Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC9A1	6548	broad.mit.edu	37	1	27426904	27426904	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27426904G>A	uc001bnm.2	-	12	2968	c.2342C>T	c.(2341-2343)GCG>GTG	p.A781V	SLC9A1_uc001bnl.2_Missense_Mutation_p.A285V|SLC9A1_uc010ofk.1_Missense_Mutation_p.A442V	NM_003047	NP_003038	P19634	SL9A1_HUMAN	solute carrier family 9, isoform A1	781	Cytoplasmic (Potential).				regulation of pH	integral to membrane	sodium:hydrogen antiporter activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	GTCACTGGGCGCGGGGGTGAA	0.647													27	114	---	---	---	---	PASS
TMEM48	55706	broad.mit.edu	37	1	54252821	54252821	+	Intron	SNP	G	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54252821G>T	uc001cvs.2	-						TMEM48_uc010onu.1_Intron|TMEM48_uc001cvt.2_Intron|TMEM48_uc009vzk.2_Intron|TMEM48_uc010onv.1_Intron	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48						mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						CCAACCCACAGATTTCTTACC	0.433													55	173	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109801411	109801411	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109801411G>A	uc001dxa.3	+	2	3729	c.3668G>A	c.(3667-3669)CGC>CAC	p.R1223H		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1223	Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TCGGCACAGCGCGTGCTGCCC	0.587													5	5	---	---	---	---	PASS
KCNC4	3749	broad.mit.edu	37	1	110766382	110766382	+	Missense_Mutation	SNP	G	A	A	rs140378578		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110766382G>A	uc001dzh.2	+	2	1532	c.1475G>A	c.(1474-1476)CGG>CAG	p.R492Q	KCNC4_uc001dzf.2_Missense_Mutation_p.R492Q|KCNC4_uc009wfr.2_Missense_Mutation_p.R492Q|KCNC4_uc001dzg.2_Missense_Mutation_p.R492Q|KCNC4_uc001dzi.2_RNA	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel	492	Cytoplasmic (Potential).				synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCCAAGAAACGGAAGAAGCAC	0.617													13	86	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144864276	144864276	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144864276C>T	uc001elw.3	-	36	6110	c.5819G>A	c.(5818-5820)CGA>CAA	p.R1940Q	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.R1834Q|PDE4DIP_uc001elv.3_Missense_Mutation_p.R947Q|PDE4DIP_uc001ema.2_Missense_Mutation_p.R127Q	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1940	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAGGTGGGATCGAGAGGACAG	0.527			T	PDGFRB	MPD								37	201	---	---	---	---	PASS
ACP6	51205	broad.mit.edu	37	1	147120085	147120085	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147120085G>A	uc001epr.2	-	9	1570	c.1106C>T	c.(1105-1107)TCT>TTT	p.S369F		NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor	369					lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					CCACTCCTTAGATTCCAGGTG	0.527													13	98	---	---	---	---	PASS
ACP6	51205	broad.mit.edu	37	1	147121993	147121993	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147121993G>A	uc001epr.2	-	8	1394	c.930C>T	c.(928-930)AGC>AGT	p.S310S	ACP6_uc009wjj.1_3'UTR	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor	310					lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					TCAGCAGGTTGCTCTCTAGGA	0.537													11	133	---	---	---	---	PASS
ACP6	51205	broad.mit.edu	37	1	147124413	147124413	+	Intron	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147124413G>C	uc001epr.2	-						ACP6_uc009wjj.1_3'UTR	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor						lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					TCTGGCAGCTGATCAGCTTCC	0.478													11	128	---	---	---	---	PASS
ADAMTSL4	54507	broad.mit.edu	37	1	150525407	150525407	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150525407G>A	uc001eux.2	+	5	348	c.112G>A	c.(112-114)GAG>AAG	p.E38K	ADAMTSL4_uc001euw.2_Missense_Mutation_p.E38K|ADAMTSL4_uc009wlw.2_Missense_Mutation_p.E38K|ADAMTSL4_uc010pcg.1_Missense_Mutation_p.E38K	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	38					apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GACACCTACAGAGGAGGGCCA	0.587													161	97	---	---	---	---	PASS
INTS3	65123	broad.mit.edu	37	1	153745111	153745111	+	Intron	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153745111C>T	uc009wom.2	+						INTS3_uc001fct.2_Intron|INTS3_uc001fcu.2_Intron|INTS3_uc001fcv.2_Intron|INTS3_uc010peb.1_Silent_p.L800L|INTS3_uc001fcw.2_Intron|INTS3_uc010pec.1_Intron|INTS3_uc001fcy.2_Silent_p.L303L|INTS3_uc001fcx.2_Intron	NM_023015	NP_075391	Q68E01	INT3_HUMAN	integrator complex subunit 3						DNA repair|G2/M transition checkpoint|response to ionizing radiation|snRNA processing	integrator complex|SOSS complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTTTCTTCCTCTAGTTTTTAG	0.522													25	34	---	---	---	---	PASS
OR6K3	391114	broad.mit.edu	37	1	158687406	158687406	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158687406G>A	uc010pip.1	-	1	548	c.548C>T	c.(547-549)CCT>CTT	p.P183L		NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,	183	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					CCCACAGAAAGGCAGTGTGGA	0.517													19	85	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564691	176564691	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564691G>C	uc001gkz.2	+	3	3115	c.1951G>C	c.(1951-1953)GAT>CAT	p.D651H	PAPPA2_uc001gky.1_Missense_Mutation_p.D651H|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	651	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CCAGGTGGCTGATGTGCGCAA	0.532													5	39	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197059457	197059457	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197059457C>T	uc001gtu.2	-	24	9955	c.9698G>A	c.(9697-9699)CGA>CAA	p.R3233Q	ASPM_uc001gtv.2_Missense_Mutation_p.R1648Q|ASPM_uc001gtw.3_Missense_Mutation_p.R1081Q	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3233	IQ 39.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						AAGACTTAGTCGTATAGCTTT	0.328													9	47	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203672793	203672793	+	Silent	SNP	C	T	T	rs145839216	byFrequency	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203672793C>T	uc001gzw.2	+	8	1835	c.951C>T	c.(949-951)GAC>GAT	p.D317D	ATP2B4_uc001gzv.2_Silent_p.D317D|ATP2B4_uc009xaq.2_Silent_p.D317D	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	317	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGACCCAAGACGGAGTGGCCC	0.522													27	72	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204403616	204403616	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204403616C>G	uc001haw.2	-	25	4116	c.3637G>C	c.(3637-3639)GAT>CAT	p.D1213H	PIK3C2B_uc010pqv.1_Missense_Mutation_p.D1185H	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	1213	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CGGCCAAAATCAATGTGGAAC	0.537													25	19	---	---	---	---	PASS
SCCPDH	51097	broad.mit.edu	37	1	246927547	246927547	+	Splice_Site	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246927547G>A	uc001ibr.2	+	10	1338	c.991_splice	c.e10-1	p.I331_splice		NM_016002	NP_057086	Q8NBX0	SCPDH_HUMAN	saccharopine dehydrogenase (putative)							midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity			ovary(1)	1	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		CTCCTTCACAGATTGATGCTG	0.403													34	60	---	---	---	---	PASS
EIF2B4	8890	broad.mit.edu	37	2	27592363	27592363	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27592363C>G	uc002rkb.2	-	3	272	c.129G>C	c.(127-129)AAG>AAC	p.K43N	EIF2B4_uc002rjz.2_Missense_Mutation_p.K64N|EIF2B4_uc002rka.2_Missense_Mutation_p.K28N|EIF2B4_uc002rkc.2_Missense_Mutation_p.K43N|EIF2B4_uc002rkd.2_5'UTR|EIF2B4_uc002rke.2_Missense_Mutation_p.K13N|EIF2B4_uc002rkf.1_Missense_Mutation_p.K13N|SNX17_uc010ylj.1_5'Flank|SNX17_uc002rkg.1_5'Flank|SNX17_uc010ylk.1_5'Flank|SNX17_uc010eza.1_5'Flank|SNX17_uc002rki.1_5'Flank|SNX17_uc002rkh.1_5'Flank|SNX17_uc010yll.1_5'Flank|SNX17_uc010ylm.1_5'Flank|SNX17_uc010yln.1_5'Flank|SNX17_uc010ylo.1_5'Flank|SNX17_uc010ylp.1_5'Flank|SNX17_uc010ylq.1_5'Flank	NM_001034116	NP_001029288	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B,	43					myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTGCTGTTTCTTTTCCTTCC	0.498													25	164	---	---	---	---	PASS
FOSL2	2355	broad.mit.edu	37	2	28635065	28635065	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28635065C>G	uc002rma.2	+	4	1540	c.731C>G	c.(730-732)TCT>TGT	p.S244C	FOSL2_uc010ymi.1_Missense_Mutation_p.S205C	NM_005253	NP_005244	P15408	FOSL2_HUMAN	FOS-like antigen 2	244					cell death|regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(172;0.155)					GCCCAGCGCTCTGTCATCAAG	0.662													17	88	---	---	---	---	PASS
FOSL2	2355	broad.mit.edu	37	2	28635081	28635081	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28635081C>T	uc002rma.2	+	4	1556	c.747C>T	c.(745-747)ATC>ATT	p.I249I	FOSL2_uc010ymi.1_Silent_p.I210I	NM_005253	NP_005244	P15408	FOSL2_HUMAN	FOS-like antigen 2	249					cell death|regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(172;0.155)					TCAAGCCCATCAGCATTGCTG	0.642													20	87	---	---	---	---	PASS
EPAS1	2034	broad.mit.edu	37	2	46597010	46597010	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46597010G>A	uc002ruv.2	+	7	1312	c.824G>A	c.(823-825)CGC>CAC	p.R275H		NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	275	PAS 2.				angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			CTGCTTGGCCGCTCAGCCTAT	0.478													9	65	---	---	---	---	PASS
ZNF638	27332	broad.mit.edu	37	2	71653771	71653771	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71653771G>A	uc002shx.2	+	24	5091	c.4772G>A	c.(4771-4773)GGT>GAT	p.G1591D	ZNF638_uc002shy.2_Missense_Mutation_p.G1591D|ZNF638_uc002shz.2_Missense_Mutation_p.G1591D|ZNF638_uc002sia.2_Missense_Mutation_p.G1591D|ZNF638_uc002sib.1_3'UTR|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Missense_Mutation_p.G688D|ZNF638_uc002sid.2_Translation_Start_Site	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	1591					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						ACTCCTCGTGGTGTTGAGGGA	0.413													8	78	---	---	---	---	PASS
TET3	200424	broad.mit.edu	37	2	74320665	74320665	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74320665G>A	uc002skb.3	+	7	2734	c.2734G>A	c.(2734-2736)GAG>AAG	p.E912K		NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	912							metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GGTGACCAACGAGGAAATAGC	0.617													8	76	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98409038	98409038	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98409038C>G	uc002syh.3	-	31	4184	c.3955G>C	c.(3955-3957)GAA>CAA	p.E1319Q		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1319	Pro-rich.					integral to membrane				ovary(4)|central_nervous_system(2)	6						GACAGCCTTTCAGGCTGCGGC	0.677													7	24	---	---	---	---	PASS
TSGA10	80705	broad.mit.edu	37	2	99688285	99688285	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99688285G>A	uc002szg.3	-	12	1619	c.991C>T	c.(991-993)CGG>TGG	p.R331W	TSGA10_uc002szh.3_Missense_Mutation_p.R331W|TSGA10_uc002szi.3_Missense_Mutation_p.R331W|TSGA10_uc010fin.1_Missense_Mutation_p.R331W|TSGA10_uc010yvn.1_3'UTR	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	331					spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2						TCCAATTGCCGACGCATTCTG	0.433													36	104	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152476025	152476025	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152476025G>A	uc010fnx.2	-	69	10274	c.10083C>T	c.(10081-10083)ATC>ATT	p.I3361I		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3361	Nebulin 92.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CGGGCAGGCAGATCCATTCAT	0.488													43	71	---	---	---	---	PASS
ACVR1C	130399	broad.mit.edu	37	2	158412762	158412762	+	Silent	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158412762C>G	uc002tzk.3	-	3	630	c.387G>C	c.(385-387)GCG>GCC	p.A129A	ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Silent_p.A79A	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	129	Helical; (Potential).				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						CTGTCAGCATCGCAGCTATGG	0.483													19	34	---	---	---	---	PASS
MFSD6	54842	broad.mit.edu	37	2	191301315	191301315	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191301315C>G	uc002urz.2	+	3	884	c.560C>G	c.(559-561)TCT>TGT	p.S187C		NM_017694	NP_060164	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing	187					transmembrane transport	integral to membrane				ovary(2)	2						TCCTTTACCTCTTTCCTCACC	0.443													37	81	---	---	---	---	PASS
SUMO1	7341	broad.mit.edu	37	2	203079157	203079157	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203079157C>G	uc002uyz.1	-	3	236	c.88G>C	c.(88-90)GAT>CAT	p.D30H	SUMO1_uc002uza.1_Missense_Mutation_p.D5H	NM_001005781	NP_001005781	P63165	SUMO1_HUMAN	SMT3 suppressor of mif two 3 homolog 1 isoform a	30	Ubiquitin-like.				DNA repair|interferon-gamma-mediated signaling pathway|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|palate development|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein complex assembly|protein sumoylation|regulation of interferon-gamma-mediated signaling pathway|regulation of protein localization	cytoplasm|nuclear membrane|nuclear pore|nuclear speck	ubiquitin protein ligase binding				0						TCACTGCTATCCTAAGGAGAT	0.303													6	39	---	---	---	---	PASS
ATG7	10533	broad.mit.edu	37	3	11372813	11372813	+	Splice_Site	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11372813G>A	uc003bwc.2	+	8	796	c.679_splice	c.e8-1	p.I227_splice	ATG7_uc003bwd.2_Splice_Site_p.I227_splice|ATG7_uc011aum.1_Splice_Site_p.I188_splice	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						TTTGTTCACAGATAACAATTG	0.398													86	98	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49933981	49933981	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49933981C>T	uc003cxy.3	-	9	2695	c.2431G>A	c.(2431-2433)GAA>AAA	p.E811K	MST1R_uc011bdd.1_Missense_Mutation_p.E811K|MST1R_uc011bdc.1_5'Flank	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	811	IPT/TIG 3.|Extracellular (Potential).				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		ACCCTGCTTTCCACTGCCCTA	0.577													19	69	---	---	---	---	PASS
RBM6	10180	broad.mit.edu	37	3	50005125	50005125	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50005125G>C	uc003cyc.2	+	3	400	c.267G>C	c.(265-267)GAG>GAC	p.E89D	RBM6_uc011bdh.1_RNA|RBM6_uc010hlc.1_Intron|RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6	89					RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		GAGGAGGGGAGGGACCTGGAC	0.507													10	150	---	---	---	---	PASS
ROBO1	6091	broad.mit.edu	37	3	78734954	78734954	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78734954G>A	uc003dqe.2	-	10	1492	c.1284C>T	c.(1282-1284)TGC>TGT	p.C428C	ROBO1_uc003dqb.2_Silent_p.C389C|ROBO1_uc003dqc.2_Silent_p.C392C|ROBO1_uc003dqd.2_Silent_p.C392C|ROBO1_uc010hoh.2_5'UTR|ROBO1_uc003dqf.1_Silent_p.C107C	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	428	Extracellular (Potential).|Ig-like C2-type 4.				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TTAAAGTCTGGCAGATGTAAT	0.398													11	11	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108195277	108195277	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108195277G>A	uc003dxa.1	-	13	1317	c.1260C>T	c.(1258-1260)AAC>AAT	p.N420N		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	420	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TAACATATTCGTTACCAACTT	0.358													8	42	---	---	---	---	PASS
ZNF148	7707	broad.mit.edu	37	3	124951901	124951901	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124951901C>T	uc003ehx.3	-	9	2155	c.1669G>A	c.(1669-1671)GAG>AAG	p.E557K	SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Missense_Mutation_p.E557K|ZNF148_uc010hsa.2_Missense_Mutation_p.E557K|ZNF148_uc003eia.3_Missense_Mutation_p.E557K|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	557					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						AAGGATATCTCATGCTGTCCA	0.398													30	200	---	---	---	---	PASS
HLTF	6596	broad.mit.edu	37	3	148789138	148789138	+	Silent	SNP	T	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148789138T>C	uc003ewq.1	-	7	1013	c.795A>G	c.(793-795)GAA>GAG	p.E265E	HLTF_uc003ewr.1_Silent_p.E265E|HLTF_uc003ews.1_Silent_p.E265E|HLTF_uc010hve.1_Silent_p.E265E	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	265					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CATTTCGCTGTTCCCAGAATG	0.393													13	122	---	---	---	---	PASS
MAN2B2	23324	broad.mit.edu	37	4	6615955	6615955	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6615955G>A	uc003gjf.1	+	16	2610	c.2574G>A	c.(2572-2574)CCG>CCA	p.P858P	MAN2B2_uc003gje.1_Silent_p.P858P|MAN2B2_uc011bwf.1_Silent_p.P807P	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	858					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						GGACTGCGCCGAAGCTCCCAG	0.622													14	66	---	---	---	---	PASS
WDR19	57728	broad.mit.edu	37	4	39246134	39246134	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39246134C>T	uc003gtv.2	+	23	2761	c.2607C>T	c.(2605-2607)TAC>TAT	p.Y869Y	WDR19_uc011byi.1_Silent_p.Y709Y|WDR19_uc003gtw.1_Silent_p.Y466Y	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	869	TPR 3.				cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						GTCTCTACTACGATAAAGCAG	0.388													14	76	---	---	---	---	PASS
NSUN7	79730	broad.mit.edu	37	4	40752791	40752791	+	Silent	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40752791G>C	uc003gvj.3	+	2	576	c.81G>C	c.(79-81)CTG>CTC	p.L27L	NSUN7_uc003gvh.2_Silent_p.L27L|NSUN7_uc003gvi.3_Silent_p.L27L	NM_024677	NP_078953			NOL1/NOP2/Sun domain family, member 7												0						CCCTGCCTCTGTCCGGTGGGA	0.527													14	55	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49040097	49040097	+	Missense_Mutation	SNP	T	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49040097T>G	uc003gyv.2	+	13	1885	c.1703T>G	c.(1702-1704)CTA>CGA	p.L568R	CWH43_uc011bzl.1_Missense_Mutation_p.L541R	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	568					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						GTTTCAAAACTACTGAAAAGT	0.358													33	231	---	---	---	---	PASS
SLC10A6	345274	broad.mit.edu	37	4	87770275	87770275	+	5'UTR	SNP	A	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87770275A>G	uc003hqd.2	-	1						NM_197965	NP_932069	Q3KNW5	SOAT_HUMAN	sodium-dependent organic anion transporter							integral to membrane|plasma membrane	bile acid:sodium symporter activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		TCATCTCCTCATCTCCTTAAG	0.517													45	71	---	---	---	---	PASS
HERC6	55008	broad.mit.edu	37	4	89326036	89326036	+	Silent	SNP	T	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89326036T>C	uc011cdi.1	+	9	1284	c.1101T>C	c.(1099-1101)AGT>AGC	p.S367S	HERC6_uc011cdj.1_Silent_p.S367S|HERC6_uc011cdk.1_Intron|HERC6_uc011cdl.1_Intron	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1	367					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		AGGATACTAGTTCCACACGTG	0.433													13	47	---	---	---	---	PASS
LRIT3	345193	broad.mit.edu	37	4	110791137	110791137	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110791137C>T	uc003hzx.3	+	3	1290	c.1097C>T	c.(1096-1098)TCT>TTT	p.S366F	LRIT3_uc003hzw.3_Missense_Mutation_p.S228F	NM_198506	NP_940908	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and	366	Ser-rich.					integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		gcttccttctctttatctcct	0.229													44	57	---	---	---	---	PASS
INTU	27152	broad.mit.edu	37	4	128626914	128626914	+	Missense_Mutation	SNP	A	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128626914A>G	uc003ifk.1	+	11	1805	c.1735A>G	c.(1735-1737)ACT>GCT	p.T579A	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	579										ovary(1)	1						AGACTCAAGCACTGAAGTCTT	0.413													83	84	---	---	---	---	PASS
PDGFC	56034	broad.mit.edu	37	4	157688963	157688963	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157688963G>A	uc003iph.1	-	5	1374	c.883C>T	c.(883-885)CAA>TAA	p.Q295*	PDGFC_uc003ipi.1_Nonsense_Mutation_p.Q132*|PDGFC_uc011cis.1_Nonsense_Mutation_p.Q132*|PDGFC_uc011cir.1_Nonsense_Mutation_p.Q139*	NM_016205	NP_057289	Q9NRA1	PDGFC_HUMAN	platelet-derived growth factor C precursor	295					central nervous system development|platelet-derived growth factor receptor signaling pathway|positive regulation of cell division|positive regulation of DNA replication|positive regulation of fibroblast proliferation|vascular endothelial growth factor receptor signaling pathway	endoplasmic reticulum lumen|extracellular space|Golgi membrane|nucleus	cell surface binding|growth factor activity|platelet-derived growth factor receptor binding|protein homodimerization activity			ovary(1)|lung(1)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		GGGACACATTGACATTCATTG	0.403													41	65	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175896932	175896932	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175896932C>T	uc003iuc.2	+	5	926	c.256C>T	c.(256-258)CAG>TAG	p.Q86*	ADAM29_uc003iud.2_Nonsense_Mutation_p.Q86*|ADAM29_uc010irr.2_Nonsense_Mutation_p.Q86*|ADAM29_uc011cki.1_Nonsense_Mutation_p.Q86*	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	86					proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CTACACAGACCAGGGTGCTAT	0.478													19	28	---	---	---	---	PASS
PAPD7	11044	broad.mit.edu	37	5	6742641	6742641	+	Silent	SNP	G	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6742641G>T	uc003jdx.1	+	5	426	c.297G>T	c.(295-297)GTG>GTT	p.V99V	PAPD7_uc011cmn.1_Silent_p.V90V	NM_006999	NP_008930	Q5XG87	PAPD7_HUMAN	DNA polymerase sigma	99					cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding			ovary(1)	1						AGACTGAAGTGAAAGTTGACA	0.463													13	127	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21975288	21975288	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21975288G>C	uc010iuc.2	-	3	896	c.438C>G	c.(436-438)TTC>TTG	p.F146L	CDH12_uc011cno.1_Missense_Mutation_p.F146L|CDH12_uc003jgk.2_Missense_Mutation_p.F146L	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	146	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						CTTTGATGATGAATTCTGATT	0.433										HNSCC(59;0.17)			24	160	---	---	---	---	PASS
CKMT2	1160	broad.mit.edu	37	5	80554979	80554979	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80554979G>A	uc003khc.3	+	9	1162	c.920G>A	c.(919-921)TGG>TAG	p.W307*	RNU5E_uc011cto.1_Intron|CKMT2_uc010jaq.2_Nonsense_Mutation_p.W307*|CKMT2_uc003khd.3_Nonsense_Mutation_p.W307*|uc003khe.1_Intron|uc003khf.1_Intron|uc003khg.1_Intron	NM_001825	NP_001816	P17540	KCRS_HUMAN	sarcomeric mitochondrial creatine kinase	307	Phosphagen kinase C-terminal.				creatine metabolic process|muscle contraction	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	GAGTTCATGTGGAATGAGCGC	0.473													27	145	---	---	---	---	PASS
SSBP2	23635	broad.mit.edu	37	5	80736439	80736439	+	Missense_Mutation	SNP	C	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80736439C>A	uc003kho.2	-	14	1077	c.866G>T	c.(865-867)GGG>GTG	p.G289V	RNU5E_uc011cto.1_Intron|SSBP2_uc010jar.2_Missense_Mutation_p.G177V|SSBP2_uc003khn.2_Missense_Mutation_p.G163V|SSBP2_uc003khp.2_Missense_Mutation_p.G297V|SSBP2_uc011ctp.1_Missense_Mutation_p.G269V|SSBP2_uc011ctq.1_Missense_Mutation_p.G267V|SSBP2_uc011ctr.1_Missense_Mutation_p.G259V	NM_012446	NP_036578	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2	289	Gly-rich.|Pro-rich.				regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		ACCATCTGACCCAGGACCCAT	0.333													7	44	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741175	140741175	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741175C>G	uc003ljs.1	+	1	1473	c.1473C>G	c.(1471-1473)ATC>ATG	p.I491M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.I491M|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	491	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTACTCCATCGTAGCGAGCG	0.602													26	49	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741819	140741819	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741819C>T	uc003ljs.1	+	1	2117	c.2117C>T	c.(2116-2118)GCG>GTG	p.A706V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.A706V|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	706	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTTCCTCGCGGTGATTCTG	0.592													54	80	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741884	140741884	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741884C>T	uc003ljs.1	+	1	2182	c.2182C>T	c.(2182-2184)CAG>TAG	p.Q728*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Nonsense_Mutation_p.Q728*|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	728	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACTGTTTTCAGCCTGGTCT	0.552													60	96	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156590578	156590578	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156590578C>G	uc003lwn.2	-	2	798	c.698G>C	c.(697-699)GGG>GCG	p.G233A		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	233	Ala-rich.					nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCCTCTCCCCCAGCATAAGC	0.572													16	105	---	---	---	---	PASS
OR11A1	26531	broad.mit.edu	37	6	29395167	29395167	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29395167C>T	uc003nmg.2	-	1	343	c.252G>A	c.(250-252)CTG>CTA	p.L84L		NM_013937	NP_039225	Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A,	84	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GGAAGCCCTCCAGCATTTTTG	0.498													65	37	---	---	---	---	PASS
PHF3	23469	broad.mit.edu	37	6	64422276	64422276	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64422276C>T	uc003pep.1	+	15	4818	c.4792C>T	c.(4792-4794)CAG>TAG	p.Q1598*	PHF3_uc003pen.2_Nonsense_Mutation_p.Q1510*|PHF3_uc011dxs.1_Nonsense_Mutation_p.Q867*	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	1598					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AAGACAGCTTCAGGAAGATCA	0.338													13	75	---	---	---	---	PASS
COQ3	51805	broad.mit.edu	37	6	99817559	99817559	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99817559C>T	uc003ppk.2	-	7	1054	c.1027G>A	c.(1027-1029)GAG>AAG	p.E343K		NM_017421	NP_059117	Q9NZJ6	COQ3_HUMAN	hexaprenyldihydroxybenzoate methyltransferase	343					glycerol metabolic process|ubiquinone biosynthetic process	mitochondrial matrix	2-polyprenyl-6-methoxy-1,4-benzoquinone methyltransferase activity|3-demethylubiquinone-9 3-O-methyltransferase activity|hexaprenyldihydroxybenzoate methyltransferase activity			upper_aerodigestive_tract(1)	1		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0625)		AAAACAAACTCAGCAGAGGCT	0.448													81	154	---	---	---	---	PASS
NPVF	64111	broad.mit.edu	37	7	25266507	25266507	+	Missense_Mutation	SNP	C	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25266507C>A	uc003sxo.2	-	2	324	c.277G>T	c.(277-279)GGG>TGG	p.G93W		NM_022150	NP_071433	Q9HCQ7	RFRP_HUMAN	neuropeptide VF precursor	93					neuropeptide signaling pathway	extracellular region|membrane	G-protein coupled receptor activity			ovary(1)	1						ACGTTCCTCCCAAATCTCAAT	0.443													41	191	---	---	---	---	PASS
C7orf63	79846	broad.mit.edu	37	7	89917563	89917563	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89917563G>A	uc010lep.2	+	15	1923	c.1672G>A	c.(1672-1674)GAA>AAA	p.E558K	C7orf63_uc003ukf.2_RNA|C7orf63_uc003ukg.2_Missense_Mutation_p.E233K|C7orf63_uc011khj.1_Missense_Mutation_p.E540K|C7orf63_uc011khk.1_Missense_Mutation_p.E120K	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1	558							binding			ovary(1)	1						TTTCGGAACTGAAGGAGTAGA	0.338													26	45	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101844947	101844947	+	Silent	SNP	C	T	T	rs145408393		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101844947C>T	uc003uyx.3	+	18	2408	c.2370C>T	c.(2368-2370)GAC>GAT	p.D790D	CUX1_uc003uys.3_Silent_p.D801D|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	790					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						AGGCCCAGGACGCCCCCGGGC	0.667													9	67	---	---	---	---	PASS
REPIN1	29803	broad.mit.edu	37	7	150069177	150069177	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150069177C>T	uc010lpq.1	+	4	1336	c.847C>T	c.(847-849)CGG>TGG	p.R283W	REPIN1_uc003whd.2_Missense_Mutation_p.R272W|REPIN1_uc010lpr.1_Missense_Mutation_p.R340W|REPIN1_uc003whc.2_Missense_Mutation_p.R283W|REPIN1_uc003whe.2_Missense_Mutation_p.R283W	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	283	C2H2-type 7.				DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			GACTTCGCACCGGCGCATCCA	0.637													6	25	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151970952	151970952	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151970952G>A	uc003wla.2	-	7	1069	c.850C>T	c.(850-852)CGA>TGA	p.R284*		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	284					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AATGCACATCGCTGAAAGGGG	0.393			N		medulloblastoma								9	81	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10480214	10480214	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10480214C>T	uc003wtc.2	-	2	727	c.498G>A	c.(496-498)CAG>CAA	p.Q166Q		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	166					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		GAACCACTGTCTGCTGGAGGC	0.562													41	167	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100155380	100155380	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100155380C>T	uc003yiv.2	+	13	1941	c.1830C>T	c.(1828-1830)AGC>AGT	p.S610S	VPS13B_uc003yiw.2_Silent_p.S610S|VPS13B_uc003yit.2_Silent_p.S610S|VPS13B_uc003yiu.1_Silent_p.S610S|VPS13B_uc003yix.1_Silent_p.S81S	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	610					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AACCATATAGCAGGCTAAAAT	0.333													45	227	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14750127	14750127	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14750127C>G	uc003zlm.2	-	30	6145	c.5555G>C	c.(5554-5556)GGA>GCA	p.G1852A	FREM1_uc010mic.2_RNA|FREM1_uc003zlk.2_Intron|FREM1_uc003zll.2_Missense_Mutation_p.G388A	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1852					cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		AAGAATACCTCCTTTTGAGTC	0.433													16	73	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109690314	109690314	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109690314G>T	uc004bcz.2	+	3	4410	c.4121G>T	c.(4120-4122)TGT>TTT	p.C1374F	ZNF462_uc010mto.2_Missense_Mutation_p.C1222F|ZNF462_uc004bda.2_Missense_Mutation_p.C1222F	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	1374					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TGCAGGGACTGTGTTTTCGAA	0.517													46	95	---	---	---	---	PASS
BAT2L1	84726	broad.mit.edu	37	9	134362661	134362661	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134362661C>T	uc004can.3	+	26	6019	c.5964C>T	c.(5962-5964)TTC>TTT	p.F1988F	BAT2L1_uc004cao.3_Silent_p.F1345F|BAT2L1_uc004cap.3_Silent_p.F133F	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	1988							protein binding				0						AGGAGATCTTCAGCTCCTTGC	0.612													14	17	---	---	---	---	PASS
TUBB8	347688	broad.mit.edu	37	10	93876	93876	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93876G>A	uc001ifi.2	-	4	456	c.456C>T	c.(454-456)CTC>CTT	p.L152L	TUBB8_uc009xhe.2_Silent_p.L115L|TUBB8_uc010pzs.1_Silent_p.L80L	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 isoform 1	152					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GGATCTTACTGAGCAGAAGGG	0.592													21	194	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25464455	25464455	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25464455C>T	uc001isj.2	+	1	166	c.106C>T	c.(106-108)CGA>TGA	p.R36*	LOC100128811_uc010qde.1_Intron	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	36	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						GGATTCCCCTCGAGAGAGGAC	0.682													15	58	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	56138561	56138561	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56138561C>T	uc001jju.1	-	4	694	c.299G>A	c.(298-300)GGA>GAA	p.G100E	PCDH15_uc010qhq.1_Missense_Mutation_p.G105E|PCDH15_uc010qhr.1_Missense_Mutation_p.G100E|PCDH15_uc010qhs.1_Missense_Mutation_p.G105E|PCDH15_uc010qht.1_Missense_Mutation_p.G100E|PCDH15_uc010qhu.1_Missense_Mutation_p.G100E|PCDH15_uc001jjv.1_Missense_Mutation_p.G78E|PCDH15_uc010qhv.1_Missense_Mutation_p.G100E|PCDH15_uc010qhw.1_Missense_Mutation_p.G100E|PCDH15_uc010qhx.1_Missense_Mutation_p.G100E|PCDH15_uc010qhy.1_Missense_Mutation_p.G105E|PCDH15_uc010qhz.1_Missense_Mutation_p.G100E|PCDH15_uc010qia.1_Missense_Mutation_p.G78E|PCDH15_uc010qib.1_Missense_Mutation_p.G78E|PCDH15_uc001jjw.2_Missense_Mutation_p.G100E	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	100	Cadherin 1.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CAGAACTCTTCCGGTGCTGTT	0.358										HNSCC(58;0.16)			22	102	---	---	---	---	PASS
CWF19L1	55280	broad.mit.edu	37	10	101996654	101996654	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101996654G>T	uc001kqq.1	-	12	1414	c.1327C>A	c.(1327-1329)CAG>AAG	p.Q443K	CWF19L1_uc001kqs.1_Missense_Mutation_p.Q195K|CWF19L1_uc001kqr.1_Intron|CWF19L1_uc001kqt.1_Missense_Mutation_p.Q147K|CWF19L1_uc010qpn.1_Missense_Mutation_p.Q306K	NM_018294	NP_060764	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control	443							catalytic activity				0		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		TCTATCTGCTGCTCCTGTGCC	0.458													78	95	---	---	---	---	PASS
LRDD	55367	broad.mit.edu	37	11	800182	800182	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:800182C>T	uc001lro.1	-	14	2365	c.2223G>A	c.(2221-2223)CAG>CAA	p.Q741Q	SLC25A22_uc009yci.2_5'Flank|SLC25A22_uc001lrj.2_5'Flank|LRDD_uc009yck.1_RNA|LRDD_uc001lrk.1_Silent_p.Q724Q|LRDD_uc001lrl.1_Silent_p.Q584Q|LRDD_uc001lrm.1_Silent_p.Q428Q|LRDD_uc001lrn.1_Silent_p.Q584Q|LRDD_uc001lrp.1_Silent_p.Q386Q	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	741					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGCCCTTCCTCTGCCGGGCAG	0.697													9	29	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32636423	32636423	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32636423G>C	uc001mtv.2	-	16	1485	c.1441C>G	c.(1441-1443)CAA>GAA	p.Q481E		NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	481										ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					ATTTCACTTTGATTTTCATCC	0.323													15	92	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	56143745	56143745	+	IGR	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56143745G>A								OR8J1 (15074 upstream) : OR5R1 (40991 downstream)																							GATTGTCTTTGTCTCCTACAT	0.498													26	90	---	---	---	---	PASS
CPSF7	79869	broad.mit.edu	37	11	61178432	61178432	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61178432G>A	uc001nrq.2	-	9	1533	c.1399C>T	c.(1399-1401)CGG>TGG	p.R467W	CPSF7_uc001nro.2_Missense_Mutation_p.R458W|CPSF7_uc001nrp.2_Missense_Mutation_p.R510W|CPSF7_uc001nrr.2_Missense_Mutation_p.R458W	NM_001136040	NP_001129512	Q8N684	CPSF7_HUMAN	pre-mRNA cleavage factor I, 59 kDa subunit	467	Arg-rich.				mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	mRNA cleavage factor complex	nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						TGCCGGTCCCGTTCTCTATCC	0.483													49	241	---	---	---	---	PASS
TYR	7299	broad.mit.edu	37	11	88911391	88911391	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88911391G>A	uc001pcs.2	+	1	352	c.270G>A	c.(268-270)CAG>CAA	p.Q90Q		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	90	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	GGACCTGCCAGTGCTCTGGCA	0.498									Oculocutaneous_Albinism				9	32	---	---	---	---	PASS
HTR3A	3359	broad.mit.edu	37	11	113848497	113848497	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113848497G>A	uc010rxb.1	+	2	323	c.90G>A	c.(88-90)AGG>AGA	p.R30R	HTR3A_uc010rxa.1_Silent_p.R30R|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Silent_p.R9R	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	24	Extracellular (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	TCCCAGCCAGGAGGAGCCGAA	0.567													14	31	---	---	---	---	PASS
CADM1	23705	broad.mit.edu	37	11	115047275	115047275	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115047275G>A	uc001ppi.3	-	10	1377	c.1248C>T	c.(1246-1248)GAC>GAT	p.D416D	CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Silent_p.D388D|CADM1_uc001ppj.3_Silent_p.D417D|CADM1_uc001pph.3_Silent_p.D179D	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	416	Cytoplasmic (Potential).				adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		CGTCTGCTGCGTCATCGGCTC	0.453													52	53	---	---	---	---	PASS
ERP27	121506	broad.mit.edu	37	12	15090933	15090933	+	Missense_Mutation	SNP	T	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15090933T>C	uc001rco.2	-	2	169	c.148A>G	c.(148-150)ATG>GTG	p.M50V		NM_152321	NP_689534	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27 kDa precursor	50	Thioredoxin.					endoplasmic reticulum lumen				breast(1)	1						ATGAATTCCATGGCAGCTGGG	0.522													24	126	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26208357	26208357	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26208357C>T	uc001rgx.2	+	2	302	c.81C>T	c.(79-81)GTC>GTT	p.V27V	RASSF8_uc001rgy.2_Silent_p.V27V|RASSF8_uc001rgz.2_Silent_p.V27V|RASSF8_uc009zjd.1_Silent_p.V27V|RASSF8_uc009zje.1_Silent_p.V27V|RASSF8_uc001rgw.1_RNA	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	27	Ras-associating.				signal transduction						0	Colorectal(261;0.0847)					AGGAGGTTGTCATAGCCTTAG	0.428													28	513	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26208363	26208363	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26208363C>T	uc001rgx.2	+	2	308	c.87C>T	c.(85-87)GCC>GCT	p.A29A	RASSF8_uc001rgy.2_Silent_p.A29A|RASSF8_uc001rgz.2_Silent_p.A29A|RASSF8_uc009zjd.1_Silent_p.A29A|RASSF8_uc009zje.1_Silent_p.A29A|RASSF8_uc001rgw.1_RNA	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	29	Ras-associating.				signal transduction						0	Colorectal(261;0.0847)					TTGTCATAGCCTTAGCTCAAG	0.428													28	500	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41337930	41337930	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41337930C>T	uc001rmm.1	+	14	1754	c.1641C>T	c.(1639-1641)ATC>ATT	p.I547I	CNTN1_uc009zjy.1_Silent_p.I547I|CNTN1_uc001rmn.1_Silent_p.I536I|CNTN1_uc001rmo.2_Silent_p.I547I	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	547	Ig-like C2-type 6.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GCTATGTGATCGATTTTAACA	0.408													19	70	---	---	---	---	PASS
LLPH	84298	broad.mit.edu	37	12	66517664	66517664	+	Missense_Mutation	SNP	T	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66517664T>G	uc010ssw.1	-	3	402	c.346A>C	c.(346-348)AGC>CGC	p.S116R	LLPH_uc010ssx.1_RNA	NM_032338	NP_115714	Q9BRT6	LLPH_HUMAN	LLP homolog	116	Lys-rich.										0						TTTGCTTTGCTTTTCCCCTTT	0.428													65	127	---	---	---	---	PASS
MYF5	4617	broad.mit.edu	37	12	81112734	81112734	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81112734C>T	uc001szg.2	+	3	807	c.672C>T	c.(670-672)CTC>CTT	p.L224L		NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5	224					muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						GGTTGCCTCTCCAGGATCTGG	0.493													49	71	---	---	---	---	PASS
ELK3	2004	broad.mit.edu	37	12	96641178	96641178	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96641178C>G	uc001teo.1	+	3	947	c.668C>G	c.(667-669)TCC>TGC	p.S223C		NM_005230	NP_005221	P41970	ELK3_HUMAN	ELK3 protein	223					negative regulation of transcription, DNA-dependent|signal transduction	mitochondrion	protein binding|purine-rich negative regulatory element binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	all_cancers(2;0.00173)					GCCAAGATCTCCTCTTTAATG	0.622													61	92	---	---	---	---	PASS
HSPB8	26353	broad.mit.edu	37	12	119617367	119617367	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119617367G>A	uc001txb.2	+	1	773	c.250G>A	c.(250-252)GAG>AAG	p.E84K	HSPB8_uc001txc.2_Missense_Mutation_p.E84K	NM_014365	NP_055180	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	84					cell death|response to heat	cytoplasm|nucleus	identical protein binding|protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGTGCCTGCCGAGGGCAGGAC	0.657													11	49	---	---	---	---	PASS
AACS	65985	broad.mit.edu	37	12	125558413	125558413	+	Intron	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125558413C>G	uc001uhc.2	+						AACS_uc009zyg.2_Intron|AACS_uc001uhd.2_Intron|AACS_uc009zyh.2_5'Flank	NM_023928	NP_076417	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase						fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TGAGCTATTTCATTTTTAGAG	0.408													12	82	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32912060	32912060	+	Missense_Mutation	SNP	C	T	T	rs80358604		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32912060C>T	uc001uub.1	+	11	3795	c.3568C>T	c.(3568-3570)CGG>TGG	p.R1190W		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	1190					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TGAAATTAAACGGAAGTTTGC	0.403			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			8	85	---	---	---	---	PASS
TMTC4	84899	broad.mit.edu	37	13	101257341	101257341	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101257341G>A	uc001vou.2	-	18	2293	c.2133C>T	c.(2131-2133)ATC>ATT	p.I711I	TMTC4_uc001vot.2_Silent_p.I730I|TMTC4_uc010tja.1_Silent_p.I600I	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	711	TPR 8.					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCTGCAAGGAGATTTCATAGT	0.433													82	53	---	---	---	---	PASS
ZNF770	54989	broad.mit.edu	37	15	35274379	35274379	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35274379C>T	uc001ziw.2	-	3	1568	c.1257G>A	c.(1255-1257)TTG>TTA	p.L419L		NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	419					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		GGATGCCTTTCAAATTTTTTC	0.328													15	103	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48736764	48736764	+	Missense_Mutation	SNP	T	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48736764T>C	uc001zwx.1	-	49	6339	c.6011A>G	c.(6010-6012)TAC>TGC	p.Y2004C	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2004	EGF-like 34; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTGAAGACTGTATCCAGGTGG	0.428													13	75	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48826336	48826336	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48826336G>A	uc001zwx.1	-	8	1131	c.803C>T	c.(802-804)TCT>TTT	p.S268F		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	268	EGF-like 4; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GCACTCAAAAGACCCAACAGT	0.443													159	310	---	---	---	---	PASS
ZSCAN10	84891	broad.mit.edu	37	16	3140073	3140073	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3140073G>A	uc002ctv.1	-	5	1285	c.1197C>T	c.(1195-1197)CAC>CAT	p.H399H	ZSCAN10_uc002cty.1_Silent_p.H60H|ZSCAN10_uc002ctw.1_Silent_p.H317H|ZSCAN10_uc002ctx.1_Silent_p.H327H	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	399	C2H2-type 4.				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						GGTCCTGGGCGTGCGCCAGCA	0.701													4	19	---	---	---	---	PASS
GLIS2	84662	broad.mit.edu	37	16	4385082	4385082	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4385082C>T	uc002cwc.1	+	4	601	c.544C>T	c.(544-546)CTG>TTG	p.L182L		NM_032575	NP_115964	Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	182	C2H2-type 1.				cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development	cytoplasm|nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|transcription regulatory region DNA binding|zinc ion binding				0						CTTTGAGCTCCTGCAAGACCT	0.617													30	107	---	---	---	---	PASS
PMM2	5373	broad.mit.edu	37	16	8906893	8906893	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8906893G>A	uc002czf.3	+	7	639	c.569G>A	c.(568-570)AGA>AAA	p.R190K	PMM2_uc010uyf.1_RNA|PMM2_uc010uyg.1_Missense_Mutation_p.R107K|PMM2_uc010uyh.1_Missense_Mutation_p.R65K|PMM2_uc010buj.2_RNA|PMM2_uc010uyi.1_Missense_Mutation_p.R43K	NM_000303	NP_000294	O15305	PMM2_HUMAN	phosphomannomutase 2	190					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	phosphomannomutase activity			ovary(1)	1						TGGGACAAGAGATACTGTCTG	0.458													44	109	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	953339	953339	+	Missense_Mutation	SNP	T	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:953339T>G	uc002fsd.2	-	16	1852	c.1742A>C	c.(1741-1743)AAG>ACG	p.K581T	ABR_uc002fse.2_Missense_Mutation_p.K535T|ABR_uc010vqg.1_Missense_Mutation_p.K363T|ABR_uc002fsg.2_Missense_Mutation_p.K544T|ABR_uc002fsh.1_Intron	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related	581	C2.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		ATTGTTGTCCTTGTTGACCTT	0.572													47	264	---	---	---	---	PASS
TADA2A	6871	broad.mit.edu	37	17	35830526	35830526	+	Silent	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35830526C>G	uc002hnt.2	+	13	1075	c.918C>G	c.(916-918)CTC>CTG	p.L306L	TADA2A_uc002hnv.2_Silent_p.L306L|TADA2A_uc002hnw.2_Silent_p.L205L|TADA2A_uc010cvb.2_Silent_p.L102L	NM_001488	NP_001479	O75478	TAD2A_HUMAN	transcriptional adaptor 2A isoform a	306					histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4						ACGATCACCTCAAGAAGACAC	0.522													22	124	---	---	---	---	PASS
KRT35	3886	broad.mit.edu	37	17	39633831	39633831	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39633831G>A	uc002hws.2	-	6	1202	c.1159C>T	c.(1159-1161)CGG>TGG	p.R387W		NM_002280	NP_002271	Q92764	KRT35_HUMAN	keratin 35	387	Rod.|Coil 2.				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)				AGCCGGGCCCGGACGTCCAGC	0.607													19	89	---	---	---	---	PASS
C17orf53	78995	broad.mit.edu	37	17	42222620	42222620	+	Missense_Mutation	SNP	A	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42222620A>C	uc002ifi.1	+	2	238	c.53A>C	c.(52-54)GAG>GCG	p.E18A	C17orf53_uc010czq.1_Missense_Mutation_p.E18A|C17orf53_uc002ifj.1_Missense_Mutation_p.E18A|C17orf53_uc002ifk.1_5'Flank	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995	18											0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TTTGAAGATGAGGTAGGGAAG	0.433													25	73	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56084341	56084341	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56084341C>T	uc002ivi.2	-	1	367	c.158G>A	c.(157-159)GGA>GAA	p.G53E	SFRS1_uc002ivj.2_Missense_Mutation_p.G53E	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform	53	RRM 1.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		GAAGGGCGGTCCCCCGCGGCG	0.587													39	101	---	---	---	---	PASS
DDX42	11325	broad.mit.edu	37	17	61888467	61888467	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61888467G>C	uc002jbu.2	+	14	1589	c.1332G>C	c.(1330-1332)AAG>AAC	p.K444N	DDX42_uc002jbv.2_Missense_Mutation_p.K444N|DDX42_uc002jbw.1_Missense_Mutation_p.K180N|DDX42_uc002jbx.2_Missense_Mutation_p.K180N|DDX42_uc002jby.2_5'Flank	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein	444	Helicase ATP-binding.				protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						TTCGGAAGAAGATTGAAAAGT	0.403													20	41	---	---	---	---	PASS
TEX2	55852	broad.mit.edu	37	17	62291274	62291274	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62291274G>C	uc002jec.2	-	2	477	c.304C>G	c.(304-306)CAG>GAG	p.Q102E	TEX2_uc002jed.2_Missense_Mutation_p.Q102E|TEX2_uc002jee.2_Missense_Mutation_p.Q102E	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2	102					signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		GCAGGGGCCTGGGACACGGAC	0.577													20	156	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66039427	66039427	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66039427G>T	uc002jgk.2	+	7	1010	c.878G>T	c.(877-879)GGA>GTA	p.G293V	KPNA2_uc002jgl.2_Missense_Mutation_p.G293V	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	293	ARM 6.				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTGAAAACAGGAGTTGTGCCC	0.413													83	302	---	---	---	---	PASS
CDC42EP4	23580	broad.mit.edu	37	17	71282208	71282208	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71282208C>T	uc002jjn.2	-	2	579	c.432G>A	c.(430-432)GTG>GTA	p.V144V	CDC42EP4_uc002jjo.2_Silent_p.V144V|CDC42EP4_uc002jjp.1_Silent_p.V74V	NM_012121	NP_036253	Q9H3Q1	BORG4_HUMAN	Cdc42 effector protein 4	144					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			TGGCCTTCTTCACGGGGCTGG	0.652													15	73	---	---	---	---	PASS
CDC42EP4	23580	broad.mit.edu	37	17	71282253	71282253	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71282253C>G	uc002jjn.2	-	2	534	c.387G>C	c.(385-387)GAG>GAC	p.E129D	CDC42EP4_uc002jjo.2_Missense_Mutation_p.E129D|CDC42EP4_uc002jjp.1_Missense_Mutation_p.E59D	NM_012121	NP_036253	Q9H3Q1	BORG4_HUMAN	Cdc42 effector protein 4	129					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			TGGTGCCCTTCTCCGCGGCCT	0.652													16	70	---	---	---	---	PASS
SLC16A5	9121	broad.mit.edu	37	17	73096514	73096514	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73096514C>G	uc002jmr.2	+	5	1128	c.756C>G	c.(754-756)TTC>TTG	p.F252L	SLC16A5_uc002jms.1_Missense_Mutation_p.F252L|SLC16A5_uc002jmt.2_Missense_Mutation_p.F252L|SLC16A5_uc002jmu.2_Missense_Mutation_p.F252L|SLC16A5_uc010wrt.1_Missense_Mutation_p.F292L	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5	252	Helical; (Potential).				organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	TCCTGGGCTTCCCACTGCCAC	0.607													137	299	---	---	---	---	PASS
SLC16A5	9121	broad.mit.edu	37	17	73096595	73096595	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73096595C>G	uc002jmr.2	+	5	1209	c.837C>G	c.(835-837)ATC>ATG	p.I279M	SLC16A5_uc002jms.1_Missense_Mutation_p.I279M|SLC16A5_uc002jmt.2_Missense_Mutation_p.I279M|SLC16A5_uc002jmu.2_Missense_Mutation_p.I279M|SLC16A5_uc010wrt.1_Missense_Mutation_p.I319M	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5	279	Helical; (Potential).				organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	TCATCTCCATCATCGGCTTCA	0.622													277	479	---	---	---	---	PASS
TMC6	11322	broad.mit.edu	37	17	76115482	76115482	+	Intron	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76115482G>A	uc002juj.1	-						TMC6_uc002jui.1_Intron|TMC6_uc010dhf.1_Intron|TMC6_uc002juk.2_Intron|TMC6_uc010dhg.1_Intron|TMC6_uc002jul.1_Intron	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6							endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TCCTGCCTCCGAGGACCCCGG	0.617									Epidermodysplasia_Verruciformis_Familial_Clustering_of				7	54	---	---	---	---	PASS
PPP4R1	9989	broad.mit.edu	37	18	9570273	9570273	+	Silent	SNP	T	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9570273T>C	uc002koe.1	-	11	1573	c.1455A>G	c.(1453-1455)CCA>CCG	p.P485P	PPP4R1_uc002kof.2_5'UTR|PPP4R1_uc010wzo.1_Silent_p.P331P|PPP4R1_uc002kod.1_Silent_p.P468P|PPP4R1_uc010wzp.1_RNA	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	485					protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						ATTCTTCCTCTGGTCCCTCTG	0.483													10	71	---	---	---	---	PASS
PSMA8	143471	broad.mit.edu	37	18	23758844	23758844	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23758844G>C	uc002kvq.2	+	5	660	c.546G>C	c.(544-546)AAG>AAC	p.K182N	PSMA8_uc002kvo.2_Missense_Mutation_p.K138N|PSMA8_uc002kvp.2_Missense_Mutation_p.K176N|PSMA8_uc002kvr.2_Missense_Mutation_p.K150N	NM_144662	NP_653263	Q8TAA3	PSA7L_HUMAN	proteasome alpha 8 subunit isoform 1	182					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	threonine-type endopeptidase activity			skin(1)	1	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			TTCTAGAAAAGAATTACACAG	0.318													6	43	---	---	---	---	PASS
PIK3C3	5289	broad.mit.edu	37	18	39550410	39550410	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39550410G>A	uc002lap.2	+	4	579	c.521G>A	c.(520-522)CGT>CAT	p.R174H	PIK3C3_uc010xcl.1_Missense_Mutation_p.R111H|PIK3C3_uc002lao.2_Missense_Mutation_p.R174H	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3	174					cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						CAGATGAGCCGTCTTGCCAAG	0.408										TSP Lung(28;0.18)			13	42	---	---	---	---	PASS
TMX3	54495	broad.mit.edu	37	18	66344338	66344338	+	Silent	SNP	G	A	A	rs151168037	byFrequency	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66344338G>A	uc002lkf.2	-	16	1332	c.1197C>T	c.(1195-1197)GCC>GCT	p.A399A	TMX3_uc010xez.1_Silent_p.A258A	NM_019022	NP_061895	Q96JJ7	TMX3_HUMAN	thioredoxin domain containing 10 precursor	399	Cytoplasmic (Potential).				cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			skin(1)	1						CATCTGTGTCGGCTGTGTAGA	0.438													22	152	---	---	---	---	PASS
APC2	10297	broad.mit.edu	37	19	1466348	1466348	+	Silent	SNP	C	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1466348C>A	uc002lsr.1	+	15	3256	c.3048C>A	c.(3046-3048)CTC>CTA	p.L1016L	APC2_uc002lss.1_Silent_p.L598L|APC2_uc002lst.1_Silent_p.L1016L|APC2_uc002lsu.1_Silent_p.L1015L|C19orf25_uc010xgn.1_Intron	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	1016					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGAGCCCCTCGCGGGGCCTG	0.697													3	19	---	---	---	---	PASS
PNPLA6	10908	broad.mit.edu	37	19	7619550	7619550	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7619550C>T	uc010xjq.1	+	23	2800	c.2605C>T	c.(2605-2607)CGA>TGA	p.R869*	PNPLA6_uc002mgq.1_Nonsense_Mutation_p.R821*|PNPLA6_uc010xjp.1_Nonsense_Mutation_p.R794*|PNPLA6_uc002mgr.1_Nonsense_Mutation_p.R821*|PNPLA6_uc002mgs.2_Nonsense_Mutation_p.R859*|PNPLA6_uc002mgt.1_5'Flank	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	860	Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						GCGCTGCCTGCGACAGGCCGA	0.682													41	77	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8161808	8161808	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8161808C>T	uc002mjf.2	-	42	5391	c.5370G>A	c.(5368-5370)AAG>AAA	p.K1790K		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1790	EGF-like 27; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CTCGGGTGCACTTGCAGCGGT	0.602													11	98	---	---	---	---	PASS
PDE4A	5141	broad.mit.edu	37	19	10571783	10571783	+	Intron	SNP	A	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10571783A>G	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron|PDE4A_uc002mom.2_Intron|PDE4A_uc002mon.2_Intron|PDE4A_uc002moo.2_Intron	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	AACACCAGTGAGTGGCCCTCG	0.632													17	36	---	---	---	---	PASS
NXNL1	115861	broad.mit.edu	37	19	17566593	17566593	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17566593C>T	uc002ngs.2	-	2	549	c.502G>A	c.(502-504)GAC>AAC	p.D168N		NM_138454	NP_612463	Q96CM4	NXNL1_HUMAN	nucleoredoxin-like 1	168					cell redox homeostasis	nuclear outer membrane					0						TCCTCCAGGTCCTCTGGCAGC	0.577													3	6	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36326600	36326600	+	Intron	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36326600G>A	uc002oby.2	-						NPHS1_uc010eem.1_Intron	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor						cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGGGACTGAGGACTTGCCTGA	0.547													64	143	---	---	---	---	PASS
ZNF573	126231	broad.mit.edu	37	19	38229812	38229812	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38229812C>T	uc002ohe.2	-	4	1601	c.1579G>A	c.(1579-1581)GAA>AAA	p.E527K	ZNF573_uc010efs.2_Missense_Mutation_p.E440K|ZNF573_uc002ohd.2_Missense_Mutation_p.E525K|ZNF573_uc002ohf.2_Missense_Mutation_p.E469K|ZNF573_uc002ohg.2_Missense_Mutation_p.E439K	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	zinc finger protein 573	507	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			ACCTTACATTCATAGGGTTTC	0.333													12	72	---	---	---	---	PASS
CCDC114	93233	broad.mit.edu	37	19	48800516	48800516	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48800516G>A	uc002pir.2	-	14	2413	c.1730C>T	c.(1729-1731)ACG>ATG	p.T577M	CCDC114_uc002piq.2_Missense_Mutation_p.T386M|CCDC114_uc002pio.2_3'UTR	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	577										ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GTCACCGTGCGTGATGTGGCT	0.622													15	49	---	---	---	---	PASS
TFPT	29844	broad.mit.edu	37	19	54611748	54611748	+	Intron	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54611748G>A	uc010yej.1	-							NM_013342	NP_037474	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner						apoptosis|DNA recombination|DNA repair|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex	DNA binding|protein binding				0	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					ATCTCCTAGCGGCTGGGGAAA	0.473			T	TCF3	pre-B ALL								31	36	---	---	---	---	PASS
LAIR1	3903	broad.mit.edu	37	19	54872754	54872754	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54872754C>G	uc002qfk.1	-	3	443	c.133G>C	c.(133-135)GTG>CTG	p.V45L	LAIR1_uc002qfl.1_Missense_Mutation_p.V45L|LAIR1_uc002qfm.1_Missense_Mutation_p.V44L|LAIR1_uc002qfn.1_Missense_Mutation_p.V44L|LAIR1_uc010yex.1_Missense_Mutation_p.V38L|LAIR1_uc002qfo.2_Missense_Mutation_p.V27L	NM_002287	NP_002278	Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like	45	Extracellular (Potential).|Ig-like C2-type.					integral to membrane|plasma membrane	protein binding|receptor activity			ovary(4)	4	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		ACGAAAGTCACATGGCTCCCC	0.572													45	152	---	---	---	---	PASS
LENG9	94059	broad.mit.edu	37	19	54974291	54974291	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54974291G>C	uc010yez.1	-	1	604	c.485C>G	c.(484-486)TCG>TGG	p.S162W		NM_198988	NP_945339	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	162					RNA metabolic process	intracellular	catalytic activity|nucleic acid binding|zinc ion binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		GTCGGTGCGCGAGGCGCGGTC	0.751													9	33	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56538828	56538828	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56538828G>C	uc002qmj.2	+	7	1229	c.1229G>C	c.(1228-1230)AGA>ACA	p.R410T	NLRP5_uc002qmi.2_Missense_Mutation_p.R391T	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	410	NACHT.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GTCACCGTCAGAGACGTGGGC	0.552													8	35	---	---	---	---	PASS
A1BG	1	broad.mit.edu	37	19	58864353	58864353	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58864353C>T	uc002qsd.3	-	3	343	c.281G>A	c.(280-282)CGC>CAC	p.R94H	NCRNA00181_uc002qse.2_Intron|A1BG_uc002qsf.1_RNA|NCRNA00181_uc002qsg.2_RNA	NM_130786	NP_570602	P04217	A1BG_HUMAN	alpha 1B-glycoprotein precursor	94	Ig-like V-type 1.					extracellular region					0		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CAAGCCCGAGCGGCAGCGGTA	0.637													66	74	---	---	---	---	PASS
LPIN3	64900	broad.mit.edu	37	20	39987182	39987182	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39987182C>T	uc002xjx.2	+	19	2502	c.2411C>T	c.(2410-2412)ACG>ATG	p.T804M	LPIN3_uc010ggh.2_Missense_Mutation_p.T805M|LPIN3_uc010zwf.1_RNA	NM_022896	NP_075047	Q9BQK8	LPIN3_HUMAN	lipin 3	804					fatty acid metabolic process	nucleus	phosphatidate phosphatase activity			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.000739)				CACAAATCCACGTGAGGCTAA	0.597													51	74	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40192757	40192757	+	Intron	SNP	T	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40192757T>C	uc002xka.1	-						CHD6_uc002xkd.2_Intron|CHD6_uc002xkc.2_Missense_Mutation_p.T11A	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				acagaaCTGGTACAAAAGCCA	0.179													20	27	---	---	---	---	PASS
PRIC285	85441	broad.mit.edu	37	20	62199860	62199860	+	Silent	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62199860C>T	uc002yfm.2	-	6	2473	c.1581G>A	c.(1579-1581)GCG>GCA	p.A527A	PRIC285_uc002yfl.1_5'Flank	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	527					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			GGCCCCAGCCCGCGATGAGCG	0.697													5	10	---	---	---	---	PASS
DNAJC5	80331	broad.mit.edu	37	20	62559804	62559804	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62559804C>T	uc002yhf.2	+	2	276	c.106C>T	c.(106-108)CGG>TGG	p.R36W	DNAJC5_uc002yhg.1_Missense_Mutation_p.R36W|DNAJC5_uc002yhh.2_RNA	NM_025219	NP_079495	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	36	J.				neurotransmitter secretion|protein folding	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|melanosome|plasma membrane	heat shock protein binding|unfolded protein binding			pancreas(1)	1	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					AAAGTCCTATCGGTAAGTGGA	0.498													11	78	---	---	---	---	PASS
NRIP1	8204	broad.mit.edu	37	21	16338529	16338529	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16338529G>A	uc002yjx.2	-	4	2583	c.1985C>T	c.(1984-1986)CCG>CTG	p.P662L		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	662	Repression domain 2.				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		CATACCTATCGGTTTATCTGT	0.378													25	87	---	---	---	---	PASS
EIF3D	8664	broad.mit.edu	37	22	36915583	36915583	+	Missense_Mutation	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36915583C>G	uc003apq.2	-	8	696	c.580G>C	c.(580-582)GAG>CAG	p.E194Q	EIF3D_uc011amr.1_Missense_Mutation_p.E21Q|EIF3D_uc003apr.2_Missense_Mutation_p.E194Q|EIF3D_uc011ams.1_Missense_Mutation_p.E97Q|EIF3D_uc011amt.1_Missense_Mutation_p.E145Q	NM_003753	NP_003744	O15371	EIF3D_HUMAN	eukaryotic translation initiation factor 3	194						cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			pancreas(1)	1						CCACAACACTCACTGTGGGAA	0.468													42	139	---	---	---	---	PASS
GLRA2	2742	broad.mit.edu	37	X	14748344	14748344	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14748344C>T	uc010nep.2	+	10	1428	c.1096C>T	c.(1096-1098)CGT>TGT	p.R366C	GLRA2_uc010neq.2_Missense_Mutation_p.R366C|GLRA2_uc004cwe.3_Missense_Mutation_p.R366C|GLRA2_uc011mio.1_Missense_Mutation_p.R277C|GLRA2_uc011mip.1_Missense_Mutation_p.R344C	NM_001118885	NP_001112357	P23416	GLRA2_HUMAN	glycine receptor, alpha 2 isoform A	366	Cytoplasmic (Probable).				neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(1)|lung(1)	2	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)	AGACGTTACTCGTGAAAGTCG	0.443													84	369	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19482436	19482436	+	5'UTR	SNP	G	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19482436G>T	uc004czk.1	-	3						NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase								ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					GTACTCGGAGGCTCGTCTCTG	0.512													9	47	---	---	---	---	PASS
PHKA1	5255	broad.mit.edu	37	X	71825423	71825423	+	Missense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71825423C>T	uc004eax.3	-	24	2954	c.2653G>A	c.(2653-2655)GAA>AAA	p.E885K	PHKA1_uc004eay.3_Missense_Mutation_p.E885K|PHKA1_uc011mqi.1_Missense_Mutation_p.E826K	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	885					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					ATATCCCCTTCACTGGCTTCA	0.378													9	76	---	---	---	---	PASS
KLHL4	56062	broad.mit.edu	37	X	86868950	86868950	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86868950G>A	uc004efb.2	+	2	675	c.493G>A	c.(493-495)GCA>ACA	p.A165T	KLHL4_uc004efa.2_Missense_Mutation_p.A165T	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	165						cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						TATAAACCACGCAGAGCAAAC	0.423													32	97	---	---	---	---	PASS
CPXCR1	53336	broad.mit.edu	37	X	88008861	88008861	+	Missense_Mutation	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88008861G>A	uc004efd.3	+	3	705	c.446G>A	c.(445-447)AGA>AAA	p.R149K	CPXCR1_uc004efc.3_Missense_Mutation_p.R149K	NM_033048	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	149						intracellular	zinc ion binding			ovary(3)	3						CATGAGATAAGAAGTATGATT	0.368													26	68	---	---	---	---	PASS
PAK3	5063	broad.mit.edu	37	X	110406215	110406215	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110406215G>C	uc004epa.2	+	6	613	c.586G>C	c.(586-588)GAA>CAA	p.E196Q	PAK3_uc010npt.1_Missense_Mutation_p.E181Q|PAK3_uc010npu.1_Missense_Mutation_p.E181Q|PAK3_uc004eoy.1_5'UTR|PAK3_uc004eoz.2_Missense_Mutation_p.E181Q|PAK3_uc011mst.1_RNA|PAK3_uc010npv.1_Missense_Mutation_p.E217Q|PAK3_uc010npw.1_Missense_Mutation_p.E202Q	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d	196	Linker.				multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						ggaagaagaagaagaagatga	0.333										TSP Lung(19;0.15)			65	176	---	---	---	---	PASS
ZCCHC16	340595	broad.mit.edu	37	X	111698017	111698017	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111698017G>C	uc004epo.1	+	3	502	c.61G>C	c.(61-63)GAG>CAG	p.E21Q		NM_001004308	NP_001004308	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	21							nucleic acid binding|zinc ion binding			ovary(1)	1						TCTTCAGGCAGAGAATCTGAT	0.498													17	273	---	---	---	---	PASS
MAP7D3	79649	broad.mit.edu	37	X	135326895	135326895	+	Missense_Mutation	SNP	G	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135326895G>C	uc004ezt.2	-	4	404	c.313C>G	c.(313-315)CAG>GAG	p.Q105E	MAP7D3_uc004ezs.2_Missense_Mutation_p.Q104E|MAP7D3_uc011mwc.1_Missense_Mutation_p.Q87E|MAP7D3_uc010nsa.1_Missense_Mutation_p.Q104E	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	105	Potential.					cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					TCCTCCATCTGTTTTTCATAT	0.378													137	100	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138714590	138714590	+	Missense_Mutation	SNP	G	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138714590G>T	uc004fau.2	-	2	369	c.75C>A	c.(73-75)CAC>CAA	p.H25Q	MCF2_uc004fav.2_Missense_Mutation_p.H25Q|MCF2_uc011mwl.1_Missense_Mutation_p.H25Q|MCF2_uc010nsh.1_Missense_Mutation_p.H25Q|MCF2_uc011mwm.1_Missense_Mutation_p.H25Q|MCF2_uc011mwn.1_Missense_Mutation_p.H170Q|MCF2_uc004faw.2_Missense_Mutation_p.H85Q|MCF2_uc011mwo.1_Missense_Mutation_p.H85Q	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	25	CRAL-TRIO.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					CCAAAACCAAGTGCAAGTTCC	0.368													14	142	---	---	---	---	PASS
FATE1	89885	broad.mit.edu	37	X	150891094	150891094	+	Intron	SNP	C	G	G			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150891094C>G	uc004fex.2	+							NM_033085	NP_149076	Q969F0	FATE1_HUMAN	fetal and adult testis expressed transcript							endoplasmic reticulum|integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TTTGACTCCTCTGCAGCTGTA	0.612													26	411	---	---	---	---	PASS
SPRY3	10251	broad.mit.edu	37	X	155003762	155003762	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155003762C>T	uc004fnq.1	+	2	683	c.229C>T	c.(229-231)CAG>TAG	p.Q77*	SPRY3_uc010nvl.1_Nonsense_Mutation_p.Q77*	NM_005840	NP_005831	O43610	SPY3_HUMAN	sprouty homolog 3	77					multicellular organismal development|regulation of signal transduction	cytoplasm|membrane					0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCCCTTGCCTCAGCATCTGAG	0.542													19	336	---	---	---	---	PASS
IL9R	3581	broad.mit.edu	37	X	155231085	155231085	+	Intron	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155231085G>A	uc004fnv.1	+						IL9R_uc010nvn.2_5'UTR|IL9R_uc004fnu.1_Silent_p.K19K	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACTGCTGCAAGAACGGACAGA	0.572													349	265	---	---	---	---	PASS
IL9R	3581	broad.mit.edu	37	X	155239720	155239720	+	Silent	SNP	G	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155239720G>A	uc004fnv.1	+	9	1391	c.1212G>A	c.(1210-1212)ACG>ACA	p.T404T	IL9R_uc004fnu.1_3'UTR	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor	404	Cytoplasmic (Potential).				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGGTACAGACGCTTGCCTATC	0.567													48	29	---	---	---	---	PASS
AGRN	375790	broad.mit.edu	37	1	985444	985444	+	Intron	DEL	G	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:985444delG	uc001ack.1	+							NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor						axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TCTCGGGGCAGGGGGGGGGGG	0.657													4	3	---	---	---	---	
MYOM3	127294	broad.mit.edu	37	1	24434717	24434718	+	Intron	INS	-	C	C	rs150317373	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24434717_24434718insC	uc001bin.3	-						MYOM3_uc001bio.2_Intron|MYOM3_uc001bip.1_Translation_Start_Site	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3											skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		CAAGGCTGCATCCCCCCGACCC	0.599													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218664195	218664196	+	IGR	INS	-	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218664195_218664196insC								TGFB2 (46236 upstream) : LYPLAL1 (682996 downstream)																							ttgcttgctttttctttccttc	0.119													4	3	---	---	---	---	
DDX1	1653	broad.mit.edu	37	2	15757227	15757227	+	Intron	DEL	T	-	-	rs67926060		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15757227delT	uc002rce.2	+						DDX1_uc010yjq.1_Intron	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1						DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		CTGTAACTCCttttttttttt	0.259													4	2	---	---	---	---	
SLC30A6	55676	broad.mit.edu	37	2	32427564	32427565	+	Intron	INS	-	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32427564_32427565insT	uc002roe.1	+						SLC30A6_uc002rof.1_Intron|SLC30A6_uc010ymw.1_Intron|SLC30A6_uc010ezr.1_Intron|SLC30A6_uc002rog.1_Intron|SLC30A6_uc010ezs.1_Intron|SLC30A6_uc002roh.1_Intron	NM_017964	NP_060434	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter),							Golgi membrane|integral to membrane	zinc ion transmembrane transporter activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					acccccgactatttttttttgt	0.000													4	2	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54855859	54855860	+	Intron	INS	-	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54855859_54855860insA	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron|SPTBN1_uc002rxx.2_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			GCGGTTTGGCCAAAAAAAAATA	0.396													4	2	---	---	---	---	
CLK1	1195	broad.mit.edu	37	2	201722365	201722366	+	Intron	DEL	AC	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201722365_201722366delAC	uc002uwe.2	-						CLK1_uc002uwd.2_Intron|CLK1_uc010zhi.1_Intron|CLK1_uc002uwf.2_Intron|CLK1_uc002uwg.2_Intron|CLK1_uc010fsv.2_Intron	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1						cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						taaaaattgtacacacttagga	0.233													4	4	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49339623	49339624	+	Intron	DEL	AA	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49339623_49339624delAA	uc003cwq.2	-						USP4_uc003cwo.2_Intron|USP4_uc003cwp.2_Intron|USP4_uc003cwr.2_Intron	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		gtctctatttaaaaaaaaaaaa	0.208													4	2	---	---	---	---	
CP	1356	broad.mit.edu	37	3	148899609	148899609	+	Intron	DEL	T	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148899609delT	uc003ewy.3	-						CP_uc011bnr.1_Intron|CP_uc003eww.3_5'Flank|CP_uc003ewx.3_Intron|CP_uc003ewz.2_Intron	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor						cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TCCTGTGGACTTTTTTTTTTA	0.443													5	4	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196288494	196288494	+	Intron	DEL	A	-	-	rs113594168		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196288494delA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		tcaattaattaaaaaaaaaaa	0.299													6	3	---	---	---	---	
DLG1	1739	broad.mit.edu	37	3	196795255	196795255	+	Intron	DEL	A	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196795255delA	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TTTCCACACCAAAAAAAAAAT	0.308													4	2	---	---	---	---	
IQCG	84223	broad.mit.edu	37	3	197671125	197671126	+	Intron	INS	-	T	T	rs112068492		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197671125_197671126insT	uc003fyo.2	-						IQCG_uc003fyp.2_Intron|IQCG_uc003fyq.3_Intron	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		ACAACTTACTCttttttttttt	0.188													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	95332244	95332245	+	IGR	INS	-	AAGG	AAGG	rs141921585	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95332244_95332245insAAGG								HPGDS (68217 upstream) : PDLIM5 (40793 downstream)																							aaagaaagaaaaaggaaggaag	0.074													4	3	---	---	---	---	
BANK1	55024	broad.mit.edu	37	4	102951572	102951572	+	Intron	DEL	T	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102951572delT	uc003hvy.3	+						BANK1_uc003hvx.3_Intron|BANK1_uc010ill.2_Intron|BANK1_uc003hvz.3_Intron	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1						B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TACTGGCTCATTTTTTTTCCA	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6571881	6571884	+	IGR	DEL	GAAG	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6571881_6571884delGAAG								UBE2QL1 (79176 upstream) : LOC255167 (10403 downstream)																							agggaggagagaaggaaggaagga	0.000													5	3	---	---	---	---	
FAM105B	90268	broad.mit.edu	37	5	14692788	14692789	+	Intron	INS	-	T	T	rs144619199		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14692788_14692789insT	uc003jfk.2	+							NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)					TGATTATCTGCttttttttttt	0.233													1	7	---	---	---	---	
RNF130	55819	broad.mit.edu	37	5	179442479	179442479	+	Intron	DEL	G	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442479delG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			gaaaggagtagggaaaggagt	0.114													5	4	---	---	---	---	
CCDC90A	63933	broad.mit.edu	37	6	13794350	13794350	+	Intron	DEL	T	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13794350delT	uc003nbd.2	-						CCDC90A_uc010jpf.2_Intron	NM_001031713	NP_001026883	Q96AQ8	CC90A_HUMAN	coiled-coil domain containing 90A precursor							integral to membrane|mitochondrion					0	Breast(50;0.0027)|Ovarian(93;0.0964)	all_hematologic(90;0.117)				TTGAGGtttcttttttttttt	0.199													2	4	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	136883493	136883493	+	Intron	DEL	T	-	-	rs11322947		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136883493delT	uc003qhc.2	-						MAP3K5_uc011edj.1_Intron	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AAAAACTGGATTTTTTTTTTT	0.169													4	2	---	---	---	---	
TCP10	6953	broad.mit.edu	37	6	167789428	167789431	+	Intron	DEL	AGTT	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167789428_167789431delAGTT	uc003qvv.1	-						TCP10_uc003qvu.2_Intron|TCP10_uc003qvw.2_3'UTR	NM_004610	NP_004601	Q12799	TCP10_HUMAN	t-complex 10							cytosol				breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GCATGGAAACAGTTAGGAGCCCTC	0.569													6	6	---	---	---	---	
C7orf50	84310	broad.mit.edu	37	7	1167118	1167118	+	Intron	DEL	A	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1167118delA	uc003sju.2	-						C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron	NM_032350	NP_115726	Q9BRJ6	CG050_HUMAN	hypothetical protein LOC84310								protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		CTCTCCCATTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142143465	142143466	+	Intron	INS	-	C	C			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142143465_142143466insC	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CCTGGCTGAGATGCCTGCAGAG	0.619													4	2	---	---	---	---	
SSPO	23145	broad.mit.edu	37	7	149515189	149515189	+	Splice_Site	DEL	A	-	-	rs112122477		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149515189delA	uc010lpk.2	+	81	11577	c.11577_splice	c.e81+2	p.E3859_splice		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GACCTCGAGTAACTGCCCCAG	0.562													7	7	---	---	---	---	
DLC1	10395	broad.mit.edu	37	8	12958414	12958416	+	Intron	DEL	TTT	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12958414_12958416delTTT	uc003wwm.2	-						DLC1_uc003wwk.1_Intron|DLC1_uc003wwl.1_Intron|DLC1_uc011kxx.1_Intron	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						AATTTTAAAGttttttttttttt	0.232													4	2	---	---	---	---	
ASPH	444	broad.mit.edu	37	8	62437929	62437930	+	Intron	DEL	AT	-	-	rs71992492		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62437929_62437930delAT	uc003xuj.2	-						ASPH_uc011leg.1_Intron	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	acacacacacatacacacacGC	0.307													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	94968105	94968105	+	IGR	DEL	T	-	-	rs76646378		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94968105delT								CYP26A1 (130464 upstream) : MYOF (98082 downstream)																							taattttgtctttttttttta	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33808897	33808897	+	IGR	DEL	T	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33808897delT								FBXO3 (12826 upstream) : LMO2 (71228 downstream)																							GCTCGGCAAGTTTTTCTTTGT	0.423													20	12	---	---	---	---	
DHCR7	1717	broad.mit.edu	37	11	71146249	71146260	+	3'UTR	DEL	AGCAAGGAACAG	-	-	rs72112762		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71146249_71146260delAGCAAGGAACAG	uc001oqk.2	-	9					DHCR7_uc001oql.2_3'UTR	NM_001163817	NP_001157289	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase						cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|nuclear outer membrane	7-dehydrocholesterol reductase activity|protein binding			ovary(1)|liver(1)	2					NADH(DB00157)	TGAAGGCAAAAGCAAGGAACAGAGCGTGATTA	0.443									Smith-Lemli-Opitz_syndrome				3	4	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892815	76892816	+	Intron	INS	-	TTG	TTG			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892815_76892816insTTG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CTTCTCAAGtttttttttttgt	0.297													3	3	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178448	134178450	+	Intron	DEL	CAT	-	-	rs140914654	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178448_134178450delCAT	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		tcaccatcaccatcaccaccacc	0.000													1	5	---	---	---	---	
ZCCHC8	55596	broad.mit.edu	37	12	122962859	122962860	+	Intron	INS	-	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122962859_122962860insA	uc001ucn.2	-						ZCCHC8_uc001ucl.2_5'UTR|ZCCHC8_uc001ucm.2_Intron|ZCCHC8_uc009zxp.2_Intron|ZCCHC8_uc009zxq.2_Intron	NM_017612	NP_060082	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8							catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		AAAAGAGAAGGAAAAAAAAAAC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21622710	21622711	+	IGR	DEL	GA	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21622710_21622711delGA								ZNF219 (49847 upstream) : OR5AU1 (386 downstream)																							ctcgggggtggagagagagaga	0.020													4	2	---	---	---	---	
DLGAP5	9787	broad.mit.edu	37	14	55643694	55643695	+	Intron	INS	-	A	A	rs34109336		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55643694_55643695insA	uc001xbs.2	-						DLGAP5_uc001xbt.2_Intron	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a						cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						aactccgtctgaaaaaaaaaaa	0.104													18	9	---	---	---	---	
ACOT4	122970	broad.mit.edu	37	14	74060211	74060211	+	Intron	DEL	A	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74060211delA	uc001xoo.2	+							NM_152331	NP_689544	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4						acyl-CoA metabolic process|dicarboxylic acid metabolic process|long-chain fatty acid metabolic process|saturated monocarboxylic acid metabolic process|short-chain fatty acid metabolic process|succinyl-CoA metabolic process|unsaturated monocarboxylic acid metabolic process|very long-chain fatty acid metabolic process	peroxisome	carboxylesterase activity|palmitoyl-CoA hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)		ctgactaattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107012244	107012245	+	Intron	INS	-	TCTT	TCTT	rs144569068	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107012244_107012245insTCTT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						tccttcctctctctttctctct	0.000													5	3	---	---	---	---	
CA12	771	broad.mit.edu	37	15	63668011	63668011	+	Intron	DEL	T	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63668011delT	uc002amc.2	-						CA12_uc002amd.2_Intron|CA12_uc002ame.2_Intron	NM_001218	NP_001209	O43570	CAH12_HUMAN	carbonic anhydrase XII isoform 1 precursor						one-carbon metabolic process	integral to membrane	carbonate dehydratase activity|zinc ion binding			ovary(1)	1					Acetazolamide(DB00819)	tttctttttcttttttttttt	0.164													4	2	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81730396	81730397	+	Intron	INS	-	A	A	rs151182692	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81730396_81730397insA	uc002fgp.2	+						CMIP_uc002fgq.1_Intron|CMIP_uc010vnq.1_Intron|CMIP_uc002fgr.1_Intron|CMIP_uc010vnr.1_3'UTR	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						AACACAGTGCTGATCATGAAgg	0.351													4	4	---	---	---	---	
CALCOCO2	10241	broad.mit.edu	37	17	46928280	46928281	+	Intron	DEL	AA	-	-	rs10553497		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46928280_46928281delAA	uc002iof.2	+						CALCOCO2_uc010wlp.1_Intron|CALCOCO2_uc010wlq.1_Intron|CALCOCO2_uc010wlr.1_Intron|CALCOCO2_uc010wls.1_Intron	NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2						response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1						acactgtcttaaaaaaaaaaaa	0.010													6	3	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71397914	71397915	+	Intron	INS	-	C	C	rs140071991	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71397914_71397915insC	uc010dfm.2	-						SDK2_uc002jjt.3_Intron|SDK2_uc010dfn.2_Intron	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						AGGAACCCCCACCCCCCAAGGC	0.609													3	4	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3169070	3169071	+	Intron	INS	-	A	A	rs140809501	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3169070_3169071insA	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GCAGTCACAGCAAAAAAAAAAT	0.307													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3581662	3581663	+	Intron	INS	-	A	A			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3581662_3581663insA	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				TTCTCACCATGaaaaaaaaaaa	0.381													4	4	---	---	---	---	
BCL2	596	broad.mit.edu	37	18	60795697	60795698	+	3'UTR	DEL	TG	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60795697_60795698delTG	uc002lit.1	-	3					BCL2_uc002liu.1_3'UTR	NM_000633	NP_000624	P10415	BCL2_HUMAN	B-cell lymphoma protein 2 alpha isoform						activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)	TGTTAATTGTtgtgtgtgtgtg	0.213			T	IGH@	NHL|CLL								4	2	---	---	---	---	
MKNK2	2872	broad.mit.edu	37	19	2037631	2037631	+	3'UTR	DEL	T	-	-	rs71737199		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2037631delT	uc002lus.2	-	14					MKNK2_uc002luq.1_3'UTR|MKNK2_uc010xgu.1_3'UTR|MKNK2_uc010xgv.1_3'UTR|MKNK2_uc002lur.2_3'UTR|MKNK2_uc002lut.1_3'UTR	NM_199054	NP_951009	Q9HBH9	MKNK2_HUMAN	MAP kinase-interacting serine/threonine kinase 2						cell surface receptor linked signaling pathway|intracellular protein kinase cascade|regulation of translation		ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(1)|breast(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTTTTGAGGTTTTTTTTTTT	0.438													4	2	---	---	---	---	
ANO8	57719	broad.mit.edu	37	19	17434120	17434121	+	3'UTR	INS	-	TGTGTG	TGTGTG	rs141546754	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17434120_17434121insTGTGTG	uc002ngf.2	-	18					ANO8_uc010eap.2_RNA	NM_020959	NP_066010	Q9HCE9	ANO8_HUMAN	anoctamin 8							chloride channel complex	chloride channel activity			ovary(3)	3						ATCGCCTGTTCtgtgtgtgtgt	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	39727753	39727754	+	IGR	DEL	GA	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39727753_39727754delGA								SYCN (32847 upstream) : IL28B (6519 downstream)																							caggtgtggggagaggagagag	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25900372	25900372	+	IGR	DEL	A	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25900372delA								FAM182B (51586 upstream) : LOC100134868 (90063 downstream)																							AGTTTGTCAGaaaaaaaaaaa	0.264													10	6	---	---	---	---	
DPM1	8813	broad.mit.edu	37	20	49565355	49565355	+	Intron	DEL	A	-	-	rs76899294		TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49565355delA	uc002xvw.1	-						DPM1_uc002xvv.1_5'Flank|DPM1_uc002xvx.1_Intron	NM_003859	NP_003850	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase 1						C-terminal protein lipidation|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|protein N-linked glycosylation via asparagine|protein O-linked mannosylation	dolichol-phosphate-mannose synthase complex|endoplasmic reticulum membrane|membrane fraction	dolichyl-phosphate beta-D-mannosyltransferase activity|dolichyl-phosphate-mannose-protein mannosyltransferase activity|protein binding			ovary(1)	1						TTGCCAAAAGAAAAAAAAAAG	0.189													3	7	---	---	---	---	
CABLES2	81928	broad.mit.edu	37	20	60972983	60972984	+	Intron	INS	-	GGTGGTGGTGATGGC	GGTGGTGGTGATGGC	rs146308567	by1000genomes	TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60972983_60972984insGGTGGTGGTGATGGC	uc002ycv.2	-							NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			gtggtgatggtggtggtggtga	0.168													4	3	---	---	---	---	
IFNGR2	3460	broad.mit.edu	37	21	34804527	34804528	+	Frame_Shift_Ins	INS	-	AA	AA			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34804527_34804528insAA	uc002yrp.3	+	5	1253_1254	c.605_606insAA	c.(604-606)TTAfs	p.L202fs	IFNGR2_uc002yrq.3_Frame_Shift_Ins_p.L221fs|IFNGR2_uc010gma.2_Frame_Shift_Ins_p.L123fs|IFNGR2_uc002yrr.3_Frame_Shift_Ins_p.L123fs	NM_005534	NP_005525	P38484	INGR2_HUMAN	interferon gamma receptor 2 precursor	202	Extracellular (Potential).|Fibronectin type-III 2.				regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity				0					Interferon gamma-1b(DB00033)	TTGGATAACTTAAAACCCTCCA	0.406													65	50	---	---	---	---	
FAM109B	150368	broad.mit.edu	37	22	42472305	42472306	+	Intron	INS	-	T	T			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42472305_42472306insT	uc003bbz.2	+							NM_001002034	NP_001002034	Q6ICB4	SESQ2_HUMAN	hypothetical protein LOC150368						endosome organization|receptor recycling|retrograde transport, endosome to Golgi	clathrin-coated vesicle|early endosome|recycling endosome|trans-Golgi network	protein homodimerization activity				0						aatgttatttcttttttttttt	0.000													6	3	---	---	---	---	
PFKFB1	5207	broad.mit.edu	37	X	54972135	54972136	+	Intron	DEL	GT	-	-			TCGA-BI-A0VS-01	TCGA-BI-A0VS-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54972135_54972136delGT	uc004dty.1	-						PFKFB1_uc010nkd.1_Intron|PFKFB1_uc011mol.1_Intron	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,						energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						gtgtgtatgcgtgtgtgtgtgt	0.322													4	3	---	---	---	---	
