Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PER3	8863	broad.mit.edu	37	1	7890010	7890010	+	Silent	SNP	A	G	G	rs11576985	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7890010A>G	uc001aoo.2	+	18	3151	c.2976A>G	c.(2974-2976)ACA>ACG	p.T992T	PER3_uc009vmg.1_Silent_p.T1000T|PER3_uc009vmh.1_Silent_p.T993T|PER3_uc001aop.2_Silent_p.T1001T|PER3_uc010nzw.1_Silent_p.T681T	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	992	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTGTCCACAGGATCGCCTC	0.582													6	85	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918783	16918783	+	5'UTR	SNP	C	T	T			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918783C>T	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GTGAGGTAGACTGTGGCCAGC	0.507													3	16	---	---	---	---	PASS
RBM15	64783	broad.mit.edu	37	1	110884731	110884731	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110884731G>C	uc001dzl.1	+	1	2787	c.2704G>C	c.(2704-2706)GGG>CGG	p.G902R	RBM15_uc001dzm.1_Missense_Mutation_p.G902R|uc001dzj.2_5'Flank	NM_022768	NP_073605	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	902	SPOC.				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCAGGCAGCCGGGGTGATCAG	0.552			T	MKL1	acute megakaryocytic leukemia								7	114	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803746	142803746	+	Intron	SNP	A	G	G			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803746A>G	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		actatggattagagctgatta	0.000													2	7	---	---	---	---	PASS
DENND4B	9909	broad.mit.edu	37	1	153907306	153907306	+	Silent	SNP	T	C	C	rs12567786	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153907306T>C	uc001fdd.1	-	18	3104	c.2703A>G	c.(2701-2703)CAA>CAG	p.Q901Q	uc001fdc.1_RNA	NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	901	Gln-rich.									ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgttgctgctgct	0.473													4	86	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44153050	44153050	+	Silent	SNP	T	C	C			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44153050T>C	uc002rtr.2	-	26	2845	c.2787A>G	c.(2785-2787)AGA>AGG	p.R929R	LRPPRC_uc010yob.1_Silent_p.R829R	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	929					mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTGCAACACATCTGTCACAAA	0.413													6	85	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137814268	137814268	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137814268C>A	uc002tva.1	+	2	325	c.325C>A	c.(325-327)CAC>AAC	p.H109N	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGGACTGCAGCACCGGATGGT	0.547													8	89	---	---	---	---	PASS
NOSTRIN	115677	broad.mit.edu	37	2	169681151	169681151	+	Silent	SNP	C	T	T	rs3732031	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169681151C>T	uc002ueg.2	+	3	125	c.121C>T	c.(121-123)CTG>TTG	p.L41L	NOSTRIN_uc002uef.2_Silent_p.L41L|NOSTRIN_uc002uei.2_5'UTR|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_5'UTR|NOSTRIN_uc002uej.2_5'UTR	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2	41	FCH.				endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						CAGGGCAAACCTGGAAATTAG	0.299													3	48	---	---	---	---	PASS
NOP58	51602	broad.mit.edu	37	2	203149110	203149110	+	Nonsense_Mutation	SNP	G	T	T			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203149110G>T	uc002uzb.2	+	5	490	c.340G>T	c.(340-342)GAA>TAA	p.E114*	NOP58_uc010zhv.1_Nonsense_Mutation_p.E114*	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog	114					cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						TGTTGTTAATGAACTTATGAG	0.373													3	46	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220162727	220162727	+	Silent	SNP	C	A	A			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220162727C>A	uc002vkz.2	-	13	1856	c.1767G>T	c.(1765-1767)GGG>GGT	p.G589G	PTPRN_uc010zlc.1_Silent_p.G499G|PTPRN_uc002vla.2_Silent_p.G560G	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	589	Helical; (Potential).				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CCACCAGCAGCCCAGCCACAC	0.677													7	57	---	---	---	---	PASS
MFI2	4241	broad.mit.edu	37	3	196743130	196743130	+	Silent	SNP	T	C	C	rs6779362	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196743130T>C	uc003fxk.3	-	8	1124	c.1011A>G	c.(1009-1011)ACA>ACG	p.T337T		NM_005929	NP_005920	P08582	TRFM_HUMAN	melanoma-associated antigen p97 isoform 1	337	Transferrin-like 1.				cellular iron ion homeostasis|iron ion transport	anchored to membrane|extracellular region|integral to plasma membrane	ferric iron binding|protein binding				0	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CATAGGTCTGTGTGGCGATGG	0.592													4	59	---	---	---	---	PASS
LOC220729	220729	broad.mit.edu	37	3	197348668	197348668	+	RNA	SNP	C	G	G	rs79940815	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197348668C>G	uc011bug.1	-	4		c.423G>C			LOC220729_uc003fxw.2_RNA|LOC220729_uc003fxy.2_RNA|LOC220729_uc010iao.1_Intron					Homo sapiens cDNA FLJ60865 complete cds, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC 1.3.5.1).												0						ACTTGAGGCTCTGTCCACCAA	0.488													4	107	---	---	---	---	PASS
UGT2A1	10941	broad.mit.edu	37	4	70460328	70460328	+	Missense_Mutation	SNP	C	T	T	rs4148304	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70460328C>T	uc003hem.3	-	5	1234	c.1171G>A	c.(1171-1173)GTT>ATT	p.V391I	UGT2A1_uc011caq.1_Missense_Mutation_p.V557I|UGT2A1_uc010ihu.2_Missense_Mutation_p.V391I|UGT2A1_uc010iht.2_Missense_Mutation_p.V347I|UGT2A1_uc010ihs.2_Missense_Mutation_p.V392I	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,	391	Extracellular (Potential).				detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						AACATGGGAACTCCCACCATA	0.448													3	65	---	---	---	---	PASS
MIR1274A	100302199	broad.mit.edu	37	5	41475766	41475766	+	RNA	SNP	C	T	T	rs318039	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41475766C>T	hsa-mir-1274a|MI0006410	+			c.33C>T			PLCXD3_uc003jmm.1_Intron																	0						CAGGCGCCACCtgtggctgtc	0.090													8	368	---	---	---	---	PASS
ADAMTS2	9509	broad.mit.edu	37	5	178555106	178555106	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178555106C>A	uc003mjw.2	-	17	2471	c.2471G>T	c.(2470-2472)GGA>GTA	p.G824V		NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	824	Spacer.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CCGGGTGTCTCCCACCGGGAT	0.577													4	59	---	---	---	---	PASS
BTNL8	79908	broad.mit.edu	37	5	180374523	180374523	+	Missense_Mutation	SNP	G	A	A	rs7724813	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180374523G>A	uc003mmp.2	+	4	919	c.685G>A	c.(685-687)GAG>AAG	p.E229K	BTNL8_uc003mmq.2_Missense_Mutation_p.E229K|BTNL8_uc011dhg.1_Missense_Mutation_p.E104K|BTNL8_uc010jll.2_Missense_Mutation_p.E229K|BTNL8_uc010jlm.2_Missense_Mutation_p.E113K|BTNL8_uc011dhh.1_Missense_Mutation_p.E45K	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor	229	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TACCTTTTTCGAGCCTATATC	0.398													7	296	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43540887	43540887	+	Silent	SNP	A	C	C	rs17339479	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43540887A>C	uc003tid.1	+	21	4202	c.3597A>C	c.(3595-3597)CGA>CGC	p.R1199R	HECW1_uc011kbi.1_Silent_p.R1165R	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	1199					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						TCTCTCCCCGATGTTCACCCT	0.473													4	83	---	---	---	---	PASS
GNAQ	2776	broad.mit.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	A	A	rs139963842	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80537112T>A	uc004akw.2	-	2	327	c.286A>T	c.(286-288)ACA>TCA	p.T96S		NM_002072	NP_002063	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein),	96					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity			eye(136)|skin(44)|meninges(11)|ovary(1)|kidney(1)	193						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma								6	112	---	---	---	---	PASS
TMEM132A	54972	broad.mit.edu	37	11	60696173	60696173	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60696173G>T	uc001nqj.2	+	4	800	c.607G>T	c.(607-609)GCC>TCC	p.A203S	TMEM132A_uc001nqi.2_Missense_Mutation_p.A203S|TMEM132A_uc001nqk.2_Missense_Mutation_p.A216S|TMEM132A_uc001nql.1_Missense_Mutation_p.A216S	NM_178031	NP_821174	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform b	203	Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				skin(1)	1						CACCACACGGGCCGAGCTGGC	0.682													8	43	---	---	---	---	PASS
TMEM216	51259	broad.mit.edu	37	11	61161357	61161357	+	Silent	SNP	T	G	G			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61161357T>G	uc010rlj.1	+	3	410	c.117T>G	c.(115-117)GGT>GGG	p.G39G	TMEM216_uc001nrn.1_5'UTR	NM_016499	NP_057583	Q9P0N5	TM216_HUMAN	transmembrane protein 216	39						integral to membrane					0						TATTGGCAGGTGTCCTGCTAC	0.438													14	37	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	1989018	1989018	+	Silent	SNP	T	C	C	rs60945277	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1989018T>C	uc001qjp.2	-	14	1746	c.1515A>G	c.(1513-1515)ACA>ACG	p.T505T	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Silent_p.T393T	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	505	Cache.|Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		TGGTGAGCAGTGTCAGGCTCT	0.607													2	9	---	---	---	---	PASS
LOC653113	653113	broad.mit.edu	37	12	8384397	8384397	+	RNA	SNP	C	T	T			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8384397C>T	uc010sgk.1	-	5		c.1391G>A				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						CCCCAGGGCCCCTGCTGTCCT	0.587													3	61	---	---	---	---	PASS
LOC653113	653113	broad.mit.edu	37	12	8384412	8384412	+	RNA	SNP	G	A	A			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8384412G>A	uc010sgk.1	-	5		c.1376C>T				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						TGTCCTTCCCGCAGCTTCTTC	0.582													7	62	---	---	---	---	PASS
MLEC	9761	broad.mit.edu	37	12	121134394	121134394	+	3'UTR	SNP	A	C	C			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121134394A>C	uc001tyy.1	+	5						NM_014730	NP_055545	Q14165	MLEC_HUMAN	malectin precursor						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	carbohydrate binding			ovary(1)	1						TGGGAAAGAAACCAGCCATAT	0.423													19	82	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19415742	19415742	+	RNA	SNP	T	C	C			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19415742T>C	uc010tcj.1	-	1		c.30368A>G				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						GCTGTTTTCCTAATCTTTCTT	0.313													3	67	---	---	---	---	PASS
PSMA6	5687	broad.mit.edu	37	14	35782253	35782253	+	Silent	SNP	A	G	G	rs4665	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35782253A>G	uc001wtd.2	+	5	685	c.576A>G	c.(574-576)GAA>GAG	p.E192E	KIAA0391_uc001wta.2_RNA|PSMA6_uc010tpt.1_Silent_p.E113E|PSMA6_uc010tpu.1_Silent_p.E113E	NM_002791	NP_002782	P60900	PSA6_HUMAN	proteasome alpha 6 subunit	192					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nuclear matrix|polysome|proteasome core complex, alpha-subunit complex|sarcomere	NF-kappaB binding|purine ribonucleoside triphosphate binding|RNA binding|threonine-type endopeptidase activity				0	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		GGACATTTGAACAGACAGTGG	0.363													4	135	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20657740	20657740	+	Missense_Mutation	SNP	T	C	C	rs143411031	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20657740T>C	uc001ytg.2	-	16	2238	c.1529A>G	c.(1528-1530)CAA>CGA	p.Q510R	uc010tyx.1_RNA|uc001yth.3_Missense_Mutation_p.Q510R|uc010tyy.1_Missense_Mutation_p.Q510R|uc010tyz.1_3'UTR					RecName: Full=Putative HERC2-like protein 3;																		GAAGTGGGCTTGCGGGATGGT	0.592													3	44	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515335	102515335	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515335C>G	uc002cdi.2	+	9	1979	c.559C>G	c.(559-561)CTG>GTG	p.L187V	WASH3P_uc002cdl.2_Missense_Mutation_p.L187V|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.L187V|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						GGAGCGAAAGCTGGAGAAGAA	0.652													4	12	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74445808	74445808	+	Intron	SNP	T	C	C	rs146209466	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74445808T>C	uc002fct.2	-						CLEC18B_uc002fcu.2_Intron|CLEC18B_uc010vmu.1_3'UTR|CLEC18B_uc010vmv.1_Intron	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region	sugar binding				0						GGGTcaggagtgagctggtca	0.294													3	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161902	90161902	+	3'UTR	SNP	A	G	G	rs6500471	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161902A>G	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		ATATGTTCCAAGACCCTAAAA	0.537													3	32	---	---	---	---	PASS
NLRP1	22861	broad.mit.edu	37	17	5485367	5485367	+	Missense_Mutation	SNP	A	T	T	rs12150220	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5485367A>T	uc002gci.2	-	3	1019	c.464T>A	c.(463-465)CTC>CAC	p.L155H	NLRP1_uc002gcg.1_Missense_Mutation_p.L155H|NLRP1_uc002gck.2_Missense_Mutation_p.L155H|NLRP1_uc002gcj.2_Missense_Mutation_p.L155H|NLRP1_uc002gcl.2_Missense_Mutation_p.L155H|NLRP1_uc002gch.3_Missense_Mutation_p.L155H|NLRP1_uc010clh.2_Missense_Mutation_p.L155H	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	155					defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				TTGGTAGAGGAGTGAGGCAGA	0.418													3	48	---	---	---	---	PASS
MRM1	79922	broad.mit.edu	37	17	34964853	34964853	+	3'UTR	SNP	G	A	A	rs148063042	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34964853G>A	uc002hne.2	+	5					MRM1_uc002hnf.2_3'UTR	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog						RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		GAGGGCTGACGTGGACTGTCC	0.637													4	69	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274087	39274087	+	Missense_Mutation	SNP	G	C	C	rs141357429	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274087G>C	uc002hvz.2	-	1	520	c.481C>G	c.(481-483)CTG>GTG	p.L161V		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	161	27.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACTGGACGCAGGcagcagcag	0.323													3	14	---	---	---	---	PASS
KRT31	3881	broad.mit.edu	37	17	39553811	39553811	+	5'UTR	SNP	G	T	T	rs6503629	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39553811G>T	uc002hwn.2	-	1					KRT31_uc010cxn.2_5'UTR	NM_002277	NP_002268	Q15323	K1H1_HUMAN	keratin 31						epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000496)				AGGGAGGGAGGGAGTGCCTGG	0.617													10	7	---	---	---	---	PASS
SRP68	6730	broad.mit.edu	37	17	74057619	74057619	+	Nonsense_Mutation	SNP	C	A	A			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74057619C>A	uc002jqk.1	-	5	633	c.598G>T	c.(598-600)GAA>TAA	p.E200*	SRP68_uc010wsu.1_Nonsense_Mutation_p.E99*|SRP68_uc002jql.1_Nonsense_Mutation_p.E162*	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	200					response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						TCTTGATGTTCAAAACGTAGC	0.433													3	38	---	---	---	---	PASS
ZNF177	7730	broad.mit.edu	37	19	9492370	9492370	+	Missense_Mutation	SNP	A	T	T	rs2230752	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9492370A>T	uc002mli.2	+	12	1546	c.883A>T	c.(883-885)ATT>TTT	p.I295F	ZNF177_uc002mlj.2_Missense_Mutation_p.I245F|ZNF177_uc002mlk.2_Missense_Mutation_p.I295F	NM_003451	NP_003442	Q13360	ZN177_HUMAN	zinc finger protein 177	295	C2H2-type 7.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTATAAATGTATTCAGTGTGA	0.428													6	216	---	---	---	---	PASS
RDH8	50700	broad.mit.edu	37	19	10129552	10129552	+	Missense_Mutation	SNP	C	G	G	rs1122206	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10129552C>G	uc002mmr.2	+	3	657	c.408C>G	c.(406-408)CAC>CAG	p.H136Q		NM_015725	NP_056540	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	136					estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity			ovary(3)|pancreas(1)	4			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	GGCAGGGCCACATCGTGGTGA	0.582													4	120	---	---	---	---	PASS
ZNF681	148213	broad.mit.edu	37	19	23927344	23927344	+	Silent	SNP	T	C	C	rs112856587		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23927344T>C	uc002nrk.3	-	4	1150	c.1008A>G	c.(1006-1008)AAA>AAG	p.K336K	ZNF681_uc002nrl.3_Silent_p.K267K|ZNF681_uc002nrj.3_Silent_p.K267K	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	336					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ATTTGTAGGGTTTCTCTCCAG	0.403													4	81	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40392347	40392347	+	Missense_Mutation	SNP	C	G	G	rs139175656	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40392347C>G	uc002omp.3	-	16	8165	c.8157G>C	c.(8155-8157)CAG>CAC	p.Q2719H		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	2719				Q -> H (in Ref. 1; BAA19526).		extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGGGCTCCACCTGGCCTCCAG	0.592													7	36	---	---	---	---	PASS
VPS16	64601	broad.mit.edu	37	20	2840773	2840773	+	Silent	SNP	C	T	T	rs3818605	byFrequency	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2840773C>T	uc002whe.2	+	3	264	c.216C>T	c.(214-216)TCC>TCT	p.S72S	VPS16_uc002whh.2_5'Flank|VPS16_uc002whf.2_Silent_p.S72S|VPS16_uc002whd.2_RNA|VPS16_uc002whg.2_5'Flank	NM_022575	NP_072097	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 isoform 1	72					intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome				ovary(2)|pancreas(1)|skin(1)	4						ACTCTGCTTCCGGCATGCCTC	0.577													4	84	---	---	---	---	PASS
TTLL9	164395	broad.mit.edu	37	20	30527065	30527065	+	Silent	SNP	T	C	C	rs6061043	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30527065T>C	uc010gdx.1	+	14	1492	c.1239T>C	c.(1237-1239)CAT>CAC	p.H413H	TTLL9_uc002wwy.1_RNA|TTLL9_uc002wwz.1_Intron|TTLL9_uc002wxa.1_RNA|TTLL9_uc002wxb.1_RNA|TTLL9_uc010zto.1_RNA|TTLL9_uc002wxc.2_Silent_p.H315H|TTLL9_uc010ztp.1_Intron|TTLL9_uc010ztq.1_RNA	NM_001008409	NP_001008409	Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	413					protein modification process	cilium|microtubule|microtubule basal body	ATP binding|tubulin-tyrosine ligase activity			ovary(2)	2			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCAACACACATCTCGGTATGT	0.542													4	55	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40670167	40670167	+	Intron	SNP	T	A	A	rs2836979	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40670167T>A	uc002yxk.1	-						BRWD1_uc002yxl.2_Intron|BRWD1_uc002yxm.2_3'UTR	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				AACTTTTTAATGCAGAAGGAC	0.274													2	2	---	---	---	---	PASS
MAP7D3	79649	broad.mit.edu	37	X	135310785	135310785	+	Missense_Mutation	SNP	T	C	C	rs2273221	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135310785T>C	uc004ezt.2	-	11	1974	c.1883A>G	c.(1882-1884)CAA>CGA	p.Q628R	MAP7D3_uc004ezs.2_Missense_Mutation_p.Q592R|MAP7D3_uc011mwc.1_Missense_Mutation_p.Q610R|MAP7D3_uc010nsa.1_Missense_Mutation_p.Q586R	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	628	Potential.					cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					TGCTGACCTTTGCTGCATTTC	0.398													3	47	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	31128088	31128099	+	IGR	DEL	TGGTGGTGGTGA	-	-	rs77486301	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128088_31128099delTGGTGGTGGTGA								None (None upstream) : MATN1 (56027 downstream)																							cttgtggtagtggtggtggtgatggtggtggt	0.000													3	3	---	---	---	---	
UBAP2L	9898	broad.mit.edu	37	1	154223324	154223324	+	Intron	DEL	A	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154223324delA	uc001fep.3	+						UBAP2L_uc009wot.2_Intron|UBAP2L_uc010pek.1_Intron|UBAP2L_uc010pel.1_Intron|UBAP2L_uc010pen.1_Intron	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a						binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			ctcccatctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	186115161	186115162	+	Intron	INS	-	A	A			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186115161_186115162insA	uc001grq.1	+						HMCN1_uc001grs.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GGTGGAATTAGAAAAAAAAAAA	0.317													6	5	---	---	---	---	
KCNH1	3756	broad.mit.edu	37	1	211277050	211277051	+	Intron	DEL	AC	-	-	rs113338326		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211277050_211277051delAC	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		gtactgtggaacacaCACACAC	0.114													4	2	---	---	---	---	
KBTBD10	10324	broad.mit.edu	37	2	170371545	170371546	+	Intron	INS	-	T	T			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170371545_170371546insT	uc002ueu.1	+						KBTBD10_uc010zdh.1_Intron	NM_006063	NP_006054	O60662	KBTBA_HUMAN	kelch repeat and BTB (POZ) domain containing 10						striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0						Cttttcttttcttttttttttt	0.163													5	4	---	---	---	---	
SLC6A6	6533	broad.mit.edu	37	3	14509843	14509843	+	Intron	DEL	A	-	-	rs142706263	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14509843delA	uc010heg.2	+						SLC6A6_uc003byq.2_Intron|SLC6A6_uc003byr.2_Intron	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter						cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						TCTAAAATGGACCCCCCCCCC	0.522											OREG0015421	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
ARL6IP5	10550	broad.mit.edu	37	3	69153414	69153415	+	Intron	INS	-	A	A	rs35189946		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69153414_69153415insA	uc003dnr.2	+							NM_006407	NP_006398	O75915	PRAF3_HUMAN	ADP-ribosylation-like factor 6 interacting						L-glutamate transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.78e-05)|Epithelial(33;0.000818)|LUSC - Lung squamous cell carcinoma(21;0.0118)|Lung(16;0.0189)|KIRC - Kidney renal clear cell carcinoma(39;0.203)|Kidney(39;0.238)		CTTTAATGCAGAAAAAAAACTA	0.411													4	2	---	---	---	---	
CRYBG3	131544	broad.mit.edu	37	3	97605313	97605313	+	Intron	DEL	A	-	-	rs9862347	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97605313delA	uc003drx.2	+							NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0						AAAACTTTTTAAAAAAAAAAA	0.269													8	4	---	---	---	---	
FRG1	2483	broad.mit.edu	37	4	190874371	190874372	+	Intron	DEL	AG	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190874371_190874372delAG	uc003izs.2	+							NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TTAAGCCCACAGGGTAATTTTG	0.252													6	3	---	---	---	---	
GIN1	54826	broad.mit.edu	37	5	102432916	102432917	+	Intron	DEL	TG	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102432916_102432917delTG	uc003koa.1	-						GIN1_uc003kob.1_Intron|GIN1_uc003koc.1_Intron	NM_017676	NP_060146	Q9NXP7	GIN1_HUMAN	zinc finger, H2C2 domain containing						DNA integration		DNA binding			ovary(1)|skin(1)	2		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		CAAGTAAGTATGTGTGTGTGTG	0.252													4	2	---	---	---	---	
PPIP5K2	23262	broad.mit.edu	37	5	102484798	102484799	+	Intron	DEL	AC	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102484798_102484799delAC	uc003kod.3	+						PPIP5K2_uc011cva.1_Intron|PPIP5K2_uc003koe.2_Intron|PPIP5K2_uc010jbo.1_Intron	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						TCTGTTGGTTacacacacacac	0.267													5	3	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	491327	491327	+	Intron	DEL	G	-	-	rs3839498		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:491327delG	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CCAGTCATGAGTAGAGTTTCT	0.423													8	8	---	---	---	---	
PPT2	9374	broad.mit.edu	37	6	32123361	32123362	+	Intron	INS	-	TG	TG	rs140466503	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32123361_32123362insTG	uc003nzx.2	+						PRRT1_uc003nzu.2_5'Flank|uc003nzv.3_5'Flank|PPT2_uc003nzw.2_Intron|PPT2_uc011dpi.1_Intron|PPT2_uc003nzy.1_Intron|PPT2_uc003nzz.2_Intron|PPT2_uc003oaa.2_Intron|PPT2_uc010jtu.1_Intron	NM_005155	NP_005146	Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2 isoform a						protein modification process	lysosome	palmitoyl-(protein) hydrolase activity				0						gtgtgtgtctctgtgtgtgtgt	0.198													27	7	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5347976	5347977	+	Intron	INS	-	G	G	rs148493175	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5347976_5347977insG	uc003soi.3	-							NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGATGGCAGGTGGGGGGCACAG	0.446													7	4	---	---	---	---	
RAC1	5879	broad.mit.edu	37	7	6442143	6442143	+	3'UTR	DEL	C	-	-	rs59685280		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6442143delC	uc003spx.2	+	6					RAC1_uc003spw.2_3'UTR	NM_006908	NP_008839	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1						actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding			lung(2)	2		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Pravastatin(DB00175)|Simvastatin(DB00641)	Caaaaaaaaacaaaaaaaaaa	0.358													9	4	---	---	---	---	
MTMR9	66036	broad.mit.edu	37	8	11153008	11153011	+	Intron	DEL	ACTC	-	-	rs149766910		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11153008_11153011delACTC	uc003wtm.2	+						MTMR9_uc010lrx.2_Intron|MTMR9_uc011kxa.1_Intron	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9							cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		GTCTGGTGTTACTCACGTTATATG	0.392													5	3	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	25902514	25902514	+	Intron	DEL	A	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25902514delA	uc003xek.2	+						EBF2_uc003xes.1_5'Flank|EBF2_uc003xet.1_5'Flank	NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		TGAGTCTTAGAAAAAAAAAAA	0.468													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11158570	11158570	+	IGR	DEL	A	-	-	rs10574607		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11158570delA								ZBED5 (278950 upstream) : GALNTL4 (133851 downstream)																							actctgtctcaaaaaaaaaaa	0.114													6	7	---	---	---	---	
ARRB1	408	broad.mit.edu	37	11	74980343	74980343	+	Intron	DEL	C	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74980343delC	uc001owe.1	-						ARRB1_uc001owf.1_Intron	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A						G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						TGCCCTGGGACCCCCCCCCAC	0.682													4	2	---	---	---	---	
TMEM117	84216	broad.mit.edu	37	12	44338306	44338306	+	Intron	DEL	T	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44338306delT	uc001rod.2	+						TMEM117_uc001roe.2_Intron|TMEM117_uc009zkc.2_Intron	NM_032256	NP_115632	Q9H0C3	TM117_HUMAN	transmembrane protein 117							endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		GACATTAACATTTTTTTTTTC	0.303													5	4	---	---	---	---	
PYGL	5836	broad.mit.edu	37	14	51374820	51374820	+	Intron	DEL	T	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51374820delT	uc001wyu.2	-						PYGL_uc010tqq.1_Intron|PYGL_uc001wyv.2_Intron|PYGL_uc001wyt.2_Intron	NM_002863	NP_002854	P06737	PYGL_HUMAN	liver glycogen phosphorylase isoform 1						glucose homeostasis|glucose metabolic process|glycogen catabolic process	cytosol|soluble fraction	AMP binding|ATP binding|bile acid binding|drug binding|glucose binding|glycogen phosphorylase activity|protein homodimerization activity|purine base binding|pyridoxal phosphate binding			skin(1)	1	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)|Pyridoxal Phosphate(DB00114)|Riboflavin(DB00140)	AAAGACAAGgttttttttttt	0.199													4	2	---	---	---	---	
GABPB1	2553	broad.mit.edu	37	15	50581976	50581977	+	Intron	INS	-	TTTTTTT	TTTTTTT	rs140176493	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50581976_50581977insTTTTTTT	uc001zyb.2	-						GABPB1_uc001zya.2_Intron|GABPB1_uc010ufg.1_Intron|GABPB1_uc001zyc.2_Intron|GABPB1_uc001zyd.2_Intron|GABPB1_uc001zye.2_Intron|GABPB1_uc001zyf.2_Intron	NM_005254	NP_005245	Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta						positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)	1						tttcttttttcttttttaaata	0.129													4	2	---	---	---	---	
IQGAP1	8826	broad.mit.edu	37	15	91018049	91018049	+	Intron	DEL	T	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91018049delT	uc002bpl.1	+							NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1						energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CCATAAGAGCttttttttttt	0.274													4	2	---	---	---	---	
CIRH1A	84916	broad.mit.edu	37	16	69190057	69190057	+	Intron	DEL	C	-	-			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69190057delC	uc002ews.3	+						CIRH1A_uc002ewr.2_Intron|CIRH1A_uc002ewt.3_Intron|CIRH1A_uc010cfi.2_Intron	NM_032830	NP_116219	Q969X6	CIR1A_HUMAN	cirhin							nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)		ttctttctttctttttttttt	0.159													4	2	---	---	---	---	
FAM64A	54478	broad.mit.edu	37	17	6350599	6350599	+	Intron	DEL	T	-	-	rs113827676		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6350599delT	uc002gcw.1	+						FAM64A_uc002gct.1_Intron|FAM64A_uc002gcu.1_Intron|FAM64A_uc002gcv.1_Intron|FAM64A_uc002gcx.1_Intron|FAM64A_uc002gcy.1_Intron|FAM64A_uc002gcz.1_Intron|FAM64A_uc002gda.1_Intron|FAM64A_uc002gdb.1_Intron	NM_019013	NP_061886	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A							nucleolus	protein binding				0				COAD - Colon adenocarcinoma(228;0.141)		gcctggctaatttttttttgc	0.000													7	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518943	21518944	+	IGR	INS	-	AT	AT	rs116944418	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518943_21518944insAT								C17orf51 (41212 upstream) : FAM27L (306426 downstream)																							AGGGGAGAATCGTGTATAATGT	0.381													25	9	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36361540	36361541	+	Intron	INS	-	A	A			TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36361540_36361541insA	uc010wdn.1	-									Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		aaaaAAGAAAGAAAAAGAGGCT	0.035													9	4	---	---	---	---	
ARID3A	1820	broad.mit.edu	37	19	966459	966459	+	Intron	DEL	A	-	-	rs71335324		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:966459delA	uc002lql.2	+							NM_005224	NP_005215	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT- like)							cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actccgtctcaaaaaaaaaaa	0.204													4	3	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37599842	37599843	+	Intron	INS	-	A	A	rs141141432	by1000genomes	TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37599842_37599843insA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						aagactctgtcaaaaaaaaaga	0.104													4	6	---	---	---	---	
FBXO7	25793	broad.mit.edu	37	22	32891355	32891356	+	Intron	INS	-	T	T	rs11332165		TCGA-G9-6367-01	TCGA-G9-6367-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32891355_32891356insT	uc003amq.2	+						FBXO7_uc003amr.2_Intron|FBXO7_uc003ams.2_Intron|FBXO7_uc003amt.2_Intron|FBXO7_uc003amu.2_Intron|FBXO7_uc003amv.2_Intron	NM_012179	NP_036311	Q9Y3I1	FBX7_HUMAN	F-box only protein 7 isoform 1						cell death|regulation of protein stability|ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)	1						TAAATGGTTAGTTTTTTTTTTT	0.302													2	4	---	---	---	---	
