Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL1	84809	broad.mit.edu	37	1	16946438	16946438	+	RNA	SNP	G	A	A	rs28392876	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16946438G>A	uc010ocf.1	-	3		c.460C>T			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						GCCTTCCGCCGGGCCAGCAGC	0.672													5	12	---	---	---	---	PASS
TMEM53	79639	broad.mit.edu	37	1	45101478	45101478	+	3'UTR	SNP	T	C	C	rs2236219	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45101478T>C	uc001cmb.1	-	4					RNF220_uc001clv.1_Intron|RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron|RNF220_uc010okz.1_Intron|RNF220_uc001clx.1_Intron|RNF220_uc001cly.1_Intron|RNF220_uc001clz.1_Intron|RNF220_uc001cma.1_Intron			Q6P2H8	TMM53_HUMAN	SubName: Full=Transmembrane protein 53;							integral to membrane				ovary(2)	2	Acute lymphoblastic leukemia(166;0.155)					TGCTCTCTCCTTTTGCTTTCA	0.532													5	3	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94506837	94506837	+	Silent	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94506837G>A	uc001dqh.2	-	23	3554	c.3450C>T	c.(3448-3450)TGC>TGT	p.C1150C		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1150	Cytoplasmic.|ABC transporter 1.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CTGTGCCAAAGCAGTTCTTCA	0.562													19	75	---	---	---	---	PASS
SPRR2F	6705	broad.mit.edu	37	1	153085079	153085079	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153085079G>A	uc001fbi.2	-	2	190	c.131C>T	c.(130-132)TCC>TTC	p.S44F	SPRR2D_uc009wnz.2_Intron|SPRR2A_uc001fbf.2_Intron|SPRR2A_uc009woa.2_Intron	NM_001014450	NP_001014450	Q96RM1	SPR2F_HUMAN	small proline-rich protein 2F	44	3 X 9 AA tandem repeats of [PS]-K-C-P- [EQ]-[PS]-C-P-P.|3.				keratinization	cornified envelope|cytoplasm					0	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGGTGGGCAGGACTGTGGACA	0.617													54	313	---	---	---	---	PASS
C1orf110	339512	broad.mit.edu	37	1	162824943	162824943	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162824943C>T	uc001gck.2	-	4	696	c.521G>A	c.(520-522)GGC>GAC	p.G174D	C1orf110_uc009wuw.1_Intron|C1orf110_uc009wux.1_Missense_Mutation_p.G173D	NM_178550	NP_848645	Q86UF4	CA110_HUMAN	hypothetical protein LOC339512	174											0						AACAGAGATGCCCTTGCTGGG	0.463													59	306	---	---	---	---	PASS
RASAL2	9462	broad.mit.edu	37	1	178269157	178269157	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178269157A>G	uc001glq.2	+	3	1125	c.361A>G	c.(361-363)ACA>GCA	p.T121A	RASAL2_uc009wxb.2_Missense_Mutation_p.T121A	NM_170692	NP_733793	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 2	Error:Variant_position_missing_in_Q9UJF2_after_alignment					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						GGAGCAGCAGACAGATTCCAC	0.473											OREG0014010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	66	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197407883	197407883	+	Intron	SNP	C	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197407883C>G	uc001gtz.2	+						CRB1_uc010poz.1_Intron|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Intron|CRB1_uc010ppb.1_Intron|CRB1_uc010ppd.1_Intron|CRB1_uc001gub.1_3'UTR	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor						cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						ATTTTCTCCTCTAATTTTTTA	0.358													11	39	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228509861	228509861	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228509861C>T	uc009xez.1	+	55	15363	c.15319C>T	c.(15319-15321)CCT>TCT	p.P5107S	OBSCN_uc001hsn.2_Missense_Mutation_p.P5107S	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5107					apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CAAAGAGACTCCTGCCCCTGT	0.597													4	37	---	---	---	---	PASS
SPAST	6683	broad.mit.edu	37	2	32368485	32368485	+	Splice_Site	SNP	G	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32368485G>T	uc002roc.2	+	14	1837	c.1616_splice	c.e14+1	p.R539_splice	SPAST_uc002rod.2_Splice_Site_p.R507_splice	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AACTTGCTAGGTGAGTAATTT	0.239													3	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	132292791	132292791	+	RNA	SNP	T	C	C	rs3101988	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132292791T>C	uc002ttc.1	-	2		c.257A>G								full-length cDNA clone CS0DI014YM20 of Placenta Cot 25-normalized of Homo sapiens (human).																		GTGGATGCTCTGGGCACAGGT	0.627													3	5	---	---	---	---	PASS
NRP2	8828	broad.mit.edu	37	2	206562286	206562286	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206562286G>A	uc002vaw.2	+	2	883	c.92G>A	c.(91-93)CGT>CAT	p.R31H	NRP2_uc002vat.2_Missense_Mutation_p.R31H|NRP2_uc002vau.2_Missense_Mutation_p.R31H|NRP2_uc002vav.2_Missense_Mutation_p.R31H|NRP2_uc002vax.2_Missense_Mutation_p.R31H|NRP2_uc002vay.2_Missense_Mutation_p.R31H|NRP2_uc010fud.2_Missense_Mutation_p.R31H	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor	31	Extracellular (Potential).|CUB 1.				angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						TGCGGAGGTCGTTTGAATTCC	0.517													24	462	---	---	---	---	PASS
ABCB6	10058	broad.mit.edu	37	2	220081146	220081146	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220081146A>G	uc002vkc.1	-	4	1187	c.910T>C	c.(910-912)TGG>CGG	p.W304R	ABCB6_uc010fwe.1_Missense_Mutation_p.W258R|ABCB6_uc010zku.1_RNA	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	304	ABC transmembrane type-1.				cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTAACAGTCCAGGCCAGAGAG	0.547													16	46	---	---	---	---	PASS
GRM7	2917	broad.mit.edu	37	3	7721859	7721859	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7721859C>T	uc003bqm.2	+	9	2849	c.2575C>T	c.(2575-2577)CGG>TGG	p.R859W	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.R859W|GRM7_uc003bql.2_Missense_Mutation_p.R859W|GRM7_uc003bqn.1_Missense_Mutation_p.R442W	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	859	Cytoplasmic (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	TGTCCAGAAACGGAAGCGAAG	0.512													4	89	---	---	---	---	PASS
PRSS48	345062	broad.mit.edu	37	4	152201037	152201037	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152201037G>A	uc011cif.1	+	2	142	c.142G>A	c.(142-144)GAC>AAC	p.D48N	PRSS48_uc011cig.1_Intron	NM_183375	NP_899231	Q7RTY5	PRS48_HUMAN	epidermis-specific serine protease-like protein	48	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			large_intestine(1)	1						CCTACACTTTGACCACAACTT	0.542													22	153	---	---	---	---	PASS
ZDHHC11	79844	broad.mit.edu	37	5	840928	840928	+	Intron	SNP	C	T	T	rs3817055	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:840928C>T	uc011cma.1	-						ZDHHC11_uc003jbj.2_Intron|ZDHHC11_uc010itd.1_RNA|ZDHHC11_uc003jbk.2_Intron	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CTGAGTGCCCCGTAGGCCCTG	0.622													11	23	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90106488	90106488	+	Silent	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90106488C>T	uc003kju.2	+	74	15507	c.15411C>T	c.(15409-15411)TTC>TTT	p.F5137F	GPR98_uc003kjt.2_Silent_p.F2843F|GPR98_uc003kjw.2_Silent_p.F798F	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	5137	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATATTTCCTTCCCCGAGACAA	0.443													48	300	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140531277	140531277	+	Missense_Mutation	SNP	T	C	C	rs145154187		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140531277T>C	uc003lir.2	+	1	1439	c.1439T>C	c.(1438-1440)ATC>ACC	p.I480T	PCDHB6_uc011dah.1_Missense_Mutation_p.I344T	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	480	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACTCAGGCATCAACGCCCAG	0.652													8	218	---	---	---	---	PASS
RELL2	285613	broad.mit.edu	37	5	141017909	141017909	+	Silent	SNP	C	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141017909C>G	uc003lli.2	+	2	965	c.117C>G	c.(115-117)CTC>CTG	p.L39L	HDAC3_uc003llf.2_5'Flank|HDAC3_uc010jgd.1_5'Flank|HDAC3_uc010jge.1_5'Flank|RELL2_uc003llh.2_Silent_p.L39L|RELL2_uc003llg.2_Intron|RELL2_uc010jgf.2_Intron	NM_001130029	NP_001123501	Q8NC24	RELL2_HUMAN	RELT-like 2	39						integral to membrane|plasma membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCACGTGCTCAAGAAGAAGG	0.597													6	158	---	---	---	---	PASS
STK19	8859	broad.mit.edu	37	6	31940215	31940215	+	Silent	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31940215C>T	uc003nyv.2	+	2	485	c.357C>T	c.(355-357)ATC>ATT	p.I119I	DOM3Z_uc003nyo.1_5'Flank|DOM3Z_uc003nyp.1_5'Flank|DOM3Z_uc003nyq.1_5'Flank|DOM3Z_uc003nyr.1_5'Flank|DOM3Z_uc003nys.1_5'Flank|DOM3Z_uc010jtl.1_5'Flank|STK19_uc003nyt.2_Silent_p.I76I|DOM3Z_uc003nyu.1_5'Flank|STK19_uc011dow.1_Silent_p.I119I|STK19_uc011dox.1_Silent_p.I76I|STK19_uc003nyw.2_Silent_p.I119I|STK19_uc010jtn.1_RNA	NM_032454	NP_115830	P49842	STK19_HUMAN	serine/threonine kinase 19 isoform 2	119						nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			skin(4)	4						ATCACCTGATCCCGGAGACCT	0.597													15	119	---	---	---	---	PASS
PPT2	9374	broad.mit.edu	37	6	32122416	32122416	+	Silent	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32122416G>A	uc003nzx.2	+	2	613	c.45G>A	c.(43-45)CTG>CTA	p.L15L	PRRT1_uc003nzs.2_5'Flank|PRRT1_uc003nzt.2_5'Flank|PRRT1_uc003nzu.2_5'Flank|uc003nzv.3_5'Flank|PPT2_uc003nzw.2_Silent_p.L21L|PPT2_uc011dpi.1_RNA|PPT2_uc003nzy.1_RNA|PPT2_uc003nzz.2_Silent_p.L15L|PPT2_uc003oaa.2_Silent_p.L15L|PPT2_uc010jtu.1_Silent_p.L15L	NM_005155	NP_005146	Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2 isoform a	15					protein modification process	lysosome	palmitoyl-(protein) hydrolase activity				0						CGTGGGTCCTGCTTCTGTTGC	0.672													32	152	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36922496	36922496	+	5'UTR	SNP	G	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36922496G>T	uc003ona.2	+	1					PI16_uc003omz.1_5'UTR|PI16_uc003onb.2_5'UTR	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor							extracellular region|integral to membrane	peptidase inhibitor activity				0						AAATCCAGCTGCCAGACCCCT	0.522													12	59	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57393144	57393144	+	Missense_Mutation	SNP	A	T	T	rs3763183	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57393144A>T	uc003pdx.2	+	9	881	c.794A>T	c.(793-795)CAG>CTG	p.Q265L		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	265					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TACAGTACCCAGGGAAATGTT	0.294													3	10	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41739857	41739857	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41739857G>A	uc003thq.2	-	1	351	c.116C>T	c.(115-117)GCG>GTG	p.A39V	LOC285954_uc003tht.3_Intron|INHBA_uc003thr.2_Missense_Mutation_p.A39V|LOC285954_uc003ths.2_Intron	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	39					cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						GGCGGCCAGCGCACAGGACGG	0.577										TSP Lung(11;0.080)			57	374	---	---	---	---	PASS
C7orf44	55744	broad.mit.edu	37	7	43687182	43687182	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43687182C>T	uc003tin.1	-	3	161	c.67G>A	c.(67-69)GGT>AGT	p.G23S	C7orf44_uc003til.2_RNA|C7orf44_uc003tii.2_RNA|C7orf44_uc003tij.2_RNA|C7orf44_uc010kxu.1_RNA|C7orf44_uc003tik.2_RNA|C7orf44_uc003tim.1_RNA|C7orf44_uc003tio.1_Missense_Mutation_p.G23S|C7orf44_uc003tiq.1_Missense_Mutation_p.G23S|C7orf44_uc003tip.1_Missense_Mutation_p.G23S	NM_018224	NP_060694	Q9GZY4	CG044_HUMAN	hypothetical protein LOC55744	23	Helical; (Potential).					integral to membrane				ovary(1)	1						TAGAACACACCGTGGAAAAGG	0.493													5	94	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48443343	48443343	+	Silent	SNP	C	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48443343C>A	uc003toq.2	+	39	11962	c.11937C>A	c.(11935-11937)GGC>GGA	p.G3979G	ABCA13_uc010kys.1_Silent_p.G1053G|ABCA13_uc003tos.1_Silent_p.G805G|ABCA13_uc010kyt.1_RNA	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3979	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TGTCTGGAGGCCTGAAGAGGA	0.527													10	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	64498737	64498737	+	RNA	SNP	C	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64498737C>A	uc003ttt.1	+	1		c.6C>A			uc010kzt.1_RNA					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																		gaggcggtggcggcggcggca	0.343													4	23	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100609631	100609631	+	Missense_Mutation	SNP	C	T	T	rs114167943	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100609631C>T	uc003uxl.1	+	8	2863	c.2063C>T	c.(2062-2064)GCC>GTC	p.A688V	uc003uxm.1_5'Flank|uc003uxn.1_RNA|uc010lhn.1_Intron					SubName: Full=Intestinal mucin; Flags: Fragment;																		ACGGCCGGCGCCGCGCTGCTG	0.721													4	3	---	---	---	---	PASS
SGK223	157285	broad.mit.edu	37	8	8238940	8238940	+	Silent	SNP	G	C	C			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8238940G>C	uc003wsh.3	-	1	318	c.318C>G	c.(316-318)GCC>GCG	p.A106A		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	106							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GCGAGACTTCGGCACTCAGGT	0.562													14	75	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12428229	12428229	+	Intron	SNP	A	C	C	rs62499296		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12428229A>C	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_RNA					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		CCAACACAAAACAGATGAAAG	0.378													3	4	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732871	52732871	+	3'UTR	SNP	T	C	C	rs77261625	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732871T>C	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTTTCAAGACTAAAGGAATTA	0.313													3	21	---	---	---	---	PASS
IFNA13	3447	broad.mit.edu	37	9	21367472	21367472	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21367472T>C	uc003zpa.2	-	1	604	c.538A>G	c.(538-540)ACA>GCA	p.T180A		NM_006900	NP_008831	P01562	IFNA1_HUMAN	interferon, alpha 13 precursor	179					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(1)	1				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		TGCAAGTTTGTTGATAAAGAG	0.408													30	155	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	43818062	43818062	+	RNA	SNP	T	A	A	rs78142446	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43818062T>A	uc004acz.1	+	7		c.1181T>A								Homo sapiens cDNA FLJ30083 fis, clone BGGI12001097, weakly similar to Homo sapiens contactin associated protein (Caspr) mRNA.																		GGGAATTCTGTCACCCGGAAG	0.338													3	37	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68744046	68744046	+	Intron	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68744046G>A	uc004aez.1	+						uc004afa.1_Intron|uc010mnp.1_Intron|uc004afb.1_RNA					Homo sapiens cDNA, FLJ18209.																		AGCAGTTTATGGCTGTCAAAT	0.249													2	4	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790168	78790168	+	Intron	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790168G>A	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.E675K|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						gaatggaatggaatggaatgg	0.144													3	16	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84202844	84202844	+	Intron	SNP	T	C	C			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84202844T>C	uc004aly.2	-						TLE1_uc004alz.2_Intron|TLE1_uc011lsr.1_Intron|TLE1_uc004ama.1_3'UTR	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1						negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						tgtgtgtgtgtgtgtgtgtgt	0.368													3	3	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84202845	84202845	+	Intron	SNP	G	C	C			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84202845G>C	uc004aly.2	-						TLE1_uc004alz.2_Intron|TLE1_uc011lsr.1_Intron|TLE1_uc004ama.1_3'UTR	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1						negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						gtgtgtgtgtgtgtgtgtgtg	0.368													3	3	---	---	---	---	PASS
FAM69B	138311	broad.mit.edu	37	9	139617909	139617909	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139617909C>T	uc004cik.2	+	5	1073	c.979C>T	c.(979-981)CGC>TGC	p.R327C	FAM69B_uc004cil.2_Missense_Mutation_p.R240C|SNHG7_uc004cim.2_Intron	NM_152421	NP_689634	Q5VUD6	FA69B_HUMAN	hypothetical protein LOC138311	327	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane					0	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		CACCGTGCGCCGCTTCCTGCA	0.667													5	31	---	---	---	---	PASS
FAM166A	401565	broad.mit.edu	37	9	140140297	140140297	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140140297C>T	uc004cmi.1	-	2	120	c.65G>A	c.(64-66)GGC>GAC	p.G22D		NM_001001710	NP_001001710	Q6J272	F166A_HUMAN	hypothetical protein LOC401565	22										ovary(1)	1						CGGAAAGAAGCCGGCATAGCT	0.562													3	43	---	---	---	---	PASS
AKR1C1	1645	broad.mit.edu	37	10	4995058	4995058	+	5'UTR	SNP	T	C	C	rs1132228		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4995058T>C	uc001iho.2	+	5					AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	TCACTAACTGTTGGAACTGAT	0.483													2	6	---	---	---	---	PASS
C10orf26	54838	broad.mit.edu	37	10	104536133	104536133	+	5'UTR	SNP	C	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104536133C>G	uc001kwe.3	+	1					C10orf26_uc001kwf.3_Intron|C10orf26_uc009xxg.1_Intron	NM_017787	NP_060257	Q9NX94	OPA1L_HUMAN	hypothetical protein LOC54838 isoform 2							integral to membrane				central_nervous_system(1)	1		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;6.14e-09)|all cancers(201;1.66e-07)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TTAGTGTGGACGATGCTCTTG	0.512													6	109	---	---	---	---	PASS
KLC2	64837	broad.mit.edu	37	11	66026227	66026227	+	Silent	SNP	G	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66026227G>T	uc010rov.1	+	2	405	c.162G>T	c.(160-162)TCG>TCT	p.S54S	KLC2_uc010row.1_Silent_p.S54S|KLC2_uc009yra.2_Silent_p.S54S|KLC2_uc001ohb.2_Silent_p.S54S|KLC2_uc010rox.1_Silent_p.S54S|KLC2_uc001ohc.2_Silent_p.S54S|KLC2_uc001ohd.2_Silent_p.S54S|KLC2_uc001ohe.1_5'Flank	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	54					blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0						AGCCTGGCTCGCAGGAGCGCT	0.667											OREG0021097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	61	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106558447	106558447	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106558447G>A	uc001pjg.1	-	8	2417	c.2027C>T	c.(2026-2028)CCG>CTG	p.P676L	GUCY1A2_uc010rvo.1_Missense_Mutation_p.P697L|GUCY1A2_uc009yxn.1_Missense_Mutation_p.P707L	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	676					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		ACGAGACCGCGGAATGAATGT	0.418													13	154	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082243	8082243	+	Intron	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082243C>T	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		AAGTGAAATACTTTAAGACAC	0.254													3	38	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082245	8082245	+	Intron	SNP	T	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082245T>G	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GTGAAATACTTTAAGACACGT	0.254													3	39	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11506669	11506669	+	Missense_Mutation	SNP	G	T	T	rs74903687	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11506669G>T	uc001qzw.1	-	3	405	c.368C>A	c.(367-369)CCA>CAA	p.P123Q	PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	184	7.|15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in clone CP-4).|Missing (in clone CP-5).|Missing (in allele S).			extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GCCTCCTTGTGGGGGTGGTCC	0.612													14	279	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31282765	31282765	+	Missense_Mutation	SNP	A	T	T	rs2536839	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31282765A>T	uc010sjy.1	-	24	3119	c.3119T>A	c.(3118-3120)TTT>TAT	p.F1040Y						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		AATGAATACAAATTTTTTCAT	0.363													3	15	---	---	---	---	PASS
NCKAP5L	57701	broad.mit.edu	37	12	50186731	50186731	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50186731C>T	uc009zlk.2	-	11	3581	c.3379G>A	c.(3379-3381)GGG>AGG	p.G1127R	NCKAP5L_uc001rvc.3_Missense_Mutation_p.G331R|NCKAP5L_uc001rvb.2_Missense_Mutation_p.G720R	NM_001037806	NP_001032895	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	1123	Pro-rich.									central_nervous_system(1)	1						GGGAAGGTCCCAATGCCACTG	0.652													6	19	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68220894	68220894	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68220894G>T	uc001xka.2	-	38	7161	c.7022C>A	c.(7021-7023)ACC>AAC	p.T2341N	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkb.2_Missense_Mutation_p.T187N	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2341					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CAAGAACCTGGTCACTTCCAT	0.527													27	188	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68220896	68220896	+	Silent	SNP	C	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68220896C>A	uc001xka.2	-	38	7159	c.7020G>T	c.(7018-7020)GTG>GTT	p.V2340V	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkb.2_Silent_p.V186V	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2340					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AGAACCTGGTCACTTCCATCT	0.522													26	187	---	---	---	---	PASS
PLCB2	5330	broad.mit.edu	37	15	40583458	40583458	+	Intron	SNP	A	G	G	rs936209	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40583458A>G	uc001zld.2	-						PLCB2_uc001zlc.2_5'UTR|PLCB2_uc010bbo.2_Intron|PLCB2_uc010ucm.1_Intron	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2						activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CACCGCCACGAGCCTTACCTC	0.647													3	6	---	---	---	---	PASS
LRRC57	255252	broad.mit.edu	37	15	42839684	42839684	+	Silent	SNP	C	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42839684C>A	uc001zqd.1	-	3	635	c.267G>T	c.(265-267)ACG>ACT	p.T89T	HAUS2_uc001zqe.2_5'Flank|HAUS2_uc010udi.1_5'Flank|HAUS2_uc001zqf.2_5'Flank|LRRC57_uc001zqc.2_Silent_p.T89T	NM_153260	NP_694992	Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	89	LRR 3.										0		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		TTAGGCTTAGCGTCTCTAGTT	0.438													14	95	---	---	---	---	PASS
GLDN	342035	broad.mit.edu	37	15	51676022	51676022	+	Silent	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51676022G>A	uc002aba.2	+	4	643	c.474G>A	c.(472-474)TTG>TTA	p.L158L	GLDN_uc010bez.1_Nonsense_Mutation_p.W141*|GLDN_uc002abb.2_Silent_p.L34L	NM_181789	NP_861454	Q6ZMI3	GLDN_HUMAN	gliomedin	158	Extracellular (Potential).|Collagen-like 1.				cell differentiation|nervous system development	collagen|integral to membrane|plasma membrane				ovary(2)	2				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		ACAACGGATTGGATGGACAGC	0.433													9	44	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51795002	51795002	+	Splice_Site	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51795002C>T	uc002abf.2	-	17	3217	c.2992_splice	c.e17+1	p.G998_splice	DMXL2_uc010ufy.1_Splice_Site_p.G998_splice|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		AGTGACCTTACCTGCTGAAGG	0.393													12	74	---	---	---	---	PASS
CYP1A1	1543	broad.mit.edu	37	15	75013056	75013056	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75013056G>A	uc002ayp.3	-	7	1435	c.1313C>T	c.(1312-1314)GCT>GTT	p.A438V	CYP1A1_uc010bjv.2_RNA|CYP1A1_uc010bjw.2_RNA|CYP1A1_uc010bju.2_Missense_Mutation_p.A174V|CYP1A1_uc010bjx.2_Missense_Mutation_p.A174V|CYP1A1_uc002ayq.3_Missense_Mutation_p.A438V|CYP1A1_uc010bjy.2_Missense_Mutation_p.A409V	NM_000499	NP_000490	P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A,	438					cellular lipid metabolic process|drug metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|vitamin D 24-hydroxylase activity			ovary(2)|breast(2)|pancreas(1)	5					Arsenic trioxide(DB01169)|Benzphetamine(DB00865)|Bleomycin(DB00290)|Chlorzoxazone(DB00356)|Dacarbazine(DB00851)|Dactinomycin(DB00970)|Esomeprazole(DB00736)|Estrone(DB00655)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Ginseng(DB01404)|Granisetron(DB00889)|Ketoconazole(DB01026)|Menadione(DB00170)|Picrotoxin(DB00466)|Primaquine(DB01087)|Quinidine(DB00908)|Quinine(DB00468)|Thiabendazole(DB00730)	CTTGTCGATAGCACCATCAGG	0.522									Endometrial_Cancer_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia				36	157	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83349301	83349301	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83349301C>G	uc010uoh.1	-	8	1155	c.978G>C	c.(976-978)CAG>CAC	p.Q326H	AP3B2_uc010uoi.1_Missense_Mutation_p.Q326H|AP3B2_uc010uoj.1_Missense_Mutation_p.Q294H|AP3B2_uc010uog.1_5'Flank	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	326					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			GGAAGTAGAGCTGCGCCACCG	0.632													3	15	---	---	---	---	PASS
ZNF213	7760	broad.mit.edu	37	16	3189209	3189209	+	Intron	SNP	G	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3189209G>T	uc010uws.1	+						ZNF213_uc002cud.2_Intron|ZNF213_uc010btf.2_3'UTR|ZNF213_uc010bth.2_Intron|ZNF213_uc010uwt.1_Intron	NM_004220	NP_004211	O14771	ZN213_HUMAN	zinc finger protein 213						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTCTCCCTAGGTCTTGCCAGG	0.542													4	24	---	---	---	---	PASS
SEPT12	124404	broad.mit.edu	37	16	4833345	4833345	+	Intron	SNP	A	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4833345A>G	uc002cxq.2	-						SEPT12_uc002cxr.2_Intron|SEPT12_uc010bty.2_RNA	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2						cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						GTAGAGAATCATATCTGCTAG	0.318													4	12	---	---	---	---	PASS
NOMO3	408050	broad.mit.edu	37	16	16350005	16350005	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16350005G>A	uc002deq.2	+	11	1345	c.1210G>A	c.(1210-1212)GTT>ATT	p.V404I	NOMO3_uc002dep.2_Missense_Mutation_p.V404I|NOMO3_uc010bvp.1_Missense_Mutation_p.V237I	NM_001004067	NP_001004067	P69849	NOMO3_HUMAN	nodal modulator 3 precursor	404	Extracellular (Potential).					integral to membrane	carbohydrate binding|carboxypeptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		GGCTGACATTGTTGCAACAGG	0.473													5	87	---	---	---	---	PASS
ZNF629	23361	broad.mit.edu	37	16	30794665	30794665	+	Silent	SNP	G	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30794665G>T	uc002dzs.1	-	3	1192	c.984C>A	c.(982-984)ATC>ATA	p.I328I		NM_001080417	NP_001073886	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	328	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			Colorectal(24;0.198)			CCGAGCTCTGGATGAAGCTCT	0.637													4	76	---	---	---	---	PASS
MIR1826	100302162	broad.mit.edu	37	16	33965563	33965563	+	RNA	SNP	C	T	T	rs142154618	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33965563C>T	hsa-mir-1826|MI0008194	+			c.56C>T																				0						CAGGGCTTTGCCTGTCTGAGC	0.617													4	34	---	---	---	---	PASS
C16orf3	750	broad.mit.edu	37	16	90095561	90095561	+	Missense_Mutation	SNP	C	T	T	rs3785183	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90095561C>T	uc002fqk.1	-	1	749	c.190G>A	c.(190-192)GTA>ATA	p.V64I	GAS8_uc010vps.1_Intron|GAS8_uc002fqh.2_Intron|GAS8_uc010vpt.1_Intron|GAS8_uc010vpu.1_Intron|GAS8_uc010vpv.1_Intron|GAS8_uc010cjc.1_Intron|GAS8_uc002fqi.1_Intron|GAS8_uc010vpw.1_Intron|GAS8_uc002fqj.1_Intron	NM_001214	NP_001205	O95177	CP003_HUMAN	hypothetical protein LOC750	72											0		all_cancers(9;9.01e-08)|Hepatocellular(780;0.000325)|Lung NSC(15;0.0104)|all_lung(18;0.0239)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		gggcagcctacggggcaggct	0.363													11	15	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16097899	16097899	+	5'UTR	SNP	C	T	T	rs149293452	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16097899C>T	uc002gpo.2	-	2					NCOR1_uc002gpn.2_5'UTR|NCOR1_uc002gpp.1_5'UTR|NCOR1_uc002gpr.2_5'UTR|NCOR1_uc002gps.1_5'UTR|NCOR1_uc010coz.1_5'UTR|NCOR1_uc010cpb.1_5'UTR|NCOR1_uc010cpa.1_5'UTR|NCOR1_uc002gpu.2_5'UTR	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTAAAGAAGTCCTCACCAGAC	0.393													3	12	---	---	---	---	PASS
PEMT	10400	broad.mit.edu	37	17	17409560	17409560	+	Missense_Mutation	SNP	C	T	T	rs7946	byFrequency	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17409560C>T	uc002grj.2	-	6	590	c.523G>A	c.(523-525)GTG>ATG	p.V175M	PEMT_uc002grk.2_Missense_Mutation_p.V175M|PEMT_uc002grl.2_Missense_Mutation_p.V212M|PEMT_uc010vwx.1_Missense_Mutation_p.S222N	NM_148173	NP_680478	Q9UBM1	PEMT_HUMAN	phosphatidylethanolamine N-methyltransferase	175	Helical; (Potential).				cell proliferation|phosphatidylcholine biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	phosphatidylethanolamine N-methyltransferase activity				0				Colorectal(2;0.0157)|READ - Rectum adenocarcinoma(2;0.0891)		AGGAGAGCCACTATGTAGGTG	0.657													6	6	---	---	---	---	PASS
KRTAP9-9	81870	broad.mit.edu	37	17	39388891	39388891	+	Intron	SNP	C	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39388891C>T	uc010wfq.1	+							NM_030975	NP_112237	B5MDD6	B5MDD6_HUMAN	keratin associated protein 9-9							keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCCAGCCTTGCTGCCACCCAA	0.622													14	93	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234749	45234749	+	Silent	SNP	A	C	C	rs148497428		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234749A>C	uc002ild.3	-	6	604	c.477T>G	c.(475-477)GGT>GGG	p.G159G	CDC27_uc002ile.3_Silent_p.G159G|CDC27_uc002ilf.3_Silent_p.G159G|CDC27_uc010wkp.1_Silent_p.G98G|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	159					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						CTGGCTTTTCACCTGTGAAGA	0.358													10	30	---	---	---	---	PASS
CATSPERG	57828	broad.mit.edu	37	19	38851455	38851455	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38851455A>C	uc002oih.3	+	16	1939	c.1852A>C	c.(1852-1854)ACC>CCC	p.T618P	CATSPERG_uc002oig.3_Missense_Mutation_p.T578P|CATSPERG_uc002oif.3_Missense_Mutation_p.T258P|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	618	Extracellular (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						TCAACAGCACACCAGCCACTA	0.478													5	12	---	---	---	---	PASS
SIGLEC16	400709	broad.mit.edu	37	19	50473221	50473221	+	RNA	SNP	T	C	C	rs117072442	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50473221T>C	uc002prf.2	+	2		c.240T>C			SIGLEC16_uc010ybj.1_5'Flank|uc010ybk.1_5'Flank	NR_002825				Homo sapiens cDNA FLJ50062 complete cds, highly similar to Sialic acid-binding Ig-like lectin 11 precursor.												0						GTTCAAAGGATGGACCAGCCC	0.602													5	86	---	---	---	---	PASS
SULF2	55959	broad.mit.edu	37	20	46294864	46294864	+	Intron	SNP	A	G	G	rs13044281	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46294864A>G	uc002xto.2	-						SULF2_uc002xtr.2_Intron|SULF2_uc002xtq.2_Intron|SULF2_uc010zyd.1_5'Flank	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor						bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						TGGCGGCTGAATAGTCGGGAA	0.592													4	78	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23029608	23029608	+	RNA	SNP	T	C	C			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23029608T>C	uc011aim.1	+	128		c.8247T>C								Parts of antibodies, mostly variable regions.												0						ATAAAGACAGTGAGAGGCCCT	0.542													6	98	---	---	---	---	PASS
PRRG1	5638	broad.mit.edu	37	X	37285150	37285150	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37285150G>A	uc004ddn.2	+	4	321	c.68G>A	c.(67-69)GGG>GAG	p.G23E	PRRG1_uc004ddo.2_Missense_Mutation_p.G23E|PRRG1_uc010ngx.1_RNA	NM_000950	NP_000941	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	23	Gla.|Extracellular (Potential).					extracellular region|integral to plasma membrane	calcium ion binding			ovary(1)|breast(1)	2						AGAGCTAATGGGTTTTTTGAA	0.338													4	32	---	---	---	---	PASS
MID1IP1	58526	broad.mit.edu	37	X	38664272	38664272	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38664272G>A	uc004dei.3	+	3	497	c.73G>A	c.(73-75)GTG>ATG	p.V25M	MID1IP1_uc010ngz.2_Missense_Mutation_p.V25M|MID1IP1_uc004dej.3_Missense_Mutation_p.V25M	NM_001098790	NP_001092260	Q9NPA3	M1IP1_HUMAN	MID1 interacting G12-like protein	25					lipid biosynthetic process|negative regulation of microtubule depolymerization|positive regulation of fatty acid biosynthetic process|positive regulation of ligase activity|protein polymerization	cytosol|microtubule|nucleus					0						CATTGGCGCCGTGAACAACAT	0.607													3	29	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151900633	151900633	+	Silent	SNP	G	A	A			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151900633G>A	uc010ntp.2	-	3	522	c.168C>T	c.(166-168)GCC>GCT	p.A56A	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Silent_p.A56A|CSAG1_uc004fge.2_5'Flank|CSAG1_uc004fgf.2_5'Flank|CSAG1_uc004fgd.2_5'Flank	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	56										skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TTGGTGACTCGGCAGCAGGCA	0.612													24	59	---	---	---	---	PASS
CDC20	991	broad.mit.edu	37	1	43825360	43825361	+	Intron	INS	-	ATAC	ATAC			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43825360_43825361insATAC	uc001cix.2	+						CDC20_uc001ciy.2_Intron	NM_001255	NP_001246	Q12834	CDC20_HUMAN	cell division cycle 20						activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	cytosol|nucleoplasm|spindle	enzyme binding|protein C-terminus binding				0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TTCTTTGGATAATACCATCTTG	0.510													311	13	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185992421	185992421	+	Intron	DEL	T	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185992421delT	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAACCTAGGGTTTTTTTTTTT	0.269													4	2	---	---	---	---	
PTPN14	5784	broad.mit.edu	37	1	214557049	214557051	+	In_Frame_Del	DEL	CCT	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214557049_214557051delCCT	uc001hkk.1	-	13	2418_2420	c.2147_2149delAGG	c.(2146-2151)GAGGCT>GCT	p.E716del	PTPN14_uc010pty.1_In_Frame_Del_p.E617del	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	716	Poly-Glu.				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GATTCTGGAGCCTCCTCCTCCTC	0.626													97	7	---	---	---	---	
RHOQ	23433	broad.mit.edu	37	2	46808361	46808361	+	3'UTR	DEL	T	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46808361delT	uc002rva.2	+	5					uc002rvb.2_5'Flank	NM_012249	NP_036381	P17081	RHOQ_HUMAN	ras-like protein TC10 precursor						cortical actin cytoskeleton organization|insulin receptor signaling pathway|negative regulation of establishment of protein localization in plasma membrane|positive regulation of filopodium assembly|positive regulation of glucose import|positive regulation of transcription from RNA polymerase II promoter|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	actin filament|cytosol|plasma membrane	GBD domain binding|GTP binding|GTPase activity|profilin binding			skin(2)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CAGAATTCTATAAAGTGTATT	0.323													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130751835	130751836	+	IGR	DEL	AG	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130751835_130751836delAG								RAB6C (11524 upstream) : LOC440905 (31736 downstream)																							AAAGAAAGAAAGAaagaaaatg	0.173													4	2	---	---	---	---	
RND3	390	broad.mit.edu	37	2	151343663	151343664	+	Intron	INS	-	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151343663_151343664insT	uc002txe.2	-						RND3_uc002txf.2_Intron|RND3_uc002txg.2_Intron|RND3_uc010zbv.1_Intron|RND3_uc010zbw.1_5'Flank	NM_005168	NP_005159	P61587	RND3_HUMAN	ras homolog gene family, member E precursor						actin cytoskeleton organization|cell adhesion|small GTPase mediated signal transduction	Golgi membrane	GTP binding|GTPase activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.106)		CCGAGAAAGACttttttttttc	0.525													2	4	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	242007466	242007466	+	Intron	DEL	C	-	-	rs67511252		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242007466delC	uc002wah.1	+						SNED1_uc002wai.1_Intron|SNED1_uc002waj.1_Intron|SNED1_uc002wak.2_Intron	NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GTGGACTGTACCACCTGCCGC	0.657													4	3	---	---	---	---	
IL17RC	84818	broad.mit.edu	37	3	9969633	9969633	+	Intron	DEL	A	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9969633delA	uc003bua.2	+						CIDEC_uc003bto.2_Intron|IL17RC_uc011ato.1_Intron|IL17RC_uc010hcs.2_Intron|IL17RC_uc003btz.2_Intron|IL17RC_uc011atp.1_Intron|IL17RC_uc003bud.2_Intron|IL17RC_uc003bub.2_Intron|IL17RC_uc010hct.2_Intron|IL17RC_uc010hcu.2_Intron|IL17RC_uc010hcv.2_Intron|IL17RC_uc011atq.1_Intron|IL17RC_uc003buc.2_Intron|IL17RC_uc003bue.2_5'Flank	NM_153461	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			ovary(1)|pancreas(1)	2						actctatctcaaaaaaaaaaa	0.189													4	2	---	---	---	---	
CCDC80	151887	broad.mit.edu	37	3	112329034	112329034	+	Intron	DEL	A	-	-	rs146699705		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112329034delA	uc003dzf.2	-						CCDC80_uc011bhv.1_Intron|CCDC80_uc003dzg.2_Intron|CCDC80_uc003dzh.1_Intron	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor											ovary(2)	2						CTGTGCCCAGAAAAAAAAAAA	0.363													4	4	---	---	---	---	
ABCF3	55324	broad.mit.edu	37	3	183905006	183905010	+	Intron	DEL	GTTTT	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183905006_183905010delGTTTT	uc003fmz.2	+						ABCF3_uc003fna.2_Intron|ABCF3_uc003fnb.2_5'Flank	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),								ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ttctacgtgagttttgttttgtttt	0.000													4	2	---	---	---	---	
SDHAP2	727956	broad.mit.edu	37	3	195412724	195412725	+	Intron	DEL	TT	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195412724_195412725delTT	uc003fuw.2	+						SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						TTGACAAAACTTTGAACGAGGC	0.401													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	37822924	37822924	+	IGR	DEL	A	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37822924delA								RELL1 (134925 upstream) : PGM2 (5358 downstream)																							aaaaaaaaagaaaaaaaaAAA	0.204													4	2	---	---	---	---	
ANKRD56	345079	broad.mit.edu	37	4	77818628	77818629	+	In_Frame_Ins	INS	-	CGC	CGC			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77818628_77818629insCGC	uc003hki.2	-	1	374_375	c.374_375insGCG	c.(373-375)CGC>CGGCGC	p.125_125R>RR		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	125	Poly-Arg.										0						GCTCCTTCTCGCGCCGCCGCCG	0.792													3	3	---	---	---	---	
LRAT	9227	broad.mit.edu	37	4	155666158	155666159	+	Intron	DEL	CT	-	-	rs66898606		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155666158_155666159delCT	uc003iom.1	+						uc003iol.2_Intron|LRAT_uc003ion.1_Intron	NM_004744	NP_004735	O95237	LRAT_HUMAN	lecithin retinol acyltransferase						response to stimulus|retinoid metabolic process|steroid metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|multivesicular body|perinuclear region of cytoplasm|rough endoplasmic reticulum	phosphatidylcholine-retinol O-acyltransferase activity			central_nervous_system(1)	1	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	tttctttttccttttttttttt	0.238													5	3	---	---	---	---	
ARRDC3	57561	broad.mit.edu	37	5	90669252	90669252	+	Intron	DEL	A	-	-	rs71971854		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90669252delA	uc003kjz.2	-							NM_020801	NP_065852	Q96B67	ARRD3_HUMAN	arrestin domain containing 3						signal transduction	cytoplasm	protein binding			ovary(1)|breast(1)	2		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		AGTTTAAGAGAAAAAAAAATT	0.284													4	2	---	---	---	---	
CNOT8	9337	broad.mit.edu	37	5	154251142	154251142	+	Intron	DEL	G	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154251142delG	uc003lvu.2	+						CNOT8_uc011ddf.1_Intron|CNOT8_uc011ddg.1_Intron|CNOT8_uc011ddh.1_Intron|CNOT8_uc003lvv.2_Intron|CNOT8_uc010jig.2_Intron|CNOT8_uc010jif.2_Intron|CNOT8_uc003lvw.2_Intron|CNOT8_uc011ddi.1_Intron|CNOT8_uc011ddj.1_Intron	NM_004779	NP_004770	Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8						negative regulation of cell proliferation|nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	nucleic acid binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			aaaaaaaaaaGATTCAGATTA	0.169								Direct_reversal_of_damage					9	6	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38730832	38730832	+	Intron	DEL	T	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38730832delT	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AAAGTAGTGGTTTTAAAACAT	0.373													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	73308509	73308510	+	IGR	INS	-	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73308509_73308510insG								RIMS1 (196002 upstream) : KCNQ5 (23061 downstream)																							CAGAAAATCGAGGGTTTTTTTT	0.366													4	2	---	---	---	---	
MAN1A1	4121	broad.mit.edu	37	6	119511121	119511121	+	Intron	DEL	A	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119511121delA	uc003pym.1	-							NM_005907	NP_005898	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		GCCCAACATTAAAAAAAAAAG	0.308													10	7	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152539952	152539969	+	Intron	DEL	GGCAGAGAACAGCGCAAA	-	-	rs71761553		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152539952_152539969delGGCAGAGAACAGCGCAAA	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAAATTCCTTGGCAGAGAACAGCGCAAAACGTCCACCT	0.413										HNSCC(10;0.0054)			3	4	---	---	---	---	
RHBDD2	57414	broad.mit.edu	37	7	75512836	75512837	+	Intron	INS	-	A	A	rs143886218		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75512836_75512837insA	uc003udw.1	+						RHBDD2_uc003udv.1_Intron	NM_001040456	NP_001035546	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2 isoform a							integral to membrane	serine-type endopeptidase activity				0						gactccatctcaaaaaaaaaaa	0.238													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	138088912	138088912	+	IGR	DEL	A	-	-	rs138300337		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138088912delA								AKR1D1 (285862 upstream) : TRIM24 (56167 downstream)																							ttttttttttAGTTTAACTTT	0.453													4	3	---	---	---	---	
UBXN8	7993	broad.mit.edu	37	8	30601611	30601611	+	5'Flank	DEL	C	-	-	rs3217273		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30601611delC	uc003xii.2	+						UBXN8_uc010lvi.2_5'Flank|UBXN8_uc011lbb.1_5'Flank	NM_005671	NP_005662	O00124	UBXN8_HUMAN	reproduction 8						single fertilization						0						TTGACCCTCTCCCAGCCGGCC	0.587													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104121960	104121963	+	IGR	DEL	AAAC	-	-	rs113884218		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104121960_104121963delAAAC								LPPR1 (34544 upstream) : BAAT (737 downstream)																							aagactGTCTaaacaaacaaacaa	0.137													9	5	---	---	---	---	
ATRNL1	26033	broad.mit.edu	37	10	117024499	117024502	+	Intron	DEL	GTTA	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117024499_117024502delGTTA	uc001lcg.2	+							NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AATGAATAATGTTAGTTGAGTAAA	0.270													2	4	---	---	---	---	
MALAT1	378938	broad.mit.edu	37	11	65273415	65273415	+	RNA	DEL	T	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65273415delT	uc010roh.1	+	1		c.8183delT			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						CTGCTAAGACTTTTTCAGGTG	0.448													127	18	---	---	---	---	
C11orf80	79703	broad.mit.edu	37	11	66610823	66610824	+	3'UTR	INS	-	GGCCC	GGCCC			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66610823_66610824insGGCCC	uc001ojf.2	+	17					C11orf80_uc001ojg.2_3'UTR|C11orf80_uc001ojh.2_3'UTR|C11orf80_uc001oji.2_3'UTR|C11orf80_uc010rpl.1_3'UTR|C11orf80_uc001ojj.2_3'UTR|RCE1_uc001ojk.1_5'Flank|RCE1_uc001ojl.1_5'Flank	NM_024650	NP_078926	Q8N6T0	CK080_HUMAN	hypothetical protein LOC79703												0						CTTCCGCGTCGGGCCCgggcgg	0.634													3	4	---	---	---	---	
DGAT2	84649	broad.mit.edu	37	11	75508392	75508393	+	Intron	DEL	AC	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75508392_75508393delAC	uc001oxa.2	+						DGAT2_uc001oxb.2_Intron	NM_032564	NP_115953	Q96PD7	DGAT2_HUMAN	diacylglycerol O-acyltransferase 2						glycerol metabolic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	diacylglycerol O-acyltransferase activity				0	Ovarian(111;0.103)					GTGCCTCCCTACACACACACAC	0.619													98	7	---	---	---	---	
HYOU1	10525	broad.mit.edu	37	11	118916978	118916979	+	Intron	DEL	TT	-	-	rs144229837		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118916978_118916979delTT	uc001puu.2	-						HYOU1_uc001put.2_Intron|HYOU1_uc010ryu.1_Intron|HYOU1_uc010ryv.1_Intron|HYOU1_uc001pux.3_Intron	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor							endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		gtgcctggcctttttttttttt	0.000													6	3	---	---	---	---	
DDX12	440081	broad.mit.edu	37	12	9574232	9574238	+	Intron	DEL	GCAGCAC	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9574232_9574238delGCAGCAC	uc010sgs.1	-						DDX12_uc001qvx.3_5'Flank|DDX12_uc001qvy.1_5'Flank	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						GTCACACTGGGCAGCACGCAGCAGGCA	0.633													9	4	---	---	---	---	
ITPR2	3709	broad.mit.edu	37	12	26864155	26864156	+	Frame_Shift_Ins	INS	-	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26864155_26864156insT	uc001rhg.2	-	9	1318_1319	c.901_902insA	c.(901-903)AGCfs	p.S301fs		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	301	Cytoplasmic (Potential).|MIR 4.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TCTGAACAAGCTGTTCCACTGT	0.416													74	7	---	---	---	---	
SMARCC2	6601	broad.mit.edu	37	12	56561673	56561674	+	Intron	INS	-	ACACACACACAC	ACACACACACAC	rs147768041		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56561673_56561674insACACACACACAC	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTTTCACTGAAacacacacaca	0.233													7	6	---	---	---	---	
NAP1L1	4673	broad.mit.edu	37	12	76462516	76462529	+	Intron	DEL	ACACACACACACAC	-	-	rs72456083		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76462516_76462529delACACACACACACAC	uc001sxw.2	-						NAP1L1_uc001sxv.2_Intron|NAP1L1_uc001sxz.2_Intron|NAP1L1_uc001sxx.2_Intron|NAP1L1_uc001sxy.2_Intron|NAP1L1_uc010sty.1_Intron|NAP1L1_uc010stz.1_Intron|NAP1L1_uc010sua.1_Intron|NAP1L1_uc001syb.2_Intron|NAP1L1_uc001sya.2_Intron|NAP1L1_uc001syc.2_Intron	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1						DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				CCCGCCCCTTacacacacacacacacacacacac	0.341													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19933246	19933246	+	IGR	DEL	A	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19933246delA								LOC100101938 (14133 upstream) : TPTE2 (63775 downstream)																							actccatctcaaaaaaaaaaa	0.194													3	4	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	48954160	48954160	+	Intron	DEL	T	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48954160delT	uc001vcb.2	+							NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AAACAACTTCTTTTTTTTTTT	0.129		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20138377	20138377	+	IGR	DEL	A	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20138377delA								P704P (118105 upstream) : OR4Q3 (77210 downstream)																							CAaaagaaagaaagaaagaaa	0.214													3	4	---	---	---	---	
PSMC1	5700	broad.mit.edu	37	14	90731688	90731688	+	Intron	DEL	A	-	-	rs34260220		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90731688delA	uc001xyf.2	+						PSMC1_uc001xyg.2_Intron|PSMC1_uc001xyh.2_Intron|PSMC1_uc010twh.1_Intron	NM_002802	NP_002793	P62191	PRS4_HUMAN	proteasome 26S ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0		all_cancers(154;0.142)		COAD - Colon adenocarcinoma(157;0.21)		atactgatgGAAAAAAAAAAA	0.065													4	2	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91110624	91110625	+	Intron	DEL	CG	-	-	rs1286424	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91110624_91110625delCG	uc001xyp.2	-						TTC7B_uc001xyo.2_5'Flank|TTC7B_uc010ats.2_Intron|uc001xyq.2_Intron	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				cacacacacacGCGCGAAAGAA	0.327													16	8	---	---	---	---	
INF2	64423	broad.mit.edu	37	14	105173451	105173452	+	Intron	INS	-	G	G			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105173451_105173452insG	uc001ypb.2	+						INF2_uc010tyi.1_Intron|INF2_uc001ypc.2_Intron|INF2_uc010awz.1_5'Flank	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1						actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		TCTTAGACCATGGGGGGGGGAG	0.693													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22440158	22440159	+	3'UTR	INS	-	T	T	rs146439979	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22440158_22440159insT	uc001yug.2	-	1										full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																		CTCTGTTTCTCTTTTTTTTTTG	0.238													4	2	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11064866	11064867	+	Intron	DEL	TT	-	-	rs71404430		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11064866_11064867delTT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						ATTGGCAACATTTTTTTTTTTT	0.426													5	3	---	---	---	---	
TXNDC11	51061	broad.mit.edu	37	16	11782231	11782236	+	In_Frame_Del	DEL	GGCAGA	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11782231_11782236delGGCAGA	uc010buu.1	-	10	2109_2114	c.2047_2052delTCTGCC	c.(2047-2052)TCTGCCdel	p.SA683del	TXNDC11_uc002dbg.1_In_Frame_Del_p.SA656del	NM_015914	NP_056998	Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	683_684	Thioredoxin 2.				cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0						ACGGGAACTGGGCAGAGCCACTTCCA	0.398													91	13	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76482606	76482606	+	Intron	DEL	T	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482606delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						GAAGGGAACCTTTTTTTTTTT	0.393													9	4	---	---	---	---	
DHX33	56919	broad.mit.edu	37	17	5364626	5364627	+	Intron	INS	-	T	T			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5364626_5364627insT	uc002gca.2	-						DHX33_uc002gbz.2_5'UTR|DHX33_uc002gcb.2_Intron|DHX33_uc010clf.2_Intron	NM_020162	NP_064547	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33							nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|pancreas(1)	2						TCCTTTCCTTCTTTTTTTTTTT	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16520983	16520984	+	IGR	INS	-	CGGG	CGGG	rs141887404	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16520983_16520984insCGGG								ZNF287 (48463 upstream) : ZNF624 (3064 downstream)																							GACGCGGGCCCCGGGCGTGCTC	0.644													6	7	---	---	---	---	
TBC1D28	254272	broad.mit.edu	37	17	18544823	18544824	+	Intron	DEL	CT	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18544823_18544824delCT	uc002gud.2	-							NM_001039397	NP_001034486	Q2M2D7	TBC28_HUMAN	TBC1 domain family, member 28							intracellular	Rab GTPase activator activity			ovary(1)	1						GGCCCCACCCCTGACTGGATCT	0.589													3	7	---	---	---	---	
ZNF286B	729288	broad.mit.edu	37	17	18583921	18583922	+	Intron	INS	-	C	C			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18583921_18583922insC	uc010vyd.1	-							NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTCTCCTGACTAGTCTCTTAGA	0.386													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20746999	20746999	+	Intron	DEL	G	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20746999delG	uc010crb.1	+											Homo sapiens cDNA clone IMAGE:6269068, partial cds.																		AGCTGGGCCCGGGGACGCCCG	0.726													2	4	---	---	---	---	
NF1	4763	broad.mit.edu	37	17	29687884	29687885	+	Intron	INS	-	GAAG	GAAG	rs139384924	by1000genomes	TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29687884_29687885insGAAG	uc002hgg.2	+						NF1_uc002hgh.2_Intron|NF1_uc010cso.2_Intron|NF1_uc010wbu.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGTTATTCTATGAAGCTTTCTA	0.332			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			4	4	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377700	45377701	+	Intron	INS	-	GC	GC	rs113076632		TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377700_45377701insGC	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	TTGTCTTACAGGCGCGCGCGCG	0.525													4	2	---	---	---	---	
TLE6	79816	broad.mit.edu	37	19	2993943	2993943	+	Intron	DEL	T	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2993943delT	uc002lwu.2	+						TLE6_uc002lwt.2_Intron|TLE6_uc010dtg.2_Intron|TLE6_uc002lwv.2_Intron	NM_024760	NP_079036	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6 isoform 2						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aaaaaaaaGGTGGGTGGGGAG	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36913800	36913800	+	IGR	DEL	A	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36913800delA								ZFP82 (4250 upstream) : ZNF566 (22222 downstream)																							CTTTGTCATTAAAAAAAAAAA	0.194													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	3646962	3646962	+	IGR	DEL	T	-	-			TCGA-G9-6378-01	TCGA-G9-6378-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:3646962delT								TGIF2LY (198882 upstream) : None (None downstream)																							CTTCGGCACCTTTTGTCTTTA	0.448													5	3	---	---	---	---	
