Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
APITD1	378708	broad.mit.edu	37	1	10502561	10502561	+	3'UTR	SNP	A	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10502561A>T	uc001are.2	+	5					APITD1_uc001arf.2_Intron|APITD1_uc001arg.2_Intron|APITD1_uc001arh.2_3'UTR	NM_199294	NP_954988	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1 isoform						DNA repair|mitotic prometaphase|transcription initiation, DNA-dependent	chromosome, centromeric region|cytosol|Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		ATAGAGatttaaaaaaataaa	0.398													5	24	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16958047	16958047	+	Intron	SNP	C	T	T	rs9658896	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16958047C>T	uc001azf.2	-						CROCCL1_uc009vov.1_5'Flank|CROCCL1_uc001aze.2_5'Flank|CROCCL1_uc001azg.1_RNA|CROCCL1_uc001azi.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						CCTTAGGCTCCGCTGTAGCCC	0.667													3	12	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097555	167097555	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097555G>T	uc001geb.1	+	5	3187	c.3187G>T	c.(3187-3189)GCC>TCC	p.A1063S		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1063					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						CCCAAATTGGGCCAGGTCCAG	0.552													5	34	---	---	---	---	PASS
TPO	7173	broad.mit.edu	37	2	1499889	1499889	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1499889G>A	uc002qww.2	+	12	2226	c.2135G>A	c.(2134-2136)GGC>GAC	p.G712D	TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Missense_Mutation_p.G655D|TPO_uc002qwr.2_Missense_Mutation_p.G712D|TPO_uc002qwx.2_Missense_Mutation_p.G655D|TPO_uc010yio.1_Missense_Mutation_p.G539D|TPO_uc010yip.1_Missense_Mutation_p.G712D|TPO_uc002qwy.1_Missense_Mutation_p.G52D|TPO_uc002qwz.2_Intron	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	712	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TTCCAAGTCGGCAAATTCCCC	0.562													3	49	---	---	---	---	PASS
CAPN13	92291	broad.mit.edu	37	2	30987143	30987143	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30987143T>C	uc002rnn.2	-	6	730	c.554A>G	c.(553-555)TAT>TGT	p.Y185C	CAPN13_uc002rnp.1_Missense_Mutation_p.Y185C	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13	185	Calpain catalytic.				proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					GAGGAAGCCATAGTGCAGATC	0.577													9	22	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54753666	54753666	+	Silent	SNP	G	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54753666G>A	uc002rxu.2	+	2	360	c.111G>A	c.(109-111)GCG>GCA	p.A37A	SPTBN1_uc002rxv.1_Silent_p.A37A|RPL23AP32_uc010yot.1_5'Flank	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	37	Actin-binding.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			ACAGCTCTGCGCGGCTTTTTG	0.532													16	54	---	---	---	---	PASS
HS6ST1	9394	broad.mit.edu	37	2	129075939	129075939	+	Nonsense_Mutation	SNP	T	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129075939T>A	uc002tpt.3	-	1	233	c.199A>T	c.(199-201)AAG>TAG	p.K67*		NM_004807	NP_004798	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	67	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification	integral to plasma membrane	sulfotransferase activity			pancreas(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		AAGTAGTACTTCTTCTCGTAG	0.547													6	55	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179436669	179436669	+	Silent	SNP	A	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179436669A>C	uc010zfg.1	-	275	66710	c.66486T>G	c.(66484-66486)GGT>GGG	p.G22162G	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.G15857G|TTN_uc010zfi.1_Silent_p.G15790G|TTN_uc010zfj.1_Silent_p.G15665G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23089							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAGGTCTTCACCTGCCAGTA	0.453													11	33	---	---	---	---	PASS
NGLY1	55768	broad.mit.edu	37	3	25778887	25778887	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25778887T>C	uc003cdl.2	-	6	1049	c.941A>G	c.(940-942)AAT>AGT	p.N314S	NGLY1_uc010hfg.2_Missense_Mutation_p.N314S|NGLY1_uc003cdm.2_Missense_Mutation_p.N314S|NGLY1_uc011awo.1_Missense_Mutation_p.N272S|NGLY1_uc003cdk.2_RNA	NM_018297	NP_060767	Q96IV0	NGLY1_HUMAN	N-glycanase 1 isoform 1	314					glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding			breast(1)	1						TGTAAAACAATTGGCCCACTC	0.308													8	61	---	---	---	---	PASS
SLC34A2	10568	broad.mit.edu	37	4	25678365	25678365	+	Silent	SNP	C	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25678365C>T	uc003grr.2	+	13	2148	c.2067C>T	c.(2065-2067)GCC>GCT	p.A689A	SLC34A2_uc003grs.2_Silent_p.A688A|SLC34A2_uc010iev.2_Silent_p.A688A	NM_006424	NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (sodium phosphate),	689	Cytoplasmic (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			skin(3)|ovary(1)|kidney(1)	5		Breast(46;0.0503)				AATGCACGGCCTTGTAGGGGA	0.562													12	56	---	---	---	---	PASS
NUDT9	53343	broad.mit.edu	37	4	88343974	88343974	+	5'UTR	SNP	C	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88343974C>T	uc003hqq.2	+	1					NUDT9_uc003hqr.2_Intron|NUDT9_uc010ikl.2_5'UTR	NM_024047	NP_076952	Q9BW91	NUDT9_HUMAN	nudix-type motif 9 isoform a							mitochondrion	ADP-ribose diphosphatase activity				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		TACCCGCGGCCGGGACTCGGA	0.632													3	45	---	---	---	---	PASS
TMEM184C	55751	broad.mit.edu	37	4	148545026	148545026	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148545026T>G	uc003ila.3	+	2	734	c.165T>G	c.(163-165)TTT>TTG	p.F55L		NM_018241	NP_060711	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	55	Helical; (Potential).					integral to membrane					0						CTGGAATCTTTTTGCTGTTGA	0.308													23	66	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169300651	169300651	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169300651T>C	uc003irq.3	-	32	4447	c.4226A>G	c.(4225-4227)TAT>TGT	p.Y1409C		NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1409							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTTATTTAAATAGTCCTAAAA	0.303													11	15	---	---	---	---	PASS
FOXI1	2299	broad.mit.edu	37	5	169535492	169535492	+	Silent	SNP	G	A	A	rs55685928	byFrequency	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169535492G>A	uc003mai.3	+	2	1059	c.1014G>A	c.(1012-1014)GCG>GCA	p.A338A	FOXI1_uc003maj.3_Silent_p.A243A	NM_012188	NP_036320	Q12951	FOXI1_HUMAN	forkhead box I1 isoform a	338					epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(3)|central_nervous_system(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTGACTGGGCGAACCCCATGC	0.582									Pendred_syndrome				23	56	---	---	---	---	PASS
HLA-C	3107	broad.mit.edu	37	6	31238931	31238931	+	Silent	SNP	G	A	A	rs697743	byFrequency	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31238931G>A	uc003nsy.2	-	3	545	c.538C>T	c.(538-540)CTG>TTG	p.L180L	HLA-C_uc011dnj.1_Silent_p.L152L|HLA-C_uc003nsx.2_Silent_p.L59L|HLA-C_uc003nsz.2_Silent_p.L180L|HLA-C_uc010jsl.2_Silent_p.L180L|HLA-C_uc003nta.2_Silent_p.L180L|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron|HLA-C_uc011dnl.1_Silent_p.L59L|HLA-B_uc003ntf.2_Silent_p.L180L	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C	180	Extracellular (Potential).|Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						TAGGCTCTCAGCTGCTCCGCC	0.682													3	25	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34004179	34004179	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34004179G>A	uc003oir.3	-	8	1878	c.1708C>T	c.(1708-1710)CGC>TGC	p.R570C	GRM4_uc011dsn.1_Missense_Mutation_p.R523C|GRM4_uc010jvh.2_Missense_Mutation_p.R570C|GRM4_uc010jvi.2_Missense_Mutation_p.R262C|GRM4_uc003oio.2_Missense_Mutation_p.R262C|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.R430C|GRM4_uc003oiq.2_Missense_Mutation_p.R437C|GRM4_uc011dsm.1_Missense_Mutation_p.R401C	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	570	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	CAGCCCGTGCGGTTCTCTGTG	0.652													15	38	---	---	---	---	PASS
BEND6	221336	broad.mit.edu	37	6	56882125	56882125	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56882125G>A	uc010kab.2	+	5	1226	c.640G>A	c.(640-642)GCA>ACA	p.A214T	BEND6_uc003pdi.3_Missense_Mutation_p.A116T	NM_152731	NP_689944	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	214	BEN.										0						CCTGACAGGGGCAAAATCCTC	0.388													3	30	---	---	---	---	PASS
HMGN3	9324	broad.mit.edu	37	6	79944114	79944114	+	Intron	SNP	C	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79944114C>A	uc003pit.2	-						HMGN3_uc003pis.2_Intron|HMGN3_uc003piu.1_Intron|uc003piv.1_RNA	NM_004242	NP_004233	Q15651	HMGN3_HUMAN	high mobility group nucleosomal binding domain 3						chromatin modification	chromatin|cytoplasm|nucleus	DNA binding|thyroid hormone receptor binding				0		all_cancers(76;0.000116)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0393)		BRCA - Breast invasive adenocarcinoma(397;0.125)		GGAACGTCTGCAACAGGCATC	0.517													3	38	---	---	---	---	PASS
FAM26F	441168	broad.mit.edu	37	6	116784932	116784932	+	3'UTR	SNP	G	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116784932G>A	uc003pwv.2	+	3						NM_001010919	NP_001010919	Q5R3K3	FA26F_HUMAN	hypothetical protein LOC441168							integral to membrane					0				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		ATAAACATTGGTATTTTTTGA	0.234													14	30	---	---	---	---	PASS
TMED4	222068	broad.mit.edu	37	7	44621433	44621433	+	Intron	SNP	G	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44621433G>C	uc003tli.2	-						TMED4_uc003tlj.2_5'UTR|TMED4_uc003tlk.2_Intron|uc003tll.2_5'Flank	NM_182547	NP_872353	Q7Z7H5	TMED4_HUMAN	transmembrane emp24 protein transport domain						positive regulation of I-kappaB kinase/NF-kappaB cascade|transport	endoplasmic reticulum membrane|integral to membrane	signal transducer activity				0						CTGCGGGGCAGACACATAGTC	0.682													23	59	---	---	---	---	PASS
ASNS	440	broad.mit.edu	37	7	97481478	97481478	+	3'UTR	SNP	A	G	G			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97481478A>G	uc003uot.3	-	13					ASNS_uc011kin.1_3'UTR|ASNS_uc003uou.3_3'UTR|ASNS_uc003uov.3_3'UTR|ASNS_uc011kio.1_3'UTR|ASNS_uc003uow.3_3'UTR|ASNS_uc003uox.3_3'UTR	NM_133436	NP_597680	P08243	ASNS_HUMAN	asparagine synthetase						cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CACCCAAGTTAGCCTGAGTTG	0.383													2	4	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62492216	62492216	+	Intron	SNP	A	G	G			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62492216A>G	uc011leg.1	-						ASPH_uc003xuj.2_Intron|ASPH_uc003xuo.2_Intron|uc003xuk.2_Missense_Mutation_p.I421V	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	GTCCTCTGACATCCTGCCCAA	0.622													4	42	---	---	---	---	PASS
FZD6	8323	broad.mit.edu	37	8	104340556	104340556	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104340556A>G	uc003ylh.2	+	5	1737	c.1453A>G	c.(1453-1455)ATT>GTT	p.I485V	FZD6_uc003yli.2_Missense_Mutation_p.I485V|FZD6_uc003ylj.2_Missense_Mutation_p.I485V|FZD6_uc011lhn.1_Missense_Mutation_p.I451V|FZD6_uc011lho.1_Missense_Mutation_p.I180V|FZD6_uc011lhp.1_Missense_Mutation_p.I430V	NM_003506	NP_003497	O60353	FZD6_HUMAN	frizzled 6 isoform a precursor	485	Helical; Name=7; (Potential).				angiogenesis|axonogenesis|cell proliferation in midbrain|establishment of planar polarity|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|neural tube closure|non-canonical Wnt receptor signaling pathway	apical part of cell|apicolateral plasma membrane|cytoplasm|integral to plasma membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			GATGACATTAATTGTTGGCAT	0.358													14	47	---	---	---	---	PASS
AQP7P1	375719	broad.mit.edu	37	9	67281846	67281846	+	RNA	SNP	C	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67281846C>A	uc004aem.1	-	1		c.59G>T			AQP7P1_uc004aen.1_Intron|AQP7P1_uc004aeo.1_Intron|AQP7P1_uc004aep.1_Intron					Homo sapiens aquaporin 7 pseudogene 1, mRNA (cDNA clone IMAGE:6191443).												0						TACAGTGGCCCGAGCCCATGG	0.532													3	60	---	---	---	---	PASS
TLE4	7091	broad.mit.edu	37	9	82320809	82320809	+	Silent	SNP	C	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82320809C>T	uc004ald.2	+	10	1563	c.714C>T	c.(712-714)AGC>AGT	p.S238S	TLE4_uc004alc.2_Silent_p.S245S|TLE4_uc010mpr.2_Silent_p.S124S|TLE4_uc004ale.2_5'UTR|TLE4_uc011lsq.1_Silent_p.S213S|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Silent_p.S184S	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment										lung(2)|ovary(1)|breast(1)|skin(1)	5						TGCAGGACAGCGATGGTGAGA	0.398													6	129	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071755	141071755	+	3'UTR	SNP	T	G	G	rs2507130	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071755T>G	uc004com.2	+	4					TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						AGGCAGTGTGTATTCTTCACT	0.373													3	59	---	---	---	---	PASS
SLK	9748	broad.mit.edu	37	10	105761232	105761232	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105761232C>A	uc001kxo.1	+	8	929	c.895C>A	c.(895-897)CCC>ACC	p.P299T	SLK_uc001kxp.1_Missense_Mutation_p.P299T	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2	299					apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TTCCAACAAACCCATCCGAGA	0.274													7	32	---	---	---	---	PASS
KRTAP5-9	3846	broad.mit.edu	37	11	71259904	71259904	+	Silent	SNP	C	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71259904C>T	uc001oqs.1	+	1	439	c.201C>T	c.(199-201)GGC>GGT	p.G67G		NM_005553	NP_005544	P26371	KRA59_HUMAN	keratin associated protein 5-9	67	8 X 4 AA repeats of C-C-X-P.				epidermis development	keratin filament					0						CCTGTGGGGGCTCCAAGGGAG	0.627													8	159	---	---	---	---	PASS
APLP2	334	broad.mit.edu	37	11	129979414	129979414	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129979414C>A	uc010sby.1	+	2	353	c.196C>A	c.(196-198)CAG>AAG	p.Q66K	APLP2_uc001qfp.2_Missense_Mutation_p.Q66K|APLP2_uc001qfq.2_Missense_Mutation_p.Q66K|APLP2_uc010sbz.1_Intron|APLP2_uc001qfr.2_Intron|APLP2_uc001qfs.2_Missense_Mutation_p.Q66K|APLP2_uc001qfv.2_Missense_Mutation_p.Q13K	NM_001642	NP_001633	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	66	Extracellular (Potential).				G-protein coupled receptor protein signaling pathway	integral to membrane|nucleus|plasma membrane	DNA binding|identical protein binding|serine-type endopeptidase inhibitor activity			ovary(3)	3	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TGTGAACATTCAGACTGGGAA	0.458													3	46	---	---	---	---	PASS
KRT18	3875	broad.mit.edu	37	12	53342968	53342968	+	Missense_Mutation	SNP	C	T	T	rs76301931	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53342968C>T	uc001sbe.2	+	2	80	c.11C>T	c.(10-12)ACC>ATC	p.T4I	KRT18_uc009zmn.1_Missense_Mutation_p.T4I|KRT18_uc001sbf.1_5'UTR|KRT18_uc001sbg.2_Missense_Mutation_p.T4I|KRT18_uc009zmo.2_Missense_Mutation_p.T4I|KRT8_uc009zml.1_Intron|KRT8_uc009zmm.1_Intron	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	4	Head.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						ATGAGCTTCACCACTCGCTCC	0.672													6	130	---	---	---	---	PASS
KRT18	3875	broad.mit.edu	37	12	53343005	53343005	+	Silent	SNP	G	A	A	rs80354424	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53343005G>A	uc001sbe.2	+	2	117	c.48G>A	c.(46-48)CTG>CTA	p.L16L	KRT18_uc009zmn.1_Silent_p.L16L|KRT18_uc001sbf.1_5'UTR|KRT18_uc001sbg.2_Silent_p.L16L|KRT18_uc009zmo.2_Silent_p.L16L|KRT8_uc009zml.1_Intron|KRT8_uc009zmm.1_Intron	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	16	Head.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						ACCGGTCCCTGGGCTCTGTCC	0.677													6	116	---	---	---	---	PASS
KRT18	3875	broad.mit.edu	37	12	53343007	53343007	+	Missense_Mutation	SNP	G	A	A	rs79476176	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53343007G>A	uc001sbe.2	+	2	119	c.50G>A	c.(49-51)GGC>GAC	p.G17D	KRT18_uc009zmn.1_Missense_Mutation_p.G17D|KRT18_uc001sbf.1_5'UTR|KRT18_uc001sbg.2_Missense_Mutation_p.G17D|KRT18_uc009zmo.2_Missense_Mutation_p.G17D|KRT8_uc009zml.1_Intron|KRT8_uc009zmm.1_Intron	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	17	Head.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						CGGTCCCTGGGCTCTGTCCAG	0.677													6	117	---	---	---	---	PASS
BBS10	79738	broad.mit.edu	37	12	76740951	76740951	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76740951C>T	uc001syd.1	-	2	898	c.814G>A	c.(814-816)GGA>AGA	p.G272R		NM_024685	NP_078961	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	272					cellular protein metabolic process|nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	cilium	ATP binding			ovary(1)|skin(1)	2						AACTCTGATCCAGAAGTGGAA	0.373									Bardet-Biedl_syndrome				12	26	---	---	---	---	PASS
XPO4	64328	broad.mit.edu	37	13	21436893	21436893	+	Silent	SNP	G	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21436893G>T	uc001unq.3	-	3	316	c.280C>A	c.(280-282)CGA>AGA	p.R94R	XPO4_uc010tcr.1_Silent_p.R20R	NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4	94					protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		AGGAATGTTCGCAGAGACTCG	0.433													9	257	---	---	---	---	PASS
FGF9	2254	broad.mit.edu	37	13	22245936	22245936	+	5'UTR	SNP	C	T	T	rs35376466		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22245936C>T	uc001uog.2	+	1						NM_002010	NP_002001	P31371	FGF9_HUMAN	fibroblast growth factor 9 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|male gonad development|positive regulation of cell division	extracellular space	growth factor activity|heparin binding				0		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		CCTTTTTTTTCTCTCTCTCTC	0.393													4	26	---	---	---	---	PASS
SLC7A1	6541	broad.mit.edu	37	13	30107118	30107118	+	Silent	SNP	A	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30107118A>C	uc001uso.2	-	4	759	c.372T>G	c.(370-372)GGT>GGG	p.G124G		NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid	124	Extracellular (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CGCTTGAAGTACCTGCCACAA	0.547													8	21	---	---	---	---	PASS
RPS6KA5	9252	broad.mit.edu	37	14	91360831	91360831	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91360831T>G	uc001xys.2	-	13	1785	c.1570A>C	c.(1570-1572)ATC>CTC	p.I524L	RPS6KA5_uc010twi.1_Missense_Mutation_p.I445L|RPS6KA5_uc001xyt.2_Missense_Mutation_p.I524L	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5	524	Protein kinase 2.				axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		TTCCTCATGATGTAGCTGGCT	0.448													25	54	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106552556	106552556	+	RNA	SNP	C	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106552556C>A	uc010tyt.1	-	1447		c.30279G>T								Parts of antibodies, mostly variable regions.												0						TACCAAGCCTCCCCCAGACTC	0.557													17	66	---	---	---	---	PASS
MORF4L1	10933	broad.mit.edu	37	15	79177371	79177371	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79177371T>C	uc002bel.2	+	4	406	c.218T>C	c.(217-219)CTT>CCT	p.L73P	MORF4L1_uc010bli.1_Intron|MORF4L1_uc010blj.1_Intron|MORF4L1_uc002bem.2_Intron|MORF4L1_uc010une.1_Intron	NM_206839	NP_996670	Q9UBU8	MO4L1_HUMAN	MORF-related gene 15 isoform 2	73					double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0						ATTGTAGCCCTTTTTCCTGTT	0.443													3	93	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83346500	83346500	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83346500C>A	uc010uoh.1	-	12	1478	c.1301G>T	c.(1300-1302)GGA>GTA	p.G434V	AP3B2_uc010uoi.1_Missense_Mutation_p.G434V|AP3B2_uc010uoj.1_Missense_Mutation_p.G402V|AP3B2_uc010uog.1_Missense_Mutation_p.G70V	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	434					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			TGCACAGCGTCCAATGGCCTG	0.537													4	14	---	---	---	---	PASS
IQGAP1	8826	broad.mit.edu	37	15	91027480	91027480	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91027480C>G	uc002bpl.1	+	30	3918	c.3817C>G	c.(3817-3819)CCA>GCA	p.P1273A		NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1273	C1.				energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TTGTGATGTCCCAGAGCTTCA	0.423													33	121	---	---	---	---	PASS
BCAR1	9564	broad.mit.edu	37	16	75269477	75269477	+	Silent	SNP	A	C	C	rs61729595	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75269477A>C	uc002fdv.2	-	5	1443	c.1320T>G	c.(1318-1320)TCT>TCG	p.S440S	BCAR1_uc002fdt.2_5'UTR|BCAR1_uc002fdu.2_Silent_p.S230S|BCAR1_uc010cgu.2_Silent_p.S429S|BCAR1_uc010vna.1_Silent_p.S438S|BCAR1_uc010vnb.1_Silent_p.S486S|BCAR1_uc002fdw.2_Silent_p.S440S|BCAR1_uc010vnc.1_Silent_p.S292S|BCAR1_uc010vnd.1_Silent_p.S458S|BCAR1_uc002fdx.2_Silent_p.S458S	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	440	Ser-rich.				actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		AGGAGGACGCAGACTGGCTGC	0.701													9	4	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274150	39274150	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274150T>A	uc002hvz.2	-	1	457	c.418A>T	c.(418-420)AGC>TGC	p.S140C		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	140	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ctggagatgctgcagctgggg	0.129													3	39	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274157	39274157	+	Silent	SNP	G	A	A	rs145503152		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274157G>A	uc002hvz.2	-	1	450	c.411C>T	c.(409-411)CCC>CCT	p.P137P		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	137	23.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tgctgcagctggggtggcagc	0.109													7	38	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274205	39274205	+	Silent	SNP	T	C	C	rs80322614		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274205T>C	uc002hvz.2	-	1	402	c.363A>G	c.(361-363)AGA>AGG	p.R121R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	121	20.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcactggggtctgcagcagc	0.095													4	58	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274206	39274206	+	Missense_Mutation	SNP	C	T	T	rs79388709		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274206C>T	uc002hvz.2	-	1	401	c.362G>A	c.(361-363)AGA>AAA	p.R121K		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	121	20.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcactggggtctgcagcagct	0.100													4	58	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630962	44630962	+	3'UTR	SNP	G	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630962G>A	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						tcagcctcccgagtagctggg	0.040													3	8	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234300	45234300	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234300G>T	uc002ild.3	-	7	948	c.821C>A	c.(820-822)GCT>GAT	p.A274D	CDC27_uc002ile.3_Missense_Mutation_p.A274D|CDC27_uc002ilf.3_Missense_Mutation_p.A274D|CDC27_uc010wkp.1_Missense_Mutation_p.A213D|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	274					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TGGACTAAGAGCTGCTGGTCC	0.363													4	47	---	---	---	---	PASS
CHAF1A	10036	broad.mit.edu	37	19	4442949	4442949	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4442949C>T	uc002mal.2	+	15	2898	c.2798C>T	c.(2797-2799)TCC>TTC	p.S933F		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	933	Binds to p60.				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGCCGCTTCCGGAGCTGGG	0.672								Chromatin_Structure					5	18	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22605057	22605057	+	5'UTR	SNP	C	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22605057C>T	uc002nqt.2	-	1						NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				ACCTGCAGGTCACAGGGCCAC	0.592													26	64	---	---	---	---	PASS
KIR2DL3	3804	broad.mit.edu	37	19	55264147	55264147	+	3'UTR	SNP	G	C	C	rs3040		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55264147G>C	uc002qgv.2	+	8					KIR2DS4_uc010yfj.1_5'Flank|KIR2DL3_uc002qgx.2_3'UTR|KIR2DL3_uc002qgy.2_3'UTR|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_5'Flank	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two						immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		AAATCTGAACGTGCCTCTCCC	0.478													3	16	---	---	---	---	PASS
C20orf194	25943	broad.mit.edu	37	20	3236652	3236652	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3236652C>G	uc002wii.2	-	34	3312	c.3261G>C	c.(3259-3261)CAG>CAC	p.Q1087H	C20orf194_uc002wij.3_Missense_Mutation_p.Q826H|C20orf194_uc002wik.2_Missense_Mutation_p.Q761H	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943	1087											0						TGGAAACCACCTGCTTAGCTG	0.597													8	27	---	---	---	---	PASS
C20orf12	55184	broad.mit.edu	37	20	18446022	18446022	+	Splice_Site	SNP	C	A	A	rs74875927	byFrequency	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18446022C>A	uc010zsa.1	-	2	191	c.-18_splice	c.e2-1		C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Splice_Site|C20orf12_uc002wqq.3_Splice_Site|C20orf12_uc002wqu.1_RNA|C20orf12_uc010gct.1_Splice_Site|POLR3F_uc002wqv.2_5'Flank|POLR3F_uc002wqw.2_5'Flank|POLR3F_uc002wqx.2_5'Flank	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184							intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				ctctctctctctctATATATA	0.318													6	3	---	---	---	---	PASS
C20orf12	55184	broad.mit.edu	37	20	18446024	18446024	+	Intron	SNP	C	A	A	rs6111974	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18446024C>A	uc010zsa.1	-						C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Intron|C20orf12_uc002wqq.3_Intron|C20orf12_uc002wqu.1_RNA|C20orf12_uc010gct.1_Intron|POLR3F_uc002wqv.2_5'Flank|POLR3F_uc002wqw.2_5'Flank|POLR3F_uc002wqx.2_5'Flank	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184							intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				ctctctctctctATATATATA	0.323													7	2	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40735499	40735499	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40735499T>G	uc002xkg.2	-	24	3501	c.3317A>C	c.(3316-3318)AAT>ACT	p.N1106T	PTPRT_uc010ggj.2_Missense_Mutation_p.N1125T|PTPRT_uc010ggi.2_Missense_Mutation_p.N309T	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1106	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).		N -> I (in a colorectal cancer; reduced phosphatase activity).		homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CACCCCTTCATTCTCGGCCAT	0.562													4	103	---	---	---	---	PASS
KCNB1	3745	broad.mit.edu	37	20	47989844	47989844	+	Silent	SNP	A	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47989844A>C	uc002xur.1	-	2	2417	c.2253T>G	c.(2251-2253)GGT>GGG	p.G751G	KCNB1_uc002xus.1_Silent_p.G751G	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related	751	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACTGGTGGACACCCGCCTCAA	0.572													13	165	---	---	---	---	PASS
RSPH1	89765	broad.mit.edu	37	21	43892746	43892746	+	3'UTR	SNP	C	T	T	rs1127455	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43892746C>T	uc002zbg.2	-	9						NM_080860	NP_543136	Q8WYR4	RSPH1_HUMAN	testis-specific gene A2						meiosis	cytosol|nucleus				ovary(1)	1						cagggtctcgctctgccaccc	0.104													4	2	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	C	C	rs142470496	byFrequency	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091840T>C	uc003adu.1	-	11	1189	c.1117A>G	c.(1117-1119)AAG>GAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				3	68	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	A	A	rs146546850	byFrequency	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091841G>A	uc003adu.1	-	11	1188	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	372	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				3	67	---	---	---	---	PASS
NLGN4Y	22829	broad.mit.edu	37	Y	16952767	16952767	+	Silent	SNP	C	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:16952767C>T	uc004ftg.2	+	6	2328	c.2076C>T	c.(2074-2076)GCC>GCT	p.A692A	NLGN4Y_uc004fte.2_Silent_p.A524A|NLGN4Y_uc011nas.1_Silent_p.A712A|NLGN4Y_uc004ftf.2_Silent_p.A385A|NLGN4Y_uc004fth.2_Silent_p.A692A	NM_014893	NP_055708	Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked isoform 1	692	Helical; (Potential).				brainstem development|cell adhesion|cerebellum development|male courtship behavior|positive regulation of organ growth|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|integral to plasma membrane|synapse	neurexin binding|receptor activity				0						ACATCTTAGCCTTTGCGGCGC	0.502													3	71	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	18730127	18730127	+	IGR	DEL	G	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18730127delG								IGSF21 (25151 upstream) : KLHDC7A (77297 downstream)																							ctggggggaaggcttaccagt	0.114													4	2	---	---	---	---	
HTR6	3362	broad.mit.edu	37	1	20005323	20005324	+	Intron	DEL	GT	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20005323_20005324delGT	uc001bcl.2	+							NM_000871	NP_000862	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6						G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	histamine receptor activity|protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Granisetron(DB00889)|Ondansetron(DB00904)|Sertindole(DB06144)	CTCGTGGTGCGTGTGTGTGTGT	0.678													47	7	---	---	---	---	
SESN2	83667	broad.mit.edu	37	1	28595624	28595639	+	Intron	DEL	AGGCTGGATAGGTAAT	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28595624_28595639delAGGCTGGATAGGTAAT	uc001bps.2	+							NM_031459	NP_113647	P58004	SESN2_HUMAN	sestrin 2						cell cycle arrest	cytoplasm|nucleus				skin(3)|ovary(2)|pancreas(1)|lung(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		TAGGAGGAAGAGGCTGGATAGGTAATAATCCTCTTT	0.523													67	20	---	---	---	---	
CELF3	11189	broad.mit.edu	37	1	151677284	151677285	+	Intron	INS	-	GT	GT	rs138717096	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151677284_151677285insGT	uc001eys.1	-						CELF3_uc010pdh.1_Intron|CELF3_uc001eyr.2_Intron|CELF3_uc009wmy.2_Intron|CELF3_uc009wmx.1_Intron	NM_007185	NP_009116	Q5SZQ8	CELF3_HUMAN	trinucleotide repeat containing 4						nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding			ovary(1)|central_nervous_system(1)	2						GGTCACGGAGGGTGTGTGTGTG	0.460													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185815256	185815256	+	Intron	DEL	G	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185815256delG	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GTGTTCTCTTGGGGGAATGGA	0.303													30	14	---	---	---	---	
C1orf55	163859	broad.mit.edu	37	1	226180816	226180816	+	Intron	DEL	C	-	-	rs66975923		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226180816delC	uc001hpu.3	-						C1orf55_uc001hpv.2_Intron	NM_152608	NP_689821	Q6IQ49	CA055_HUMAN	hypothetical protein LOC163859											lung(1)	1	Breast(184;0.197)					TACTTTCTTTCTTTTTTTTTT	0.303													4	2	---	---	---	---	
NAGK	55577	broad.mit.edu	37	2	71304485	71304485	+	Intron	DEL	T	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71304485delT	uc002shp.3	+						NAGK_uc010fea.2_Intron|NAGK_uc002shq.3_Intron|NAGK_uc002shr.2_Intron	NM_017567	NP_060037	Q9UJ70	NAGK_HUMAN	N-Acetylglucosamine kinase						N-acetylglucosamine metabolic process|N-acetylmannosamine metabolic process		ATP binding|N-acetylglucosamine kinase activity|protein binding				0					N-Acetyl-D-glucosamine(DB00141)	TGCTTAACGCTTTTTCCTTCC	0.393													4	2	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113147931	113147933	+	Intron	DEL	ATG	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113147931_113147933delATG	uc002ths.1	-						RGPD8_uc010fkk.1_Intron|RGPD5_uc002tht.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						gttaacaataatgatgatgatga	0.123													8	4	---	---	---	---	
DNAH7	56171	broad.mit.edu	37	2	196681466	196681467	+	Frame_Shift_Ins	INS	-	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196681466_196681467insA	uc002utj.3	-	51	9747_9748	c.9646_9647insT	c.(9646-9648)TCTfs	p.S3216fs		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3216					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ATCAGCAAGAGAAAAAAATAGG	0.411													96	12	---	---	---	---	
USP37	57695	broad.mit.edu	37	2	219352921	219352921	+	Intron	DEL	G	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219352921delG	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		aaaaaaaaaagaaaagaaAAG	0.104													4	5	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10081677	10081677	+	Intron	DEL	A	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10081677delA	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc003buv.2_3'UTR	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GATTTGACTTAAAAAAAAAAG	0.239			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	53099204	53099207	+	IGR	DEL	TCTT	-	-	rs56856737		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53099204_53099207delTCTT								SFMBT1 (19134 upstream) : RFT1 (23296 downstream)																							tttctctttctctttctttctttc	0.049													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	19815894	19815895	+	IGR	INS	-	A	A	rs145239076		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19815894_19815895insA								None (None upstream) : SLIT2 (439340 downstream)																							CTCTGGGCTGTaaaaaaaaaaa	0.218													6	3	---	---	---	---	
ADAMTS3	9508	broad.mit.edu	37	4	73174951	73174951	+	Intron	DEL	T	-	-	rs76753805		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73174951delT	uc003hgk.1	-						ADAMTS3_uc003hgl.2_Intron	NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAGTGATTTCTTTTTTTTTTT	0.254													4	2	---	---	---	---	
SMAD1	4086	broad.mit.edu	37	4	146479247	146479247	+	3'UTR	DEL	C	-	-	rs67615455		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146479247delC	uc003ikc.2	+	7					SMAD1_uc003ikd.2_3'UTR|SMAD1_uc010iov.2_3'UTR|SMAD1_uc011cic.1_3'UTR	NM_005900	NP_005891	Q15797	SMAD1_HUMAN	Sma- and Mad-related protein 1						BMP signaling pathway|embryonic pattern specification|primary miRNA processing|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|nuclear inner membrane	co-SMAD binding|I-SMAD binding|identical protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity			ovary(1)	1	all_hematologic(180;0.151)					AAAAAAAAAACACACACACCT	0.328											OREG0016348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
WWC2	80014	broad.mit.edu	37	4	184210943	184210943	+	Intron	DEL	T	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184210943delT	uc010irx.2	+						WWC2_uc003ivk.3_Intron|WWC2_uc003ivl.3_Intron|WWC2_uc010iry.2_Intron|WWC2_uc003ivn.3_Intron|WWC2_uc010irz.2_Intron|WWC2_uc003ivo.3_Intron	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2											ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TTATAGGCCCTTTTTTTTTTT	0.453													6	3	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	10981719	10981720	+	Intron	DEL	AG	-	-	rs58618024	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10981719_10981720delAG	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						acacacacacagagacacacac	0.386													4	5	---	---	---	---	
NUP153	9972	broad.mit.edu	37	6	17669073	17669074	+	Intron	INS	-	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17669073_17669074insA	uc003ncd.1	-						NUP153_uc011dje.1_Intron|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			gactgagactcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
COL12A1	1303	broad.mit.edu	37	6	75798722	75798722	+	Intron	DEL	C	-	-	rs672648		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75798722delC	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						gtctcaaaaacaaaaaaaaga	0.184													5	3	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117645483	117645485	+	Intron	DEL	TAT	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117645483_117645485delTAT	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTAAAAATTCTATTATACTTACC	0.291			T	GOPC|ROS1	glioblastoma|NSCLC								51	15	---	---	---	---	
LOC389458	389458	broad.mit.edu	37	7	5036852	5036852	+	Intron	DEL	T	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5036852delT	uc003snr.2	+						RNF216L_uc003snp.3_RNA|RNF216L_uc003snq.3_RNA|RNF216L_uc010ksr.2_RNA|RNF216L_uc011jwe.1_RNA					Synthetic construct DNA, clone: pF1KB3788, Homo sapiens RBAK gene for RB-associated KRAB repressor, complete cds, without stop codon, in Flexi system.												0						AGCACAGAACTTTTTTCCCAA	0.562													4	2	---	---	---	---	
GUSB	2990	broad.mit.edu	37	7	65440854	65440854	+	Intron	DEL	G	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65440854delG	uc003tun.2	-						GUSB_uc011kdt.1_Intron|GUSB_uc010kzw.1_Frame_Shift_Del_p.L187fs	NM_000181	NP_000172	P08236	BGLR_HUMAN	glucuronidase, beta precursor						glycosaminoglycan catabolic process	lysosome	beta-glucuronidase activity|cation binding				0						aaaaaaaaaagaaaaTGGGCC	0.284													4	2	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100349724	100349724	+	Frame_Shift_Del	DEL	G	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100349724delG	uc003uwj.2	+	14	2161	c.1996delG	c.(1996-1998)GAGfs	p.E666fs	ZAN_uc003uwk.2_Frame_Shift_Del_p.E666fs|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	666	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CACCCCCACTGAGGAGACCAC	0.537													34	15	---	---	---	---	
LRWD1	222229	broad.mit.edu	37	7	102106858	102106861	+	Intron	DEL	TTTA	-	-	rs66463732		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106858_102106861delTTTA	uc003uzn.2	+						ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_Intron	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain						chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GATGTGCTACtttatttatttatt	0.260													4	3	---	---	---	---	
PRSS3	5646	broad.mit.edu	37	9	33796520	33796521	+	Intron	INS	-	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33796520_33796521insA	uc003ztj.3	+						uc003ztk.1_Intron|PRSS3_uc003zti.3_Intron|PRSS3_uc003ztl.3_Intron	NM_007343	NP_031369	P35030	TRY3_HUMAN	mesotrypsin isoform 1 preproprotein						digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)			AGCGCTCCCTCCCTTGCCTGGC	0.589													57	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430022	68430025	+	IGR	DEL	CAAA	-	-	rs112735354		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430022_68430025delCAAA								FAM27B (635833 upstream) : MIR1299 (572214 downstream)																							ctcctgggctcaaacaatcctcct	0.074													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	81651372	81651372	+	IGR	DEL	A	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81651372delA								PSAT1 (706365 upstream) : TLE4 (535506 downstream)																							CCACTTTGCCATCCACTGTCT	0.502													4	2	---	---	---	---	
SLC28A3	64078	broad.mit.edu	37	9	86895090	86895090	+	Intron	DEL	T	-	-	rs35540005		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86895090delT	uc010mpz.2	-						SLC28A3_uc011lsy.1_Intron|SLC28A3_uc004anu.1_Intron	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						GTCAGCTGACTTTTTTTTTTT	0.383													4	2	---	---	---	---	
EGFL7	51162	broad.mit.edu	37	9	139565377	139565378	+	Intron	INS	-	C	C			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139565377_139565378insC	uc004cid.2	+						EGFL7_uc004cif.2_Intron|EGFL7_uc004cig.2_RNA|EGFL7_uc010nbp.2_Intron|EGFL7_uc004cie.2_Intron|EGFL7_uc004cih.2_Intron	NM_201446	NP_958854	Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7						angiogenesis|vasculogenesis		calcium ion binding			ovary(1)	1	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		GCCGGCCGTGACCCAGCGCCTG	0.688													6	4	---	---	---	---	
AKR1C1	1645	broad.mit.edu	37	10	5006252	5006253	+	Intron	INS	-	A	A	rs10664133		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5006252_5006253insA	uc001iho.2	+						AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc009xhx.2_Intron|AKR1C1_uc001ihq.2_Intron	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	CTCATTTTAAGAAAAAAAAAAT	0.287													4	2	---	---	---	---	
PTF1A	256297	broad.mit.edu	37	10	23482393	23482393	+	Intron	DEL	T	-	-	rs72117811		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23482393delT	uc001irp.2	+							NM_178161	NP_835455	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a						endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex				pancreas(1)|skin(1)	2						GCGTTTCTCGttttttttttt	0.587													4	3	---	---	---	---	
CTBP2	1488	broad.mit.edu	37	10	126714531	126714532	+	Intron	DEL	GT	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126714531_126714532delGT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|CTBP2_uc001lie.3_Intron	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TTGTTTGGTGGTGTGTGTGTGT	0.574													30	7	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69998441	69998442	+	Intron	DEL	AA	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69998441_69998442delAA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						actccatctcaaaaaaaaaaaa	0.124													4	2	---	---	---	---	
SIDT2	51092	broad.mit.edu	37	11	117054354	117054355	+	Intron	INS	-	A	A			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117054354_117054355insA	uc001pqh.1	+						SIDT2_uc010rxe.1_Intron|SIDT2_uc001pqg.2_Intron|SIDT2_uc001pqi.1_Intron	NM_001040455	NP_001035545	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2 precursor							integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		aactccgtctcaaaaaaaaaaa	0.025													4	2	---	---	---	---	
KIAA1704	55425	broad.mit.edu	37	13	45580181	45580181	+	Intron	DEL	G	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45580181delG	uc001uzq.2	+						KIAA1704_uc010tfo.1_Intron|KIAA1704_uc001uzr.1_Intron|KIAA1704_uc001uzs.2_Intron|KIAA1704_uc001uzt.2_Intron	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425											pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		aaaaaaaaaagaaCTATCGTA	0.124													4	2	---	---	---	---	
LOC220429	220429	broad.mit.edu	37	13	50464697	50464698	+	5'UTR	INS	-	G	G	rs140429392	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50464697_50464698insG	uc001vdk.2	+	1						NR_003268				Homo sapiens CTAGE family, member 5 pseudogene, mRNA (cDNA clone IMAGE:5270026).												0						CCTGGGTTACTGCGGCCACCGC	0.639													2	4	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111164629	111164630	+	3'UTR	DEL	AA	-	-	rs5806862		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111164629_111164630delAA	uc001vqx.2	+	48						NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TTTTTTTCTTAAAAAAAAAAAA	0.485													3	3	---	---	---	---	
MIPOL1	145282	broad.mit.edu	37	14	37754802	37754802	+	Intron	DEL	T	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37754802delT	uc001wuc.2	+						MIPOL1_uc010amr.2_Intron|MIPOL1_uc001wub.3_Intron|MIPOL1_uc001wud.2_Intron|MIPOL1_uc010ams.2_Intron|MIPOL1_uc001wue.2_Intron|MIPOL1_uc010amt.2_Intron	NM_138731	NP_620059	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1											ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		ttttcttttcttttttttttt	0.144													4	2	---	---	---	---	
NRG4	145957	broad.mit.edu	37	15	76248134	76248134	+	Intron	DEL	A	-	-	rs146303179		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76248134delA	uc002bbo.2	-						NRG4_uc010bkm.1_Intron|NRG4_uc002bbn.2_Intron|NRG4_uc010bkn.2_Intron|NRG4_uc010bko.2_Intron	NM_138573	NP_612640	Q8WWG1	NRG4_HUMAN	neuregulin 4							extracellular region|integral to membrane|plasma membrane	growth factor activity				0						GTACCTGGCCAAAAAAAAAAA	0.284													5	3	---	---	---	---	
CD68	968	broad.mit.edu	37	17	7483262	7483263	+	Frame_Shift_Del	DEL	CA	-	-	rs143998725		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7483262_7483263delCA	uc002ghv.2	+	2	375_376	c.184_185delCA	c.(184-186)CACfs	p.H62fs	CD68_uc002ghu.2_Frame_Shift_Del_p.H35fs	NM_001251	NP_001242	P34810	CD68_HUMAN	CD68 antigen isoform A	62	Mucin-like.|Extracellular (Potential).					endosome membrane|integral to membrane|lysosomal membrane|membrane fraction|plasma membrane					0						Aaccaccactcacaggacaacc	0.317													24	14	---	---	---	---	
FAM18B2	201158	broad.mit.edu	37	17	15406041	15406064	+	3'UTR	DEL	TCTCTTTCTCTCTCCTCTCTCCCG	-	-	rs149635358	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15406041_15406064delTCTCTTTCTCTCTCCTCTCTCCCG	uc002goq.2	-	6					CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron	NM_145301	NP_660344	Q96ET8	F18B2_HUMAN	hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)		ctcctctctctctctttctctctcctctctcccgtctctttctc	0.241													5	3	---	---	---	---	
CYTSB	92521	broad.mit.edu	37	17	20209172	20209172	+	Intron	DEL	T	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20209172delT	uc002gwq.2	+						CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Intron	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						AACCTGTTGATTTTTTTTTTT	0.279													4	2	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377712	45377713	+	Intron	INS	-	GT	GT	rs10221263	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377712_45377713insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CGCGCGCGCGCgtgtgtgtgtg	0.510													3	3	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626922	73626923	+	Intron	INS	-	T	T	rs56158987		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626922_73626923insT	uc010dgl.2	-						RECQL5_uc010dgk.2_Intron|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TCTCATCTGTGGGGGGGGGGGG	0.649								Other_identified_genes_with_known_or_suspected_DNA_repair_function					3	3	---	---	---	---	
C18orf8	29919	broad.mit.edu	37	18	21089321	21089322	+	Intron	DEL	AT	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21089321_21089322delAT	uc010xax.1	+						C18orf8_uc010xau.1_Intron|C18orf8_uc010xav.1_Intron|C18orf8_uc010xaw.1_Intron|C18orf8_uc002kul.2_Intron	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1											ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TCAGTACTGaatatatatatat	0.168													6	4	---	---	---	---	
ANKRD27	84079	broad.mit.edu	37	19	33108660	33108660	+	Intron	DEL	T	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33108660delT	uc002ntn.1	-							NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					TCTGATTTAGttttttttttt	0.109													5	3	---	---	---	---	
RBCK1	10616	broad.mit.edu	37	20	409871	409871	+	Intron	DEL	T	-	-			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:409871delT	uc002wdp.3	+						RBCK1_uc002wdq.3_Intron|RBCK1_uc010fzy.2_Intron|RBCK1_uc002wdr.3_Intron	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing						interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				gaggtaagaattttttttttt	0.075													6	5	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36708400	36708401	+	Intron	INS	-	A	A	rs143290016	by1000genomes	TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36708400_36708401insA	uc003apg.2	-						MYH9_uc003aph.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						CCAGGAGAAGCAAAGCACTGTT	0.574			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				4	2	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43459641	43459641	+	Intron	DEL	T	-	-	rs77325620		TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43459641delT	uc003bdi.2	-						TTLL1_uc010gzh.2_Intron|TTLL1_uc003bdj.2_Intron|TTLL1_uc003bdh.2_Intron	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		aatttccgtattttttttttt	0.000													4	2	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1501563	1501564	+	3'UTR	INS	-	T	T			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1501563_1501564insT	uc004cps.2	+	12					IL3RA_uc011mhd.1_3'UTR	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TGATAAAGTGATTTTTTTTTTT	0.426													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	140233410	140233411	+	IGR	INS	-	AAAAT	AAAAT			TCGA-G9-6364-01	TCGA-G9-6364-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140233410_140233411insAAAAT								SPANXB2 (147540 upstream) : LDOC1 (36529 downstream)																							GTTTATGTTAAaaaataaaata	0.178													7	4	---	---	---	---	
