1 isoform 1						DNA recombination|DNA repair	Cajal body|cytoplasm|nucleolus|PML body	DNA binding|nucleotide binding|RNA binding			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		ttctttctttcttttttttttt	0.139								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					4	2	---	---	---	---	
KAT2A	2648	broad.mit.edu	37	17	40270120	40270123	+	Intron	DEL	GAGA	-	-	rs150172215		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40270120_40270123delGAGA	uc002hyx.2	-							NM_021078	NP_066564	Q92830	KAT2A_HUMAN	general control of amino acid synthesis 5-like						chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity			upper_aerodigestive_tract(1)|lung(1)	2						TGAAGCTGAGGAGAGAGAGAGTCA	0.623													10	8	---	---	---	---	
AOC3	8639	broad.mit.edu	37	17	41006869	41006869	+	Intron	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41006869delT	uc002ibv.2	+							NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor						amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	tttcttttccttttttttttt	0.269													4	2	---	---	---	---	
CDC27	996	broad.mit.edu	37	17	45234955	45234956	+	Intron	INS	-	TTA	TTA	rs10636944		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234955_45234956insTTA	uc002ild.3	-						CDC27_uc002ile.3_Intron|CDC27_uc002ilf.3_Intron|CDC27_uc010wkp.1_Intron|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						AAGCTGTAAATGAAAATAAACT	0.282													2	4	---	---	---	---	
GGA3	23163	broad.mit.edu	37	17	73243031	73243032	+	Intron	INS	-	A	A	rs75940499		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73243031_73243032insA	uc002jni.1	-						GGA3_uc002jnj.1_Intron|GGA3_uc010wrw.1_Intron|GGA3_uc002jnk.1_Intron|GGA3_uc010wrx.1_Intron|GGA3_uc010wry.1_Intron|GGA3_uc010wrz.1_Intron	NM_138619	NP_619525	Q9NZ52	GGA3_HUMAN	ADP-ribosylation factor binding protein 3						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|breast(1)	2			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			CAAGGAGACAGAAAAAAAAAAA	0.347													5	3	---	---	---	---	
SFRS2	6427	broad.mit.edu	37	17	74732433	74732456	+	In_Frame_Del	DEL	GACCGAGATCGAGAACGAGTGCGG	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74732433_74732456delGACCGAGATCGAGAACGAGTGCGG	uc002jsv.2	-	2	623_646	c.453_476delCCGCACTCGTTCTCGATCTCGGTC	c.(451-477)TCCCGCACTCGTTCTCGATCTCGGTCG>TCG	p.151_159SRTRSRSRS>S	SFRS2_uc002jsw.1_RNA|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_In_Frame_Del_p.151_159SRTRSRSRS>S|SFRS2_uc010wtg.1_In_Frame_Del_p.139_147SRTRSRSRS>S|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	NM_003016	NP_003007	Q01130	SRSF2_HUMAN	splicing factor, arginine/serine-rich 2	151_159	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity				0						CTTGGAGGTCGACCGAGATCGAGAACGAGTGCGGGACCGAGACT	0.661													231	25	---	---	---	---	
NAPG	8774	broad.mit.edu	37	18	10530665	10530665	+	Intron	DEL	T	-	-	rs71360247		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10530665delT	uc002kon.2	+						NAPG_uc010wzr.1_Intron|NAPG_uc002koo.2_Intron	NM_003826	NP_003817	Q99747	SNAG_HUMAN	N-ethylmaleimide-sensitive factor attachment						cellular membrane fusion|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein complex assembly|protein stabilization	membrane|membrane fraction|mitochondrion	protein binding				0						TGGTTTCTCCTTTTTTTTTTT	0.398													2	4	---	---	---	---	
CLC	1178	broad.mit.edu	37	19	40226832	40226833	+	Intron	INS	-	A	A	rs112910859		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40226832_40226833insA	uc002omh.2	-							NM_001828	NP_001819	Q05315	LPPL_HUMAN	Charcot-Leyden crystal protein						lipid catabolic process|multicellular organismal development		carboxylesterase activity|lysophospholipase activity|sugar binding				0	all_cancers(60;2.99e-06)|all_lung(34;4.7e-08)|Lung NSC(34;5.46e-08)|Ovarian(47;0.06)	Renal(1328;0.000147)|Hepatocellular(1079;0.0202)|Myeloproliferative disorder(2;0.0255)	Epithelial(26;6.43e-25)|OV - Ovarian serous cystadenocarcinoma(5;1.07e-24)|all cancers(26;8.38e-23)	GBM - Glioblastoma multiforme(1328;4.97e-06)|STAD - Stomach adenocarcinoma(1328;0.00655)		ttttaaCCACCAAAAAAAAAAA	0.223													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107414	42107415	+	IGR	DEL	CA	-	-	rs72172011		TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107414_42107415delCA								CEACAM21 (14218 upstream) : CEACAM4 (17929 downstream)																							Gacacgcacgcacgcgcgcgcg	0.183													9	4	---	---	---	---	
PSG6	5675	broad.mit.edu	37	19	43460948	43460948	+	Intron	DEL	A	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43460948delA	uc002ovh.1	-						PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				GCTGTCATGGAAAAAAAAAGA	0.323													5	4	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49964436	49964437	+	Intron	INS	-	G	G			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49964436_49964437insG	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		gaggaggggctggggtctggat	0.000													4	2	---	---	---	---	
CABLES2	81928	broad.mit.edu	37	20	60973182	60973187	+	Intron	DEL	TATGAC	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60973182_60973187delTATGAC	uc002ycv.2	-							NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			tggtggtggttatgacggtggtgatg	0.000													4	2	---	---	---	---	
ITSN1	6453	broad.mit.edu	37	21	35195922	35195922	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35195922delT	uc002yta.1	+	25	3416	c.3148delT	c.(3148-3150)TTCfs	p.F1050fs	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_Intron|ITSN1_uc002ysz.2_Intron|ITSN1_uc010gmg.2_Intron|ITSN1_uc010gmh.2_Intron|ITSN1_uc002ysw.2_Frame_Shift_Del_p.F1050fs|ITSN1_uc010gmi.2_Frame_Shift_Del_p.F1013fs|ITSN1_uc010gmj.2_Frame_Shift_Del_p.F929fs|ITSN1_uc002ysy.2_Frame_Shift_Del_p.F1045fs|ITSN1_uc002ysx.2_Frame_Shift_Del_p.F1008fs|ITSN1_uc002ytb.1_Frame_Shift_Del_p.F1045fs|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Intron|ITSN1_uc010gml.2_Intron|ITSN1_uc002ytj.2_Frame_Shift_Del_p.F1045fs|ITSN1_uc010gmm.1_Intron|ITSN1_uc002yte.2_Intron|ITSN1_uc002ytg.1_Intron	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	1050	SH3 3.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						GGCCGGAGTCTTCCCTTCTAA	0.473													115	71	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	38437653	38437653	+	IGR	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38437653delT								DSCR6 (45697 upstream) : PIGP (11 downstream)																							CTGACATTGATTTTTTTTTTT	0.323													4	2	---	---	---	---	
RRP1	8568	broad.mit.edu	37	21	45209622	45209636	+	In_Frame_Del	DEL	GCCAGGACTCAGCGG	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45209622_45209636delGCCAGGACTCAGCGG	uc002zds.2	+	1	205_219	c.112_126delGCCAGGACTCAGCGG	c.(112-126)GCCAGGACTCAGCGGdel	p.ARTQR38del	RRP1_uc011aez.1_In_Frame_Del_p.ARTQR38del|RRP1_uc010gpk.1_5'UTR	NM_003683	NP_003674	P56182	RRP1_HUMAN	ribosomal RNA processing 1 homolog	38_42					rRNA processing	nucleolus|preribosome, small subunit precursor					0				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		ATACATCGTCGCCAGGACTCAGCGGGCCGCAGGTT	0.749													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16920274	16920275	+	IGR	DEL	AT	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16920274_16920275delAT								OR11H1 (470470 upstream) : CCT8L2 (151373 downstream)																							TTATAGTGACATGTATGAAAAC	0.267													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	83996004	83996004	+	IGR	DEL	T	-	-			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83996004delT								HDX (238546 upstream) : UBE2DNL (193153 downstream)																							ggccagtatgttttttttttt	0.000													4	2	---	---	---	---	
COL4A6	1288	broad.mit.edu	37	X	107415595	107415596	+	Intron	INS	-	A	A			TCGA-EJ-5525-01	TCGA-EJ-5525-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107415595_107415596insA	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						gcctaaaaaagaaaaaaaaaaa	0.144									Alport_syndrome_with_Diffuse_Leiomyomatosis				28	8	---	---	---	---	
