Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CDK11B	984	broad.mit.edu	37	1	1572104	1572104	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1572104C>T	uc001agv.1	-	21	1968	c.1857G>A	c.(1855-1857)CTG>CTA	p.L619L	CDK11B_uc009vkj.2_Silent_p.L276L|CDK11B_uc001ags.1_Silent_p.L477L|CDK11B_uc001agt.1_Silent_p.L402L|CDK11B_uc001aha.1_Silent_p.L585L|CDK11B_uc001agw.1_Silent_p.L574L|CDK11B_uc001agy.1_Silent_p.L617L|CDK11B_uc001agx.1_Silent_p.L608L|CDK11B_uc001agz.1_Silent_p.L363L	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)	632	Protein kinase.				apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						GCTTCTGAGTCAGCAGCTCCC	0.587													8	80	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7724942	7724942	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7724942G>A	uc001aoi.2	+	9	2542	c.2335G>A	c.(2335-2337)GAC>AAC	p.D779N		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	779					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CCTGATCAACGACTTCATCTC	0.647													68	503	---	---	---	---	PASS
PER3	8863	broad.mit.edu	37	1	7863155	7863155	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7863155G>A	uc001aoo.2	+	8	1093	c.918G>A	c.(916-918)TCG>TCA	p.S306S	PER3_uc009vmg.1_Silent_p.S307S|PER3_uc009vmh.1_Silent_p.S307S|PER3_uc001aop.2_Silent_p.S307S|PER3_uc010nzw.1_5'UTR|PER3_uc001aon.2_Silent_p.S306S	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	306	PAS 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGAACATCGATCCTAAGCT	0.448													9	106	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34180259	34180259	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34180259C>G	uc001bxn.1	-	21	3243	c.3214G>C	c.(3214-3216)GAG>CAG	p.E1072Q	CSMD2_uc001bxm.1_Missense_Mutation_p.E1112Q	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1072	Sushi 6.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCGGTGCCCTCCAGACGGTAC	0.642													41	274	---	---	---	---	PASS
BSND	7809	broad.mit.edu	37	1	55464880	55464880	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55464880C>T	uc001cye.2	+	1	264	c.21C>T	c.(19-21)TTC>TTT	p.F7F		NM_057176	NP_476517	Q8WZ55	BSND_HUMAN	barttin	7	Helical; (Potential).					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex				ovary(1)|skin(1)	2						AGAAGACCTTCCGGATCGGCT	0.617													32	96	---	---	---	---	PASS
TUFT1	7286	broad.mit.edu	37	1	151534633	151534633	+	Missense_Mutation	SNP	G	A	A	rs139065608	byFrequency	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151534633G>A	uc001eyl.2	+	2	189	c.127G>A	c.(127-129)GCC>ACC	p.A43T	TUFT1_uc001eym.2_Intron|TUFT1_uc010pdf.1_Missense_Mutation_p.A62T|TUFT1_uc010pdg.1_Intron	NM_020127	NP_064512	Q9NNX1	TUFT1_HUMAN	tuftelin 1 isoform 1	43					bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGAACACATAGCCCAGAAGGT	0.517													15	120	---	---	---	---	PASS
IFI16	3428	broad.mit.edu	37	1	159023487	159023487	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159023487G>C	uc001ftg.2	+	10	2372	c.2082G>C	c.(2080-2082)TTG>TTC	p.L694F	IFI16_uc010pis.1_Missense_Mutation_p.L694F|IFI16_uc001fth.2_Missense_Mutation_p.L237F|IFI16_uc010pit.1_Missense_Mutation_p.L293F	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	750	HIN-200 2.				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					CCGGGGAGTTGAGATCTGTAA	0.408													9	147	---	---	---	---	PASS
ADORA1	134	broad.mit.edu	37	1	203134455	203134455	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203134455C>T	uc001gze.1	+	4	841	c.408C>T	c.(406-408)TTC>TTT	p.F136F	FMOD_uc010pqi.1_Intron|ADORA1_uc001gzf.1_Silent_p.F136F|ADORA1_uc010pqg.1_Silent_p.F68F|ADORA1_uc009xak.1_Missense_Mutation_p.R62C|ADORA1_uc010pqh.1_Silent_p.F169F	NM_000674	NP_000665	P30542	AA1R_HUMAN	adenosine A1 receptor	136	Helical; Name=4; (Potential).				induction of apoptosis by extracellular signals|inflammatory response|nervous system development|phagocytosis	integral to plasma membrane				large_intestine(1)	1					Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Gabapentin(DB00996)|Imipramine(DB00458)|Pegademase bovine(DB00061)|Theophylline(DB00277)	TCCTCTCCTTCGTGGTGGGAC	0.652													11	44	---	---	---	---	PASS
OPTC	26254	broad.mit.edu	37	1	203472794	203472794	+	Silent	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203472794C>G	uc001gzu.1	+	7	1061	c.945C>G	c.(943-945)CTC>CTG	p.L315L		NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	opticin precursor	315	LRR 6.					proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.109)			ACCTCAGCCTCTTCCCCAGCG	0.622													15	126	---	---	---	---	PASS
FLVCR1	28982	broad.mit.edu	37	1	213032277	213032277	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213032277C>T	uc001hjt.2	+	1	681	c.483C>T	c.(481-483)ATC>ATT	p.I161I	LQK1_uc001hjr.3_5'Flank|LQK1_uc001hjs.3_5'Flank	NM_014053	NP_054772	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular	161	Helical; (Potential).				cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		TGCCCCTCATCTTCCCGGCCA	0.627													17	157	---	---	---	---	PASS
MTR	4548	broad.mit.edu	37	1	236973894	236973894	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236973894C>T	uc001hyi.3	+	5	924	c.501C>T	c.(499-501)ATC>ATT	p.I167I	MTR_uc010pxv.1_RNA|MTR_uc010pxw.1_5'UTR|MTR_uc010pxx.1_Silent_p.I167I|MTR_uc010pxy.1_Silent_p.I167I|MTR_uc009xgj.1_5'UTR	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	167	Hcy-binding.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	ATAGGAACATCAGTGAGTAtt	0.264													28	89	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1271197	1271197	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1271197G>C	uc002qwq.2	+	14	1266	c.1138G>C	c.(1138-1140)GAC>CAC	p.D380H	SNTG2_uc010ewi.2_Missense_Mutation_p.D253H	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	380	PH.				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TCAAGATTTTGACTTTGAGGA	0.527													3	19	---	---	---	---	PASS
MFSD2B	388931	broad.mit.edu	37	2	24245997	24245997	+	Intron	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24245997C>T	uc002reo.1	+							NM_001080473	NP_001073942	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing						transport	integral to membrane				ovary(2)	2						TGTGTCTCCCCAGGCGATGGT	0.552													42	84	---	---	---	---	PASS
MFSD2B	388931	broad.mit.edu	37	2	24247079	24247079	+	Silent	SNP	C	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24247079C>A	uc002reo.1	+	13	1442	c.1428C>A	c.(1426-1428)CTC>CTA	p.L476L		NM_001080473	NP_001073942	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing	476	Helical; (Potential).				transport	integral to membrane				ovary(2)	2						TCTGCATCCTCATGGTCGGCT	0.652													10	33	---	---	---	---	PASS
FAM98A	25940	broad.mit.edu	37	2	33811748	33811748	+	Intron	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33811748G>A	uc002rpa.1	-						FAM98A_uc010yne.1_Intron|FAM98A_uc010ynd.1_Intron|FAM98A_uc002roz.1_Intron	NM_015475	NP_056290	Q8NCA5	FA98A_HUMAN	hypothetical protein LOC25940											ovary(1)	1	all_hematologic(175;0.115)					ATCTTTTCCTGAAGCAAAATT	0.388													17	42	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37227719	37227719	+	Intron	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37227719G>A	uc002rpp.1	-						HEATR5B_uc002rpo.1_Intron|HEATR5B_uc010ezy.1_Intron	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				GTTTAAAACTGATAGGTTACC	0.383													22	62	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48950793	48950793	+	Silent	SNP	C	T	T	rs142554296		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48950793C>T	uc002rwu.3	-	5	496	c.426G>A	c.(424-426)ACG>ACA	p.T142T	GTF2A1L_uc002rwt.2_Intron|LHCGR_uc002rwv.2_RNA	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	142	LRR 2.|Extracellular (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	AGAAGACCTTCGTAACATCTG	0.393									Familial_Male-Limited_Precocious_Puberty				9	92	---	---	---	---	PASS
EMX1	2016	broad.mit.edu	37	2	73145356	73145356	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73145356C>T	uc002sin.1	+	1	753	c.375C>T	c.(373-375)CAC>CAT	p.H125H	EMX1_uc002sim.1_Intron	NM_004097	NP_004088	Q04741	EMX1_HUMAN	empty spiracles homolog 1	92						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCATGAACCACCCCGCGCTGA	0.607													4	30	---	---	---	---	PASS
TBC1D8	11138	broad.mit.edu	37	2	101646213	101646213	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101646213G>A	uc010fiv.2	-	12	2048	c.1917C>T	c.(1915-1917)TTC>TTT	p.F639F	TBC1D8_uc002tau.3_Silent_p.F396F	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	639	Rab-GAP TBC.				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						TGAGCTCCTCGAAGACAGACT	0.547													6	99	---	---	---	---	PASS
SPOPL	339745	broad.mit.edu	37	2	139318393	139318393	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139318393G>A	uc002tvh.2	+	8	1133	c.733G>A	c.(733-735)GAT>AAT	p.D245N		NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	245	BTB.					nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		GGAAATAAATGATTTAGACCC	0.333													6	85	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168107674	168107674	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168107674G>A	uc002udx.2	+	8	9790	c.9772G>A	c.(9772-9774)GCT>ACT	p.A3258T	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.A3083T|XIRP2_uc010fpq.2_Missense_Mutation_p.A3036T|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	3083					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATCTGTGGACGCTCAAGAGGA	0.408													13	72	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179462709	179462709	+	Missense_Mutation	SNP	A	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179462709A>G	uc010zfg.1	-	242	49708	c.49484T>C	c.(49483-49485)GTT>GCT	p.V16495A	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V10190A|TTN_uc010zfi.1_Missense_Mutation_p.V10123A|TTN_uc010zfj.1_Missense_Mutation_p.V9998A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17422							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTGCTCTAACTCTAAATTT	0.398													26	122	---	---	---	---	PASS
SLC39A10	57181	broad.mit.edu	37	2	196573389	196573389	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196573389G>A	uc002utg.3	+	5	1610	c.1396G>A	c.(1396-1398)GGA>AGA	p.G466R	SLC39A10_uc002uth.3_Missense_Mutation_p.G466R|SLC39A10_uc010zgp.1_Missense_Mutation_p.G16R	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),	466	His-rich.				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)			GTCTCAGGGTGGACATGATCA	0.299													10	55	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197085612	197085612	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197085612C>T	uc002utm.1	-	25	4383	c.4200G>A	c.(4198-4200)AAG>AAA	p.K1400K	HECW2_uc002utl.1_Silent_p.K1044K	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	1400	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						CCTTCTTGTTCTTCTCTGTAA	0.413													28	176	---	---	---	---	PASS
CCL20	6364	broad.mit.edu	37	2	228678700	228678700	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228678700G>C	uc002vpl.2	+	1	143	c.73G>C	c.(73-75)GAA>CAA	p.E25Q	CCL20_uc002vpm.2_Missense_Mutation_p.E25Q	NM_004591	NP_004582	P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20 isoform 1	25					cell-cell signaling|chemotaxis|defense response to bacterium|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity				0		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		CGGCGAATCAGAAGGTAAGTG	0.473													7	96	---	---	---	---	PASS
ITM2C	81618	broad.mit.edu	37	2	231738281	231738281	+	Intron	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231738281C>T	uc002vqz.2	+						ITM2C_uc002vra.2_Intron|ITM2C_uc002vrb.2_Intron|ITM2C_uc002vrc.2_5'Flank|ITM2C_uc002vrd.2_5'Flank	NM_030926	NP_112188	Q9NQX7	ITM2C_HUMAN	integral membrane protein 2C isoform 1						negative regulation of neuron projection development|neuron differentiation	Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	beta-amyloid binding				0		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		AGGTGAGGGGCCGGGCCAGGT	0.607													6	50	---	---	---	---	PASS
TDGF1	6997	broad.mit.edu	37	3	46621265	46621265	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46621265G>A	uc003cpv.2	+	4	540	c.260G>A	c.(259-261)GGA>GAA	p.G87E	LRRC2_uc003cpu.3_Intron	NM_003212	NP_003203	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1	87	EGF-like.				activation of MAPK activity|anterior/posterior axis specification, embryo|mammary gland development|morphogenesis of a branching structure|negative regulation of apoptosis|peptidyl-serine phosphorylation|positive regulation of cell migration|positive regulation of peptidyl-tyrosine phosphorylation	anchored to membrane|cell surface|extrinsic to plasma membrane	growth factor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		CTGAATGGGGGAACCTGCATG	0.532													29	188	---	---	---	---	PASS
CACNA2D2	9254	broad.mit.edu	37	3	50404872	50404872	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50404872C>T	uc003daq.2	-	28	2413	c.2375G>A	c.(2374-2376)CGC>CAC	p.R792H	CACNA2D2_uc003dap.2_Missense_Mutation_p.R785H|CACNA2D2_uc003dao.2_5'Flank	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	792	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	ATCCAGGCTGCGGCGGTAGAA	0.612													6	39	---	---	---	---	PASS
C3orf63	23272	broad.mit.edu	37	3	56667588	56667588	+	Silent	SNP	A	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56667588A>G	uc003did.3	-	17	3149	c.3048T>C	c.(3046-3048)TTT>TTC	p.F1016F	C3orf63_uc003dib.3_Silent_p.F135F|C3orf63_uc003dic.3_Silent_p.F640F|C3orf63_uc003die.3_Silent_p.F1077F	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	1077										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		AACCATCTACAAACTCCTGCA	0.408													21	106	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66455646	66455646	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66455646G>A	uc003dmx.2	-	9	1150	c.1136C>T	c.(1135-1137)TCA>TTA	p.S379L	LRIG1_uc011bfu.1_5'Flank|LRIG1_uc003dmw.2_Missense_Mutation_p.S45L|LRIG1_uc010hnz.2_Missense_Mutation_p.S119L|LRIG1_uc010hoa.2_Missense_Mutation_p.S379L	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	379	Extracellular (Potential).					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GTCGAGCCCTGAGAAGGCGCC	0.627													6	42	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	100963077	100963077	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100963077G>A	uc003duq.1	-	13	2301	c.2098C>T	c.(2098-2100)CTA>TTA	p.L700L	IMPG2_uc011bhe.1_Silent_p.L563L	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	700	Extracellular (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						GGGAGGGTTAGAGACGCAGAT	0.473													10	123	---	---	---	---	PASS
BOC	91653	broad.mit.edu	37	3	112993328	112993328	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112993328G>A	uc003dzx.2	+	9	1962	c.1341G>A	c.(1339-1341)GCG>GCA	p.A447A	BOC_uc003dzy.2_Silent_p.A447A|BOC_uc003dzz.2_Silent_p.A447A|BOC_uc003eab.2_Silent_p.A148A	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	447	Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			GGCAACCGGCGCTCCCCAGAC	0.662													13	167	---	---	---	---	PASS
QTRTD1	79691	broad.mit.edu	37	3	113804753	113804753	+	3'UTR	SNP	A	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113804753A>G	uc003eay.2	+	10					QTRTD1_uc003eaz.2_3'UTR|QTRTD1_uc011biq.1_3'UTR|QTRTD1_uc011bir.1_3'UTR	NM_024638	NP_078914	Q9H974	QTRD1_HUMAN	queuine tRNA-ribosyltransferase domain						queuosine biosynthetic process	mitochondrion	metal ion binding|queuine tRNA-ribosyltransferase activity			central_nervous_system(1)|skin(1)	2						GCATCTTGAGATCTTGCAAAT	0.393													75	44	---	---	---	---	PASS
DZIP1L	199221	broad.mit.edu	37	3	137800604	137800604	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137800604G>A	uc003erq.2	-	9	1569	c.1206C>T	c.(1204-1206)ATC>ATT	p.I402I	DZIP1L_uc003err.1_Silent_p.I402I	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like	402	Potential.					intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						ACAAGGACTGGATCTGCAAAG	0.502													44	62	---	---	---	---	PASS
P2RY14	9934	broad.mit.edu	37	3	150931083	150931083	+	3'UTR	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150931083G>A	uc003eyr.1	-	3					MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron|P2RY14_uc003eys.1_3'UTR	NM_001081455	NP_001074924	Q15391	P2Y14_HUMAN	P2Y14 receptor							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled|UDP-activated nucleotide receptor activity			large_intestine(2)|ovary(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GAAGAGGGTAGGAACTCACAA	0.358													26	257	---	---	---	---	PASS
TRIM59	286827	broad.mit.edu	37	3	160156239	160156239	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160156239C>G	uc003fdm.2	-	3	928	c.733G>C	c.(733-735)GAG>CAG	p.E245Q	IFT80_uc003fda.2_RNA	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	245	Potential.					integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGTGGAGACTCTTCTTGTAAA	0.353													15	294	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193207650	193207650	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193207650G>C	uc003ftd.2	-	7	715	c.607C>G	c.(607-609)CTA>GTA	p.L203V	ATP13A4_uc003fte.1_Missense_Mutation_p.L203V|ATP13A4_uc011bsr.1_5'UTR	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	203	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		AATGGATTTAGAACCTGTTGG	0.338													5	147	---	---	---	---	PASS
GABRA2	2555	broad.mit.edu	37	4	46252457	46252457	+	Missense_Mutation	SNP	C	A	A	rs145736784		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46252457C>A	uc003gxc.3	-	9	1897	c.1224G>T	c.(1222-1224)AAG>AAT	p.K408N	GABRA2_uc010igc.2_Missense_Mutation_p.K408N|GABRA2_uc011bzc.1_Missense_Mutation_p.K413N	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2	408	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	p.K408K(1)		ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGAAAGTTTTCTTTGCTTCAG	0.398													34	145	---	---	---	---	PASS
GPM6A	2823	broad.mit.edu	37	4	176561306	176561306	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176561306C>T	uc003iuf.2	-	6	1462	c.658G>A	c.(658-660)GGA>AGA	p.G220R	GPM6A_uc011ckj.1_Missense_Mutation_p.G213R|GPM6A_uc003iug.2_Missense_Mutation_p.G220R|GPM6A_uc003iuh.2_Missense_Mutation_p.G209R	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2	220	Helical; (Potential).					cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		GCCCCAGCTCCAGCAAGTGCC	0.433													11	72	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	236602	236602	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:236602G>A	uc003jao.3	+	10	1435	c.1320G>A	c.(1318-1320)GAG>GAA	p.E440E	SDHA_uc011clv.1_Silent_p.E440E|SDHA_uc011clw.1_Silent_p.E392E|SDHA_uc003jap.3_Silent_p.E440E|SDHA_uc003jaq.3_Silent_p.E215E|SDHA_uc003jar.3_Silent_p.E34E	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	440		FAD (By similarity).			nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CCTGTGGGGAGGCCGCCTGTG	0.592									Familial_Paragangliomas				15	105	---	---	---	---	PASS
SLC9A3	6550	broad.mit.edu	37	5	480053	480053	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:480053G>A	uc003jbe.2	-	10	1657	c.1545C>T	c.(1543-1545)CTC>CTT	p.L515L	SLC9A3_uc011clx.1_Silent_p.L506L|uc011cly.1_RNA	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	515	Cytoplasmic (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GGACCCTGCTGAGGAACTTCC	0.627													9	161	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9197364	9197364	+	Silent	SNP	C	T	T	rs1806117		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9197364C>T	uc003jek.2	-	10	1696	c.984G>A	c.(982-984)GCG>GCA	p.A328A		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	328	Sema.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						AGAAGGCCTGCGCGATGGCGC	0.612													18	170	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10377945	10377945	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10377945G>A	uc003jet.1	+	2	238	c.55G>A	c.(55-57)GAG>AAG	p.E19K	MARCH6_uc011cmu.1_Missense_Mutation_p.E19K|MARCH6_uc003jeu.1_5'UTR|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	19	Cytoplasmic (Potential).|RING-CH-type.				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						AGGAACACCTGAGAAACCGCT	0.338													21	96	---	---	---	---	PASS
GPBP1	65056	broad.mit.edu	37	5	56557074	56557074	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56557074G>C	uc003jrh.3	+	11	2502	c.1228G>C	c.(1228-1230)GAT>CAT	p.D410H	GPBP1_uc010iwg.2_Missense_Mutation_p.D430H|GPBP1_uc003jri.3_Missense_Mutation_p.D239H|GPBP1_uc003jrj.3_Missense_Mutation_p.D402H|GPBP1_uc003jrk.3_Missense_Mutation_p.D417H|GPBP1_uc003jrl.3_RNA	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1 isoform 1	410					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		CTTAACTGAGGATGAAATGAG	0.328													19	109	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140257039	140257039	+	Missense_Mutation	SNP	C	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140257039C>A	uc003lic.2	+	1	2109	c.1982C>A	c.(1981-1983)TCC>TAC	p.S661Y	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.S661Y	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	661	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCTGACGTCCACGGCCACG	0.692													14	64	---	---	---	---	PASS
LARS	51520	broad.mit.edu	37	5	145531511	145531511	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145531511C>T	uc003lnx.1	-	14	1577	c.1339G>A	c.(1339-1341)GAT>AAT	p.D447N	LARS_uc011dbq.1_Missense_Mutation_p.D401N|LARS_uc011dbr.1_Missense_Mutation_p.D393N|LARS_uc011dbs.1_Missense_Mutation_p.D420N	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	447	Editing domain.				leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	TTCAACTCATCACAAATGGTT	0.398													23	164	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147503405	147503405	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147503405C>T	uc003lox.2	+	27	2621	c.2548C>T	c.(2548-2550)CGT>TGT	p.R850C	SPINK5_uc010jgr.2_Missense_Mutation_p.R831C|SPINK5_uc003low.2_Missense_Mutation_p.R850C|SPINK5_uc003loy.2_Missense_Mutation_p.R850C	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform	850	Kazal-like 13.				anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGATCTGTGTCGTGAATTTCG	0.388													6	38	---	---	---	---	PASS
PANK3	79646	broad.mit.edu	37	5	167995656	167995656	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167995656G>A	uc003lzz.1	-	2	676	c.376C>T	c.(376-378)CGC>TGC	p.R126C		NM_024594	NP_078870	Q9H999	PANK3_HUMAN	pantothenate kinase 3	126					coenzyme A biosynthetic process	cytoplasm|nucleus	ATP binding|pantothenate kinase activity			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		CCTACTGTGCGAAAATCTTTT	0.373													6	98	---	---	---	---	PASS
GABRP	2568	broad.mit.edu	37	5	170236741	170236741	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170236741G>C	uc003mau.2	+	9	1200	c.1002G>C	c.(1000-1002)CAG>CAC	p.Q334H	GABRP_uc011dev.1_Intron	NM_014211	NP_055026	O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	334	Cytoplasmic (Potential).					cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			breast(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTTACAGCAGATGGCAGCCA	0.507											OREG0017032	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	76	---	---	---	---	PASS
JARID2	3720	broad.mit.edu	37	6	15496965	15496965	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15496965G>A	uc003nbj.2	+	7	1753	c.1509G>A	c.(1507-1509)ACG>ACA	p.T503T	JARID2_uc011diu.1_Silent_p.T367T|JARID2_uc011div.1_Silent_p.T331T|JARID2_uc011diw.1_Silent_p.T465T	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	503					central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGCGGGCCACGGCCGGGAAGA	0.642													6	49	---	---	---	---	PASS
EGFL8	80864	broad.mit.edu	37	6	32135384	32135384	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32135384C>T	uc003oab.1	+	8	844	c.786C>T	c.(784-786)ATC>ATT	p.I262I	PPT2_uc003nzy.1_RNA|EGFL8_uc003oac.1_Silent_p.I262I	NM_030652	NP_085155	Q99944	EGFL8_HUMAN	NG3 protein precursor	262						extracellular region|integral to membrane	calcium ion binding				0						GTGACCGGATCGAATCTCTCA	0.647													19	121	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51483976	51483976	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51483976C>T	uc003pah.1	-	67	12404	c.12128G>A	c.(12127-12129)AGC>AAC	p.S4043N		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	4043	Cytoplasmic (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					AAGCCCCAAGCTGCCACTTTG	0.547													29	50	---	---	---	---	PASS
TINAG	27283	broad.mit.edu	37	6	54191661	54191661	+	Missense_Mutation	SNP	C	T	T	rs115438249	byFrequency	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54191661C>T	uc003pcj.2	+	4	717	c.571C>T	c.(571-573)CGC>TGC	p.R191C	TINAG_uc010jzt.2_RNA	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	191					cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TTTTAAATTTCGCCTTGGCAC	0.373													11	81	---	---	---	---	PASS
UBE2CBP	90025	broad.mit.edu	37	6	83732175	83732175	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83732175G>C	uc003pjp.2	-	7	951	c.843C>G	c.(841-843)ATC>ATG	p.I281M	UBE2CBP_uc011dyx.1_Intron|UBE2CBP_uc003pjq.2_Missense_Mutation_p.I71M	NM_198920	NP_944602	Q7Z6J8	UB2CB_HUMAN	ubiquitin-conjugating enzyme E2C binding	281						cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)		TTCTTACCAAGATATACACTT	0.413													4	28	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	106967523	106967523	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106967523G>C	uc003prh.2	+	2	1703	c.1216G>C	c.(1216-1218)GAG>CAG	p.E406Q		NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	406							sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TAAGCTCTTAGAGAAGGAGGA	0.458													17	88	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144875962	144875962	+	Missense_Mutation	SNP	A	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144875962A>G	uc003qkt.2	+	48	7159	c.7067A>G	c.(7066-7068)GAG>GGG	p.E2356G		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	2356					muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AGAAAATATGAGGCTCGACTC	0.438													6	54	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1525079	1525079	+	Silent	SNP	G	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1525079G>T	uc003skn.2	-	23	3104	c.3003C>A	c.(3001-3003)GGC>GGA	p.G1001G	INTS1_uc003skp.1_Silent_p.G348G	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	1001					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCCGCAGGCTGCCCTCCGAAA	0.667													9	45	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2998150	2998150	+	5'UTR	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2998150C>T	uc003smv.2	-	2						NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11						positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGGAGGGGTGCTCACACACAG	0.443			Mis		DLBCL								9	71	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	3998591	3998591	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3998591G>C	uc003smx.2	+	8	1318	c.1179G>C	c.(1177-1179)GAG>GAC	p.E393D		NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	393	Ig-like C2-type 4.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CTGAGCCCGAGAGTCGGATTT	0.458													39	114	---	---	---	---	PASS
PMS2	5395	broad.mit.edu	37	7	6042276	6042276	+	Intron	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6042276G>A	uc003spl.2	-						PMS2_uc003spj.2_Intron|PMS2_uc003spk.2_Intron|PMS2_uc011jwl.1_Intron|PMS2_uc010ktg.2_Intron|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Intron	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform						mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		CGCTGTGAGAGAATACCAGGC	0.443			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				37	111	---	---	---	---	PASS
ZNF680	340252	broad.mit.edu	37	7	63982011	63982011	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63982011C>G	uc003tta.2	-	4	1294	c.1121G>C	c.(1120-1122)GGA>GCA	p.G374A	ZNF680_uc010kzr.2_Missense_Mutation_p.G301A	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1	374					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)				GGATTTCTCTCCAGTATGAAT	0.358													4	57	---	---	---	---	PASS
BAIAP2L1	55971	broad.mit.edu	37	7	97949382	97949382	+	Silent	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97949382C>G	uc003upj.2	-	5	599	c.336G>C	c.(334-336)GTG>GTC	p.V112V		NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	112	IMD.				filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			TCATATATTTCACGTCAAGTT	0.433													7	106	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107848053	107848053	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107848053C>T	uc003vfb.2	-	13	1597	c.1126G>A	c.(1126-1128)GAG>AAG	p.E376K	NRCAM_uc003vfc.2_Missense_Mutation_p.E370K|NRCAM_uc011kmk.1_Missense_Mutation_p.E371K|NRCAM_uc003vfd.2_Missense_Mutation_p.E352K|NRCAM_uc003vfe.2_Missense_Mutation_p.E352K	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	376	Ig-like 4.|Extracellular (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						GTCCCATCCTCTCCTGGGGAC	0.443													10	59	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	120373014	120373014	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120373014G>A	uc003vjj.1	+	2	2138	c.1173G>A	c.(1171-1173)TCG>TCA	p.S391S		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	391	Helical; Name=Segment S6; (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					CTATCTGTTCGCTGAGTGGGG	0.423													15	84	---	---	---	---	PASS
REPIN1	29803	broad.mit.edu	37	7	150069696	150069696	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150069696G>A	uc010lpq.1	+	4	1855	c.1366G>A	c.(1366-1368)GAT>AAT	p.D456N	REPIN1_uc003whd.2_Missense_Mutation_p.D445N|REPIN1_uc010lpr.1_Missense_Mutation_p.D513N|REPIN1_uc003whc.2_Missense_Mutation_p.D456N|REPIN1_uc003whe.2_Missense_Mutation_p.D456N	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	456					DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CCACGCCCCCGATCGGCCCTT	0.731													5	34	---	---	---	---	PASS
ATG9B	285973	broad.mit.edu	37	7	150720969	150720969	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150720969C>T	uc011kvc.1	-	1	618	c.542G>A	c.(541-543)GGG>GAG	p.G181E	ATG9B_uc003wig.3_5'Flank	NM_173681	NP_775952	Q674R7	ATG9B_HUMAN	ATG9 autophagy related 9 homolog B	181	Cytoplasmic (By similarity).				autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane				ovary(1)	1	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACCTCGGAGCCCTTCAGGGAC	0.612													5	20	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	157926524	157926524	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157926524G>A	uc003wno.2	-	9	1522	c.1401C>T	c.(1399-1401)GCC>GCT	p.A467A	PTPRN2_uc003wnp.2_Silent_p.A450A|PTPRN2_uc003wnq.2_Silent_p.A467A|PTPRN2_uc003wnr.2_Silent_p.A429A|PTPRN2_uc011kwa.1_Silent_p.A490A	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	467	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CAAACGCAGCGGCCCCGGGCT	0.632													12	82	---	---	---	---	PASS
STC1	6781	broad.mit.edu	37	8	23709032	23709032	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23709032C>T	uc003xdw.1	-	3	558	c.274G>A	c.(274-276)GTC>ATC	p.V92I		NM_003155	NP_003146	P52823	STC1_HUMAN	stanniocalcin 1 precursor	92					cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity			skin(3)|upper_aerodigestive_tract(1)	4		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		CTCTCTTTGACGAATGCTTTT	0.507													7	39	---	---	---	---	PASS
FUT10	84750	broad.mit.edu	37	8	33247035	33247035	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33247035C>T	uc003xje.2	-	4	1014	c.658G>A	c.(658-660)GAC>AAC	p.D220N	FUT10_uc003xjc.2_Missense_Mutation_p.D227N|FUT10_uc003xjd.2_Missense_Mutation_p.D192N|FUT10_uc011lbi.1_Missense_Mutation_p.D270N|FUT10_uc003xjf.2_Missense_Mutation_p.D158N|FUT10_uc003xjg.2_Missense_Mutation_p.D192N|FUT10_uc003xjh.2_Missense_Mutation_p.D220N	NM_032664	NP_116053	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10	220	Lumenal (Potential).				embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		GGGTCACAGTCTGACTGTACA	0.473													18	121	---	---	---	---	PASS
CCNE2	9134	broad.mit.edu	37	8	95906110	95906110	+	Intron	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95906110C>T	uc003yhc.2	-						C8orf38_uc003yhe.1_5'Flank|C8orf38_uc003yhf.2_5'Flank|CCNE2_uc003yhd.2_Intron	NM_057749	NP_477097	O96020	CCNE2_HUMAN	cyclin E2						cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)					CAGCCCAGTTCTGCATTACCC	0.383													46	121	---	---	---	---	PASS
TSPYL5	85453	broad.mit.edu	37	8	98289031	98289031	+	Missense_Mutation	SNP	G	A	A	rs144247525		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98289031G>A	uc003yhy.2	-	1	1146	c.1042C>T	c.(1042-1044)CGT>TGT	p.R348C		NM_033512	NP_277047	Q86VY4	TSYL5_HUMAN	TSPY-like 5	348					cellular response to gamma radiation|nucleosome assembly|positive regulation of cell proliferation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|regulation of growth	nucleus	protein binding			large_intestine(1)|ovary(1)	2	Breast(36;2.56e-06)					AAGAAACTACGGTTGTTTTCT	0.498													22	147	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109252288	109252288	+	Missense_Mutation	SNP	T	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109252288T>A	uc003ymu.2	-	3	250	c.222A>T	c.(220-222)AGA>AGT	p.R74S	EIF3E_uc003ymt.2_Missense_Mutation_p.R25S|EIF3E_uc003ymv.2_5'UTR|EIF3E_uc010mci.1_Missense_Mutation_p.R74S|EIF3E_uc010mcj.1_Missense_Mutation_p.R74S	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	74	Sufficient for interaction with TRIM27.|Sufficient for interaction with EPAS1.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			CCACTGTGGTTCTTTTCTCTC	0.373													19	119	---	---	---	---	PASS
CPSF1	29894	broad.mit.edu	37	8	145620684	145620684	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145620684G>A	uc003zcj.2	-	27	3137	c.3062C>T	c.(3061-3063)ACG>ATG	p.T1021M	MIR939_hsa-mir-939|MI0005761_5'Flank|CPSF1_uc011lld.1_RNA	NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	1021					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			ATAGTGGGCCGTGCAGCGCAG	0.662													12	52	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79328481	79328481	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79328481G>A	uc010mpk.2	-	7	1037	c.913C>T	c.(913-915)CAG>TAG	p.Q305*		NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	305					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						GGGCTCACCTGACTGCACAGC	0.532													7	20	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114135509	114135509	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114135509C>T	uc004bfe.1	-	42	4811	c.4811G>A	c.(4810-4812)CGG>CAG	p.R1604Q		NM_001080398	NP_001073867			KIAA0368 protein												0						GCTGCTATCCCGTGAGGTCTG	0.338													25	183	---	---	---	---	PASS
PBX3	5090	broad.mit.edu	37	9	128728131	128728131	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128728131G>A	uc004bqb.2	+	9	1350	c.1234G>A	c.(1234-1236)GCA>ACA	p.A412T	PBX3_uc004bqc.2_Missense_Mutation_p.A231T|PBX3_uc004bqd.2_3'UTR|PBX3_uc011lzw.1_Missense_Mutation_p.A337T|PBX3_uc011lzx.1_3'UTR|PBX3_uc004bqe.2_Missense_Mutation_p.A320T	NM_006195	NP_006186	P40426	PBX3_HUMAN	pre-B-cell leukemia homeobox 3 isoform 1	412					anterior compartment pattern formation|posterior compartment specification		sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						CTGGCAGGACGCAACAACTCC	0.478													38	247	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135145014	135145014	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135145014C>T	uc004cbk.2	-	25	7458	c.7275G>A	c.(7273-7275)TTG>TTA	p.L2425L	SETX_uc004cbj.2_Silent_p.L2044L|SETX_uc010mzt.2_Silent_p.L2011L	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	2425					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TCAGGGTCCTCAAATGTCCGA	0.408											OREG0019570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	404	---	---	---	---	PASS
NOXA1	10811	broad.mit.edu	37	9	140327707	140327707	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140327707G>T	uc004cmv.2	+	10	1036	c.901G>T	c.(901-903)GGT>TGT	p.G301C	C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Missense_Mutation_p.G301C|NOXA1_uc010nch.2_Missense_Mutation_p.G245C	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1	301			Missing (in NOXA1truncated, a cDNA isolated from Caco-2 cells treated with butyrate).		regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		GGACCCCGCGGGTGCTGGGGT	0.652													3	26	---	---	---	---	PASS
MASTL	84930	broad.mit.edu	37	10	27447546	27447546	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27447546G>A	uc001itm.2	+	2	894	c.255G>A	c.(253-255)CTG>CTA	p.L85L	MASTL_uc001itl.2_Silent_p.L85L|MASTL_uc009xkw.1_Silent_p.L85L|MASTL_uc009xkx.1_RNA	NM_032844	NP_116233	Q96GX5	GWL_HUMAN	microtubule associated serine/threonine	85	Protein kinase.				cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						GAGATGCACTGGCACTAAGCA	0.333													9	133	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49414917	49414917	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49414917C>G	uc001jgi.2	-	14	1778	c.1671G>C	c.(1669-1671)AGG>AGC	p.R557S	FRMPD2_uc001jgh.2_Missense_Mutation_p.R525S|FRMPD2_uc001jgj.2_Missense_Mutation_p.R535S	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	557	FERM.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		CTTCTGGCCTCCTCTTCTCTG	0.488													30	44	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68979522	68979522	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68979522G>A	uc009xpn.1	-	6	809	c.686C>T	c.(685-687)TCT>TTT	p.S229F	CTNNA3_uc001jmw.2_Missense_Mutation_p.S229F|CTNNA3_uc001jmx.3_Missense_Mutation_p.S229F|CTNNA3_uc009xpo.1_Missense_Mutation_p.S89F|CTNNA3_uc001jna.2_Missense_Mutation_p.S241F	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	229					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						AGCAACATCAGAATGCTCCAA	0.418													22	109	---	---	---	---	PASS
OIT3	170392	broad.mit.edu	37	10	74684331	74684331	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74684331G>T	uc001jte.1	+	7	1514	c.1296G>T	c.(1294-1296)TTG>TTT	p.L432F	OIT3_uc009xqs.1_Intron	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor	432	ZP.					nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					TGGAAAGCTTGGTGGAGAGCT	0.557													14	66	---	---	---	---	PASS
KCNMA1	3778	broad.mit.edu	37	10	78709021	78709021	+	Missense_Mutation	SNP	G	A	A	rs150678882		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78709021G>A	uc001jxn.2	-	22	2765	c.2588C>T	c.(2587-2589)CCG>CTG	p.P863L	KCNMA1_uc001jxj.2_Missense_Mutation_p.P809L|KCNMA1_uc001jxk.1_Missense_Mutation_p.P481L|KCNMA1_uc009xrt.1_Missense_Mutation_p.P654L|KCNMA1_uc001jxl.1_Missense_Mutation_p.P488L|KCNMA1_uc001jxo.2_Missense_Mutation_p.P846L|KCNMA1_uc001jxm.2_Missense_Mutation_p.P805L|KCNMA1_uc001jxq.2_Missense_Mutation_p.P808L	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium	863	Cytoplasmic (Potential).				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	GGCACGGAGCGGCATCACCAG	0.552													18	87	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89717615	89717615	+	Nonsense_Mutation	SNP	C	T	T	rs121909227		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89717615C>T	uc001kfb.2	+	8	1671	c.640C>T	c.(640-642)CAG>TAG	p.Q214*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	214	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.Q214*(8)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.G165_K342del(1)|p.Q214fs*22(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGCAGATCCTCAGTTTGTGGT	0.388		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			40	97	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105201705	105201705	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105201705G>A	uc001kwy.1	+	31	4767	c.4680G>A	c.(4678-4680)GAG>GAA	p.E1560E		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	1560					mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CAGACAGCGAGGAGGATGAGA	0.572													13	54	---	---	---	---	PASS
JAKMIP3	282973	broad.mit.edu	37	10	133930916	133930916	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133930916G>C	uc001lkx.3	+	2	471	c.471G>C	c.(469-471)GAG>GAC	p.E157D		NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGCAGCAGGAGATCTCCGAGC	0.617													6	76	---	---	---	---	PASS
ANO9	338440	broad.mit.edu	37	11	433372	433372	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:433372C>T	uc001lpi.2	-	4	377	c.292G>A	c.(292-294)GAG>AAG	p.E98K	ANO9_uc010qvv.1_5'UTR	NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	98	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4						GCAGGCCCCTCAGGCTCCAGG	0.652													11	73	---	---	---	---	PASS
CYB5R2	51700	broad.mit.edu	37	11	7687688	7687688	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7687688G>A	uc001mfm.2	-	8	890	c.652C>T	c.(652-654)CCC>TCC	p.P218S	CYB5R2_uc001mfn.2_RNA|CYB5R2_uc009yfk.2_Missense_Mutation_p.P218S	NM_016229	NP_057313	Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase b5R.2	218					sterol biosynthetic process	membrane|soluble fraction	cytochrome-b5 reductase activity				0				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GTACCAATGGGAGGCCTGTCC	0.483											OREG0020724	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	49	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606854	55606854	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606854G>C	uc010rio.1	+	1	627	c.627G>C	c.(625-627)GAG>GAC	p.E209D		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				CTTTTAATGAGATAAGCACAC	0.433													15	112	---	---	---	---	PASS
OR5W2	390148	broad.mit.edu	37	11	55681565	55681565	+	Missense_Mutation	SNP	C	T	T	rs148084259		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55681565C>T	uc010rir.1	-	1	494	c.494G>A	c.(493-495)CGC>CAC	p.R165H		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GAAGCATAGGCGGAAGGCCAG	0.428													9	80	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60183756	60183756	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60183756G>T	uc001npj.2	+	5	1880	c.1315G>T	c.(1315-1317)GAT>TAT	p.D439Y	MS4A14_uc001npi.2_Missense_Mutation_p.D327Y|MS4A14_uc001npn.2_Missense_Mutation_p.D177Y|MS4A14_uc001npk.2_Missense_Mutation_p.D422Y|MS4A14_uc001npl.2_Missense_Mutation_p.D177Y|MS4A14_uc001npm.2_Missense_Mutation_p.D177Y	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	439	Gln-rich.					integral to membrane	receptor activity			breast(1)	1						GCAGCCCCCAGATCTTCAACC	0.333													12	82	---	---	---	---	PASS
MARK2	2011	broad.mit.edu	37	11	63671484	63671484	+	Missense_Mutation	SNP	C	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63671484C>A	uc001nxw.2	+	15	2120	c.1541C>A	c.(1540-1542)TCC>TAC	p.S514Y	MARK2_uc001nxx.2_Intron|MARK2_uc001nxy.2_Intron|MARK2_uc001nxv.3_Intron|MARK2_uc001nxz.3_Missense_Mutation_p.S480Y|MARK2_uc009yoy.2_Intron	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN	MAP/microtubule affinity-regulating kinase 2	514					cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						TCCCGGGCCTCCACGGCTTCT	0.657													8	42	---	---	---	---	PASS
ACTN3	89	broad.mit.edu	37	11	66330623	66330623	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66330623G>A	uc001oio.1	+	22	2683	c.2665G>A	c.(2665-2667)GTG>ATG	p.V889M	ACTN3_uc010rpi.1_RNA	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3	889					focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0						CCTGGACTACGTGGCCTTCTC	0.637													15	67	---	---	---	---	PASS
UVRAG	7405	broad.mit.edu	37	11	75727987	75727987	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75727987G>C	uc001oxc.2	+	12	1430	c.1189G>C	c.(1189-1191)GAC>CAC	p.D397H	UVRAG_uc010rrw.1_Missense_Mutation_p.D296H|UVRAG_uc001oxd.2_Missense_Mutation_p.D25H|UVRAG_uc010rrx.1_Missense_Mutation_p.D25H|UVRAG_uc009yuh.1_RNA	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	397					DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						AACAATCAAAGACAATATCAA	0.353													13	96	---	---	---	---	PASS
CASP5	838	broad.mit.edu	37	11	104866483	104866483	+	Silent	SNP	A	G	G	rs146387103		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104866483A>G	uc010rva.1	-	9	1325	c.1293T>C	c.(1291-1293)TTT>TTC	p.F431F	CASP5_uc010ruz.1_Silent_p.F444F|CASP5_uc010rvb.1_Silent_p.F373F|CASP5_uc010rvc.1_Silent_p.F289F|CASP5_uc009yxh.2_Silent_p.F213F|CASP5_uc010rvd.1_Silent_p.F213F	NM_004347	NP_004338	P51878	CASP5_HUMAN	caspase 5 isoform a precursor	431					apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		AATTGCCAGGAAAGAGGTAGA	0.403													11	57	---	---	---	---	PASS
RNF214	257160	broad.mit.edu	37	11	117109497	117109497	+	Silent	SNP	A	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117109497A>C	uc001pqt.2	+	3	333	c.288A>C	c.(286-288)ACA>ACC	p.T96T	RNF214_uc001pqu.2_Silent_p.T96T|RNF214_uc010rxf.1_Intron	NM_207343	NP_997226	Q8ND24	RN214_HUMAN	ring finger protein 214	96							zinc ion binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		TGATAGCCACAGCCCTTTGTC	0.537													19	130	---	---	---	---	PASS
B3GAT1	27087	broad.mit.edu	37	11	134253724	134253724	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134253724G>A	uc001qhq.2	-	4	732	c.471C>T	c.(469-471)GAC>GAT	p.D157D	B3GAT1_uc001qhr.2_Silent_p.D157D|B3GAT1_uc010scv.1_Silent_p.D170D	NM_018644	NP_061114	Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	157	Lumenal (Potential).				carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		GGTCGCGGGCGTCTCCGCGCA	0.736													3	9	---	---	---	---	PASS
AKAP3	10566	broad.mit.edu	37	12	4735979	4735979	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4735979C>G	uc001qnb.3	-	4	2318	c.2089G>C	c.(2089-2091)GAT>CAT	p.D697H		NM_006422	NP_006413	O75969	AKAP3_HUMAN	A-kinase anchor protein 3	697					acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding			skin(3)|large_intestine(1)|ovary(1)|kidney(1)	6						GACTTGTCATCTCCCAGCTCT	0.502													6	57	---	---	---	---	PASS
OR6C70	390327	broad.mit.edu	37	12	55863491	55863491	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55863491G>A	uc010spn.1	-	1	432	c.432C>T	c.(430-432)TTC>TTT	p.F144F		NM_001005499	NP_001005499	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C,	144	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CCCAAGAACTGAATACAAGCT	0.388													21	54	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57550035	57550035	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57550035C>T	uc001snd.2	+	9	1852	c.1386C>T	c.(1384-1386)CTC>CTT	p.L462L		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	462	Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GTGGTGCCCTCCACATCTACC	0.597													7	74	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64824015	64824015	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64824015G>A	uc001ssb.2	+	17	2350	c.1924G>A	c.(1924-1926)GAA>AAA	p.E642K		NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	642	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		ACAAGATGAAGAAAGGCAAGC	0.393													12	39	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101748657	101748657	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101748657G>A	uc001tia.1	+	41	5311	c.5155G>A	c.(5155-5157)GAG>AAG	p.E1719K		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	1719					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						CATGGAATTAGAGCGTGTGGA	0.438													9	67	---	---	---	---	PASS
RPH3A	22895	broad.mit.edu	37	12	113266130	113266130	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113266130G>C	uc010syl.1	+	3	369	c.7G>C	c.(7-9)GAC>CAC	p.D3H	RPH3A_uc001ttz.2_Missense_Mutation_p.D3H|RPH3A_uc001tty.2_Missense_Mutation_p.D3H|RPH3A_uc009zwe.1_Missense_Mutation_p.D3H|RPH3A_uc010sym.1_Missense_Mutation_p.D3H	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	3					intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		TACTATGACTGACACCGTGTT	0.483													11	66	---	---	---	---	PASS
OAS1	4938	broad.mit.edu	37	12	113354509	113354509	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113354509G>A	uc001tud.2	+	4	956	c.850G>A	c.(850-852)GAA>AAA	p.E284K	OAS1_uc010syn.1_Missense_Mutation_p.E283K|OAS1_uc010syo.1_3'UTR|OAS1_uc001tub.2_Missense_Mutation_p.E284K|OAS1_uc001tuc.2_Missense_Mutation_p.E284K|OAS1_uc009zwf.2_Missense_Mutation_p.E283K	NM_016816	NP_058132	P00973	OAS1_HUMAN	2',5'-oligoadenylate synthetase 1 isoform 1	284					interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(2)	2						CCCCATTATTGAAAAGTACCT	0.453													26	78	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	130185253	130185253	+	Intron	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130185253G>A	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		ACTGTGGGGAGGGAATCGCAG	0.388													8	53	---	---	---	---	PASS
NUPL1	9818	broad.mit.edu	37	13	25894700	25894700	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25894700C>G	uc001uqi.2	+	8	989	c.743C>G	c.(742-744)CCT>CGT	p.P248R	NUPL1_uc001uqg.1_Missense_Mutation_p.P248R|NUPL1_uc001uqj.2_Missense_Mutation_p.P236R	NM_014089	NP_054808	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1 isoform a	248	14 X 2 AA repeats of F-G.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		GAAAATCTACCTCCTGTCATC	0.323													7	50	---	---	---	---	PASS
HSPH1	10808	broad.mit.edu	37	13	31724198	31724198	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31724198C>T	uc001utj.2	-	8	1428	c.1030G>A	c.(1030-1032)GCT>ACT	p.A344T	HSPH1_uc001utk.2_Missense_Mutation_p.A344T|HSPH1_uc010aaw.2_Missense_Mutation_p.A303T|HSPH1_uc001utl.2_Missense_Mutation_p.A346T|HSPH1_uc010tds.1_Missense_Mutation_p.A268T|HSPH1_uc010tdt.1_RNA	NM_006644	NP_006635	Q92598	HS105_HUMAN	heat shock 105kD	344					positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding				0		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		ATTCGTGTAGCGCCTCCAACA	0.418													43	95	---	---	---	---	PASS
CSNK1A1L	122011	broad.mit.edu	37	13	37679276	37679276	+	Missense_Mutation	SNP	C	T	T	rs112114979		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37679276C>T	uc001uwm.1	-	1	526	c.118G>A	c.(118-120)GGC>AGC	p.G40S		NM_145203	NP_660204	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	40	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)	1		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		ACGTCCTCGCCGTTGGTGGTG	0.532													8	118	---	---	---	---	PASS
THSD1	55901	broad.mit.edu	37	13	52972113	52972113	+	Missense_Mutation	SNP	T	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52972113T>C	uc001vgo.2	-	3	820	c.275A>G	c.(274-276)TAT>TGT	p.Y92C	THSD1_uc001vgp.2_Missense_Mutation_p.Y92C|THSD1_uc010tgz.1_Intron|THSD1_uc010aea.2_Intron	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1	92	Extracellular (Potential).					extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CTCCTTGAAATAGAAGCACTC	0.493													14	98	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78176203	78176203	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78176203C>T	uc001vki.2	+	16	1091	c.921C>T	c.(919-921)ATC>ATT	p.I307I	SCEL_uc001vkj.2_Silent_p.I287I|SCEL_uc010thx.1_Silent_p.I285I	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1	307	16 X approximate tandem repeats.|4.				embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TGTAAAGAATCCAAAGCCTTG	0.393													6	63	---	---	---	---	PASS
TSSK4	283629	broad.mit.edu	37	14	24675937	24675937	+	Intron	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24675937C>T	uc001wng.2	+						TM9SF1_uc010tob.1_Intron|TSSK4_uc001wne.2_Intron|TSSK4_uc001wnf.2_5'UTR|TSSK4_uc001wnh.2_Intron	NM_174944	NP_777604	Q6SA08	TSSK4_HUMAN	testis-specific serine kinase 4						cell differentiation|multicellular organismal development|positive regulation of CREB transcription factor activity|spermatogenesis		ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity				0				GBM - Glioblastoma multiforme(265;0.018)		CCGGTGAGGGCGCTGCCACCC	0.577													11	49	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58817911	58817911	+	Missense_Mutation	SNP	A	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58817911A>G	uc001xdp.2	+	16	1779	c.1525A>G	c.(1525-1527)ACT>GCT	p.T509A	ARID4A_uc001xdo.2_Missense_Mutation_p.T509A|ARID4A_uc001xdq.2_Missense_Mutation_p.T509A|ARID4A_uc010apg.1_Missense_Mutation_p.T187A	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	509					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						TGACTATGAAACTGCAGAGAA	0.299													32	78	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64599109	64599109	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64599109G>C	uc001xgm.2	+	77	14697	c.14467G>C	c.(14467-14469)GAA>CAA	p.E4823Q	SYNE2_uc001xgl.2_Missense_Mutation_p.E4823Q|SYNE2_uc010apy.2_Missense_Mutation_p.E1208Q|SYNE2_uc010apz.1_Missense_Mutation_p.E715Q	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4823	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAAAATACTAGAAGAAAAGTC	0.383													6	106	---	---	---	---	PASS
ALDH6A1	4329	broad.mit.edu	37	14	74534264	74534264	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74534264C>T	uc001xpo.2	-	8	960	c.861G>A	c.(859-861)AAG>AAA	p.K287K	C14orf45_uc001xpm.1_Intron|ALDH6A1_uc010asa.2_Silent_p.K132K|ALDH6A1_uc010tuq.1_Silent_p.K274K	NM_005589	NP_005580	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6A1 precursor	287						mitochondrial matrix|nucleus	fatty-acyl-CoA binding|malonate-semialdehyde dehydrogenase (acetylating) activity|methylmalonate-semialdehyde dehydrogenase (acylating) activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00354)	NADH(DB00157)	CCCCATGGTTCTTGGCTCCCT	0.418													11	81	---	---	---	---	PASS
AK7	122481	broad.mit.edu	37	14	96858567	96858567	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96858567G>T	uc001yfn.2	+	1	120	c.76G>T	c.(76-78)GAT>TAT	p.D26Y	AK7_uc001yfm.1_Missense_Mutation_p.D26Y	NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	26					cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		AAACCTGTTGGATTCCTACAG	0.617													6	24	---	---	---	---	PASS
ADSSL1	122622	broad.mit.edu	37	14	105196350	105196350	+	Intron	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105196350C>T	uc001ypd.2	+						INF2_uc010tyi.1_Intron|ADSSL1_uc001ype.2_Missense_Mutation_p.P41S|ADSSL1_uc001ypf.2_RNA	NM_152328	NP_689541	Q8N142	PURA1_HUMAN	adenylosuccinate synthase like 1 isoform 2						AMP biosynthetic process|immune system process|purine base metabolic process	cytosol	adenylosuccinate synthase activity|GTP binding|magnesium ion binding|phosphate binding			ovary(1)|central_nervous_system(1)	2		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)	L-Aspartic Acid(DB00128)	CTGGCTGCCTCCAAGGAGTCT	0.577													5	7	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41820228	41820228	+	Intron	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41820228G>A	uc001zod.2	-							NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1							nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GCCTGGGCCTGAGGGCAGGAG	0.517													8	54	---	---	---	---	PASS
TUBGCP4	27229	broad.mit.edu	37	15	43663591	43663591	+	Silent	SNP	T	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43663591T>C	uc001zro.2	+	1	279	c.39T>C	c.(37-39)CCT>CCC	p.P13P	ZSCAN29_uc001zrj.1_5'Flank|ZSCAN29_uc001zrk.1_5'Flank|ZSCAN29_uc010bdf.1_5'Flank|ZSCAN29_uc001zrl.1_5'Flank|ZSCAN29_uc010bdg.1_5'Flank|ZSCAN29_uc001zrm.2_5'Flank|TUBGCP4_uc001zrn.2_Silent_p.P13P	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	13					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		GCGGGTACCCTGGGTCCATTT	0.657											OREG0023087	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	56	---	---	---	---	PASS
PLEKHO2	80301	broad.mit.edu	37	15	65140786	65140786	+	Intron	SNP	T	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65140786T>C	uc002anv.2	+						PLEKHO2_uc010bgz.2_Intron|PLEKHO2_uc002anw.2_Intron	NM_025201	NP_079477	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O											ovary(1)|lung(1)	2						TGGTGCTGTGTTACAGGGTGT	0.552													21	116	---	---	---	---	PASS
TSC2	7249	broad.mit.edu	37	16	2106737	2106737	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2106737C>T	uc002con.2	+	8	847	c.741C>T	c.(739-741)ATC>ATT	p.I247I	TSC2_uc010bsd.2_Silent_p.I247I|TSC2_uc002coo.2_Silent_p.I247I|TSC2_uc010uvv.1_Silent_p.I210I|TSC2_uc010uvw.1_Silent_p.I198I|TSC2_uc002cop.2_Silent_p.I47I	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	247	Required for interaction with TSC1.				cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				GTCGCACCATCAACGTCAAGG	0.597			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				21	195	---	---	---	---	PASS
PARN	5073	broad.mit.edu	37	16	14540804	14540804	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14540804G>A	uc010uzd.1	-	23	1947	c.1805C>T	c.(1804-1806)TCA>TTA	p.S602L	PARN_uc010uzc.1_Missense_Mutation_p.S541L|PARN_uc010uze.1_Missense_Mutation_p.S556L|PARN_uc010uzf.1_Missense_Mutation_p.S427L	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation	602					female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						CCTTCCCTCTGAGAGGGGCTC	0.512													16	97	---	---	---	---	PASS
XYLT1	64131	broad.mit.edu	37	16	17232374	17232374	+	Silent	SNP	C	T	T	rs138560456	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17232374C>T	uc002dfa.2	-	8	1687	c.1602G>A	c.(1600-1602)ACG>ACA	p.T534T		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	534	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						TCTCCAGGACCGTATGGAAGA	0.502													13	65	---	---	---	---	PASS
GNAO1	2775	broad.mit.edu	37	16	56374903	56374903	+	Intron	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56374903G>C	uc002eit.3	+						GNAO1_uc002eiu.3_Intron	NM_138736	NP_620073	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha						dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)				TATACAGGTAGAGACCCCTCC	0.552													15	293	---	---	---	---	PASS
CMTM4	146223	broad.mit.edu	37	16	66670350	66670350	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66670350G>A	uc002epz.2	-	2	503	c.321C>T	c.(319-321)CTC>CTT	p.L107L	CMTM4_uc002eqa.2_Silent_p.L107L	NM_178818	NP_848933	Q8IZR5	CKLF4_HUMAN	chemokine-like factor superfamily 4 isoform 1	107	MARVEL.				chemotaxis	extracellular space|integral to membrane	cytokine activity			pancreas(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)		TGTGCAGGTTGAGACTGAACA	0.522													10	54	---	---	---	---	PASS
CHTF8	54921	broad.mit.edu	37	16	69154319	69154319	+	3'UTR	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69154319G>A	uc002ewn.1	-	4					CHTF8_uc002ewm.1_Missense_Mutation_p.R5W|CHTF8_uc002ewo.1_3'UTR|CHTF8_uc002ewp.1_3'UTR	NM_001040146	NP_001035236	P0CG13	CTF8_HUMAN	chromosome transmission fidelity factor 8						cell cycle|DNA replication	nucleus	DNA binding				0						GGGAAAATCCGAGGTTCTTTC	0.572													21	48	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76528870	76528870	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76528870C>G	uc002feu.1	+	16	2529	c.2144C>G	c.(2143-2145)TCT>TGT	p.S715C	CNTNAP4_uc002fev.1_Missense_Mutation_p.S579C|CNTNAP4_uc010chb.1_Missense_Mutation_p.S642C|CNTNAP4_uc002fex.1_Missense_Mutation_p.S718C|CNTNAP4_uc002few.2_Missense_Mutation_p.S690C	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	715	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TGGGGAGGTTCTTCGCCTGAT	0.413													14	142	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76528926	76528926	+	Missense_Mutation	SNP	C	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76528926C>A	uc002feu.1	+	16	2585	c.2200C>A	c.(2200-2202)CAG>AAG	p.Q734K	CNTNAP4_uc002fev.1_Missense_Mutation_p.Q598K|CNTNAP4_uc010chb.1_Missense_Mutation_p.Q661K|CNTNAP4_uc002fex.1_Missense_Mutation_p.Q737K|CNTNAP4_uc002few.2_Missense_Mutation_p.Q709K	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	734	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						CATTGATTCTCAGTATTACTG	0.373													23	142	---	---	---	---	PASS
SCARF1	8578	broad.mit.edu	37	17	1548203	1548203	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1548203G>C	uc002fsz.1	-	3	240	c.190C>G	c.(190-192)CAG>GAG	p.Q64E	SCARF1_uc002fsy.1_Missense_Mutation_p.Q64E|SCARF1_uc002fta.1_RNA|SCARF1_uc010cjv.1_Missense_Mutation_p.Q64E	NM_003693	NP_003684	Q14162	SREC_HUMAN	scavenger receptor class F, member 1 isoform 1	64	EGF-like 1.|Extracellular (Potential).				cell adhesion|neuron remodeling|positive regulation of axon regeneration|receptor-mediated endocytosis	integral to membrane	low-density lipoprotein particle binding|scavenger receptor activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TCGTCTTTCTGGCAGGCGTCC	0.622													5	24	---	---	---	---	PASS
WDR81	124997	broad.mit.edu	37	17	1631494	1631494	+	Intron	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1631494G>A	uc002fti.2	+						WDR81_uc002fth.2_Missense_Mutation_p.E30K|WDR81_uc010vqp.1_Intron|WDR81_uc002ftj.2_Missense_Mutation_p.E1081K|WDR81_uc010vqq.1_5'Flank	NM_001163811	NP_001157283	Q562E7	WDR81_HUMAN	WD repeat domain 81 isoform 4											skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TGACCTCCCTGAGACAGAGGA	0.647													6	73	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3917760	3917760	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3917760G>A	uc002fxe.2	-	50	8259	c.8195C>T	c.(8194-8196)TCT>TTT	p.S2732F	ZZEF1_uc002fxg.1_Missense_Mutation_p.S53F	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2732							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GTTGCACTGAGAGTCGAATTT	0.493													11	135	---	---	---	---	PASS
DHX33	56919	broad.mit.edu	37	17	5359354	5359354	+	Missense_Mutation	SNP	T	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5359354T>C	uc002gca.2	-	5	1000	c.998A>G	c.(997-999)TAT>TGT	p.Y333C	DHX33_uc002gbz.2_Missense_Mutation_p.Y104C|DHX33_uc002gcb.2_Missense_Mutation_p.Y160C|DHX33_uc010clf.2_Silent_p.L146L	NM_020162	NP_064547	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	333	Helicase C-terminal.					nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|pancreas(1)	2						CTGCTGTGCATAGGGCAGGGA	0.612													24	53	---	---	---	---	PASS
MED31	51003	broad.mit.edu	37	17	6553727	6553727	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6553727G>A	uc002gdg.3	-	2	161	c.55C>T	c.(55-57)CAG>TAG	p.Q19*	MED31_uc002gdh.3_RNA|C17orf100_uc010clp.1_5'Flank	NM_016060	NP_057144	Q9Y3C7	MED31_HUMAN	mediator of RNA polymerase II transcription,	19					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	protein binding				0						AACTCCAACTGAAACCGAAGT	0.348													35	107	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7752018	7752018	+	Silent	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7752018C>G	uc002giw.1	+	11	2788	c.2412C>G	c.(2410-2412)CTC>CTG	p.L804L	KDM6B_uc002gix.2_Silent_p.L106L	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	804	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						CCAGCCTGCTCAAATCCTTGG	0.363													13	76	---	---	---	---	PASS
SHMT1	6470	broad.mit.edu	37	17	18251844	18251844	+	Intron	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18251844G>A	uc002gta.2	-						SHMT1_uc002gtb.2_Intron|SHMT1_uc010cqb.2_Intron|SHMT1_uc010vxt.1_Intron|SHMT1_uc002gtd.1_Intron|SHMT1_uc010vxu.1_Intron	NM_004169	NP_004160	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)						carnitine biosynthetic process|folic acid metabolic process|L-serine catabolic process|one-carbon metabolic process|purine base biosynthetic process	cytosol|nucleus	glycine hydroxymethyltransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					Glycine(DB00145)|Mimosine(DB01055)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	GTGGGACAGTGAAACTAAAGT	0.478													15	101	---	---	---	---	PASS
CDK5R1	8851	broad.mit.edu	37	17	30815055	30815055	+	Silent	SNP	C	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30815055C>A	uc002hhn.2	+	2	638	c.417C>A	c.(415-417)CCC>CCA	p.P139P	CDK5R1_uc010wca.1_Silent_p.P139P|CDK5R1_uc010ctc.2_5'UTR	NM_003885	NP_003876	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1	139					axon guidance|axonal fasciculation|brain development|cell proliferation|embryo development|ionotropic glutamate receptor signaling pathway|muscarinic acetylcholine receptor signaling pathway|negative regulation of transcription, DNA-dependent|neuron cell-cell adhesion|neuron migration|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of neuron apoptosis|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation	axon|contractile fiber|cyclin-dependent protein kinase 5 holoenzyme complex|cytosol|dendritic spine|growth cone|neuromuscular junction|neuronal cell body|perinuclear region of cytoplasm|plasma membrane	cadherin binding|calcium ion binding|protein kinase binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)			CAGGGACGCCCAAACGGGTCA	0.687													25	93	---	---	---	---	PASS
TOP2A	7153	broad.mit.edu	37	17	38556817	38556817	+	Silent	SNP	A	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38556817A>G	uc002huq.2	-	22	2889	c.2763T>C	c.(2761-2763)ATT>ATC	p.I921I		NM_001067	NP_001058	P11388	TOP2A_HUMAN	DNA topoisomerase II, alpha isozyme	921					apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	CTGAGATTTCAATGGTTGTAG	0.353													4	23	---	---	---	---	PASS
CNTNAP1	8506	broad.mit.edu	37	17	40837369	40837369	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40837369G>A	uc002iay.2	+	5	862	c.646G>A	c.(646-648)GAG>AAG	p.E216K	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	216	Laminin G-like 1.|Extracellular (Potential).				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GCTGCACGCCGAGGGCGCCCA	0.662													25	56	---	---	---	---	PASS
MPP2	4355	broad.mit.edu	37	17	41956724	41956724	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41956724G>A	uc010wip.1	-	12	1593	c.1536C>T	c.(1534-1536)TTC>TTT	p.F512F	MPP2_uc002ien.1_Silent_p.F484F|MPP2_uc010wim.1_Silent_p.F456F|MPP2_uc002ieo.1_Silent_p.F467F|MPP2_uc010win.1_Silent_p.F328F|MPP2_uc010wio.1_Silent_p.F456F	NM_005374	NP_005365	Q14168	MPP2_HUMAN	palmitoylated membrane protein 2	491	Guanylate kinase-like.				signal transduction	cell surface|integral to plasma membrane|membrane fraction	guanylate kinase activity				0		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		GGGCCTCGATGAACACCACGT	0.582													27	126	---	---	---	---	PASS
MAP3K14	9020	broad.mit.edu	37	17	43364517	43364517	+	Intron	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43364517C>T	uc002iiw.1	-						MAP3K14_uc010daj.1_5'Flank|MAP3K14_uc002iiv.1_Intron	NM_003954	NP_003945	Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase						cellular response to mechanical stimulus|I-kappaB kinase/NF-kappaB cascade|immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade|T cell costimulation	cytosol	ATP binding|MAP kinase kinase kinase activity|NF-kappaB-inducing kinase activity|protein binding			central_nervous_system(3)|breast(2)|lung(1)|ovary(1)|stomach(1)	8						TGGAGGGTCTCACCTGCACTG	0.622													6	30	---	---	---	---	PASS
PRR15L	79170	broad.mit.edu	37	17	46030367	46030367	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46030367C>T	uc002imp.2	-	2	351	c.234G>A	c.(232-234)GAG>GAA	p.E78E		NM_024320	NP_077296	Q9BU68	PR15L_HUMAN	ATPase family, AAA domain containing 4	78										ovary(1)	1						CTTTCTTCTTCTCCTTGAAGC	0.537													6	180	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67171601	67171601	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67171601C>G	uc010dfa.1	-	24	3702	c.2823G>C	c.(2821-2823)TTG>TTC	p.L941F	ABCA10_uc010wqs.1_5'UTR|ABCA10_uc010wqt.1_RNA	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	941	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					AGTTTGTGATCAACAACAAAA	0.358													15	67	---	---	---	---	PASS
CETN1	1068	broad.mit.edu	37	18	580567	580567	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:580567G>A	uc002kko.1	+	1	201	c.159G>A	c.(157-159)CTG>CTA	p.L53L		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	53	EF-hand 1.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2						CGAAGGAGCTGAAGGTGGCCA	0.557													10	62	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18571139	18571139	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18571139C>G	uc002kte.2	-	18	3082	c.2141G>C	c.(2140-2142)TGT>TCT	p.C714S		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	714	Glu-rich.|Interaction with FHOD1.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					ACACTTACCACACATTGCCAC	0.318													4	112	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21529761	21529761	+	Silent	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21529761G>C	uc002kuq.2	+	71	9470	c.9384G>C	c.(9382-9384)CTG>CTC	p.L3128L	LAMA3_uc002kur.2_Silent_p.L3072L|LAMA3_uc002kus.3_Silent_p.L1519L|LAMA3_uc002kut.3_Silent_p.L1463L	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	3128	Laminin G-like 4.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGGATGCCTGAAGAACTTTC	0.483													4	104	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44561319	44561319	+	Missense_Mutation	SNP	T	C	C	rs146911955	byFrequency	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44561319T>C	uc002lcr.1	-	1	670	c.317A>G	c.(316-318)CAG>CGG	p.Q106R	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	106					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GGCCTTTTCCTGGTCCTGAAG	0.652													6	139	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44561321	44561321	+	Missense_Mutation	SNP	G	C	C	rs138936821	byFrequency	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44561321G>C	uc002lcr.1	-	1	668	c.315C>G	c.(313-315)GAC>GAG	p.D105E	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	105					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						CCTTTTCCTGGTCCTGAAGAG	0.662													6	142	---	---	---	---	PASS
DYM	54808	broad.mit.edu	37	18	46860222	46860222	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46860222C>G	uc002ldi.1	-	7	861	c.496G>C	c.(496-498)GAT>CAT	p.D166H	DYM_uc010xdf.1_Intron|DYM_uc002ldj.3_5'UTR	NM_017653	NP_060123	Q7RTS9	DYM_HUMAN	dymeclin	166						Golgi apparatus					0						TATGTAATATCTCTAAAATGG	0.313													5	74	---	---	---	---	PASS
CPLX4	339302	broad.mit.edu	37	18	56964111	56964111	+	Missense_Mutation	SNP	T	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56964111T>G	uc002lhy.2	-	3	489	c.302A>C	c.(301-303)GAT>GCT	p.D101A		NM_181654	NP_857637	Q7Z7G2	CPLX4_HUMAN	complexin 4 precursor	101					exocytosis|neurotransmitter transport	cell junction|synapse	syntaxin binding			ovary(1)	1		Colorectal(73;0.175)				TTCAGGTAAATCCACATCATC	0.358													8	76	---	---	---	---	PASS
TNFRSF11A	8792	broad.mit.edu	37	18	60017106	60017106	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60017106G>A	uc002lin.2	+	3	257	c.219G>A	c.(217-219)CCG>CCA	p.P73P	TNFRSF11A_uc010dpv.2_Silent_p.P73P	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,	73	TNFR-Cys 2.|Extracellular (Potential).				adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity			breast(2)|lung(1)	3		Colorectal(73;0.188)				CCTGTGGCCCGGATGAATACT	0.418									Paget_Disease_of_Bone				30	166	---	---	---	---	PASS
PCSK4	54760	broad.mit.edu	37	19	1487169	1487169	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1487169G>A	uc002ltb.1	-	7	888	c.826C>T	c.(826-828)CGC>TGC	p.R276C	PCSK4_uc002lta.2_Missense_Mutation_p.R88C	NM_017573	NP_060043	Q6UW60	PCSK4_HUMAN	proprotein convertase subtilisin/kexin type 4	276	Catalytic (By similarity).				proteolysis	integral to membrane	serine-type endopeptidase activity				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCCTCGCGGGTGAGGATG	0.721													10	30	---	---	---	---	PASS
FBXW9	84261	broad.mit.edu	37	19	12800192	12800192	+	Silent	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12800192G>C	uc010dyx.2	-	9	1356	c.1356C>G	c.(1354-1356)CTC>CTG	p.L452L	FBXW9_uc010xmp.1_RNA|uc002mul.1_3'UTR|FBXW9_uc002mum.1_Silent_p.L432L|FBXW9_uc002mun.1_Silent_p.L269L	NM_032301	NP_115677	Q5XUX1	FBXW9_HUMAN	F-box and WD-40 domain protein 9	462	WD 7.						protein binding			ovary(1)	1						TTACCCTATTGAGCCCATTGT	0.622													15	41	---	---	---	---	PASS
F2RL3	9002	broad.mit.edu	37	19	17001392	17001392	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17001392G>A	uc002nfa.2	+	2	1293	c.1118G>A	c.(1117-1119)GGC>GAC	p.G373D		NM_003950	NP_003941	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	373	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation|positive regulation of release of sequestered calcium ion into cytosol	extracellular region|integral to plasma membrane	thrombin receptor activity				0						GCGGAAGGGGGCAGCCGGGGC	0.527													3	18	---	---	---	---	PASS
NFKBID	84807	broad.mit.edu	37	19	36381329	36381329	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36381329G>A	uc002oci.1	-	10	1244	c.670C>T	c.(670-672)CAG>TAG	p.Q224*	NFKBID_uc002och.1_Nonsense_Mutation_p.Q61*|NFKBID_uc002ocj.1_Nonsense_Mutation_p.Q239*	NM_139239	NP_640332	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene	224	ANK 5.				inflammatory response	nucleus					0						AGCAGCAGCTGAACCAGAGTG	0.612													48	110	---	---	---	---	PASS
SUPT5H	6829	broad.mit.edu	37	19	39965349	39965349	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39965349C>T	uc002olo.3	+	28	3194	c.3015C>T	c.(3013-3015)CGC>CGT	p.R1005R	SUPT5H_uc002olp.3_Silent_p.R1005R|SUPT5H_uc002olq.3_Silent_p.R1001R|SUPT5H_uc002oln.3_Silent_p.R1005R|SUPT5H_uc002olr.3_Silent_p.R1005R|SUPT5H_uc002ols.1_Silent_p.R628R	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a	1005					cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GTGTCATCCGCAGTGTCACGG	0.498													6	34	---	---	---	---	PASS
B3GNT8	374907	broad.mit.edu	37	19	41932155	41932155	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41932155C>G	uc002oqs.2	-	3	983	c.529G>C	c.(529-531)GGG>CGG	p.G177R	CYP2F1_uc010xvw.1_Intron|B3GNT8_uc002oqt.1_Intron	NM_198540	NP_940942	Q7Z7M8	B3GN8_HUMAN	UDP-GlcNAc:betaGal	177	Lumenal (Potential).				poly-N-acetyllactosamine biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity|protein N-acetylglucosaminyltransferase activity				0						AGCCGGATCCCTGGAGCTGGA	0.622													10	124	---	---	---	---	PASS
PNMAL1	55228	broad.mit.edu	37	19	46974130	46974130	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46974130C>T	uc002peq.3	-	2	469	c.163G>A	c.(163-165)GTG>ATG	p.V55M	PNMAL1_uc002per.3_Missense_Mutation_p.V55M	NM_018215	NP_060685	Q86V59	PNML1_HUMAN	PNMA-like 1 isoform a	55											0		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		ttgttgagcacgcggtacggg	0.000													7	98	---	---	---	---	PASS
ALDH16A1	126133	broad.mit.edu	37	19	49963108	49963108	+	Intron	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49963108G>A	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		GCCCATGGGTGAGACCCTGGA	0.522													11	55	---	---	---	---	PASS
KIR2DL3	3804	broad.mit.edu	37	19	55263156	55263156	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55263156C>T	uc002qgv.2	+	6	789	c.771C>T	c.(769-771)TTC>TTT	p.F257F	KIR2DL3_uc002qgx.2_Silent_p.F257F|KIR2DL3_uc002qgy.2_Silent_p.F159F|KIR2DL3_uc010erw.1_Silent_p.F257F|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two	257	Helical; (Potential).				immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		tcatcctcttcatcctcctcc	0.408													20	116	---	---	---	---	PASS
ZNF776	284309	broad.mit.edu	37	19	58265724	58265724	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58265724G>A	uc002qpx.2	+	3	1449	c.1226G>A	c.(1225-1227)TGT>TAT	p.C409Y	ZNF587_uc002qqb.2_Intron|ZNF776_uc002qqa.2_Missense_Mutation_p.C409Y	NM_173632	NP_775903	Q68DI1	ZN776_HUMAN	zinc finger protein 776	409	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		TGTAAAGAATGTAGGAAATCA	0.428													9	103	---	---	---	---	PASS
SPEF1	25876	broad.mit.edu	37	20	3758860	3758860	+	Nonstop_Mutation	SNP	C	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3758860C>A	uc002wjj.2	-	7	878	c.710G>T	c.(709-711)TGA>TTA	p.*237L		NM_015417	NP_056232	Q9Y4P9	SPEF1_HUMAN	calponin-homology and microtubule-associated	237						cilium axoneme|cytoplasm|cytoskeleton					0						ggccgccgcTCACCGCTGCTT	0.557													3	9	---	---	---	---	PASS
KIF3B	9371	broad.mit.edu	37	20	30898226	30898226	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30898226C>G	uc002wxq.2	+	2	813	c.646C>G	c.(646-648)CAT>GAT	p.H216D	KIF3B_uc010ztv.1_Missense_Mutation_p.H216D|KIF3B_uc010ztw.1_Missense_Mutation_p.H216D	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	216	Kinesin-motor.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTCGCGTTCTCATGCAATTTT	0.488													10	106	---	---	---	---	PASS
KIF3B	9371	broad.mit.edu	37	20	30898491	30898491	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30898491C>G	uc002wxq.2	+	2	1078	c.911C>G	c.(910-912)TCC>TGC	p.S304C	KIF3B_uc010ztv.1_Missense_Mutation_p.S304C|KIF3B_uc010ztw.1_Missense_Mutation_p.S304C	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	304	Kinesin-motor.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTCCAAGATTCCCTTGGTGGC	0.532													4	100	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33364338	33364338	+	Intron	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33364338G>C	uc002xav.2	-						NCOA6_uc002xaw.2_Intron|NCOA6_uc010gew.1_Intron	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6						brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						AAGAGCAAAAGAATAAGGTGG	0.194													7	22	---	---	---	---	PASS
CEP250	11190	broad.mit.edu	37	20	34059961	34059961	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34059961C>G	uc002xcm.2	+	12	1706	c.1035C>G	c.(1033-1035)ATC>ATG	p.I345M	CEP250_uc010zve.1_Translation_Start_Site|CEP250_uc010zvd.1_RNA	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	345	Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AGCAGGTGATCAAGGATATAA	0.463													8	191	---	---	---	---	PASS
CDH4	1002	broad.mit.edu	37	20	60511902	60511902	+	Silent	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60511902C>T	uc002ybn.1	+	16	2666	c.2652C>T	c.(2650-2652)AAC>AAT	p.N884N	CDH4_uc002ybp.1_Silent_p.N810N|uc002ybr.1_5'Flank	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	884	Ser-rich.|Cytoplasmic (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GCTCCCTGAACTCATCCAGTT	0.607													12	47	---	---	---	---	PASS
KRTAP19-1	337882	broad.mit.edu	37	21	31852582	31852582	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31852582C>G	uc011acx.1	-	1	55	c.55G>C	c.(55-57)GGT>CGT	p.G19R		NM_181607	NP_853638	Q8IUB9	KR191_HUMAN	keratin associated protein 19-1	19	26 X 2 AA repeats of G-[YCGS].					intermediate filament					0						CCCAGGCCACCGAAGCCTCCA	0.572													6	101	---	---	---	---	PASS
IFNAR1	3454	broad.mit.edu	37	21	34721581	34721581	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34721581G>C	uc002yrn.2	+	7	1120	c.973G>C	c.(973-975)GAT>CAT	p.D325H	IFNAR1_uc011adv.1_Missense_Mutation_p.D256H	NM_000629	NP_000620	P17181	INAR1_HUMAN	interferon-alpha receptor 1 precursor	325	Fibronectin type-III 2.|Extracellular (Potential).				JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	integral to plasma membrane	type I interferon receptor activity			central_nervous_system(1)|skin(1)	2					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	GATAAAGTTTGATACTGAAAT	0.323													10	86	---	---	---	---	PASS
ARVCF	421	broad.mit.edu	37	22	19965082	19965082	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19965082G>A	uc002zqz.2	-	9	1997	c.1726C>T	c.(1726-1728)CGG>TGG	p.R576W	ARVCF_uc002zqy.2_Missense_Mutation_p.R98W	NM_001670	NP_001661	O00192	ARVC_HUMAN	armadillo repeat protein	576	ARM 6.				cell adhesion|multicellular organismal development		protein binding			liver(1)	1	Colorectal(54;0.0993)					GACAGGTTCCGCATGATGCAC	0.682													19	130	---	---	---	---	PASS
TBC1D10A	83874	broad.mit.edu	37	22	30688746	30688746	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30688746C>T	uc011akt.1	-	11	1169	c.1145G>A	c.(1144-1146)CGC>CAC	p.R382H	GATSL3_uc003ahf.2_Intron|GATSL3_uc003ahg.2_Intron|GATSL3_uc003ahh.2_Intron|GATSL3_uc010gvq.2_Intron|GATSL3_uc003ahi.2_Intron|TBC1D10A_uc003ahj.3_Missense_Mutation_p.R294H|TBC1D10A_uc010gvu.2_Missense_Mutation_p.R389H|TBC1D10A_uc003ahk.3_Missense_Mutation_p.R382H	NM_031937	NP_114143	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A	382						intracellular|microvillus	guanyl-nucleotide exchange factor activity|PDZ domain binding|Rab GTPase activator activity			ovary(1)	1						GGGCGGGGAGCGGCACTGCAG	0.647													8	55	---	---	---	---	PASS
DDX3X	1654	broad.mit.edu	37	X	41202541	41202541	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41202541G>T	uc004dfe.2	+	7	1471	c.616G>T	c.(616-618)GTG>TTG	p.V206L	DDX3X_uc010nhf.1_Missense_Mutation_p.V190L|DDX3X_uc004dff.2_Missense_Mutation_p.V206L|DDX3X_uc011mkq.1_Missense_Mutation_p.V190L|DDX3X_uc011mkr.1_Missense_Mutation_p.V206L|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_RNA|DDX3X_uc011mkt.1_RNA	NM_001356	NP_001347	O00571	DDX3X_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3	206	Q motif.|ATP.				interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						CCCAACTCCAGTGCAAAAGCA	0.373										HNSCC(61;0.18)			17	68	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47104314	47104314	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47104314G>C	uc004dhp.2	+	15	2206	c.2206G>C	c.(2206-2208)GAA>CAA	p.E736Q	USP11_uc004dhq.2_Missense_Mutation_p.E462Q	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	736					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						CTCCCCTGAAGAAGTCCATGG	0.607													12	123	---	---	---	---	PASS
PORCN	64840	broad.mit.edu	37	X	48374529	48374529	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48374529C>T	uc010nie.1	+	13	1326	c.1168C>T	c.(1168-1170)CGC>TGC	p.R390C	PORCN_uc004djr.1_Missense_Mutation_p.R385C|PORCN_uc004djs.1_Missense_Mutation_p.R379C|PORCN_uc004djt.1_Missense_Mutation_p.R308C|PORCN_uc011mlx.1_Missense_Mutation_p.R308C|PORCN_uc004dju.1_Missense_Mutation_p.R248C|PORCN_uc004djv.1_Missense_Mutation_p.R390C|PORCN_uc004djw.1_Missense_Mutation_p.R384C	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D	390	Extracellular (Potential).				Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3						GCACCAGCATCGCTTGGTGAG	0.572													11	68	---	---	---	---	PASS
GPKOW	27238	broad.mit.edu	37	X	48976099	48976099	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48976099C>T	uc004dmr.2	-	4	532	c.525G>A	c.(523-525)ATG>ATA	p.M175I		NM_015698	NP_056513	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	175	G-patch.					nucleus	nucleic acid binding			ovary(2)	2						GTTTCCAGCCCATGCCCCGCA	0.602													6	42	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53561048	53561048	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53561048G>A	uc004dsp.2	-	83	13344	c.12942C>T	c.(12940-12942)CTC>CTT	p.L4314L	HUWE1_uc004dsn.2_Silent_p.L3122L	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	4314	HECT.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TCATGCCTTCGAGGGCAGCAA	0.507													42	119	---	---	---	---	PASS
HDAC8	55869	broad.mit.edu	37	X	71710840	71710840	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71710840G>C	uc004eau.2	-	6	609	c.567C>G	c.(565-567)TTC>TTG	p.F189L	HDAC8_uc011mqe.1_Missense_Mutation_p.F46L|HDAC8_uc011mqf.1_5'UTR|HDAC8_uc011mqg.1_Missense_Mutation_p.F98L|HDAC8_uc011mqh.1_Missense_Mutation_p.F98L|HDAC8_uc010nlk.1_Missense_Mutation_p.F60L|HDAC8_uc004eav.2_Missense_Mutation_p.F189L|HDAC8_uc004eaw.2_RNA	NM_018486	NP_060956	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	189	Histone deacetylase.				chromatin assembly or disassembly|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nuclear chromosome	histone deacetylase activity (H3-K16 specific)|metal ion binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding				0	Renal(35;0.156)				Vorinostat(DB02546)	AGGTGAAACTGAATGCGTCTT	0.388													6	76	---	---	---	---	PASS
PGK1	5230	broad.mit.edu	37	X	77373593	77373593	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77373593G>A	uc004ecz.3	+	6	739	c.567G>A	c.(565-567)TTG>TTA	p.L189L	PGK1_uc010nlz.2_RNA|PGK1_uc011mqq.1_Silent_p.L161L	NM_000291	NP_000282	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	189					gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			upper_aerodigestive_tract(1)|ovary(1)	2						GTGGGTTTTTGATGAAGAAGG	0.478													19	235	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117742069	117742069	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117742069G>A	uc004eqp.2	+	25	2779	c.2716G>A	c.(2716-2718)GAA>AAA	p.E906K	DOCK11_uc004eqq.2_Missense_Mutation_p.E672K	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	906					blood coagulation	cytosol	GTP binding			ovary(3)	3						GTGCCATGAAGAAGGCTTGGA	0.323													11	134	---	---	---	---	PASS
CUL4B	8450	broad.mit.edu	37	X	119669687	119669687	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119669687C>G	uc004esw.2	-	18	2649	c.2212G>C	c.(2212-2214)GAG>CAG	p.E738Q	CUL4B_uc010nqq.2_Missense_Mutation_p.E439Q|CUL4B_uc004esv.2_Missense_Mutation_p.E720Q	NM_003588	NP_003579	Q13620	CUL4B_HUMAN	cullin 4B isoform 1	738					cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3						CCACTTACCTCTTTAAATTCT	0.343													17	268	---	---	---	---	PASS
GAB3	139716	broad.mit.edu	37	X	153941667	153941667	+	Silent	SNP	G	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153941667G>A	uc004fmj.1	-	3	456	c.408C>T	c.(406-408)TCC>TCT	p.S136S	GAB3_uc004fmk.1_Silent_p.S137S|GAB3_uc010nve.1_Silent_p.S137S|GAB3_uc004fml.1_5'UTR	NM_080612	NP_542179	Q8WWW8	GAB3_HUMAN	Gab3 protein isoform 2	136										ovary(1)	1	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCTGCAGGGAGGAGGGCGTGT	0.507													21	181	---	---	---	---	PASS
MPP1	4354	broad.mit.edu	37	X	154012298	154012298	+	Intron	SNP	G	C	C			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154012298G>C	uc004fmp.1	-						MPP1_uc010nvg.1_Intron|MPP1_uc011mzv.1_Intron|MPP1_uc004fmq.1_Intron|MPP1_uc011mzw.1_Intron	NM_002436	NP_002427	Q00013	EM55_HUMAN	palmitoylated membrane protein 1						regulation of neutrophil chemotaxis|signal transduction	integral to plasma membrane|membrane fraction|stereocilium	guanylate kinase activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCAATGAGAAGATACCGATCA	0.473													6	43	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974141	16974141	+	RNA	DEL	G	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974141delG	uc009vow.2	+	5		c.951delG			CROCCL1_uc001azg.1_5'Flank|CROCCL1_uc001azi.1_5'Flank|MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_Intron|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_Intron|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_Intron|MST1P2_uc001azm.3_Intron					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						TGGCTTGGCCGGGGAGGTCAG	0.667													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25371441	25371442	+	IGR	DEL	AG	-	-	rs61298913		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25371441_25371442delAG								RUNX3 (79829 upstream) : SYF2 (177325 downstream)																							gaaggaaggaagaaggaaggaa	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	48209051	48209052	+	IGR	INS	-	TGGTGA	TGGTGA	rs142247408	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48209051_48209052insTGGTGA								FOXD2 (302689 upstream) : SKINTL (358335 downstream)																							ggtagtggtggtggtggtggtg	0.000													3	3	---	---	---	---	
ABCD3	5825	broad.mit.edu	37	1	94883978	94883980	+	5'UTR	DEL	GCC	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94883978_94883980delGCC	uc001dqn.3	+	1					ABCD3_uc001dqm.3_5'UTR|ABCD3_uc010oto.1_5'UTR|ABCD3_uc010otp.1_5'UTR|ABCD3_uc009wdr.2_5'UTR	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		CAGTAAGGTAgccgccgccgccg	0.404													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	96914049	96914049	+	IGR	DEL	C	-	-	rs1931180	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96914049delC								None (None upstream) : PTBP2 (273126 downstream)																							CTTTGGTTTTCTTTTTCGCAT	0.313													5	3	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148344953	148344953	+	Intron	DEL	G	-	-	rs67971242		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148344953delG	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc009wkf.1_Intron|uc001erd.3_Intron|uc001erc.3_Intron|uc010paj.1_Intron|uc010pau.1_5'Flank|uc010pav.1_Intron|uc010paw.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						agaaactcaagggcgcgtcaa	0.174													8	6	---	---	---	---	
CCT3	7203	broad.mit.edu	37	1	156294585	156294586	+	Intron	INS	-	T	T	rs148501476	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156294585_156294586insT	uc001fol.1	-						CCT3_uc001fom.1_Intron|CCT3_uc001fon.1_Intron|CCT3_uc010phj.1_Intron|CCT3_uc010phk.1_Intron|CCT3_uc010phl.1_Intron	NM_005998	NP_005989	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 isoform a						'de novo' posttranslational protein folding	cytoskeleton|cytosol|plasma membrane	ATP binding|unfolded protein binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					tgcccaactaattttttgtatt	0.000													8	4	---	---	---	---	
HIST3H2A	92815	broad.mit.edu	37	1	228646357	228646358	+	5'Flank	DEL	GT	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228646357_228646358delGT	uc001hsy.2	-							NM_033445	NP_254280	Q7L7L0	H2A3_HUMAN	histone cluster 3, H2a						nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)	1		Prostate(94;0.183)				AATCTGAGCCgtgtgtgtgtgt	0.475													5	3	---	---	---	---	
MIR1285-2	100302268	broad.mit.edu	37	2	70481272	70481272	+	5'Flank	DEL	T	-	-	rs112545635		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70481272delT	hsa-mir-1285-2|MI0006347	-																							0						TATAGACCCAttttttttttt	0.189													4	2	---	---	---	---	
TEX261	113419	broad.mit.edu	37	2	71219277	71219277	+	Intron	DEL	T	-	-	rs112462352		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71219277delT	uc002shn.2	-						TEX261_uc010fdy.2_Intron	NM_144582	NP_653183	Q6UWH6	TX261_HUMAN	testis expressed sequence 261							integral to membrane					0						AAAGGCAACAttttttttttt	0.284													3	3	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	88091357	88091357	+	Intron	DEL	A	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88091357delA	uc010fhc.1	-						RGPD1_uc002ssm.1_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						accctgtcttaaaaaaaaaaa	0.194													9	4	---	---	---	---	
TUBA3E	112714	broad.mit.edu	37	2	130951180	130951182	+	Intron	DEL	AAA	-	-	rs34918027		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130951180_130951182delAAA	uc002tqv.2	-							NM_207312	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e						microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			skin(1)	1	Colorectal(110;0.1)					agactgtctcaaaaaaaaaaaaa	0.182													4	2	---	---	---	---	
DNAH7	56171	broad.mit.edu	37	2	196640373	196640373	+	Intron	DEL	A	-	-	rs35237602		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196640373delA	uc002utj.3	-						DNAH7_uc002uti.3_Intron	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						aagatagatgaaAAAAAAAAA	0.129													7	6	---	---	---	---	
COQ10B	80219	broad.mit.edu	37	2	198324934	198324934	+	Intron	DEL	C	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198324934delC	uc002uuh.1	+						COQ10B_uc010fsl.1_Intron	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor							mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGGCCtttttctttttttttt	0.209													3	3	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10089935	10089936	+	Intron	DEL	TC	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10089935_10089936delTC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GCTCTAAAATTCTCTGTCTGAA	0.322			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	3	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57493928	57493928	+	Intron	DEL	A	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57493928delA	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						aaaaaaaaacaaaaaaaaaaa	0.119													4	2	---	---	---	---	
PTPRG	5793	broad.mit.edu	37	3	61644712	61644717	+	Intron	DEL	CCTGCC	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61644712_61644717delCCTGCC	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron|PTPRG_uc003dla.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		GCTGTTTTCTcctgcccctgcccctg	0.427													4	2	---	---	---	---	
PLCH1	23007	broad.mit.edu	37	3	155301009	155301010	+	Intron	INS	-	G	G	rs141112074	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155301009_155301010insG	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CATTTCTTTGTGGGAAAATAGG	0.228													4	2	---	---	---	---	
NSUN7	79730	broad.mit.edu	37	4	40763013	40763014	+	Intron	INS	-	T	T	rs142152476	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40763013_40763014insT	uc003gvj.3	+						NSUN7_uc003gvh.2_Intron|NSUN7_uc003gvi.3_Intron	NM_024677	NP_078953			NOL1/NOP2/Sun domain family, member 7												0						TTTTGAAAGGGTTTTTTTTTTC	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	72742023	72742039	+	IGR	DEL	TTCCTTCCTTGCCTTCG	-	-	rs77638707		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72742023_72742039delTTCCTTCCTTGCCTTCG								GC (72265 upstream) : NPFFR2 (155482 downstream)																							cttccttgttttccttccttgccttcgttccttcctt	0.000													4	2	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186283364	186283364	+	Intron	DEL	A	-	-	rs78356496		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186283364delA	uc003ixh.2	+						SNX25_uc010ish.2_Intron|SNX25_uc003ixi.2_Intron	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		CTTTACAATGAAAAAAAAAAG	0.343													4	2	---	---	---	---	
C5orf42	65250	broad.mit.edu	37	5	37169833	37169834	+	Intron	INS	-	T	T			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37169833_37169834insT	uc011cpa.1	-						C5orf42_uc011coy.1_Intron|C5orf42_uc003jks.2_Intron|C5orf42_uc011coz.1_Intron|C5orf42_uc003jkr.1_Intron	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GGACATTATTAttttttttttt	0.134													4	2	---	---	---	---	
C5orf44	80006	broad.mit.edu	37	5	64948169	64948170	+	Intron	INS	-	TC	TC			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64948169_64948170insTC	uc003jtz.3	+						C5orf44_uc003jua.3_Intron|C5orf44_uc003juc.3_Intron|C5orf44_uc010iwv.2_Intron	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2											ovary(1)	1						ttcttttctttttttttttttt	0.158													5	6	---	---	---	---	
PPIP5K2	23262	broad.mit.edu	37	5	102526891	102526892	+	Intron	INS	-	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102526891_102526892insA	uc003kod.3	+						PPIP5K2_uc011cva.1_Intron|PPIP5K2_uc003koe.2_Intron|PPIP5K2_uc003kof.2_Intron	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						TTCTTCTTACCAAAAAAAAACA	0.322													4	2	---	---	---	---	
CCNG1	900	broad.mit.edu	37	5	162866031	162866031	+	Intron	DEL	A	-	-	rs72299838		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162866031delA	uc003lzb.2	+						CCNG1_uc011dek.1_Intron|CCNG1_uc011del.1_Intron|CCNG1_uc003lzc.2_Intron	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1						cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		actccttctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15710434	15710437	+	IGR	DEL	CTTT	-	-	rs12191708		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15710434_15710437delCTTT								DTNBP1 (47163 upstream) : MYLIP (418880 downstream)																							tccttccttcctttcttcctttct	0.088													4	3	---	---	---	---	
HCG22	285834	broad.mit.edu	37	6	31023076	31023078	+	RNA	DEL	GAG	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31023076_31023078delGAG	uc010jsi.1	+	1		c.1093_1095delGAG			HCG22_uc003nsj.1_Intron	NR_003948				Homo sapiens HLA complex group 22 (HCG22), non-coding RNA.												0						aaaaaaaaaaGAGAGAGAGAGAG	0.177													4	2	---	---	---	---	
C6orf153	88745	broad.mit.edu	37	6	42989414	42989419	+	In_Frame_Del	DEL	GCCGGG	-	-	rs3833662		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42989414_42989419delGCCGGG	uc003otp.1	+	1	30_35	c.22_27delGCCGGG	c.(22-27)GCCGGGdel	p.AG14del		NM_033112	NP_149103	Q96EU6	RRP36_HUMAN	hypothetical protein LOC88745	14_15					ribosomal small subunit biogenesis|rRNA processing	nucleolus					0			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TAACTAccgcgccggggccggggccg	0.529													3	5	---	---	---	---	
HS3ST5	222537	broad.mit.edu	37	6	114378233	114378234	+	3'UTR	INS	-	T	T	rs80329057		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114378233_114378234insT	uc003pwg.3	-	2					uc003pwf.2_Intron|HS3ST5_uc003pwh.3_3'UTR	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		GCAGACAGCAATTTTTTTTTTT	0.347													4	2	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123592367	123592367	+	Intron	DEL	T	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123592367delT	uc003pzj.1	-						TRDN_uc010kem.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		AAGTAGGAAATTTGAATACAT	0.303													4	2	---	---	---	---	
INTS1	26173	broad.mit.edu	37	7	1546840	1546840	+	5'Flank	DEL	T	-	-	rs111819550		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1546840delT	uc003skn.2	-						INTS1_uc003skq.2_5'Flank	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1						snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GTCAttattcttttttttttt	0.269													4	2	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40228031	40228032	+	Intron	INS	-	C	C	rs72318342		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40228031_40228032insC	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						agactccatctccaaaaaaaaa	0.158													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	88269890	88269891	+	IGR	INS	-	T	T	rs113056340		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88269890_88269891insT								STEAP4 (333681 upstream) : ZNF804B (118862 downstream)																							AGAAGGAGCACTTTTTTTTTTT	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	101967963	101967964	+	IGR	INS	-	A	A	rs138796949	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101967963_101967964insA								SH2B2 (5786 upstream) : SPDYE6 (18229 downstream)																							TTTTTTCCCTTAAAAAAAAAAG	0.371													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	67393251	67393255	+	IGR	DEL	AAAAA	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67393251_67393255delAAAAA								ADHFE1 (12209 upstream) : C8orf46 (12236 downstream)																							actctgtctcaaaaaaaaaaaaaaa	0.146													4	3	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	304943	304943	+	Intron	DEL	G	-	-	rs145661146		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:304943delG	uc003zgf.2	+						DOCK8_uc011lls.1_Intron|DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgt.2_Intron|DOCK8_uc003zgg.2_Intron|DOCK8_uc003zgh.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		agctctaactgggggacagag	0.129													1	5	---	---	---	---	
FXN	2395	broad.mit.edu	37	9	71668387	71668388	+	Intron	INS	-	GATGGATG	GATGGATG	rs73647061	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71668387_71668388insGATGGATG	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						actctgtcatagatggatggat	0.069													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8203152	8203152	+	IGR	DEL	A	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8203152delA								GATA3 (85990 upstream) : None (None downstream)																							ttatttatttatttatttTTT	0.353													3	3	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	18122472	18122473	+	Intron	INS	-	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18122472_18122473insA	uc001ipm.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						gactctgtctcaaaaaaaaaaa	0.079													4	3	---	---	---	---	
LOC100133308	100133308	broad.mit.edu	37	10	45634779	45634780	+	Intron	DEL	AC	-	-	rs71659798		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45634779_45634780delAC	uc001jbz.2	-						LOC100133308_uc009xmq.1_Intron					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						AAAAAAAAAAACAAAATTTGTA	0.163													4	4	---	---	---	---	
MRPS16	51021	broad.mit.edu	37	10	75011301	75011301	+	Intron	DEL	T	-	-	rs113802791		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75011301delT	uc001jts.1	-						DNAJC9_uc010qkg.1_5'Flank|MRPS16_uc010qkh.1_Intron|MRPS16_uc001jtt.1_Intron|uc001jtu.1_5'Flank	NM_016065	NP_057149	Q9Y3D3	RT16_HUMAN	mitochondrial ribosomal protein S16 precursor						translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0	Prostate(51;0.0119)					gcccaactaattttttttttt	0.000													10	5	---	---	---	---	
SLIT1	6585	broad.mit.edu	37	10	98781316	98781316	+	Intron	DEL	T	-	-	rs11303965		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98781316delT	uc001kmw.2	-							NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor						axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		tcagtgctgcttttttttttt	0.179													9	5	---	---	---	---	
DUSP8	1850	broad.mit.edu	37	11	1577819	1577820	+	Frame_Shift_Del	DEL	CG	-	-	rs61747093		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1577819_1577820delCG	uc001lts.2	-	7	1934_1935	c.1806_1807delCG	c.(1804-1809)CGCGGCfs	p.R602fs		NM_004420	NP_004411	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	602_603					inactivation of MAPK activity	cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		AGCTCCTCGCCGCGCGCGCGCC	0.752													4	2	---	---	---	---	
FAM99B	100132464	broad.mit.edu	37	11	1707878	1707881	+	5'Flank	DEL	CTCA	-	-	rs78379018		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1707878_1707881delCTCA	uc010qxa.1	-						uc001ltz.1_5'Flank	NR_026642				Homo sapiens family with sequence similarity 99, member B (FAM99B), non-coding RNA.												0						tcttccctccctcacttccttcct	0.216													3	3	---	---	---	---	
NUMA1	4926	broad.mit.edu	37	11	71728543	71728544	+	Intron	INS	-	A	A	rs143789109	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71728543_71728544insA	uc001orl.1	-						NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Intron|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Intron|NUMA1_uc001oro.1_Intron|NUMA1_uc009ysy.1_3'UTR|NUMA1_uc001orp.2_3'UTR|NUMA1_uc001orq.2_3'UTR	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1						G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						ATTGACTGGGGAAAAAAAAAAT	0.228			T	RARA	APL								1	6	---	---	---	---	
GPRC5A	9052	broad.mit.edu	37	12	13065679	13065680	+	3'UTR	INS	-	T	T	rs111900693		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13065679_13065680insT	uc001rba.2	+	4					uc001rbb.3_5'Flank	NM_003979	NP_003970	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, family C, group 5,							cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	GCGCTGTAGTATTTTTTTTTTT	0.401													6	3	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101776646	101776647	+	Intron	INS	-	G	G	rs55823952		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101776646_101776647insG	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						aaaaaaaaaaaggaatatctaa	0.104													3	4	---	---	---	---	
ATXN2	6311	broad.mit.edu	37	12	111951476	111951477	+	Intron	INS	-	A	A			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111951476_111951477insA	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsm.1_Intron	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						GTTAAAAATAGAAAAAAAAAAA	0.203													4	2	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50299783	50299783	+	Intron	DEL	T	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50299783delT	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		CCAACCCTACttttttttttt	0.174													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480465	98480470	+	IGR	DEL	TCTTTC	-	-	rs72290183		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480465_98480470delTCTTTC								C14orf64 (36004 upstream) : C14orf177 (697480 downstream)																							ttccttcctttctttctctttctttc	0.000													4	3	---	---	---	---	
HDC	3067	broad.mit.edu	37	15	50546973	50546974	+	Intron	INS	-	TCTGTG	TCTGTG	rs71424050		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50546973_50546974insTCTGTG	uc001zxz.2	-						HDC_uc001zxy.2_5'Flank|HDC_uc010uff.1_Intron|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Intron	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase						catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	ctctctctctctgtgtgtgtat	0.307													8	4	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	64047330	64047331	+	Intron	DEL	AC	-	-	rs138372887		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64047330_64047331delAC	uc002amp.2	-						HERC1_uc010uil.1_Intron|HERC1_uc010bgt.1_Intron	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						AAAATAAATGACAGTCTTTGGC	0.252													3	6	---	---	---	---	
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAAC	AAAC	rs140336932	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190	Q86UW2	OSTB_HUMAN	organic solute transporter beta							integral to membrane|plasma membrane					0						CAAGCTGTTaaaaacaaacaaa	0.465													5	3	---	---	---	---	
TNRC6A	27327	broad.mit.edu	37	16	24741818	24741818	+	Intron	DEL	A	-	-	rs115981479		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24741818delA	uc002dmm.2	+							NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		TTCTTTCTTTAAAAAAAAAAA	0.408													5	5	---	---	---	---	
CDH1	999	broad.mit.edu	37	16	68857141	68857141	+	Intron	DEL	A	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68857141delA	uc002ewg.1	+						CDH1_uc010vlj.1_Intron|CDH1_uc010cfg.1_Intron	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TTTTTACAGCAAAAAAAAAAA	0.408			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				4	2	---	---	---	---	
TRPV3	162514	broad.mit.edu	37	17	3427201	3427202	+	Intron	INS	-	AC	AC	rs140742241	by1000genomes	TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3427201_3427202insAC	uc002fvt.1	-						TRPV3_uc002fvs.1_Intron|TRPV3_uc010vrh.1_Intron|TRPV3_uc010vri.1_Intron|TRPV3_uc010vrj.1_Intron|TRPV3_uc010vrk.1_Intron|TRPV3_uc010vrl.1_Intron|TRPV3_uc010vrm.1_Intron|TRPV3_uc002fvr.2_Intron|TRPV3_uc002fvu.2_Intron|TRPV3_uc010vrn.1_Intron	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)	cacacacacatacacacacaca	0.153													6	5	---	---	---	---	
KIAA0100	9703	broad.mit.edu	37	17	26950601	26950601	+	Intron	DEL	A	-	-	rs35696171		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26950601delA	uc002hbu.2	-						KIAA0100_uc002hbt.2_5'Flank	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor							extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					CACCATGAGGAAAAAAAAAAA	0.368													9	4	---	---	---	---	
GOSR1	9527	broad.mit.edu	37	17	28849612	28849612	+	3'UTR	DEL	A	-	-	rs76806222		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28849612delA	uc002hfe.2	+	9					GOSR1_uc002hfd.2_3'UTR|GOSR1_uc002hff.2_3'UTR	NM_004871	NP_004862	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1 isoform 1						intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0						Gtttttaattaaaaaaaaaaa	0.378													10	5	---	---	---	---	
DHX40P1	653645	broad.mit.edu	37	17	58066608	58066608	+	Intron	DEL	T	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58066608delT	uc002iyf.2	-						uc002iye.1_Intron	NR_002924				Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 40 pseudogene, mRNA (cDNA clone IMAGE:5170263).												0						TTGATTGTGATTTTTTTTTTT	0.313													4	3	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626081	73626081	+	Intron	DEL	G	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626081delG	uc010dgl.2	-						RECQL5_uc010dgk.2_Intron|RECQL5_uc002jot.3_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CATCCTCACAGGGTTGGCTAG	0.572								Other_identified_genes_with_known_or_suspected_DNA_repair_function					8	4	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59894429	59894429	+	Intron	DEL	A	-	-	rs35190394		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59894429delA	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				aaccgatcttaaaaaaaaaaa	0.085													7	4	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5239175	5239176	+	Intron	INS	-	GA	GA	rs79455606		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5239175_5239176insGA	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		ggggggagggggagagagagag	0.124													7	7	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60308764	60308765	+	Intron	INS	-	GAAA	GAAA			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60308764_60308765insGAAA	uc002ybn.1	+						CDH4_uc002ybo.1_Intron|CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			aaagaaagaatgaaagaaagaa	0.292													4	7	---	---	---	---	
LSM14B	149986	broad.mit.edu	37	20	60699938	60699939	+	Intron	INS	-	T	T	rs142325994		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60699938_60699939insT	uc010gjy.1	+						LSM14B_uc002ybt.2_Intron|LSM14B_uc010gjx.1_Intron|LSM14B_uc002ybv.2_Intron|LSM14B_uc010gjz.1_Intron|LSM14B_uc010zzz.1_Intron	NM_144703	NP_653304	Q9BX40	LS14B_HUMAN	LSM14 homolog B						multicellular organismal development|regulation of translation	ribonucleoprotein complex					0	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			GAGGAATAACCttttttttttt	0.248													6	5	---	---	---	---	
SFRS15	57466	broad.mit.edu	37	21	33057323	33057323	+	Intron	DEL	T	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33057323delT	uc002ypd.2	-						SFRS15_uc002ype.2_Intron|SFRS15_uc010glu.2_Intron|SFRS15_uc002ypf.1_Frame_Shift_Del_p.T517fs	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform							nucleus	nucleotide binding|RNA binding				0						ggggggggggtggggCAAGGA	0.299													6	3	---	---	---	---	
TNRC6B	23112	broad.mit.edu	37	22	40502242	40502242	+	Intron	DEL	T	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40502242delT	uc003aym.2	+							NM_001024843	NP_001020014	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 3						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						CGAGGTTGTCTTTTTTTTTTT	0.234													5	3	---	---	---	---	
P2RY8	286530	broad.mit.edu	37	X	1585603	1585604	+	Intron	INS	-	CCTC	CCTC			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1585603_1585604insCCTC	uc004cpz.2	-							NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCTGCTGTCtcctccctccct	0.356			T	CRLF2	B-ALL|Downs associated ALL								7	4	---	---	---	---	
EGFL6	25975	broad.mit.edu	37	X	13618385	13618386	+	Intron	INS	-	TTCT	TTCT	rs71913558		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13618385_13618386insTTCT	uc004cvi.2	+						EGFL6_uc004cvj.2_Intron|EGFL6_uc011mik.1_Intron	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN	epidermal growth factor-like protein 6						cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2						cctttctttccttctttctttc	0.119													4	2	---	---	---	---	
GPM6B	2824	broad.mit.edu	37	X	13956662	13956662	+	5'UTR	DEL	G	-	-	rs112627997		TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13956662delG	uc004cvx.2	-	1					GPM6B_uc011min.1_5'Flank|GPM6B_uc004cwa.2_5'UTR	NM_001001994	NP_001001994	Q13491	GPM6B_HUMAN	glycoprotein M6B isoform 4						cell differentiation|nervous system development	integral to membrane					0						TGAGGGCTGCGGGGCGTTCGG	0.647													5	4	---	---	---	---	
SLC9A6	10479	broad.mit.edu	37	X	135081321	135081321	+	Intron	DEL	T	-	-			TCGA-BI-A0VR-01	TCGA-BI-A0VR-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135081321delT	uc004ezj.2	+						SLC9A6_uc004ezk.2_Intron|SLC9A6_uc011mvx.1_Intron	NM_006359	NP_006350	Q92581	SL9A6_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TTCCTTTTCCTTTTTTTTTTT	0.313													6	3	---	---	---	---	
