Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF8	391002	broad.mit.edu	37	1	12979764	12979764	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12979764G>A	uc001aup.2	+	4	1039	c.956G>A	c.(955-957)CGT>CAT	p.R319H		NM_001012276	NP_001012276	Q5VWM4	PRAM8_HUMAN	PRAME family member 8	319	LRR 1.										0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCGAGCATCCGTCAATTAAAG	0.587													18	213	---	---	---	---	PASS
FBLIM1	54751	broad.mit.edu	37	1	16091554	16091554	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16091554G>C	uc001axd.1	+	4	519	c.76G>C	c.(76-78)GTG>CTG	p.V26L	FBLIM1_uc001axe.1_Missense_Mutation_p.V26L|FBLIM1_uc001axf.2_RNA|FBLIM1_uc001axg.1_Missense_Mutation_p.V26L|FBLIM1_uc001axh.1_Missense_Mutation_p.V26L|FBLIM1_uc001axi.1_Missense_Mutation_p.V26L	NM_017556	NP_060026	Q8WUP2	FBLI1_HUMAN	filamin-binding LIM protein-1 isoform a	26	Filamin-binding.				cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		CGATGTGGCCGTGGCGGAGGA	0.672													36	103	---	---	---	---	PASS
ZMYND12	84217	broad.mit.edu	37	1	42898890	42898890	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42898890T>G	uc001chj.2	-	7	1169	c.899A>C	c.(898-900)GAC>GCC	p.D300A	ZMYND12_uc010ojt.1_Missense_Mutation_p.D190A	NM_032257	NP_115633	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12 isoform 1	300						intracellular	zinc ion binding			ovary(1)	1	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGGGGCTTTGTCAGATGTAGA	0.408													33	452	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145209116	145209116	+	5'UTR	SNP	T	C	C	rs114878133	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145209116T>C	uc001emp.3	+	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_5'UTR|NOTCH2NL_uc001emm.3_5'UTR|NOTCH2NL_uc001emo.2_5'UTR|NOTCH2NL_uc010oyh.1_RNA	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ACGAGGCTGCTTCGCTGCACA	0.736													2	4	---	---	---	---	PASS
MCL1	4170	broad.mit.edu	37	1	150551355	150551355	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150551355C>T	uc001euz.2	-	1	782	c.652G>A	c.(652-654)GAT>AAT	p.D218N	MCL1_uc010pch.1_Missense_Mutation_p.D108N|MCL1_uc001eva.2_Missense_Mutation_p.D218N	NM_021960	NP_068779	Q07820	MCL1_HUMAN	myeloid cell leukemia sequence 1 isoform 1	218	BH3.				anti-apoptosis|apoptosis|cell fate determination|cellular homeostasis|multicellular organismal development|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nucleoplasm	BH3 domain binding|protein binding|protein channel activity|protein heterodimerization activity				0	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TGCACGCCATCCCCAACCCGT	0.622													34	92	---	---	---	---	PASS
SELENBP1	8991	broad.mit.edu	37	1	151341656	151341656	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151341656G>A	uc001exx.2	-	4	231	c.184C>T	c.(184-186)CGG>TGG	p.R62W	SELENBP1_uc010pcy.1_Missense_Mutation_p.R104W|SELENBP1_uc001exy.2_5'UTR|SELENBP1_uc001exz.2_5'UTR|SELENBP1_uc010pcz.1_Intron|SELENBP1_uc009wms.2_5'UTR|SELENBP1_uc009wmt.2_5'UTR|SELENBP1_uc001eya.2_5'UTR|SELENBP1_uc009wmu.2_5'UTR	NM_003944	NP_003935	Q13228	SBP1_HUMAN	selenium binding protein 1	62					protein transport	cytosol|membrane|nucleolus	protein binding|selenium binding				0	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ATGGGCAGCCGGTGGATGACC	0.453													4	115	---	---	---	---	PASS
UFC1	51506	broad.mit.edu	37	1	161128288	161128288	+	3'UTR	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161128288C>A	uc001fyd.3	+	6					USP21_uc010pkc.1_5'Flank|USP21_uc010pkd.1_5'Flank|USP21_uc010pke.1_5'Flank|USP21_uc010pkf.1_5'Flank	NM_016406	NP_057490	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1						protein ufmylation		protein binding|UFM1 conjugating enzyme activity				0	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			AATGAAGAATCAAGCCACTGA	0.493													6	16	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220364491	220364491	+	Missense_Mutation	SNP	G	A	A	rs151225064		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220364491G>A	uc010puk.1	-	14	1570	c.1406C>T	c.(1405-1407)GCG>GTG	p.A469V	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Missense_Mutation_p.A49V	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	469					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		CCTTCTTGGCGCATAGATCAC	0.493													5	234	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89417050	89417050	+	RNA	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89417050C>A	uc010ytr.1	-	42		c.4552G>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		ACTTGCCCGGCAAGTGATGGT	0.498													66	255	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98853086	98853086	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98853086G>A	uc002syo.2	+	19	2830	c.2566G>A	c.(2566-2568)GCC>ACC	p.A856T	VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Missense_Mutation_p.A375T|VWA3B_uc002sym.2_Missense_Mutation_p.A856T|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.A513T|VWA3B_uc002syp.1_Missense_Mutation_p.A248T|VWA3B_uc002syq.1_Missense_Mutation_p.A132T|VWA3B_uc002syr.1_Missense_Mutation_p.A173T|VWA3B_uc010fih.1_RNA	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	856										ovary(3)|large_intestine(2)|skin(1)	6						TGGCTTGGTCGCCAAGAAACT	0.478													4	108	---	---	---	---	PASS
CCDC74A	90557	broad.mit.edu	37	2	132290465	132290465	+	Missense_Mutation	SNP	G	T	T	rs149945224		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132290465G>T	uc002tta.2	+	6	957	c.905G>T	c.(904-906)GGG>GTG	p.G302V	CCDC74A_uc002ttb.2_Missense_Mutation_p.G236V	NM_138770	NP_620125	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	302										skin(1)	1						CTCCTGGAAGGGAGCCAGAGG	0.692													11	110	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1445163	1445163	+	3'UTR	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1445163T>C	uc003boz.2	+	23					CNTN6_uc011asj.1_3'UTR|CNTN6_uc003bpa.2_3'UTR	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		ATATATGCTCTCCAGCCTCTG	0.289													6	12	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49695304	49695304	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49695304C>A	uc003cxe.3	+	5	8429	c.8315C>A	c.(8314-8316)GCC>GAC	p.A2772D		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	2772					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GGGTACCAGGCCCACCTGCCT	0.617													8	132	---	---	---	---	PASS
SDHAP2	727956	broad.mit.edu	37	3	195410640	195410640	+	Silent	SNP	T	C	C	rs6583273	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195410640T>C	uc003fuw.2	+	13	1731	c.537T>C	c.(535-537)TAT>TAC	p.Y179Y	SDHAP2_uc003fuv.2_RNA					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						TTGATGAGTATGATCACTCCA	0.468													3	13	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126337635	126337635	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126337635C>G	uc003ifj.3	+	6	6876	c.6876C>G	c.(6874-6876)AAC>AAG	p.N2292K	FAT4_uc011cgp.1_Missense_Mutation_p.N590K	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2292	Extracellular (Potential).|Cadherin 22.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GAGGATCTAACAGCAAACTCT	0.413													118	391	---	---	---	---	PASS
FGG	2266	broad.mit.edu	37	4	155532986	155532986	+	Silent	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155532986T>C	uc003ioj.2	-	4	513	c.372A>G	c.(370-372)GCA>GCG	p.A124A	FGG_uc003iog.2_Silent_p.A124A|FGG_uc003ioh.2_Silent_p.A124A|FGG_uc010ipx.2_5'UTR|FGG_uc010ipy.2_Intron|FGG_uc003ioi.2_5'Flank|FGG_uc003iok.2_Silent_p.A124A	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	124					platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TTAAAATCGATGCTTCATATT	0.299													28	66	---	---	---	---	PASS
MLF1IP	79682	broad.mit.edu	37	4	185615532	185615532	+	3'UTR	SNP	A	T	T	rs6825561	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185615532A>T	uc003iwq.2	-	13					CCDC111_uc003iwk.2_Intron|CCDC111_uc003iwj.2_Intron|CCDC111_uc003iwl.2_Intron|CCDC111_uc003iwm.2_Intron|CCDC111_uc003iwn.2_Intron|MLF1IP_uc003iwp.2_RNA	NM_024629	NP_078905	Q71F23	CENPU_HUMAN	MLF1 interacting protein						CenH3-containing nucleosome assembly at centromere|interspecies interaction between organisms|mitotic prometaphase|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|condensed chromosome kinetochore|cytosol|nucleoplasm					0		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		acggtgaGATATCGGAGACAG	0.179													4	1	---	---	---	---	PASS
ERCC8	1161	broad.mit.edu	37	5	60188403	60188403	+	Intron	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60188403C>T	uc003jsm.3	-						ERCC8_uc003jsk.2_RNA|ERCC8_uc003jsl.3_Intron|ERCC8_uc011cqp.1_Intron	NM_000082	NP_000073	Q13216	ERCC8_HUMAN	excision repair cross-complementing rodent						positive regulation of DNA repair|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein polyubiquitination|response to oxidative stress|response to UV|response to UV|transcription-coupled nucleotide-excision repair	Cul4A-RING ubiquitin ligase complex|nuclear matrix|nucleoplasm|nucleotide-excision repair complex|soluble fraction	protein binding|protein complex binding				0		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				TGGGCCACTGCTGTCAGAAAG	0.522								Direct_reversal_of_damage|NER					4	17	---	---	---	---	PASS
ARRDC3	57561	broad.mit.edu	37	5	90670036	90670036	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90670036C>T	uc003kjz.2	-	6	1168	c.928G>A	c.(928-930)GGT>AGT	p.G310S		NM_020801	NP_065852	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	310					signal transduction	cytoplasm	protein binding			ovary(1)|breast(1)	2		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		GGAATGGTACCGATGACAAGT	0.378													5	285	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140168403	140168403	+	Intron	SNP	A	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140168403A>T	uc003lhb.2	+						PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_3'UTR	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor						homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATTGAATGTAGATATCCTAT	0.284													3	8	---	---	---	---	PASS
PCDHA3	56145	broad.mit.edu	37	5	140183011	140183011	+	Silent	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140183011C>T	uc003lhf.2	+	1	2229	c.2229C>T	c.(2227-2229)AGC>AGT	p.S743S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.S743S	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	743	Cytoplasmic (Potential).|6 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGCTCCAGCGCGGTGGGGA	0.637													5	288	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140215137	140215137	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140215137C>T	uc003lhq.2	+	1	1169	c.1169C>T	c.(1168-1170)ACG>ATG	p.T390M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.T390M	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	390	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCCCTGACGCCCCGCGTT	0.542													6	293	---	---	---	---	PASS
PCDHA13	56136	broad.mit.edu	37	5	140263465	140263465	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140263465C>T	uc003lif.2	+	1	1612	c.1612C>T	c.(1612-1614)CGC>TGC	p.R538C	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.R538C|PCDHA13_uc003lid.2_Missense_Mutation_p.R538C	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	538	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGAGCGCGCGCGACTCTGG	0.682													5	167	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169483749	169483749	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169483749G>A	uc003maf.2	+	43	4437	c.4357G>A	c.(4357-4359)GTA>ATA	p.V1453I	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.V945I|DOCK2_uc003mah.2_5'UTR	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1453	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGGGGGACCGTAGACCCAGA	0.557													18	50	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66548462	66548462	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66548462C>A	uc003tvn.2	+	11	1469	c.1320C>A	c.(1318-1320)GAC>GAA	p.D440E	TYW1_uc010lai.2_RNA|TYW1_uc011kef.1_Missense_Mutation_p.D54E	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	440					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				GGAAGATGGACCAGCCTGAAA	0.443													5	151	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100680060	100680060	+	Missense_Mutation	SNP	C	T	T	rs145956810	byFrequency	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100680060C>T	uc003uxp.1	+	3	5416	c.5363C>T	c.(5362-5364)TCG>TTG	p.S1788L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1788	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|28.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGCCACTTCGTCTCCTACA	0.537													8	506	---	---	---	---	PASS
ACTR3B	57180	broad.mit.edu	37	7	152513619	152513619	+	Silent	SNP	G	A	A	rs139462098	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152513619G>A	uc003wle.1	+	6	603	c.486G>A	c.(484-486)ACG>ACA	p.T162T	ACTR3B_uc003wlf.1_Silent_p.T162T|ACTR3B_uc003wlg.1_Silent_p.T74T|ACTR3B_uc011kvp.1_Silent_p.T74T	NM_020445	NP_065178	Q9P1U1	ARP3B_HUMAN	actin-related protein 3-beta isoform 1	162					regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		GTGAACGTACGTTAACGGGGA	0.473													3	40	---	---	---	---	PASS
LOXL2	4017	broad.mit.edu	37	8	23191091	23191091	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23191091C>T	uc003xdh.1	-	5	1128	c.789G>A	c.(787-789)ATG>ATA	p.M263I	uc003xdj.2_5'Flank|uc003xdi.2_5'Flank	NM_002318	NP_002309	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2 precursor	263	SRCR 2.				aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CGGTGCAGTCCATGGAGAATG	0.612													24	61	---	---	---	---	PASS
EXTL3	2137	broad.mit.edu	37	8	28575417	28575417	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28575417T>C	uc003xgz.1	+	3	2434	c.1841T>C	c.(1840-1842)TTC>TCC	p.F614S		NM_001440	NP_001431	O43909	EXTL3_HUMAN	exostoses-like 3	614	Lumenal (Potential).					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding			skin(2)	2		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TTCCATCTTTTCCCCCACACT	0.577													18	192	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62491848	62491848	+	Intron	SNP	A	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62491848A>C	uc011leg.1	-						ASPH_uc003xuj.2_Intron|ASPH_uc003xuo.2_Intron|uc003xuk.2_Missense_Mutation_p.E298A	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TCCGAGCTGGAGGCTGCCCTG	0.632													11	53	---	---	---	---	PASS
PDP1	54704	broad.mit.edu	37	8	94929378	94929378	+	Intron	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94929378G>A	uc003yge.2	+						PDP1_uc003ygf.2_Intron|PDP1_uc010max.2_5'UTR|PDP1_uc011lgm.1_5'UTR|PDP1_uc011lgn.1_5'Flank	NM_018444	NP_060914	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic						pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						GTTGTGAGGGGGCGCCGGGCG	0.736													9	24	---	---	---	---	PASS
DMRT2	10655	broad.mit.edu	37	9	1053761	1053761	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1053761C>T	uc003zha.2	+	3	765	c.565C>T	c.(565-567)CGC>TGC	p.R189C	DMRT2_uc003zgx.3_5'UTR|DMRT2_uc010mgz.2_5'UTR|DMRT2_uc003zgy.3_Missense_Mutation_p.R33C|DMRT2_uc003zhb.3_Missense_Mutation_p.R189C|DMRT2_uc011llt.1_Missense_Mutation_p.R189C|DMRT2_uc011llu.1_Missense_Mutation_p.R189C|DMRT2_uc011llv.1_Missense_Mutation_p.R189C	NM_181872	NP_870987	Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor	189					male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		TAATTTCGAGCGCAAAGCTGT	0.448													14	158	---	---	---	---	PASS
C9orf84	158401	broad.mit.edu	37	9	114448911	114448911	+	3'UTR	SNP	G	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114448911G>T	uc004bfr.2	-	26					C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfq.2_3'UTR|C9orf84_uc010mug.2_3'UTR	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1											ovary(2)	2						TACATATTATGAATATTTAAT	0.274													3	19	---	---	---	---	PASS
EXD3	54932	broad.mit.edu	37	9	140243660	140243660	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140243660C>G	uc004cmp.2	-	16	1928	c.1732G>C	c.(1732-1734)GAC>CAC	p.D578H	C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Missense_Mutation_p.D258H|EXD3_uc004cmq.1_RNA	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3	578					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CCAGCCAGGTCCTCCGACAGG	0.701													5	17	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141070695	141070695	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141070695G>A	uc004com.2	+	4	359	c.98G>A	c.(97-99)CGC>CAC	p.R33H	TUBBP5_uc010ncq.2_Silent_p.T210T					RecName: Full=Putative tubulin beta-4q chain;												0						GCCAAGGGACGCTACACCGAA	0.592													4	13	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27329050	27329050	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27329050T>C	uc001ith.2	-	21	2388	c.2216A>G	c.(2215-2217)GAA>GGA	p.E739G	ANKRD26_uc001itg.2_Missense_Mutation_p.E426G|ANKRD26_uc009xku.1_Missense_Mutation_p.E740G	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	739						centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TTTTTTAAGTTCTAATAATCT	0.294													7	102	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832122	42832122	+	RNA	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832122C>T	uc010qey.1	-	3		c.1853G>A				NR_024380				Homo sapiens noncoding mRNA sequence.												0						CAGTAAAAGGCTTTGCCACAT	0.348													5	14	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832147	42832147	+	RNA	SNP	G	T	T	rs144592176	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832147G>T	uc010qey.1	-	3		c.1828C>A				NR_024380				Homo sapiens noncoding mRNA sequence.												0						CACAATTGTAGGGTTTCTCTC	0.353													5	19	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50666944	50666944	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50666944G>A	uc001jhs.3	-	21	4553	c.4399C>T	c.(4399-4401)CGA>TGA	p.R1467*	ERCC6_uc009xod.2_Nonsense_Mutation_p.R627*|ERCC6_uc010qgr.1_Nonsense_Mutation_p.R837*|ERCC6_uc001jhr.3_Nonsense_Mutation_p.R835*	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	1467					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						AATAGTTCTCGGAAGACACAA	0.458								Direct_reversal_of_damage|NER					6	287	---	---	---	---	PASS
LRIT2	340745	broad.mit.edu	37	10	85985269	85985269	+	Missense_Mutation	SNP	G	A	A	rs79267836		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85985269G>A	uc001kcy.2	-	1	16	c.8C>T	c.(7-9)TCA>TTA	p.S3L	LRIT2_uc010qmc.1_Missense_Mutation_p.S3L	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	3						integral to membrane				ovary(2)	2						ATGAAAAACTGAAGCCATATT	0.428													6	13	---	---	---	---	PASS
STAMBPL1	57559	broad.mit.edu	37	10	90699527	90699527	+	Intron	SNP	T	G	G			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90699527T>G	uc010qmx.1	+						ACTA2_uc001kfp.2_Intron|ACTA2_uc010qmy.1_Intron|ACTA2_uc001kfq.2_Intron|uc001kfo.1_RNA	NM_020799	NP_065850	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1								metal ion binding|metallopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		CCTGCCCTACTGCAGTCTCTC	0.468													5	15	---	---	---	---	PASS
RPP30	10556	broad.mit.edu	37	10	92654856	92654856	+	Intron	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92654856G>A	uc009xtx.2	+						RPP30_uc001khd.2_Intron|RPP30_uc010qnj.1_3'UTR	NM_006413	NP_006404	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit isoform b						tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity				0						AGATGTGTTGGAAGCCATATC	0.333													6	9	---	---	---	---	PASS
SEC23IP	11196	broad.mit.edu	37	10	121685636	121685636	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121685636C>T	uc001leu.1	+	13	2282	c.2210C>T	c.(2209-2211)TCC>TTC	p.S737F	SEC23IP_uc010qtc.1_Missense_Mutation_p.S526F|SEC23IP_uc009xzk.1_RNA	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	737					Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		GACATGGCTTCCCTCCCCTCA	0.468													11	67	---	---	---	---	PASS
PRG3	10394	broad.mit.edu	37	11	57147239	57147239	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57147239C>T	uc001njv.1	-	3	213	c.103G>A	c.(103-105)GAC>AAC	p.D35N		NM_006093	NP_006084	Q9Y2Y8	PRG3_HUMAN	proteoglycan 3 precursor	35					basophil activation|histamine biosynthetic process|immune response|leukotriene biosynthetic process|negative regulation of translation|neutrophil activation|positive regulation of interleukin-8 biosynthetic process|superoxide anion generation		sugar binding				0						TGGCCTAGGTCTGCCTGTGTC	0.557													45	115	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58979394	58979394	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58979394G>T	uc001nnu.3	-	1	1101	c.945C>A	c.(943-945)AAC>AAA	p.N315K		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	315	MACPF.|Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				GCATGTTGGGGTTGATGAAGA	0.552													17	74	---	---	---	---	PASS
DAGLA	747	broad.mit.edu	37	11	61505663	61505663	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61505663G>A	uc001nsa.2	+	16	1751	c.1640G>A	c.(1639-1641)CGA>CAA	p.R547Q		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	547	Cytoplasmic (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		GTCCTGCAGCGAAGCACCAAG	0.637													4	45	---	---	---	---	PASS
PGM2L1	283209	broad.mit.edu	37	11	74053512	74053512	+	Silent	SNP	C	T	T	rs151007979		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74053512C>T	uc001ovb.1	-	12	1922	c.1626G>A	c.(1624-1626)AAG>AAA	p.K542K		NM_173582	NP_775853	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	542					glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity			ovary(1)	1	Breast(11;3.32e-06)					TTACTGATTTCTTATTAGGCT	0.353													13	163	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108464363	108464363	+	5'UTR	SNP	A	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108464363A>C	uc001pkk.2	-	1						NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a						intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		ACTTGATCCCACAGCCAATAA	0.438													13	30	---	---	---	---	PASS
BTG4	54766	broad.mit.edu	37	11	111384094	111384094	+	5'Flank	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111384094C>A	uc001plj.2	-						BTG4_uc001plk.2_5'Flank|uc001pll.2_RNA|MIR34C_hsa-mir-34c|MI0000743_5'Flank|C11orf88_uc009yyd.2_5'Flank|C11orf88_uc001pln.3_5'Flank|C11orf88_uc001plo.1_5'Flank	NM_017589	NP_060059	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4						cell cycle arrest|negative regulation of cell proliferation|neuron differentiation						0		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		TGAGCTCCAACTCAACCAATG	0.428													3	66	---	---	---	---	PASS
SIDT2	51092	broad.mit.edu	37	11	117066583	117066583	+	Silent	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117066583C>T	uc001pqh.1	+	25	2429	c.2388C>T	c.(2386-2388)CAC>CAT	p.H796H	SIDT2_uc010rxe.1_Silent_p.H796H|SIDT2_uc001pqg.2_Silent_p.H817H|SIDT2_uc001pqi.1_Silent_p.H793H|SIDT2_uc001pqj.1_Silent_p.H108H|uc001pqk.1_RNA	NM_001040455	NP_001035545	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2 precursor	796	Cytoplasmic (Potential).					integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TTGACGACCACGACATCTGGC	0.602													6	466	---	---	---	---	PASS
KRT5	3852	broad.mit.edu	37	12	52908651	52908651	+	3'UTR	SNP	G	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52908651G>T	uc001san.2	-	9						NM_000424	NP_000415	P13647	K2C5_HUMAN	keratin 5						epidermis development|hemidesmosome assembly	cytosol|keratin filament	protein binding|structural constituent of cytoskeleton				0				BRCA - Breast invasive adenocarcinoma(357;0.189)		AACATGGCTTGAGCAACTGCC	0.527													7	32	---	---	---	---	PASS
NACA	4666	broad.mit.edu	37	12	57112065	57112065	+	Intron	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57112065T>C	uc001slz.2	-						NACA_uc001sly.2_Intron|NACA_uc009zoy.1_Silent_p.P1083P|NACA_uc001smc.2_Intron|NACA_uc001sma.2_Intron|NACA_uc001smb.2_Intron|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha						interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						GAGTCGCAGCTGGGGGAGTGG	0.672			T	BCL6	NHL								34	73	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19415644	19415644	+	RNA	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19415644C>A	uc010tcj.1	-	1		c.30466G>T				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						aaaaaaaaaacccaaacaaaa	0.169													3	65	---	---	---	---	PASS
ATP11A	23250	broad.mit.edu	37	13	113536465	113536465	+	3'UTR	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113536465G>A	uc001vsi.3	+	30					ATP11A_uc001vsj.3_3'UTR|ATP11A_uc010ago.2_RNA	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CCTTGCCCTCGAGCATGGCAC	0.637													15	35	---	---	---	---	PASS
CMA1	1215	broad.mit.edu	37	14	24976626	24976626	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24976626T>C	uc001wpp.1	-	2	175	c.145A>G	c.(145-147)AAA>GAA	p.K49E	CMA1_uc010alx.1_Intron	NM_001836	NP_001827	P23946	CMA1_HUMAN	chymase 1, mast cell preproprotein	49	Peptidase S1.				interleukin-1 beta biosynthetic process|proteolysis	extracellular region	serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.0271)		CCACAAAATTTTGAGGGACCG	0.502													94	274	---	---	---	---	PASS
BMP4	652	broad.mit.edu	37	14	54416937	54416937	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54416937T>C	uc001xal.3	-	3	1227	c.1040A>G	c.(1039-1041)GAC>GGC	p.D347G	BMP4_uc010aoh.2_Missense_Mutation_p.D347G|BMP4_uc001xao.3_Missense_Mutation_p.D347G|BMP4_uc001xan.3_Missense_Mutation_p.D347G	NM_130851	NP_570912	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein	347					activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0						GTTGAGGTGGTCAGCCAGTGG	0.552													9	91	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71543125	71543125	+	Silent	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71543125C>A	uc001xmo.2	+	28	5772	c.5326C>A	c.(5326-5328)CGA>AGA	p.R1776R	PCNX_uc010are.1_Silent_p.R1665R|PCNX_uc010arf.1_Silent_p.R564R	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1776						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CTGCTCTTCCCGAAGAGCAAA	0.393													3	94	---	---	---	---	PASS
PTPN21	11099	broad.mit.edu	37	14	88983485	88983485	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88983485C>T	uc001xwv.3	-	3	632	c.301G>A	c.(301-303)GTG>ATG	p.V101M	PTPN21_uc010twc.1_Translation_Start_Site|PTPN21_uc010atf.1_Missense_Mutation_p.V101M	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type	101	FERM.					cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						TAAAACACCACTCCAAAATAG	0.413													45	117	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107083662	107083662	+	RNA	SNP	A	G	G	rs56139643	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107083662A>G	uc010tyt.1	-	112		c.5212T>C								Parts of antibodies, mostly variable regions.												0						CCACCAGGAGAAGGAAGAACC	0.507													3	79	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23932103	23932103	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23932103G>T	uc001ywk.2	-	1	348	c.262C>A	c.(262-264)CCG>ACG	p.P88T		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	88					negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GCCGGGCCCGGCTGGGCCGCG	0.726									Prader-Willi_syndrome				7	36	---	---	---	---	PASS
ZFYVE19	84936	broad.mit.edu	37	15	41099720	41099720	+	5'UTR	SNP	G	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41099720G>T	uc001zmt.1	+	1					DNAJC17_uc001zms.1_5'Flank|DNAJC17_uc010bbz.1_5'Flank|DNAJC17_uc010bca.1_5'Flank|DNAJC17_uc010bcb.1_5'Flank|ZFYVE19_uc001zmu.1_5'UTR|ZFYVE19_uc001zmv.1_5'UTR|ZFYVE19_uc001zmw.1_5'Flank|ZFYVE19_uc001zmx.1_5'Flank|ZFYVE19_uc010bcc.1_5'Flank	NM_001077268	NP_001070736	Q96K21	ZFY19_HUMAN	zinc finger, FYVE domain containing 19								zinc ion binding				0		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TCCGAGCGGCGCCTAGCCCTC	0.607													7	43	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48788323	48788323	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48788323T>C	uc001zwx.1	-	20	2721	c.2393A>G	c.(2392-2394)TAC>TGC	p.Y798C		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	798	EGF-like 12; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ATCAGGTTTGTAGATAAATCC	0.353													41	110	---	---	---	---	PASS
PDE8A	5151	broad.mit.edu	37	15	85669469	85669469	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85669469C>A	uc002blh.2	+	20	2306	c.2117C>A	c.(2116-2118)ACT>AAT	p.T706N	PDE8A_uc002bli.2_Missense_Mutation_p.T660N|PDE8A_uc010bnc.2_Missense_Mutation_p.T459N|PDE8A_uc010bnd.2_Missense_Mutation_p.T459N|PDE8A_uc002blj.2_Missense_Mutation_p.T326N|PDE8A_uc002blk.2_Missense_Mutation_p.T326N|PDE8A_uc002bll.2_Missense_Mutation_p.T58N	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	706	Catalytic (By similarity).				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			GTGATAAACACTATGCTTAGG	0.458													3	135	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100332853	100332853	+	RNA	SNP	T	G	G			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100332853T>G	uc010urx.1	-	5		c.1339A>C			C15orf51_uc010ury.1_RNA	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						TCCCGGCCACTGCCCTGAAGC	0.607													6	100	---	---	---	---	PASS
NLRC3	197358	broad.mit.edu	37	16	3613171	3613171	+	Silent	SNP	G	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3613171G>A	uc010btn.2	-	5	2178	c.1767C>T	c.(1765-1767)AGC>AGT	p.S589S		NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	589					I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						CCAGGGCCCCGCTCTCCATGG	0.697													4	13	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49672120	49672120	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49672120G>T	uc002efs.2	-	5	1241	c.943C>A	c.(943-945)CAC>AAC	p.H315N	ZNF423_uc010vgn.1_Missense_Mutation_p.H198N	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	315	C2H2-type 7.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				TGGGCTTGGTGGATATGGGCG	0.622													4	112	---	---	---	---	PASS
CES1	1066	broad.mit.edu	37	16	55867013	55867013	+	5'UTR	SNP	T	C	C	rs28429139	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55867013T>C	uc002eim.2	-	1					CES1_uc002eil.2_5'UTR|CES1_uc002ein.2_5'UTR	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor						response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	CTCTGTGCAGTTCAGAGGGAC	0.612													4	57	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2076132	2076132	+	Silent	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2076132C>T	uc002fub.1	-	13	3232	c.3177G>A	c.(3175-3177)TCG>TCA	p.S1059S	SMG6_uc010vqv.1_Silent_p.S151S	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	1059					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						CAGCCAGCGTCGACCATACAT	0.453													13	61	---	---	---	---	PASS
GSDMB	55876	broad.mit.edu	37	17	38062140	38062140	+	Silent	SNP	C	T	T	rs144949338		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38062140C>T	uc010cwj.2	-	8	992	c.987G>A	c.(985-987)GCG>GCA	p.A329A	GSDMB_uc010cwi.2_Silent_p.A76A|GSDMB_uc010cwk.2_RNA|GSDMB_uc010cwl.2_RNA|GSDMB_uc010cwm.2_RNA|GSDMB_uc002htg.2_Silent_p.A307A|GSDMB_uc002hth.2_Silent_p.A316A|GSDMB_uc010wem.1_Silent_p.A320A	NM_001042471	NP_001035936	Q8TAX9	GSDMB_HUMAN	gasdermin B isoform 1	324						cytoplasm				breast(1)|pancreas(1)	2						CTTTTGCACGCGCTTCTACCA	0.567													80	191	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234301	45234301	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234301C>A	uc002ild.3	-	7	947	c.820G>T	c.(820-822)GCT>TCT	p.A274S	CDC27_uc002ile.3_Missense_Mutation_p.A274S|CDC27_uc002ilf.3_Missense_Mutation_p.A274S|CDC27_uc010wkp.1_Missense_Mutation_p.A213S|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	274					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						GGACTAAGAGCTGCTGGTCCT	0.363													5	141	---	---	---	---	PASS
USP32	84669	broad.mit.edu	37	17	58288802	58288802	+	Silent	SNP	A	G	G			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58288802A>G	uc002iyo.1	-	20	2539	c.2253T>C	c.(2251-2253)TGT>TGC	p.C751C	USP32_uc002iyn.1_Silent_p.C421C	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	751					protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			TGTTACTAACACACTGGATGC	0.433													6	213	---	---	---	---	PASS
TBC1D3P2	440452	broad.mit.edu	37	17	60342110	60342110	+	RNA	SNP	T	C	C	rs138946021	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60342110T>C	uc010woz.1	-	14		c.2019A>G				NR_027486				Homo sapiens cDNA FLJ60189 complete cds, highly similar to TBC1 domain family member 3.												0						GTGGTTATCCTTCCATGAGTT	0.328													2	6	---	---	---	---	PASS
TUBB6	84617	broad.mit.edu	37	18	12329786	12329786	+	3'UTR	SNP	A	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12329786A>C	uc002kqy.2	+	4					AFG3L2_uc002kqz.1_Intron			Q9BUF5	TBB6_HUMAN	Homo sapiens cDNA FLJ10433 fis, clone NT2RP1000478, highly similar to Tubulin beta-6 chain.						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0				READ - Rectum adenocarcinoma(1;0.0649)		GAGCAACCTGAAATATGAACA	0.318													5	101	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22804629	22804629	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22804629T>C	uc002kvk.2	-	4	3500	c.3253A>G	c.(3253-3255)ATC>GTC	p.I1085V	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.I1085V|ZNF521_uc002kvl.2_Missense_Mutation_p.I865V	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	1085					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AGGCCATTGATATCAAGTTTC	0.532			T	PAX5	ALL								7	120	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47352677	47352677	+	3'UTR	SNP	A	C	C	rs3208550		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352677A>C	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		AAAAATAATGACATAGTTGTG	0.323													2	4	---	---	---	---	PASS
MLLT1	4298	broad.mit.edu	37	19	6216424	6216424	+	Silent	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6216424C>T	uc002mek.2	-	8	1463	c.1299G>A	c.(1297-1299)AGG>AGA	p.R433R		NM_005934	NP_005925	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	433					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|protein binding			skin(1)	1						ACCTGGAGTCCCTCCCCGGGT	0.711			T	MLL	AL								3	15	---	---	---	---	PASS
MBD3L2	125997	broad.mit.edu	37	19	7051637	7051637	+	3'UTR	SNP	T	G	G	rs117595680	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7051637T>G	uc010dvf.1	+	2						NM_144614	NP_653215	Q8NHZ7	MB3L2_HUMAN	methyl-CpG binding domain protein 3-like 2												0	all_hematologic(4;0.166)			Lung(535;0.179)		TGGATGAAGCTCAGTCTTGGG	0.517													2	4	---	---	---	---	PASS
MBD3L2	125997	broad.mit.edu	37	19	7051643	7051643	+	3'UTR	SNP	T	C	C	rs1651750	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7051643T>C	uc010dvf.1	+	2						NM_144614	NP_653215	Q8NHZ7	MB3L2_HUMAN	methyl-CpG binding domain protein 3-like 2												0	all_hematologic(4;0.166)			Lung(535;0.179)		AAGCTCAGTCTTGGGCTTTCG	0.502													2	3	---	---	---	---	PASS
LOC284441	284441	broad.mit.edu	37	19	20369868	20369868	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20369868G>C	uc002nov.2	+	1	1412	c.661G>C	c.(661-663)GTT>CTT	p.V221L		NR_003128				SubName: Full=cDNA FLJ51655, highly similar to Actin-like protein 2;												0						TGTTGAAGGAGTTGGTGTTGC	0.408													6	93	---	---	---	---	PASS
KCNK6	9424	broad.mit.edu	37	19	38810914	38810914	+	Splice_Site	SNP	T	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38810914T>C	uc002oic.2	+	1	432	c.322_splice	c.e1+2	p.G108_splice		NM_004823	NP_004814	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6							voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)	1	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	CCACCGTGGGTACGTAAGCGC	0.647													3	50	---	---	---	---	PASS
GRIK5	2901	broad.mit.edu	37	19	42569514	42569514	+	Silent	SNP	C	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42569514C>T	uc002osj.1	-	2	140	c.105G>A	c.(103-105)GTG>GTA	p.V35V	GRIK5_uc010eib.1_Translation_Start_Site	NM_002088	NP_002079	Q16478	GRIK5_HUMAN	glutamate receptor KA2 precursor	35	Extracellular (Potential).					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity				0		Prostate(69;0.059)			L-Glutamic Acid(DB00142)	CGCGGCCACACACTGTCTGAT	0.473													4	84	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54726237	54726237	+	Missense_Mutation	SNP	C	G	G	rs138323850	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54726237C>G	uc002qef.1	-	3	379	c.268G>C	c.(268-270)GAG>CAG	p.E90Q	LILRB3_uc002qee.1_Missense_Mutation_p.E90Q|LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	90	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCATGGTGCTCTGTCATGGAT	0.557													4	120	---	---	---	---	PASS
MYT1	4661	broad.mit.edu	37	20	62839353	62839353	+	Silent	SNP	A	G	G			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62839353A>G	uc002yii.2	+	7	1168	c.804A>G	c.(802-804)GAA>GAG	p.E268E	MYT1_uc002yih.2_Intron|MYT1_uc002yij.2_5'UTR	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1	268	Glu-rich.				cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					aggaggaggaagaggaggagg	0.199													3	24	---	---	---	---	PASS
SH3BP1	23616	broad.mit.edu	37	22	38039665	38039665	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38039665C>A	uc003ati.2	+	7	599	c.488C>A	c.(487-489)ACC>AAC	p.T163N	SH3BP1_uc003atg.1_RNA|SH3BP1_uc011anl.1_Missense_Mutation_p.T163N|SH3BP1_uc003ath.1_Missense_Mutation_p.T163N|SH3BP1_uc003atj.1_Missense_Mutation_p.T99N|SH3BP1_uc003atk.1_Missense_Mutation_p.T77N|uc003atl.1_RNA	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	163	BAR.				signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					AGTCAGGCAACCAAGAATTCA	0.587											OREG0026546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	78	---	---	---	---	PASS
SAGE1	55511	broad.mit.edu	37	X	134994389	134994389	+	Intron	SNP	A	G	G			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134994389A>G	uc004ezh.2	+						SAGE1_uc010nry.1_3'UTR|SAGE1_uc011mvv.1_Intron	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1											ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GTAGCCCATGAAAAATGTATA	0.289													3	18	---	---	---	---	PASS
SAGE1	55511	broad.mit.edu	37	X	134994401	134994401	+	Intron	SNP	T	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134994401T>A	uc004ezh.2	+						SAGE1_uc010nry.1_3'UTR|SAGE1_uc011mvv.1_Intron	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1											ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					AAATGTATACTGTGGTAGTGG	0.279													3	19	---	---	---	---	PASS
CPSF3L	54973	broad.mit.edu	37	1	1248676	1248680	+	Intron	DEL	GGGCT	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1248676_1248680delGGGCT	uc001aee.1	-						CPSF3L_uc009vjy.1_Intron|CPSF3L_uc001aef.1_Intron|CPSF3L_uc009vjz.1_Intron|CPSF3L_uc010nyj.1_Intron|CPSF3L_uc001aeg.1_Intron|CPSF3L_uc001aeh.1_Intron|CPSF3L_uc001aei.1_Intron|CPSF3L_uc001aej.1_Intron|CPSF3L_uc001aek.1_Intron	NM_017871	NP_060341	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor							Golgi apparatus|nucleus	hydrolase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		AGACTGTCCAGGGCTGGGCTGGGGC	0.649													4	3	---	---	---	---	
C1orf135	79000	broad.mit.edu	37	1	26186960	26186960	+	5'Flank	DEL	T	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26186960delT	uc001bkw.1	-							NM_024037	NP_076942	Q9H7T9	CA135_HUMAN	aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AATTTTGTAATTTTTTTTTTT	0.274													4	3	---	---	---	---	
DENND2C	163259	broad.mit.edu	37	1	115165735	115165736	+	Intron	INS	-	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115165735_115165736insA	uc001efd.1	-						DENND2C_uc001eez.2_Intron|DENND2C_uc001efc.1_Intron	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C											skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		aaaaataatttaaaaaaatGTT	0.351													78	18	---	---	---	---	
FAM5B	57795	broad.mit.edu	37	1	177250856	177250857	+	3'UTR	DEL	AC	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250856_177250857delAC	uc001glf.2	+	8					FAM5B_uc001glg.2_3'UTR	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						GCGcacgcatacacacacacac	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90259860	90259861	+	Intron	INS	-	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90259860_90259861insC	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		AATTTACTCAGCCAATGTGCTC	0.480													286	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	231563940	231563947	+	Intron	DEL	GAAGGAAG	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231563940_231563947delGAAGGAAG	uc002vqw.1	-											Homo sapiens cDNA FLJ30454 fis, clone BRACE2009311.																		gggagggagagaaggaaggaaggaagga	0.067													4	2	---	---	---	---	
MLPH	79083	broad.mit.edu	37	2	238419911	238419912	+	Intron	DEL	TT	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238419911_238419912delTT	uc002vwt.2	+						MLPH_uc002vws.2_Intron|MLPH_uc010fyt.1_Intron|MLPH_uc002vwu.2_Intron|MLPH_uc002vwv.2_Intron|MLPH_uc002vww.2_Intron	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN	melanophilin isoform 1								metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		TTCTGGCTGCtttttttttttt	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	71673525	71673526	+	IGR	INS	-	AAGG	AAGG			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71673525_71673526insAAGG								FOXP1 (40385 upstream) : EIF4E3 (54916 downstream)																							aggaaggaaggattgatctgat	0.010													4	2	---	---	---	---	
GRAMD1C	54762	broad.mit.edu	37	3	113569031	113569031	+	Intron	DEL	T	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113569031delT	uc003eaq.3	+						GRAMD1C_uc011bil.1_Intron|GRAMD1C_uc011bim.1_Intron	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C							integral to membrane				ovary(2)|skin(1)	3						ATATACTTACTTTTTTTTTTT	0.328													4	2	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	86016	86017	+	Intron	INS	-	C	C	rs149846134	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86016_86017insC	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc011bus.1_5'UTR|ZNF595_uc011but.1_5'UTR	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		ATGTGGCAAAGCTTTACAGGGT	0.411													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	1516348	1516349	+	IGR	INS	-	TGG	TGG			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1516348_1516349insTGG								CRIPAK (126566 upstream) : FAM53A (125260 downstream)																							ggtggtggtgatggtggtgatg	0.000													4	2	---	---	---	---	
SYNPO2	171024	broad.mit.edu	37	4	119979267	119979268	+	3'UTR	DEL	AC	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119979267_119979268delAC	uc010inb.2	+	5					SYNPO2_uc011cgh.1_3'UTR|SYNPO2_uc010inc.2_3'UTR	NM_133477	NP_597734	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform a							nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						atgtgAATATACACACACACAC	0.297													4	3	---	---	---	---	
FGB	2244	broad.mit.edu	37	4	155489834	155489835	+	Intron	INS	-	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155489834_155489835insA	uc003ioa.3	+						FGB_uc003iob.3_Intron|FGB_uc010ipv.2_Intron|FGB_uc010ipw.2_Intron|FGB_uc003ioc.3_Intron	NM_005141	NP_005132	P02675	FIBB_HUMAN	fibrinogen, beta chain preproprotein						platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	cctaactctacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	755095	755095	+	IGR	DEL	C	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:755095delC								TPPP (61585 upstream) : ZDHHC11 (40625 downstream)																							TGCCGGCCATCCCCTCTGTGC	0.597													4	2	---	---	---	---	
IPO11	51194	broad.mit.edu	37	5	61738690	61738691	+	Intron	INS	-	AAAAC	AAAAC	rs148235524	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61738690_61738691insAAAAC	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc003jtb.1_Intron	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		aaactgtctcaaaaacaaaaca	0.089													8	4	---	---	---	---	
TCERG1	10915	broad.mit.edu	37	5	145888975	145888976	+	Intron	INS	-	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145888975_145888976insT	uc003lob.2	+						TCERG1_uc003loc.2_Intron	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATCTACCATACTTTTTTTTTTT	0.317													6	3	---	---	---	---	
TIMD4	91937	broad.mit.edu	37	5	156381895	156381896	+	Intron	INS	-	T	T	rs71922795		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156381895_156381896insT	uc003lwh.2	-						TIMD4_uc010jii.2_Intron	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain							integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			cttttctttccttttttttttt	0.168													3	3	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26460170	26460171	+	Intron	INS	-	CACAGGGAGATTCCACAGGGA	CACAGGGAGATTCCACAGGGA	rs142117310	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26460170_26460171insCACAGGGAGATTCCACAGGGA	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						ACTCCCTTTTCCACTCTCCCTG	0.480													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28700746	28700747	+	IGR	INS	-	A	A	rs140985883		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28700746_28700747insA								SCAND3 (145634 upstream) : TRIM27 (170033 downstream)																							ACATCAGTTTCaaaaaaaaaaa	0.198													5	3	---	---	---	---	
LEMD2	221496	broad.mit.edu	37	6	33740705	33740707	+	Intron	DEL	GAG	-	-	rs35333275		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33740705_33740707delGAG	uc011drm.1	-						LEMD2_uc010jvg.2_Intron|LEMD2_uc011drl.1_Intron|LEMD2_uc003ofe.2_Intron	NM_181336	NP_851853	Q8NC56	LEMD2_HUMAN	LEM domain containing 2 isoform 1							integral to nuclear inner membrane				central_nervous_system(1)	1						GACAACTGCAGAGGAGAAAAACG	0.478													3	5	---	---	---	---	
XPO5	57510	broad.mit.edu	37	6	43533306	43533306	+	Intron	DEL	A	-	-	rs113079021		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43533306delA	uc003ovp.2	-							NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			atctcaaaataaaaaaaaaaa	0.139													7	4	---	---	---	---	
SLC17A5	26503	broad.mit.edu	37	6	74331403	74331403	+	Intron	DEL	T	-	-	rs11337721		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74331403delT	uc003phn.3	-						SLC17A5_uc010kax.2_Intron|SLC17A5_uc010kay.2_Intron|SLC17A5_uc011dyo.1_Intron	NM_012434	NP_036566	Q9NRA2	S17A5_HUMAN	sialin						anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity			skin(5)|central_nervous_system(1)	6						taagaatctctaaAATTTAGG	0.134													4	3	---	---	---	---	
ZNF292	23036	broad.mit.edu	37	6	87965133	87965137	+	Frame_Shift_Del	DEL	AGTAA	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87965133_87965137delAGTAA	uc003plm.3	+	8	1827_1831	c.1786_1790delAGTAA	c.(1786-1791)AGTAAAfs	p.S596fs		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	596_597					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TAAACAATCTAGTAAAGAGAGACTA	0.361													76	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35624378	35624385	+	IGR	DEL	AAGAAAGA	-	-	rs71739701	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35624378_35624385delAAGAAAGA								TBX20 (331136 upstream) : HERPUD2 (47887 downstream)																							ggaaggaaggaagaaagaaagaaagaaa	0.053													4	4	---	---	---	---	
CHCHD3	54927	broad.mit.edu	37	7	132719269	132719269	+	Intron	DEL	T	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132719269delT	uc003vre.2	-						CHCHD3_uc010lmi.2_Intron|CHCHD3_uc003vrf.2_Intron|CHCHD3_uc010lmj.2_Intron|CHCHD3_uc011kpn.1_Intron	NM_017812	NP_060282	Q9NX63	CHCH3_HUMAN	coiled-coil-helix-coiled-coil-helix domain						inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0						GGATCCAGTCttttttttttt	0.343													5	3	---	---	---	---	
DOCK5	80005	broad.mit.edu	37	8	25154317	25154318	+	Intron	DEL	TA	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25154317_25154318delTA	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xef.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		atgaggcaggtatatatatata	0.129													3	4	---	---	---	---	
GGH	8836	broad.mit.edu	37	8	63928200	63928201	+	Intron	INS	-	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63928200_63928201insA	uc003xuw.2	-							NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor						glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)	acttactttcCAAAAAAAAAAA	0.248													7	4	---	---	---	---	
EYA1	2138	broad.mit.edu	37	8	72131131	72131133	+	Intron	DEL	AGG	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72131131_72131133delAGG	uc003xys.3	-						EYA1_uc003xyr.3_Intron|EYA1_uc003xyt.3_Intron|EYA1_uc010lzf.2_Intron|EYA1_uc003xyu.2_Intron|EYA1_uc011lfe.1_Intron|EYA1_uc003xyv.2_Intron	NM_172058	NP_742055	Q99502	EYA1_HUMAN	eyes absent 1 isoform b						double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			ATGAACAAAAAGGAGGAGGAAGT	0.443													3	3	---	---	---	---	
C9orf25	203259	broad.mit.edu	37	9	34416271	34416272	+	Intron	INS	-	GGAAGGAAGGAAGGAA	GGAAGGAAGGAAGGAA	rs144617392	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34416271_34416272insGGAAGGAAGGAAGGAA	uc011lok.1	-						C9orf25_uc003zuj.2_Intron|C9orf25_uc003zuk.2_Intron|C9orf25_uc011lol.1_Intron|C9orf25_uc003zul.2_Intron	NM_147202	NP_671735	Q8IW50	CI025_HUMAN	hypothetical protein LOC203259												0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.0858)		gagggagggagggaaggaagga	0.084													4	2	---	---	---	---	
C9orf135	138255	broad.mit.edu	37	9	72471837	72471837	+	Intron	DEL	T	-	-	rs35312825		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72471837delT	uc004ahl.2	+						C9orf135_uc011lrw.1_Intron|C9orf135_uc010moq.2_Intron|C9orf135_uc011lrx.1_Intron|C9orf135_uc010mop.2_Intron	NM_001010940	NP_001010940	Q5VTT2	CI135_HUMAN	hypothetical protein LOC138255							integral to membrane				ovary(1)	1						TTTATATGTGTTTTTTTTTTT	0.055													4	2	---	---	---	---	
NR6A1	2649	broad.mit.edu	37	9	127288825	127288826	+	Intron	INS	-	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127288825_127288826insT	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						TATAGAGATTGTGGCATTTCAG	0.411													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16454809	16454810	+	IGR	DEL	AG	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16454809_16454810delAG								FAM188A (552290 upstream) : PTER (24157 downstream)																							gaagaaagaaaggaaggaagga	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	47727808	47727809	+	IGR	INS	-	C	C			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47727808_47727809insC								ANTXRL (26362 upstream) : ANXA8L2 (19111 downstream)																							ATGAACAGTTAACTCATTTGCG	0.322													4	2	---	---	---	---	
AGAP11	119385	broad.mit.edu	37	10	88767684	88767686	+	Intron	DEL	TCT	-	-	rs72036564		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88767684_88767686delTCT	uc001kee.2	+						AGAP11_uc001kef.2_Intron	NM_133447	NP_597704	Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						AGAAAATGTATCttttttttttt	0.177													4	2	---	---	---	---	
JAKMIP3	282973	broad.mit.edu	37	10	133961636	133961637	+	Intron	INS	-	TGAACA	TGAACA	rs141683861	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133961636_133961637insTGAACA	uc001lkx.3	+						JAKMIP3_uc009yba.1_Intron	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		ACACAAAGCCCtgaacatgaac	0.495													7	4	---	---	---	---	
STK32C	282974	broad.mit.edu	37	10	134145421	134145421	+	Intron	DEL	C	-	-	rs71013521		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134145421delC	uc009ybd.1	-						STK32C_uc010quu.1_5'Flank|STK32C_uc009ybc.1_5'Flank|LRRC27_uc001llf.2_5'Flank|LRRC27_uc010quv.1_5'Flank|LRRC27_uc010quw.1_5'Flank|LRRC27_uc001llg.2_5'Flank|LRRC27_uc001lli.2_5'Flank			Q86UX6	ST32C_HUMAN	Homo sapiens cDNA FLJ25120 fis, clone CBR06020.								ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CGCACCACAACCCCCCCACCG	0.776													3	4	---	---	---	---	
USH1C	10083	broad.mit.edu	37	11	17517382	17517383	+	Intron	DEL	AT	-	-	rs138767394		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17517382_17517383delAT	uc001mnf.2	-						USH1C_uc001mne.2_Intron|USH1C_uc009yhb.2_Intron|USH1C_uc001mng.2_Intron|USH1C_uc001mnd.2_Intron	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a						equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						TCTCCAAGACATGTGTAGAGCT	0.614													5	5	---	---	---	---	
RBM4B	83759	broad.mit.edu	37	11	66436923	66436924	+	Intron	INS	-	T	T			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66436923_66436924insT	uc001oja.2	-						RBM4B_uc001ojb.2_Intron	NM_031492	NP_113680	Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B						circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|RNA splicing	nucleolus	nucleotide binding|RNA binding|zinc ion binding				0						AAGtttttttgttttttttttt	0.178													6	3	---	---	---	---	
NADSYN1	55191	broad.mit.edu	37	11	71175322	71175341	+	Intron	DEL	AAAAAGCACAAAGAAAGCCA	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71175322_71175341delAAAAAGCACAAAGAAAGCCA	uc001oqn.2	+						NADSYN1_uc001oqm.2_Intron|NADSYN1_uc001oqo.2_Intron	NM_018161	NP_060631	Q6IA69	NADE_HUMAN	NAD synthetase 1						NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	agaatgggacaaaaagcacaaagaaagccaaaaaagaatg	0.123													4	2	---	---	---	---	
RNF169	254225	broad.mit.edu	37	11	74457267	74457267	+	5'Flank	DEL	T	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74457267delT	uc001ovl.3	+							NM_001098638	NP_001092108	Q8NCN4	RN169_HUMAN	ring finger protein 169								zinc ion binding			ovary(1)	1						TTCAATACTCttttttttttt	0.294													6	3	---	---	---	---	
EED	8726	broad.mit.edu	37	11	85975481	85975482	+	Intron	INS	-	TATT	TATT	rs138959322	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85975481_85975482insTATT	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron|EED_uc010rtn.1_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AGTAAAGACtatatttatttat	0.312													4	2	---	---	---	---	
GRAMD1B	57476	broad.mit.edu	37	11	123455101	123455102	+	Intron	INS	-	G	G	rs140088482	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123455101_123455102insG	uc001pyx.2	+						GRAMD1B_uc001pyw.2_Intron|GRAMD1B_uc010rzw.1_Intron|GRAMD1B_uc010rzx.1_Intron|GRAMD1B_uc009zbe.1_Intron	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B							integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GAATGGAGGTTGGGGGAAGGGG	0.495													2	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	128482350	128482351	+	IGR	DEL	CT	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128482350_128482351delCT								ETS1 (24897 upstream) : FLI1 (74079 downstream)																							cgtcccccccctcccttccctt	0.163													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	16879344	16879350	+	IGR	DEL	TCCTTCC	-	-	rs71953318		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16879344_16879350delTCCTTCC								LMO3 (116586 upstream) : None (None downstream)																							cttccttccttccttccttccttcctt	0.174													4	2	---	---	---	---	
WNT10B	7480	broad.mit.edu	37	12	49363901	49363902	+	Frame_Shift_Ins	INS	-	GGGG	GGGG	rs143694346	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49363901_49363902insGGGG	uc001rss.2	-	3	653_654	c.307_308insCCCC	c.(307-309)CTGfs	p.L103fs	WNT10B_uc001rst.2_Frame_Shift_Ins_p.L103fs	NM_003394	NP_003385	O00744	WN10B_HUMAN	wingless-type MMTV integration site family,	103					axis specification|bone trabecula formation|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|chondrocyte differentiation|female gonad development|hemopoietic stem cell proliferation|midbrain-hindbrain boundary development|myoblast cell differentiation involved in skeletal muscle regeneration|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|neuron differentiation|positive regulation of anagen|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cell proliferation|positive regulation of epithelial cell differentiation|positive regulation of osteoblast differentiation|protein stabilization|regulation of skeletal muscle tissue development|skeletal muscle fiber development|smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			skin(4)|lung(3)	7						GTGGTGCGGCAGGCGGCCGCCG	0.752													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76509927	76509930	+	IGR	DEL	TATT	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76509927_76509930delTATT								NAP1L1 (31189 upstream) : BBS10 (228336 downstream)																							TCCGTCCTGATATTTATAAGAAAT	0.431													2	5	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109881159	109881166	+	Intron	DEL	ATACACAC	-	-	rs10545297		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881159_109881166delATACACAC	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						atgtgtgtatatacacacacacacacac	0.111													5	3	---	---	---	---	
VPS29	51699	broad.mit.edu	37	12	110931167	110931168	+	Intron	INS	-	TT	TT			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110931167_110931168insTT	uc001tqy.2	-						VPS29_uc001tqw.2_Intron|VPS29_uc001tqx.2_Intron|VPS29_uc001tqz.2_Intron	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1						protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						ACATTTATACAttttttttttt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	48161308	48161309	+	IGR	INS	-	TTTCTTTCTTTCTT	TTTCTTTCTTTCTT	rs143474215	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48161308_48161309insTTTCTTTCTTTCTT								MDGA2 (17320 upstream) : None (None downstream)																							tccctcctttctttctttcttc	0.000													3	5	---	---	---	---	
RPS6KL1	83694	broad.mit.edu	37	14	75378297	75378302	+	Intron	DEL	TGTGTA	-	-	rs34121418		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75378297_75378302delTGTGTA	uc010tux.1	-						RPS6KL1_uc001xqx.1_5'Flank|RPS6KL1_uc001xqw.2_Intron|RPS6KL1_uc010asd.1_Intron|RPS6KL1_uc001xqy.1_Intron	NM_031464	NP_113652	Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1							ribosome	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00658)		tgtgtgtttgtgtgtatgtgtatgtg	0.408													4	2	---	---	---	---	
TCF12	6938	broad.mit.edu	37	15	57570898	57570905	+	Intron	DEL	CTCCCTCC	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57570898_57570905delCTCCCTCC	uc002aec.2	+						TCF12_uc010ugm.1_Intron|TCF12_uc010ugn.1_Intron|TCF12_uc002aea.2_Intron|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Intron|TCF12_uc002aed.2_Intron|TCF12_uc002aee.2_Intron|TCF12_uc010bft.2_Intron|TCF12_uc010ugo.1_Intron|TCF12_uc010ugp.1_Intron|TCF12_uc010ugq.1_Intron	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b						immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		ctccctctctctccctccctccctccct	0.010			T	TEC	extraskeletal myxoid chondrosarcoma								11	8	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600778	600779	+	Intron	INS	-	C	C	rs146137561	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600778_600779insC	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				CCGGTGAGGGTCCCGGTCGGTG	0.757													3	3	---	---	---	---	
CHTF8	54921	broad.mit.edu	37	16	69155575	69155575	+	Intron	DEL	T	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69155575delT	uc002ewn.1	-						CHTF8_uc002ewm.1_5'Flank|CHTF8_uc002ewo.1_Intron|CHTF8_uc002ewp.1_Intron	NM_001040146	NP_001035236	P0CG13	CTF8_HUMAN	chromosome transmission fidelity factor 8						cell cycle|DNA replication	nucleus	DNA binding				0						agagatggggttttttttttt	0.000													3	4	---	---	---	---	
GLG1	2734	broad.mit.edu	37	16	74576660	74576661	+	Intron	INS	-	A	A			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74576660_74576661insA	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						aggaaggaaggaaggaaggaag	0.079													4	2	---	---	---	---	
TSR1	55720	broad.mit.edu	37	17	2232543	2232544	+	Intron	DEL	AA	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2232543_2232544delAA	uc002fuj.2	-						SNORD91B_uc002fuk.1_5'Flank	NM_018128	NP_060598	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation						ribosome assembly	nucleolus	protein binding			ovary(1)	1						CCAGAGATGTAAGATTTTGAAA	0.426													77	34	---	---	---	---	
MPDU1	9526	broad.mit.edu	37	17	7488855	7488856	+	Intron	DEL	CA	-	-	rs140696498		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7488855_7488856delCA	uc002ghw.2	+						MPDU1_uc010vub.1_Intron|MPDU1_uc002ghx.2_Intron|MPDU1_uc010vuc.1_Intron	NM_004870	NP_004861	O75352	MPU1_HUMAN	mannose-P-dolichol utilization defect 1						dolichol-linked oligosaccharide biosynthetic process|protein folding	endoplasmic reticulum membrane|integral to membrane|mitochondrion	protein binding			central_nervous_system(1)	1						actctgtctccaaaaaaaaaaa	0.257													4	4	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11597919	11597922	+	Intron	DEL	CTTT	-	-	rs12946299		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11597919_11597922delCTTT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TACCTCGGAGctttcttgctttct	0.270													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14608988	14608988	+	IGR	DEL	T	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14608988delT								HS3ST3B1 (359496 upstream) : PMP22 (524109 downstream)																							TGCTTTGGGGTTTTTTTTTTT	0.353													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	64193980	64193980	+	IGR	DEL	T	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64193980delT								CCDC46 (5768 upstream) : APOH (14168 downstream)																							TTGCAGTTCCTTTTGATGAAG	0.373													76	27	---	---	---	---	
MAP2K6	5608	broad.mit.edu	37	17	67532021	67532022	+	Intron	DEL	AC	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67532021_67532022delAC	uc002jij.2	+							NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					AAAGGAAAGTacacacacacac	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75921984	75921987	+	IGR	DEL	AAGA	-	-	rs67051242		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75921984_75921987delAAGA								FLJ45079 (41815 upstream) : TNRC6C (78331 downstream)																							ggaaggaaggaagaaagaaagaaa	0.235													3	4	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78674581	78674582	+	Intron	INS	-	TAG	TAG	rs68091563		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674581_78674582insTAG	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						ggtagagatgatgatggtggtg	0.000													4	2	---	---	---	---	
ASPSCR1	79058	broad.mit.edu	37	17	79954981	79954982	+	Intron	INS	-	GCTCCGGGATGAGGCCGTGTGG	GCTCCGGGATGAGGCCGTGTGG	rs7209749	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79954981_79954982insGCTCCGGGATGAGGCCGTGTGG	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Intron|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron|ASPSCR1_uc002kdb.1_Intron	NM_024083	NP_076988	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			AGGCCGTGTCCGCTCCGGGATG	0.406			T	TFE3	alveolar soft part sarcoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60753942	60753943	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs140616622	by1000genomes	TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60753942_60753943insTTCCTTCC								PHLPP1 (106277 upstream) : BCL2 (36636 downstream)																							tcttcctttctttccttccttc	0.153													3	3	---	---	---	---	
ZNF527	84503	broad.mit.edu	37	19	37870362	37870362	+	Intron	DEL	C	-	-	rs34967980		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37870362delC	uc010efk.1	+						ZNF527_uc002ogf.3_Intron|ZNF527_uc010xtq.1_Intron|ZNF527_uc002oge.2_Intron	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAGTAAtttctttttttttt	0.129													4	3	---	---	---	---	
MIR519C	574466	broad.mit.edu	37	19	54188534	54188534	+	5'Flank	DEL	T	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54188534delT	hsa-mir-519c|MI0003148	+																							0						cCGTGCTTGCttttttttttt	0.030													4	2	---	---	---	---	
PLCB4	5332	broad.mit.edu	37	20	9371428	9371432	+	Intron	DEL	AAAAT	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9371428_9371432delAAAAT	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron|PLCB4_uc002wnh.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						AAAGAGACACAAAATAAACATCTGG	0.361													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16755431	16755434	+	IGR	DEL	AAAG	-	-	rs74177310		TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16755431_16755434delAAAG								OTOR (22623 upstream) : PCSK2 (451318 downstream)																							ggaagatagaaaagaaagaaagaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33237268	33237279	+	IGR	DEL	CCTTCCCTCCCT	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33237268_33237279delCCTTCCCTCCCT								SFRS15 (132837 upstream) : HUNK (8349 downstream)																							GTATCTtcccccttccctccctccttccctcc	0.066													7	5	---	---	---	---	
KLF8	11279	broad.mit.edu	37	X	56296838	56296839	+	Intron	DEL	AG	-	-			TCGA-EJ-5542-01	TCGA-EJ-5542-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56296838_56296839delAG	uc004dur.2	+						KLF8_uc011mop.1_Intron|KLF8_uc010nkh.2_Intron	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						agagaggggcagagagagagag	0.252													6	3	---	---	---	---	
