Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CDK11B	984	broad.mit.edu	37	1	1573169	1573169	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1573169G>C	uc001agv.1	-	17	1530	c.1419C>G	c.(1417-1419)ATC>ATG	p.I473M	CDK11B_uc009vkj.2_Missense_Mutation_p.I130M|CDK11B_uc001ags.1_Missense_Mutation_p.I331M|CDK11B_uc001agt.1_Missense_Mutation_p.I256M|CDK11B_uc001aha.1_Missense_Mutation_p.I439M|CDK11B_uc001agw.1_Missense_Mutation_p.I428M|CDK11B_uc001agy.1_Missense_Mutation_p.I471M|CDK11B_uc001agx.1_Missense_Mutation_p.I462M|CDK11B_uc001agz.1_Missense_Mutation_p.I217M	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)	486	Protein kinase.				apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						GGATGGTGTTGATCTCCCTCA	0.567													7	314	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11575415	11575415	+	Intron	SNP	A	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11575415A>G	uc001ash.3	+						PTCHD2_uc001asi.1_Intron	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2						cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGTGTCTCTTACCCTGCCCAG	0.582													3	67	---	---	---	---	PASS
LOC649330	649330	broad.mit.edu	37	1	12907428	12907428	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12907428C>T	uc009vno.2	-	1	810	c.715G>A	c.(715-717)GAG>AAG	p.E239K	HNRNPCL1_uc010obf.1_Missense_Mutation_p.E239K	NM_001146181	NP_001139653	B7ZW38	B7ZW38_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	239							nucleic acid binding|nucleotide binding				0						CCCTCAGACTCCATCTTCACA	0.488													19	125	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16258943	16258943	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16258943G>A	uc001axk.1	+	11	6412	c.6208G>A	c.(6208-6210)GAA>AAA	p.E2070K	SPEN_uc010obp.1_Missense_Mutation_p.E2029K	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2070					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ACCGGCCCCTGAAAAAAACTC	0.478													5	131	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16259282	16259282	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16259282G>A	uc001axk.1	+	11	6751	c.6547G>A	c.(6547-6549)GAG>AAG	p.E2183K	SPEN_uc010obp.1_Missense_Mutation_p.E2142K	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2183	Interaction with MSX2 (By similarity).				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAAGCTCGCTGAGGCCTCTGC	0.602													5	101	---	---	---	---	PASS
RAP1GAP	5909	broad.mit.edu	37	1	21934836	21934836	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21934836G>A	uc001bex.2	-	17	1424	c.1166C>T	c.(1165-1167)ACG>ATG	p.T389M	RAP1GAP_uc001bev.2_Missense_Mutation_p.T389M|RAP1GAP_uc001bew.2_Missense_Mutation_p.T453M|RAP1GAP_uc001bey.2_Missense_Mutation_p.T389M	NM_002885	NP_002876	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein isoform c	389	Rap-GAP.				regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GGCGGCCCGCGTCCGCTCCTG	0.647													13	34	---	---	---	---	PASS
ZMPSTE24	10269	broad.mit.edu	37	1	40737653	40737653	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40737653G>C	uc001cfg.2	+	6	926	c.715G>C	c.(715-717)GAA>CAA	p.E239Q		NM_005857	NP_005848	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	239						endoplasmic reticulum membrane|Golgi membrane|integral to membrane	metal ion binding|metalloexopeptidase activity				0	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			AGAAGAAATTGAAGTAATGGC	0.373													10	154	---	---	---	---	PASS
STIL	6491	broad.mit.edu	37	1	47748081	47748081	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47748081G>C	uc001crc.1	-	11	1339	c.1184C>G	c.(1183-1185)TCT>TGT	p.S395C	TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Missense_Mutation_p.S348C|STIL_uc010omo.1_Missense_Mutation_p.S395C|STIL_uc001crd.1_Missense_Mutation_p.S395C|STIL_uc001cre.1_Missense_Mutation_p.S395C|STIL_uc001crf.1_Missense_Mutation_p.S8C|STIL_uc001crg.1_Missense_Mutation_p.S348C	NM_003035	NP_003026	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus isoform 2	395					cell proliferation|multicellular organismal development	centrosome|cytosol				lung(2)|skin(1)	3		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				TTCAACACCAGAGTCGTGATC	0.398													25	131	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51912653	51912653	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51912653G>C	uc001csq.1	-	10	868	c.776C>G	c.(775-777)TCT>TGT	p.S259C	EPS15_uc009vyz.1_Missense_Mutation_p.S259C	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway	259	EH 3.				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						TAGTAAGGTAGAAGGTAAACC	0.313			T	MLL	ALL								14	54	---	---	---	---	PASS
AK5	26289	broad.mit.edu	37	1	77759657	77759657	+	Intron	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77759657G>A	uc001dhn.2	+						AK5_uc001dho.2_Intron|AK5_uc001dhm.1_Intron	NM_174858	NP_777283	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1						TATGAGGACAGAAAGCAAAAA	0.353													3	33	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144931678	144931678	+	Intron	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144931678C>G	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Missense_Mutation_p.E11Q|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCACACAGCTCTCGGGCACAG	0.622			T	PDGFRB	MPD								6	79	---	---	---	---	PASS
PI4KB	5298	broad.mit.edu	37	1	151298666	151298666	+	Intron	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151298666C>T	uc001ext.2	-						PI4KB_uc001exr.2_Translation_Start_Site|PI4KB_uc001exs.2_Translation_Start_Site|PI4KB_uc001exu.2_Intron|PI4KB_uc010pcw.1_Intron|PI4KB_uc009wmq.1_Translation_Start_Site	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	catalytic phosphatidylinositol 4-kinase beta						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(2)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCAATTTCCACGCAGGCCTGT	0.433													23	98	---	---	---	---	PASS
CGN	57530	broad.mit.edu	37	1	151504881	151504881	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151504881G>C	uc009wmw.2	+	14	2719	c.2575G>C	c.(2575-2577)GAG>CAG	p.E859Q	CGN_uc010pde.1_5'Flank	NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	853	Potential.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GTTTCAGTTGGAGAAGATCGG	0.567													4	182	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155450754	155450754	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155450754G>C	uc009wqq.2	-	3	2387	c.1907C>G	c.(1906-1908)TCA>TGA	p.S636*	ASH1L_uc001fkt.2_Nonsense_Mutation_p.S636*|ASH1L_uc009wqr.1_Nonsense_Mutation_p.S636*	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	636					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGTAGTTTTTGAATCATTTAC	0.353													6	132	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155451111	155451111	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155451111G>A	uc009wqq.2	-	3	2030	c.1550C>T	c.(1549-1551)TCA>TTA	p.S517L	ASH1L_uc001fkt.2_Missense_Mutation_p.S517L|ASH1L_uc009wqr.1_Missense_Mutation_p.S517L	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	517					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TTCATGCTTTGAGGTTTCATA	0.393													5	92	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155451123	155451123	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155451123G>A	uc009wqq.2	-	3	2018	c.1538C>T	c.(1537-1539)TCT>TTT	p.S513F	ASH1L_uc001fkt.2_Missense_Mutation_p.S513F|ASH1L_uc009wqr.1_Missense_Mutation_p.S513F	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	513					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGTTTCATAAGATCCCTTTTC	0.388													7	88	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155796641	155796641	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155796641G>A	uc001flz.2	-	3	781	c.684C>T	c.(682-684)CTC>CTT	p.L228L	GON4L_uc001fly.1_Silent_p.L228L|GON4L_uc009wrh.1_Silent_p.L228L|GON4L_uc001fma.1_Silent_p.L228L|GON4L_uc001fmc.2_Silent_p.L228L|GON4L_uc001fmd.3_Silent_p.L228L|GON4L_uc009wri.2_5'UTR|GON4L_uc001fme.2_Silent_p.L56L	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	228					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TTGGAATGAAGAGTCCACCAT	0.308													4	191	---	---	---	---	PASS
OR6K6	128371	broad.mit.edu	37	1	158724897	158724897	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158724897G>C	uc001fsw.1	+	1	292	c.292G>C	c.(292-294)GAG>CAG	p.E98Q		NM_001005184	NP_001005184	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K,	98	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_hematologic(112;0.0378)					CTCCTTCCTGGAGATCTGCTA	0.483													8	185	---	---	---	---	PASS
POU2F1	5451	broad.mit.edu	37	1	167334739	167334739	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167334739C>A	uc001gec.2	+	4	256	c.94C>A	c.(94-96)CCT>ACT	p.P32T	POU2F1_uc010plg.1_RNA|POU2F1_uc001ged.2_Missense_Mutation_p.P30T|POU2F1_uc001gee.2_Missense_Mutation_p.P32T|POU2F1_uc010plh.1_Missense_Mutation_p.P32T|POU2F1_uc001gef.2_Missense_Mutation_p.P44T	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1	32					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						TCAGAAGCAGCCTGTGCCTGT	0.428													10	128	---	---	---	---	PASS
C1orf14	81626	broad.mit.edu	37	1	182908672	182908672	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182908672G>C	uc001gpu.2	-	4	1072	c.787C>G	c.(787-789)CTT>GTT	p.L263V	C1orf14_uc001gpv.2_Missense_Mutation_p.L144V|C1orf14_uc010pnz.1_Missense_Mutation_p.L121V|C1orf14_uc001gpw.2_5'UTR	NM_030933	NP_112195	Q9BZQ2	SHP1L_HUMAN	chromosome 1 open reading frame 14	335											0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)		TCTCTCCAAAGAAAGTCATAA	0.308													20	21	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200571167	200571167	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200571167G>C	uc010ppk.1	-	11	2448	c.2009C>G	c.(2008-2010)TCA>TGA	p.S670*	KIF14_uc010ppj.1_Nonsense_Mutation_p.S179*	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	670					microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						TGCAGTTTTTGAATTTCCACC	0.358													4	52	---	---	---	---	PASS
OPTC	26254	broad.mit.edu	37	1	203465362	203465362	+	Missense_Mutation	SNP	G	A	A	rs140125203		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203465362G>A	uc001gzu.1	+	2	345	c.229G>A	c.(229-231)GAG>AAG	p.E77K		NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	opticin precursor	77						proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.109)			CCAACTCCCCGAGGTGAGGGA	0.562													5	72	---	---	---	---	PASS
ELK4	2005	broad.mit.edu	37	1	205589548	205589548	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205589548G>C	uc001hcy.1	-	3	1876	c.626C>G	c.(625-627)TCA>TGA	p.S209*	ELK4_uc001hcz.2_Nonsense_Mutation_p.S209*	NM_001973	NP_001964	P28324	ELK4_HUMAN	ELK4 protein isoform a	209						cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity				0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			TGGGCCAATTGAAATGGTGGC	0.483			T	SLC45A3	prostate								13	89	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685274	248685274	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685274G>A	uc001ien.1	+	1	327	c.327G>A	c.(325-327)TCG>TCA	p.S109S		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGTTGGGCTCGTCTGAGTGTA	0.547													9	106	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20114036	20114036	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20114036G>A	uc002rdi.2	-	27	3265	c.3157C>T	c.(3157-3159)CTT>TTT	p.L1053F	WDR35_uc002rdj.2_Missense_Mutation_p.L1042F|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	1053										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCAGGTGAAGAGCTAAGAAA	0.393													5	128	---	---	---	---	PASS
SLC4A1AP	22950	broad.mit.edu	37	2	27892132	27892132	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27892132C>G	uc002rlk.3	+	5	1505	c.1223C>G	c.(1222-1224)TCA>TGA	p.S408*		NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),	408						cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)					GTGGACGATTCAACTGGAAAA	0.398													82	324	---	---	---	---	PASS
CAPN13	92291	broad.mit.edu	37	2	30974126	30974126	+	Intron	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30974126G>C	uc002rnn.2	-						CAPN13_uc002rnp.1_Intron	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TCCTGCATCAGAAAGAGCTGT	0.458													3	16	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37259808	37259808	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37259808C>T	uc002rpp.1	-	22	3421	c.3325G>A	c.(3325-3327)GCA>ACA	p.A1109T		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1109							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				GTATTTTTTGCCAGGCTCATG	0.393													4	144	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43919764	43919764	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43919764G>A	uc010yny.1	+	4	381	c.298G>A	c.(298-300)GAC>AAC	p.D100N	PLEKHH2_uc002rte.3_Missense_Mutation_p.D100N|PLEKHH2_uc002rtf.3_Missense_Mutation_p.D100N	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	100	Potential.					cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GGAAAAAGATGACGTCATTCA	0.343													9	116	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55561412	55561412	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55561412C>G	uc002ryv.2	-	15	3387	c.2545G>C	c.(2545-2547)GAT>CAT	p.D849H	CCDC88A_uc010yoz.1_Missense_Mutation_p.D849H|CCDC88A_uc010ypa.1_Missense_Mutation_p.D849H|CCDC88A_uc010ypb.1_Missense_Mutation_p.D751H|CCDC88A_uc002ryu.2_Missense_Mutation_p.D132H|CCDC88A_uc002ryw.2_Missense_Mutation_p.D132H	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	849	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						AATGTGGTATCTTTAATTTCT	0.313													8	66	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55561454	55561454	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55561454C>T	uc002ryv.2	-	15	3345	c.2503G>A	c.(2503-2505)GAG>AAG	p.E835K	CCDC88A_uc010yoz.1_Missense_Mutation_p.E835K|CCDC88A_uc010ypa.1_Missense_Mutation_p.E835K|CCDC88A_uc010ypb.1_Missense_Mutation_p.E737K|CCDC88A_uc002ryu.2_Missense_Mutation_p.E118K|CCDC88A_uc002ryw.2_Missense_Mutation_p.E118K	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	835	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						TTTTCCTTCTCCAATTGTTTC	0.308													8	88	---	---	---	---	PASS
C2orf86	51057	broad.mit.edu	37	2	63401965	63401965	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63401965G>A	uc002sch.2	-	15	2364	c.1918C>T	c.(1918-1920)CTC>TTC	p.L640F	C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Missense_Mutation_p.L481F|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Missense_Mutation_p.L448F	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	640					cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						GGTCCCAGGAGTTCTGTTGAA	0.398													12	34	---	---	---	---	PASS
C2orf40	84417	broad.mit.edu	37	2	106694362	106694362	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106694362G>A	uc010fjf.2	+	4	535	c.427G>A	c.(427-429)GTC>ATC	p.V143I		NM_032411	NP_115787	Q9H1Z8	AUGN_HUMAN	esophageal cancer related gene 4 protein	143						extracellular region|transport vesicle					0						TGGAGCCAGCGTCAACTACGA	0.458													7	44	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112596020	112596020	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112596020C>T	uc002thi.2	-	18	2357	c.2110G>A	c.(2110-2112)GAT>AAT	p.D704N		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	704					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						CTTACATCATCAGATCCAGTC	0.338													7	77	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112766024	112766024	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112766024C>G	uc002thk.1	+	14	2054	c.1932C>G	c.(1930-1932)TTC>TTG	p.F644L	MERTK_uc002thl.1_Missense_Mutation_p.F468L	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	644	Protein kinase.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						TGAAAGACTTCAGCCACCCAA	0.473													6	54	---	---	---	---	PASS
INHBB	3625	broad.mit.edu	37	2	121107168	121107168	+	Silent	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121107168C>G	uc002tmn.2	+	2	988	c.942C>G	c.(940-942)CTC>CTG	p.L314L		NM_002193	NP_002184	P09529	INHBB_HUMAN	inhibin beta B subunit preproprotein	314					activin receptor signaling pathway|cellular response to insulin stimulus|cellular response to starvation|defense response|fat cell differentiation|growth|negative regulation of follicle-stimulating hormone secretion|negative regulation of hepatocyte growth factor biosynthetic process|negative regulation of insulin secretion|ovarian follicle development|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation	extracellular region|perinuclear region of cytoplasm	cytokine activity|growth factor activity|hormone activity|host cell surface receptor binding|protein homodimerization activity			pancreas(2)|skin(1)	3		Prostate(154;0.122)				ACTTCCGCCTCATCGGCTGGA	0.632													25	73	---	---	---	---	PASS
PRPF40A	55660	broad.mit.edu	37	2	153515691	153515691	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153515691C>T	uc002tyh.3	-	23	2444	c.2422G>A	c.(2422-2424)GAT>AAT	p.D808N	PRPF40A_uc002tyg.3_Missense_Mutation_p.D264N|PRPF40A_uc010zcd.1_Missense_Mutation_p.D759N	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	835					mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TCATCATCATCTGAATCTGAC	0.353													4	28	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158167780	158167780	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158167780C>G	uc002tzg.2	+	10	2998	c.2743C>G	c.(2743-2745)CAA>GAA	p.Q915E	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	915	Lumenal (Potential).|Ricin B-type lectin.				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						AAATTTTTCTCAAAAGATCCT	0.368													3	23	---	---	---	---	PASS
PDK1	5163	broad.mit.edu	37	2	173429744	173429744	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173429744C>G	uc002uhr.2	+	5	734	c.634C>G	c.(634-636)CAT>GAT	p.H212D	PDK1_uc010zdz.1_Missense_Mutation_p.H57D|PDK1_uc010zea.1_RNA|PDK1_uc002uhq.1_Missense_Mutation_p.H232D|PDK1_uc002uhs.2_Missense_Mutation_p.H212D|PDK1_uc010zeb.1_Missense_Mutation_p.H232D	NM_002610	NP_002601	Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase 1 precursor	212	Histidine kinase.				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)			AAGTCCATCTCATCGAAAACA	0.328									Autosomal_Dominant_Polycystic_Kidney_Disease				10	177	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179638218	179638218	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179638218A>T	uc010zfg.1	-	32	7789	c.7565T>A	c.(7564-7566)GTT>GAT	p.V2522D	TTN_uc010zfh.1_Missense_Mutation_p.V2476D|TTN_uc010zfi.1_Missense_Mutation_p.V2476D|TTN_uc010zfj.1_Missense_Mutation_p.V2476D|TTN_uc002unb.2_Missense_Mutation_p.V2522D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2522							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTGGTTTCAACTCTGCCAAC	0.393													9	39	---	---	---	---	PASS
NAB1	4664	broad.mit.edu	37	2	191552003	191552003	+	Silent	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191552003G>C	uc002usb.2	+	9	1907	c.1335G>C	c.(1333-1335)CTG>CTC	p.L445L	NAB1_uc010fsc.2_Silent_p.L445L|NAB1_uc010fsd.2_Silent_p.L444L|NAB1_uc002usc.2_Silent_p.L444L|NAB1_uc010zgh.1_Silent_p.L415L	NM_005966	NP_005957	Q13506	NAB1_HUMAN	NGFI-A binding protein 1	445					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			ATGGGGAGCTGAGCAGACTTT	0.403													7	29	---	---	---	---	PASS
SUMO1	7341	broad.mit.edu	37	2	203084832	203084832	+	Intron	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203084832G>C	uc002uyz.1	-						SUMO1_uc002uza.1_Intron	NM_001005781	NP_001005781	P63165	SUMO1_HUMAN	SMT3 suppressor of mif two 3 homolog 1 isoform a						DNA repair|interferon-gamma-mediated signaling pathway|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|palate development|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein complex assembly|protein sumoylation|regulation of interferon-gamma-mediated signaling pathway|regulation of protein localization	cytoplasm|nuclear membrane|nuclear pore|nuclear speck	ubiquitin protein ligase binding				0						TTTGCCTCCTGAAAGAAAATT	0.343													4	330	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215876718	215876718	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215876718G>A	uc002vew.2	-	16	2318	c.2098C>T	c.(2098-2100)CCC>TCC	p.P700S	ABCA12_uc002vev.2_Missense_Mutation_p.P382S|ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	700					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ACACTTCTGGGCAGATGCATT	0.408													55	187	---	---	---	---	PASS
NCL	4691	broad.mit.edu	37	2	232325126	232325126	+	Intron	SNP	T	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232325126T>C	uc002vru.2	-						SNORD82_uc010fxw.1_RNA	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CAGTATTAAGTCCCTTTGTTA	0.388													52	217	---	---	---	---	PASS
DIS3L2	129563	broad.mit.edu	37	2	232952241	232952241	+	Silent	SNP	T	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232952241T>C	uc010fxz.2	+	6	687	c.411T>C	c.(409-411)TAT>TAC	p.Y137Y	DIS3L2_uc002vsm.3_RNA|DIS3L2_uc002vsn.1_Silent_p.Y137Y|DIS3L2_uc002vso.2_RNA	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.	137							exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		AAGCTGCGTATGAATCAGATA	0.413													6	43	---	---	---	---	PASS
EPM2AIP1	9852	broad.mit.edu	37	3	37034156	37034156	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37034156C>G	uc003cgk.2	-	1	640	c.413G>C	c.(412-414)AGC>ACC	p.S138T	MLH1_uc011aye.1_5'Flank|MLH1_uc003cgl.2_5'Flank|MLH1_uc011ayb.1_5'Flank|MLH1_uc010hge.2_5'Flank|MLH1_uc003cgn.3_5'Flank|MLH1_uc011ayc.1_5'Flank|MLH1_uc011ayd.1_5'Flank|MLH1_uc003cgo.2_5'Flank	NM_014805	NP_055620	Q7L775	EPMIP_HUMAN	EPM2A interacting protein 1	138						endoplasmic reticulum					0						TTGCAGGACGCTTACATGCTC	0.552													5	158	---	---	---	---	PASS
MYRIP	25924	broad.mit.edu	37	3	40192620	40192620	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40192620G>A	uc003cka.2	+	4	549	c.414G>A	c.(412-414)CTG>CTA	p.L138L	MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Silent_p.L138L|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Silent_p.L138L|MYRIP_uc011ayz.1_5'UTR	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	138					intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CCAAGGTTCTGAAGAACCTGT	0.532													3	20	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49939970	49939970	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49939970G>C	uc003cxy.3	-	1	1337	c.1073C>G	c.(1072-1074)CCT>CGT	p.P358R	MST1R_uc011bdd.1_Missense_Mutation_p.P358R|MST1R_uc011bde.1_Missense_Mutation_p.P358R|MST1R_uc011bdf.1_Missense_Mutation_p.P358R|MST1R_uc011bdg.1_Missense_Mutation_p.P358R	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	358	Extracellular (Potential).|Sema.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		GCCCACGCCAGGACCACCATC	0.582													14	287	---	---	---	---	PASS
ZMYND10	51364	broad.mit.edu	37	3	50380833	50380833	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50380833C>G	uc003dag.1	-	5	561	c.415G>C	c.(415-417)GAC>CAC	p.D139H	RASSF1_uc003dad.1_5'Flank|RASSF1_uc003dae.1_5'Flank|RASSF1_uc010hlk.1_5'Flank|RASSF1_uc003daf.1_5'Flank|RASSF1_uc011bdq.1_5'Flank|ZMYND10_uc010hll.1_Missense_Mutation_p.D139H|ZMYND10_uc003dah.1_Missense_Mutation_p.D60H|ZMYND10_uc010hlm.1_Missense_Mutation_p.D96H	NM_015896	NP_056980	O75800	ZMY10_HUMAN	zinc finger, MYND domain-containing 10	139						cytoplasm	protein binding|zinc ion binding			lung(4)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TGGCAATAGTCTACCAAGTCC	0.582										TSP Lung(30;0.18)			12	127	---	---	---	---	PASS
ABHD14B	84836	broad.mit.edu	37	3	52003448	52003448	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52003448G>A	uc003dcm.2	-	4	1515	c.627C>T	c.(625-627)CTC>CTT	p.L209L	PCBP4_uc003dch.1_5'Flank|PCBP4_uc003dci.1_5'Flank|PCBP4_uc003dcj.1_5'Flank|PCBP4_uc003dck.1_5'Flank|ABHD14B_uc010hly.2_Silent_p.L113L|ABHD14B_uc011bdy.1_Silent_p.L209L|ABHD14B_uc003dcn.2_Silent_p.L209L|ABHD14B_uc011bdz.1_3'UTR	NM_032750	NP_116139	Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	209						cytoplasm|nucleus	hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		GGCTTCACTGGAGCCCCTGCA	0.627													25	130	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65342183	65342183	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65342183C>G	uc003dmn.2	-	23	4785	c.4259G>C	c.(4258-4260)AGA>ACA	p.R1420T	MAGI1_uc003dmm.2_3'UTR	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	1449					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TCTGTCCTCTCTGTTCCTTTT	0.647													22	158	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121410567	121410567	+	Silent	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121410567C>G	uc003eei.3	-	14	7755	c.7629G>C	c.(7627-7629)GTG>GTC	p.V2543V	GOLGB1_uc010hrc.2_Silent_p.V2548V|GOLGB1_uc003eej.3_Silent_p.V2509V	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2543	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TTATTGTTATCACTTGGTTCA	0.368													6	313	---	---	---	---	PASS
ADCY5	111	broad.mit.edu	37	3	123046604	123046604	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123046604C>T	uc003egh.1	-	7	1808	c.1808G>A	c.(1807-1809)CGC>CAC	p.R603H	ADCY5_uc003egg.1_Missense_Mutation_p.R236H|ADCY5_uc003egi.1_Missense_Mutation_p.R162H	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	603	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		GATGTGGATGCGTCTACAGGG	0.557													15	88	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126707774	126707774	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126707774A>G	uc003ejg.2	+	1	273	c.269A>G	c.(268-270)AAC>AGC	p.N90S		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	113	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		AGTACTGACAACGTCAACAAG	0.667													9	55	---	---	---	---	PASS
COPG	22820	broad.mit.edu	37	3	128971139	128971139	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128971139G>A	uc003els.2	+	3	206	c.106G>A	c.(106-108)GAA>AAA	p.E36K	COPG_uc010htb.2_5'UTR	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1	36					COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						TGTATTTAATGAAACTCCCAT	0.433													20	153	---	---	---	---	PASS
C3orf72	401089	broad.mit.edu	37	3	138668373	138668373	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138668373C>T	uc003esx.1	+	2	243	c.112C>T	c.(112-114)CTG>TTG	p.L38L	FOXL2_uc003esw.2_5'Flank|C3orf72_uc011bmr.1_5'UTR	NM_001040061	NP_001035150	Q6ZUU3	CC072_HUMAN	chromosome 3 open reading frame 72	38											0						ATCCCCAGCCCTGGTGAAGAA	0.507													3	70	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170198523	170198523	+	Missense_Mutation	SNP	C	G	G	rs115446306	byFrequency	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170198523C>G	uc003fgz.2	-	7	1864	c.1548G>C	c.(1546-1548)ATG>ATC	p.M516I	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	516						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TGCCTGTGGTCATGTCCACGG	0.458													31	261	---	---	---	---	PASS
TP63	8626	broad.mit.edu	37	3	189586483	189586483	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189586483G>C	uc003fry.2	+	8	1196	c.1107G>C	c.(1105-1107)AAG>AAC	p.K369N	TP63_uc003frx.2_Missense_Mutation_p.K369N|TP63_uc003frz.2_Missense_Mutation_p.K369N|TP63_uc010hzc.1_Missense_Mutation_p.K369N|TP63_uc003fsa.2_Missense_Mutation_p.K275N|TP63_uc003fsb.2_Missense_Mutation_p.K275N|TP63_uc003fsc.2_Missense_Mutation_p.K275N|TP63_uc003fsd.2_Missense_Mutation_p.K275N|TP63_uc010hzd.1_Missense_Mutation_p.K190N|TP63_uc003fse.1_Missense_Mutation_p.K250N	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	369	Interaction with HIPK2.				anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		ACAGTACAAAGAACGGTGATG	0.517									Hay-Wells_syndrome	HNSCC(45;0.13)			3	79	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193272576	193272576	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193272576C>G	uc003ftd.2	-	1	121	c.13G>C	c.(13-15)GAG>CAG	p.E5Q	ATP13A4_uc003fte.1_Missense_Mutation_p.E5Q|ATP13A4_uc011bsr.1_5'UTR	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	5	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TGGCCCTTCTCAAAGTGTCCC	0.532													11	150	---	---	---	---	PASS
LRRC15	131578	broad.mit.edu	37	3	194080433	194080433	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194080433G>A	uc003ftu.2	-	2	1426	c.1340C>T	c.(1339-1341)ACG>ATG	p.T447M	LRRC15_uc003ftt.2_Missense_Mutation_p.T453M	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b	447	LRRCT.|Extracellular (Potential).					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		TACAGTGTCCGTCCCTAACCT	0.552													18	33	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195480006	195480006	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195480006G>C	uc011bto.1	-	21	15500	c.15040C>G	c.(15040-15042)CAG>GAG	p.Q5014E	MUC4_uc010hzq.2_5'UTR|MUC4_uc003fuz.2_Missense_Mutation_p.Q740E|MUC4_uc003fva.2_Missense_Mutation_p.Q622E|MUC4_uc003fvb.2_Missense_Mutation_p.Q658E|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Missense_Mutation_p.Q658E|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Missense_Mutation_p.Q622E|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Missense_Mutation_p.Q706E|MUC4_uc011bti.1_Missense_Mutation_p.Q706E|MUC4_uc011btj.1_Missense_Mutation_p.Q883E|MUC4_uc011btk.1_Missense_Mutation_p.Q622E|MUC4_uc011btl.1_Missense_Mutation_p.Q651E|MUC4_uc011btm.1_Missense_Mutation_p.Q831E|MUC4_uc011btn.1_Missense_Mutation_p.Q622E|MUC4_uc003fvo.2_Missense_Mutation_p.Q906E|MUC4_uc003fvp.2_Missense_Mutation_p.Q855E	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1899	EGF-like 1.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CACATGGGCTGACAGCCCAGA	0.577													6	213	---	---	---	---	PASS
OTOP1	133060	broad.mit.edu	37	4	4199349	4199349	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4199349G>C	uc003ghp.1	-	5	1242	c.1212C>G	c.(1210-1212)ATC>ATG	p.I404M		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	404	Helical; (Potential).				biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AGCCCCAGGAGATAAGCCAGG	0.577													3	95	---	---	---	---	PASS
TADA2B	93624	broad.mit.edu	37	4	7056573	7056573	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7056573C>G	uc003gjw.3	+	2	1206	c.1055C>G	c.(1054-1056)TCA>TGA	p.S352*	TADA2B_uc010idi.2_Nonsense_Mutation_p.S277*	NM_152293	NP_689506	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2 (ADA2 homolog,	352					regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|zinc ion binding				0						GAGCTCCTGTCAGATCGCGAG	0.522													23	80	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57180239	57180239	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57180239C>T	uc003hbk.2	+	8	962	c.571C>T	c.(571-573)CGG>TGG	p.R191W	KIAA1211_uc010iha.2_Missense_Mutation_p.R184W|KIAA1211_uc011bzz.1_Missense_Mutation_p.R101W|KIAA1211_uc003hbm.1_Missense_Mutation_p.R77W	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	191										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					CCTTGAGAGTCGGCCCTGCCT	0.537													13	45	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57182677	57182677	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57182677G>A	uc003hbk.2	+	8	3400	c.3009G>A	c.(3007-3009)CCG>CCA	p.P1003P	KIAA1211_uc010iha.2_Silent_p.P996P|KIAA1211_uc011bzz.1_Silent_p.P913P|KIAA1211_uc003hbm.1_Silent_p.P889P	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	1003	Pro-rich.									ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					CAAGTGAGCCGTCCAAGGAGG	0.657													3	19	---	---	---	---	PASS
PCDHA8	56140	broad.mit.edu	37	5	140221089	140221089	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140221089G>A	uc003lhs.2	+	1	183	c.183G>A	c.(181-183)CCG>CCA	p.P61P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.P61P	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	61	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGGTGCCGCGCCTGTTCC	0.642													19	117	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149215950	149215950	+	Silent	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149215950C>G	uc003lrc.2	+	8	1974	c.1932C>G	c.(1930-1932)CTC>CTG	p.L644L	PPARGC1B_uc003lrb.1_Silent_p.L644L|PPARGC1B_uc003lrd.2_Silent_p.L605L|PPARGC1B_uc003lrf.2_Silent_p.L623L|PPARGC1B_uc003lre.1_Silent_p.L623L	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	644					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GCCTCTCACTCAAGGCCACCC	0.602													4	138	---	---	---	---	PASS
N4BP3	23138	broad.mit.edu	37	5	177547344	177547344	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177547344C>G	uc003mik.1	+	3	743	c.496C>G	c.(496-498)CAG>GAG	p.Q166E	N4BP3_uc003mil.1_5'Flank	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3	166						cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGGGCCAGCCAGGCCCGGGC	0.706													10	18	---	---	---	---	PASS
AGXT2L2	85007	broad.mit.edu	37	5	177641849	177641849	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177641849C>G	uc003miz.2	-	10	1372	c.1120G>C	c.(1120-1122)GAT>CAT	p.D374H	AGXT2L2_uc003miy.2_Missense_Mutation_p.D99H|AGXT2L2_uc003mjc.2_Missense_Mutation_p.D333H|AGXT2L2_uc003mja.2_RNA|AGXT2L2_uc003mjb.2_Missense_Mutation_p.D99H|AGXT2L2_uc003mjd.1_Missense_Mutation_p.D232H	NM_153373	NP_699204	Q8IUZ5	AT2L2_HUMAN	alanine-glyoxylate aminotransferase 2-like 2	374						mitochondrion	pyridoxal phosphate binding|transaminase activity			pancreas(1)	1	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.181)|all cancers(165;0.235)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	GTGGCCTCATCTTTGATCAGA	0.537													27	86	---	---	---	---	PASS
NEDD9	4739	broad.mit.edu	37	6	11213696	11213696	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11213696G>A	uc003mzv.2	-	2	444	c.277C>T	c.(277-279)CAA>TAA	p.Q93*	NEDD9_uc010joz.2_Nonsense_Mutation_p.Q93*|NEDD9_uc003mzw.3_5'UTR|NEDD9_uc003mzx.2_Nonsense_Mutation_p.Q93*	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally	93					actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			TTTGGCACTTGATAGAGCTTC	0.562													6	96	---	---	---	---	PASS
HIST1H2BC	8347	broad.mit.edu	37	6	26124025	26124025	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26124025C>G	uc003ngk.3	-	1	130	c.108G>C	c.(106-108)GAG>GAC	p.E36D	HIST1H2BC_uc003ngl.2_Missense_Mutation_p.E36D|HIST1H2AC_uc003ngm.2_5'Flank|HIST1H2AC_uc003ngn.2_5'Flank|HIST1H2AC_uc003ngo.2_5'Flank|HIST1H2AC_uc003ngp.2_5'Flank	NM_003526	NP_003517	P62807	H2B1C_HUMAN	histone cluster 1, H2bc	36					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1						CAGAGTAACTCTCCTTGCGGC	0.542													17	222	---	---	---	---	PASS
PGBD1	84547	broad.mit.edu	37	6	28269414	28269414	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28269414G>C	uc003nky.2	+	7	2153	c.1783G>C	c.(1783-1785)GAT>CAT	p.D595H	PGBD1_uc003nkz.2_Missense_Mutation_p.D595H	NM_032507	NP_115896	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	595					viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity			ovary(4)	4						TATGAAGGTAGATGAGGATCC	0.398													21	64	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33141825	33141825	+	Missense_Mutation	SNP	G	A	A	rs121912949		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33141825G>A	uc003ocx.1	-	33	2720	c.2492C>T	c.(2491-2493)TCG>TTG	p.S831L	COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.S745L|COL11A2_uc003ocz.1_Missense_Mutation_p.S724L	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	831	Triple-helical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						TGACTTCCCCGACAGGCCCTG	0.622													19	75	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56499748	56499748	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56499748C>T	uc003pdf.2	-	24	3119	c.3091G>A	c.(3091-3093)GAG>AAG	p.E1031K	DST_uc003pcz.3_Missense_Mutation_p.E853K|DST_uc011dxj.1_Missense_Mutation_p.E882K|DST_uc011dxk.1_Missense_Mutation_p.E893K|DST_uc003pcy.3_Missense_Mutation_p.E527K|DST_uc003pdb.2_Missense_Mutation_p.E527K|DST_uc003pdc.3_Missense_Mutation_p.E527K|DST_uc003pdd.3_Missense_Mutation_p.E527K	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	853					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			tcttctttctcttcctaagta	0.169													7	104	---	---	---	---	PASS
KIAA1586	57691	broad.mit.edu	37	6	56918108	56918108	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56918108G>A	uc003pdj.2	+	4	981	c.811G>A	c.(811-813)GAA>AAA	p.E271K	KIAA1586_uc011dxm.1_Missense_Mutation_p.E244K	NM_020931	NP_065982	Q9HCI6	K1586_HUMAN	hypothetical protein LOC57691	271							nucleic acid binding				0	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GGGGGCAAGAGAATTACAGGA	0.289													16	41	---	---	---	---	PASS
TTK	7272	broad.mit.edu	37	6	80749569	80749569	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80749569G>C	uc003pjc.2	+	19	2361	c.2287G>C	c.(2287-2289)GAT>CAT	p.D763H	TTK_uc003pjb.3_Missense_Mutation_p.D762H	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	763	Protein kinase.				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TCCAGAGAAAGATCTTCAAGA	0.274													6	12	---	---	---	---	PASS
CASP8AP2	9994	broad.mit.edu	37	6	90572536	90572536	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90572536C>G	uc003pnr.2	+	7	1304	c.1108C>G	c.(1108-1110)CAA>GAA	p.Q370E	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.Q370E|CASP8AP2_uc011dzz.1_Missense_Mutation_p.Q370E	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	370					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AAAAGTTGATCAAAAACCTAA	0.318													3	73	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161512528	161512528	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161512528T>C	uc003qtn.2	+	12	3233	c.3091T>C	c.(3091-3093)TAC>CAC	p.Y1031H	MAP3K4_uc010kkc.1_Missense_Mutation_p.Y1031H|MAP3K4_uc003qto.2_Missense_Mutation_p.Y1031H|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.Y484H|MAP3K4_uc003qtp.2_Missense_Mutation_p.Y21H	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1031					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CTTGCAACAGTACTACCGAGA	0.403													30	130	---	---	---	---	PASS
ZNF117	51351	broad.mit.edu	37	7	64438701	64438701	+	Silent	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64438701G>C	uc003ttr.2	-	4	2533	c.1248C>G	c.(1246-1248)CTC>CTG	p.L416L		NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117	416						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CACATTTGTAGAGTTTCTCTC	0.373													4	56	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94156482	94156482	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94156482C>A	uc003uni.3	+	4	587	c.360C>A	c.(358-360)AAC>AAA	p.N120K	CASD1_uc003unh.2_Missense_Mutation_p.N120K|CASD1_uc003unj.3_Missense_Mutation_p.N120K	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	120						integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AGCATGAAAACATTCCTTTTG	0.274													10	106	---	---	---	---	PASS
ZSCAN21	7589	broad.mit.edu	37	7	99655344	99655344	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99655344G>C	uc003uso.2	+	3	567	c.423G>C	c.(421-423)CAG>CAC	p.Q141H	ZSCAN21_uc003usn.1_Missense_Mutation_p.Q140H	NM_145914	NP_666019	Q9Y5A6	ZSC21_HUMAN	zinc finger protein 38	141					positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CAAACGAACAGAAACCGGTGT	0.488													7	162	---	---	---	---	PASS
ZSCAN21	7589	broad.mit.edu	37	7	99661470	99661470	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99661470G>C	uc003uso.2	+	4	796	c.652G>C	c.(652-654)GAG>CAG	p.E218Q	ZSCAN21_uc003usn.1_Missense_Mutation_p.E217Q	NM_145914	NP_666019	Q9Y5A6	ZSC21_HUMAN	zinc finger protein 38	218					positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TTCTGAAGCAGAGGGGCTCAA	0.418													12	167	---	---	---	---	PASS
THAP5	168451	broad.mit.edu	37	7	108205264	108205264	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108205264C>T	uc003vfm.2	-	3	713	c.559G>A	c.(559-561)GAT>AAT	p.D187N	THAP5_uc003vfl.2_Missense_Mutation_p.D145N	NM_001130475	NP_001123947	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5 isoform 1	187					cell cycle|negative regulation of cell cycle	nucleus	DNA binding|metal ion binding|protease binding				0						CTACCTGTATCTTGGTTAACT	0.323													11	60	---	---	---	---	PASS
OPN1SW	611	broad.mit.edu	37	7	128414648	128414648	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128414648G>A	uc003vnt.3	-	3	591	c.591C>T	c.(589-591)AGC>AGT	p.S197S		NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	197	Extracellular (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						TATAGGACTCGCTGCGGTATT	0.552													8	86	---	---	---	---	PASS
ZNF777	27153	broad.mit.edu	37	7	149153071	149153071	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149153071G>A	uc003wfv.2	-	2	206	c.43C>T	c.(43-45)CCA>TCA	p.P15S		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	15					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			TCTTCTTGTGGAACACTGGGG	0.507													4	134	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151856085	151856085	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151856085C>T	uc003wla.2	-	44	11752	c.11533G>A	c.(11533-11535)GAA>AAA	p.E3845K	MLL3_uc003wkz.2_Missense_Mutation_p.E2906K|MLL3_uc003wkx.2_5'Flank|MLL3_uc003wky.2_Missense_Mutation_p.E1354K	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	3845					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTCTTGGTTTCACTTCCTCCA	0.443			N		medulloblastoma								24	103	---	---	---	---	PASS
NCAPG2	54892	broad.mit.edu	37	7	158445171	158445171	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158445171C>T	uc003wnv.1	-	23	2893	c.2748G>A	c.(2746-2748)GTG>GTA	p.V916V	NCAPG2_uc010lqu.1_Silent_p.V708V|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Silent_p.V916V|NCAPG2_uc011kwe.1_Silent_p.V916V|NCAPG2_uc011kwc.1_Silent_p.V417V|NCAPG2_uc011kwd.1_Silent_p.V359V	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	916					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		AAAATCCCTTCACTAGAAAGA	0.299													9	102	---	---	---	---	PASS
XKR6	286046	broad.mit.edu	37	8	10755476	10755476	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10755476C>G	uc003wtk.1	-	3	1939	c.1912G>C	c.(1912-1914)GAG>CAG	p.E638Q		NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related	638						integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		AGTGAAGACTCATACTGTAGC	0.473													10	143	---	---	---	---	PASS
PDLIM2	64236	broad.mit.edu	37	8	22442522	22442522	+	Intron	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22442522C>T	uc003xby.2	+						PDLIM2_uc003xbx.1_Intron|PDLIM2_uc003xbz.2_Intron|PDLIM2_uc003xca.2_Intron|PDLIM2_uc003xcb.2_Intron|PDLIM2_uc003xcc.1_Intron	NM_021630	NP_067643	Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 isoform 2							actin cytoskeleton|cell surface|cytoplasm|focal adhesion|nucleus	zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CAGTCACTCTCTCCACAGGGC	0.637													6	125	---	---	---	---	PASS
CDCA2	157313	broad.mit.edu	37	8	25325882	25325882	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25325882G>C	uc003xep.1	+	6	1167	c.688G>C	c.(688-690)GAT>CAT	p.D230H	PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.D230H|CDCA2_uc003xeq.1_Missense_Mutation_p.D215H|CDCA2_uc003xer.1_5'UTR	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	230					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		ATTCAATATTGATACAGACAG	0.388													12	89	---	---	---	---	PASS
PPAPDC1B	84513	broad.mit.edu	37	8	38124784	38124784	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38124784C>T	uc003xlf.3	-	5	484	c.463_splice	c.e5+1	p.F155_splice	PPAPDC1B_uc003xle.3_Splice_Site_p.F114_splice|PPAPDC1B_uc003xlg.3_Splice_Site_p.F155_splice|PPAPDC1B_uc010lwd.2_Missense_Mutation_p.C155Y	NM_001102559	NP_001096029	Q8NEB5	PPC1B_HUMAN	phosphatidic acid phosphatase type 2 domain						phospholipid dephosphorylation	cytoplasm|integral to membrane|plasma membrane	phosphatidate phosphatase activity				0	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)	BRCA - Breast invasive adenocarcinoma(5;3.04e-26)|COAD - Colon adenocarcinoma(9;0.188)			GATATTCATACAGGAAGAATG	0.443													21	91	---	---	---	---	PASS
ZMAT4	79698	broad.mit.edu	37	8	40532227	40532227	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40532227C>T	uc003xnr.2	-	5	719	c.573G>A	c.(571-573)CTG>CTA	p.L191L	ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a	191						nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			CCTTACCTCTCAGTTCCCCCA	0.448													7	31	---	---	---	---	PASS
RPS20	6224	broad.mit.edu	37	8	56985826	56985826	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56985826C>G	uc003xsn.2	-	4	381	c.183G>C	c.(181-183)TTG>TTC	p.L61F	RPS20_uc003xsm.2_Missense_Mutation_p.L61F	NM_001023	NP_001014	P60866	RS20_HUMAN	ribosomal protein S20 isoform 2	61					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.155)	Epithelial(17;0.00117)|all cancers(17;0.00879)			TAGTGATTCTCAAAGTCTGTA	0.363													3	192	---	---	---	---	PASS
RUNX1T1	862	broad.mit.edu	37	8	93004062	93004062	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93004062G>A	uc003yfd.2	-	6	880	c.796C>T	c.(796-798)CGA>TGA	p.R266*	RUNX1T1_uc003yfc.1_Nonsense_Mutation_p.R239*|RUNX1T1_uc003yfe.1_Nonsense_Mutation_p.R229*|RUNX1T1_uc010mao.2_Nonsense_Mutation_p.R239*|RUNX1T1_uc011lgi.1_Nonsense_Mutation_p.R277*|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Nonsense_Mutation_p.R229*	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	266					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.D266Y(1)		lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GTGCATGGTCGCTTGCTTGGA	0.488													8	42	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134030178	134030178	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134030178G>C	uc003ytw.2	+	38	6759	c.6718G>C	c.(6718-6720)GAG>CAG	p.E2240Q	TG_uc010mdw.2_Missense_Mutation_p.E999Q|TG_uc011ljb.1_Missense_Mutation_p.E609Q|TG_uc011ljc.1_Missense_Mutation_p.E373Q	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2240					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCCCCTGGCAGAGAGGCGCTT	0.607													10	69	---	---	---	---	PASS
IFNA4	3441	broad.mit.edu	37	9	21187090	21187090	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21187090G>A	uc003zon.2	-	1	509	c.441C>T	c.(439-441)TTC>TTT	p.F147F		NM_021068	NP_066546	P05014	IFNA4_HUMAN	interferon, alpha 4 precursor	147					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TGATTCTTTGGAAGTATTTCC	0.463													5	145	---	---	---	---	PASS
ACO1	48	broad.mit.edu	37	9	32419137	32419137	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32419137C>G	uc003zqw.3	+	7	915	c.760C>G	c.(760-762)CTG>GTG	p.L254V	ACO1_uc010mjh.1_Missense_Mutation_p.L88V|ACO1_uc003zqx.3_Missense_Mutation_p.L254V|ACO1_uc003zqy.3_RNA	NM_002197	NP_002188	P21399	ACOC_HUMAN	aconitase 1	254					citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		GCCCCACCCTCTGGTAACATC	0.507													6	36	---	---	---	---	PASS
DNAJB5	25822	broad.mit.edu	37	9	34993236	34993236	+	Silent	SNP	A	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34993236A>G	uc003zvt.2	+	2	144	c.6A>G	c.(4-6)GGA>GGG	p.G2G	DNAJB5_uc003zvs.2_Silent_p.G36G|DNAJB5_uc011los.1_Silent_p.G74G	NM_012266	NP_036398	O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	2					protein folding|response to unfolded protein		heat shock protein binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)			CTGTGATGGGAAAAGATTATT	0.512													7	42	---	---	---	---	PASS
MELK	9833	broad.mit.edu	37	9	36599493	36599493	+	Intron	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36599493C>G	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GGTAATTATTCATTGATTAat	0.209													5	90	---	---	---	---	PASS
KIF27	55582	broad.mit.edu	37	9	86474190	86474190	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86474190C>G	uc004ana.2	-	14	3175	c.3031G>C	c.(3031-3033)GAG>CAG	p.E1011Q	KIF27_uc010mpw.2_Missense_Mutation_p.E945Q|KIF27_uc010mpx.2_Missense_Mutation_p.E914Q	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27	1011	Potential.				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						GTTTTCTCCTCAGCTGTACTG	0.398													5	124	---	---	---	---	PASS
MUSK	4593	broad.mit.edu	37	9	113562808	113562808	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113562808C>G	uc004bey.2	+	14	2248	c.2150C>G	c.(2149-2151)TCA>TGA	p.S717*	MUSK_uc004bez.1_Nonsense_Mutation_p.S297*	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	717	Protein kinase.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						GCTTACCTCTCAGAACGTAAG	0.572													8	142	---	---	---	---	PASS
RBM18	92400	broad.mit.edu	37	9	125023709	125023709	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125023709C>T	uc004bma.2	-	2	229	c.63G>A	c.(61-63)CTG>CTA	p.L21L	RBM18_uc004blz.2_RNA|RBM18_uc010mvy.2_RNA|RBM18_uc011lyp.1_RNA	NM_033117	NP_149108	Q96H35	RBM18_HUMAN	RNA binding motif protein 18	21							nucleotide binding|RNA binding				0						GTCCTTCCTGCAGAGAGCCCT	0.408													12	119	---	---	---	---	PASS
RC3H2	54542	broad.mit.edu	37	9	125621337	125621337	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125621337A>G	uc010mwc.1	-	12	2135	c.1894T>C	c.(1894-1896)TGT>CGT	p.C632R	RC3H2_uc004bnc.2_RNA|RC3H2_uc004bnd.1_Missense_Mutation_p.C632R|RC3H2_uc004bne.3_Missense_Mutation_p.C632R	NM_001100588	NP_001094058	Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type zinc finger domains 2	632	Pro-rich.					cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding			ovary(2)|lung(2)	4						CGAGGAACACAGGGAGCCACA	0.453													8	27	---	---	---	---	PASS
ZNF79	7633	broad.mit.edu	37	9	130207191	130207191	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130207191C>T	uc004bqw.3	+	5	1626	c.1212C>T	c.(1210-1212)CTC>CTT	p.L404L	ZNF79_uc011maf.1_Silent_p.L380L|ZNF79_uc011mag.1_Silent_p.L380L	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	404	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						GTACCAATCTCATAATCCACC	0.488													27	86	---	---	---	---	PASS
CDK9	1025	broad.mit.edu	37	9	130550302	130550302	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130550302G>C	uc004bse.2	+	4	465	c.342G>C	c.(340-342)TTG>TTC	p.L114F		NM_001261	NP_001252	P50750	CDK9_HUMAN	cyclin-dependent kinase 9	114	Protein kinase.				cell proliferation|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	transcription elongation factor complex	ATP binding|cyclin-dependent protein kinase activity|DNA binding|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(1)	1						CTGGGCTGTTGAGCAATGTTT	0.502													7	223	---	---	---	---	PASS
GLE1	2733	broad.mit.edu	37	9	131271285	131271285	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131271285C>G	uc004bvj.2	+	2	344	c.230C>G	c.(229-231)TCA>TGA	p.S77*	GLE1_uc004bvi.2_Nonsense_Mutation_p.S77*|GLE1_uc010myd.2_5'UTR	NM_001003722	NP_001003722	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator homolog isoform 1	77					poly(A)+ mRNA export from nucleus|protein transport|transmembrane transport	cytoplasm|nuclear pore	protein binding				0						ACGTCAGCTTCAGCCCTAGAT	0.512													21	120	---	---	---	---	PASS
DBH	1621	broad.mit.edu	37	9	136523568	136523568	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136523568G>A	uc004cel.2	+	12	1862	c.1853G>A	c.(1852-1854)TGA>TAA	p.*618*	uc010nao.1_5'Flank	NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta hydroxylase precursor	618					hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)	GGCAAAGGCTGAGGGGGGACC	0.652													10	52	---	---	---	---	PASS
ZMYND19	116225	broad.mit.edu	37	9	140477009	140477009	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140477009C>G	uc004cno.1	-	6	892	c.670G>C	c.(670-672)GAG>CAG	p.E224Q		NM_138462	NP_612471	Q96E35	ZMY19_HUMAN	zinc finger, MYND domain containing 19	224						Golgi apparatus|plasma membrane	zinc ion binding			skin(1)	1	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		CGCTCTGGCTCAAGCTCATGC	0.642													4	100	---	---	---	---	PASS
RPP38	10557	broad.mit.edu	37	10	15145823	15145823	+	Silent	SNP	C	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15145823C>A	uc001iny.3	+	3	1223	c.510C>A	c.(508-510)CCC>CCA	p.P170P	RPP38_uc009xjm.2_Silent_p.P170P|RPP38_uc001inx.3_Silent_p.P170P	NM_183005	NP_892117	P78345	RPP38_HUMAN	ribonuclease P/MRP 38 subunit	170					tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity			ovary(1)	1						GAATCGCCCCCGTCATTGGCT	0.507													4	100	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16967746	16967746	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16967746C>G	uc001ioo.2	-	42	6351	c.6299G>C	c.(6298-6300)AGA>ACA	p.R2100T		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	2100	CUB 15.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GATGATCCCTCTGTCTGCATG	0.463													6	20	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24909044	24909044	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24909044G>A	uc001isb.2	-	9	2267	c.1780C>T	c.(1780-1782)CAG>TAG	p.Q594*	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Nonsense_Mutation_p.Q594*|ARHGAP21_uc010qdc.1_Nonsense_Mutation_p.Q429*|ARHGAP21_uc001isc.1_Nonsense_Mutation_p.Q584*	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	593					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						CTGTTTGACTGCAATGTTTTT	0.423													19	64	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29747500	29747500	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29747500G>C	uc001iut.1	-	37	7174	c.6421C>G	c.(6421-6423)CAG>GAG	p.Q2141E	LOC387647_uc001iuo.1_Intron|LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Missense_Mutation_p.Q1055E|SVIL_uc001iuu.1_Missense_Mutation_p.Q1715E	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	2141					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				AGGGTGATCTGATTGGAAACT	0.537													9	86	---	---	---	---	PASS
C10orf57	80195	broad.mit.edu	37	10	81850650	81850650	+	Missense_Mutation	SNP	C	T	T	rs144946848		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81850650C>T	uc001kbl.2	+	4	379	c.349C>T	c.(349-351)CGG>TGG	p.R117W	C10orf57_uc009xsn.2_3'UTR|C10orf57_uc010qlv.1_3'UTR|C10orf57_uc010qlw.1_Missense_Mutation_p.R141W|C10orf57_uc001kbn.3_RNA|C10orf57_uc009xsp.2_RNA|C10orf57_uc001kbo.3_RNA	NM_025125	NP_079401	Q8TBM7	CJ057_HUMAN	hypothetical protein LOC80195	117						integral to membrane					0	Prostate(51;0.0095)|all_epithelial(25;0.175)		Epithelial(14;0.0793)|Colorectal(32;0.109)|all cancers(16;0.154)			TGCTTACAAACGGAAGCGCCA	0.443													22	140	---	---	---	---	PASS
PGAM1	5223	broad.mit.edu	37	10	99190814	99190814	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99190814C>T	uc001knh.2	+	3	555	c.517C>T	c.(517-519)CCC>TCC	p.P173S	PGAM1_uc009xvo.2_Intron|PGAM1_uc010qov.1_Missense_Mutation_p.P158S	NM_002629	NP_002620	P18669	PGAM1_HUMAN	phosphoglycerate mutase 1	173					gluconeogenesis|glycolysis|regulation of glycolysis|regulation of pentose-phosphate shunt|respiratory burst	cytosol	2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity|protein kinase binding				0		Colorectal(252;0.162)		Epithelial(162;8.36e-10)|all cancers(201;5.62e-08)		AGAAATAGTTCCCCAGATCAA	0.507													21	119	---	---	---	---	PASS
ZFYVE27	118813	broad.mit.edu	37	10	99510109	99510109	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99510109C>T	uc001koo.2	+	7	886	c.686C>T	c.(685-687)TCT>TTT	p.S229F	ZFYVE27_uc001kon.2_Missense_Mutation_p.S229F|ZFYVE27_uc001koq.2_Missense_Mutation_p.S143F|ZFYVE27_uc010qpa.1_Missense_Mutation_p.S111F|ZFYVE27_uc001kop.2_Missense_Mutation_p.S229F|ZFYVE27_uc010qpb.1_Missense_Mutation_p.S131F|ZFYVE27_uc010qpc.1_RNA|ZFYVE27_uc010qpd.1_Missense_Mutation_p.S197F|ZFYVE27_uc001kok.1_RNA|ZFYVE27_uc001kol.1_Missense_Mutation_p.S229F|ZFYVE27_uc001kom.1_Missense_Mutation_p.S229F	NM_144588	NP_653189	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27 isoform	229	Extracellular (Potential).				cell death|nerve growth factor receptor signaling pathway|neuron projection development|protein localization in plasma membrane	axon|dendrite|endoplasmic reticulum membrane|growth cone membrane|integral to membrane|recycling endosome membrane	metal ion binding|protein binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		TACAGGGCATCTCTGCAGCAG	0.537													11	125	---	---	---	---	PASS
SLC18A2	6571	broad.mit.edu	37	10	119026278	119026278	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119026278C>T	uc001ldd.1	+	11	1057	c.1026C>T	c.(1024-1026)CTC>CTT	p.L342L	SLC18A2_uc009xyy.1_Silent_p.L139L	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),	342	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	TCTCTTATCTCATTGGAACCA	0.338													20	250	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124377810	124377810	+	Silent	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124377810C>G	uc001lgk.1	+	38	4888	c.4782C>G	c.(4780-4782)CTC>CTG	p.L1594L	DMBT1_uc001lgl.1_Silent_p.L1584L|DMBT1_uc001lgm.1_Silent_p.L966L|DMBT1_uc009xzz.1_Silent_p.L1594L|DMBT1_uc010qtx.1_Silent_p.L445L|DMBT1_uc009yab.1_Silent_p.L297L|DMBT1_uc009yac.1_5'Flank	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1594	SRCR 12.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	p.L1723L(1)		central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATGGCTGGCTCTCCCACAACT	0.557													12	110	---	---	---	---	PASS
OR51E1	143503	broad.mit.edu	37	11	4674156	4674156	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4674156C>A	uc001lzi.3	+	2	544	c.400C>A	c.(400-402)CGC>AGC	p.R134S		NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E,	133	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(3)|pancreas(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCACCCACTGCGCCATGCCAC	0.552													5	92	---	---	---	---	PASS
IPO7	10527	broad.mit.edu	37	11	9444574	9444574	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9444574C>T	uc001mho.2	+	9	1070	c.928C>T	c.(928-930)CAG>TAG	p.Q310*		NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7	310					interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		GGTGTTATATCAGTACAAGGA	0.323													4	135	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17113087	17113087	+	Intron	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17113087C>T	uc001mmq.3	-						PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha						cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	TCTTTGTAATCACTCACAAGA	0.398													31	118	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20629124	20629124	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20629124C>T	uc001mqd.2	+	5	1184	c.911C>T	c.(910-912)TCT>TTT	p.S304F	SLC6A5_uc009yic.2_Missense_Mutation_p.S69F	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	304	Extracellular (Potential).				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	TCCTTTGTGTCTGTACTACCC	0.423													6	364	---	---	---	---	PASS
SLC1A2	6506	broad.mit.edu	37	11	35308464	35308464	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35308464C>G	uc001mwd.2	-	8	1718	c.1126G>C	c.(1126-1128)GAA>CAA	p.E376Q	SLC1A2_uc001mwe.2_Missense_Mutation_p.E367Q|SLC1A2_uc010rev.1_Missense_Mutation_p.E376Q	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2	376					D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	AGATTTTCTTCCAGGCAACGA	0.463													22	76	---	---	---	---	PASS
ACCS	84680	broad.mit.edu	37	11	44099384	44099384	+	Intron	SNP	T	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44099384T>G	uc009yks.1	+						EXT2_uc010rfo.1_Intron|ACCS_uc010rfm.1_3'UTR|ACCS_uc001mxx.2_Intron	NM_001127219	NP_001120691	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase								1-aminocyclopropane-1-carboxylate synthase activity|protein homodimerization activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			breast(2)|ovary(1)|lung(1)	4						CTCTGATGGGTCTTTTTCCAG	0.557													6	27	---	---	---	---	PASS
F2	2147	broad.mit.edu	37	11	46744726	46744726	+	Intron	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46744726G>A	uc001ndf.3	+						F2_uc001ndg.3_Intron	NM_000506	NP_000497	P00734	THRB_HUMAN	coagulation factor II preproprotein						activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)	TGGGGTCTCCGCAGGTAACTG	0.582													44	180	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595315	55595315	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595315G>C	uc001nhy.1	+	1	621	c.621G>C	c.(619-621)GAG>GAC	p.E207D		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				CTTTGAATGAGAGTGTTACCA	0.473										HNSCC(27;0.073)			10	45	---	---	---	---	PASS
MTA2	9219	broad.mit.edu	37	11	62368147	62368147	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62368147C>T	uc001ntq.1	-	2	424	c.43G>A	c.(43-45)GAG>AAG	p.E15K	MTA2_uc010rlx.1_5'UTR	NM_004739	NP_004730	O94776	MTA2_HUMAN	metastasis-associated protein 2	15	BAH.				chromatin assembly or disassembly	NuRD complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						GAAGAGTTCTCAAAATAGACG	0.537													6	66	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63487394	63487394	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63487394G>A	uc001nxq.2	+	3	1607	c.1420G>A	c.(1420-1422)GAT>AAT	p.D474N	RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Missense_Mutation_p.D455N|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Missense_Mutation_p.D362N|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b	474					apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						GGTTTTACCTGATGACCACCT	0.463													7	137	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63488094	63488094	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63488094G>C	uc001nxq.2	+	3	2307	c.2120G>C	c.(2119-2121)GGA>GCA	p.G707A	RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Missense_Mutation_p.G688A|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Missense_Mutation_p.G595A|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b	707					apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						AAAGACATTGGAAGCAAATAC	0.383													10	126	---	---	---	---	PASS
DNAJC4	3338	broad.mit.edu	37	11	64000216	64000216	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64000216C>T	uc001nys.2	+	5	868	c.406C>T	c.(406-408)CAC>TAC	p.H136Y	uc001nyr.1_5'Flank|DNAJC4_uc001nyt.2_Missense_Mutation_p.H137Y|DNAJC4_uc001nyu.2_Missense_Mutation_p.H136Y|VEGFB_uc001nyw.2_5'Flank|VEGFB_uc001nyx.2_5'Flank	NM_005528	NP_005519	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	136					protein folding|response to unfolded protein	integral to membrane|membrane fraction	heat shock protein binding|unfolded protein binding				0						GTCCCAGTTTCACAGCGTGAG	0.592													14	99	---	---	---	---	PASS
KLC2	64837	broad.mit.edu	37	11	66033322	66033322	+	Intron	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66033322C>T	uc010rov.1	+						KLC2_uc010row.1_Intron|KLC2_uc009yra.2_Intron|KLC2_uc001ohb.2_Intron|KLC2_uc010rox.1_Intron|KLC2_uc001ohc.2_Intron|KLC2_uc001ohd.2_Intron|KLC2_uc001ohe.1_Intron|RAB1B_uc001ohf.2_5'Flank	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1						blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0						GCCCCTCCCTCAGGGTTTGGA	0.657													5	76	---	---	---	---	PASS
TCIRG1	10312	broad.mit.edu	37	11	67816372	67816372	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67816372G>C	uc001one.2	+	14	1689	c.1581G>C	c.(1579-1581)TTG>TTC	p.L527F	TCIRG1_uc001ong.2_Missense_Mutation_p.L311F|TCIRG1_uc001onh.2_Missense_Mutation_p.L229F|TCIRG1_uc001oni.2_Missense_Mutation_p.L31F|TCIRG1_uc009ysd.2_5'Flank	NM_006019	NP_006010	Q13488	VPP3_HUMAN	T-cell, immune regulator 1 isoform a	527	Lumenal (Potential).				ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity			ovary(1)	1						CCAACCACTTGAGCTTCCTCA	0.617													4	192	---	---	---	---	PASS
ANKRD42	338699	broad.mit.edu	37	11	82951985	82951985	+	Intron	SNP	G	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82951985G>T	uc001ozz.1	+						ANKRD42_uc010rsv.1_Intron|ANKRD42_uc001paa.2_Intron|ANKRD42_uc001pab.1_Intron	NM_182603	NP_872409	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42											skin(1)	1						AAGTAAGTATGCTGCCTCTGT	0.358													22	52	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	84028065	84028065	+	Intron	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84028065G>C	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Missense_Mutation_p.Q42E	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CCGAGCCCCTGACAGTTCCTC	0.637													11	134	---	---	---	---	PASS
FAM76B	143684	broad.mit.edu	37	11	95512840	95512840	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95512840G>T	uc001pfn.2	-	7	935	c.623C>A	c.(622-624)TCT>TAT	p.S208Y	FAM76B_uc001pfm.2_RNA	NM_144664	NP_653265	Q5HYJ3	FA76B_HUMAN	hypothetical protein LOC143684	208											0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AATTGTTGCAGAGGATTTATG	0.308													3	45	---	---	---	---	PASS
MMP27	64066	broad.mit.edu	37	11	102563730	102563730	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102563730C>T	uc001phd.1	-	9	1259	c.1236G>A	c.(1234-1236)CAG>CAA	p.Q412Q		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	412	Hemopexin-like 3.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		TTACCACTCTCTGCGGGAACC	0.433													22	209	---	---	---	---	PASS
HTR3B	9177	broad.mit.edu	37	11	113813723	113813723	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113813723C>A	uc001pok.2	+	7	783	c.716C>A	c.(715-717)CCC>CAC	p.P239H	HTR3B_uc001pol.2_Missense_Mutation_p.P228H	NM_006028	NP_006019	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B	239	Helical; Name=1; (Potential).				synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)		CGCAGGCACCCCCTGGTCTAT	0.542													3	36	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118376035	118376035	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118376035C>G	uc001pta.2	+	27	9442	c.9419C>G	c.(9418-9420)CCA>CGA	p.P3140R	MLL_uc001ptb.2_Missense_Mutation_p.P3143R	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3140					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		CCAAGCTTGCCAACTTCTCAA	0.463			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								5	222	---	---	---	---	PASS
HMBS	3145	broad.mit.edu	37	11	118962882	118962882	+	Intron	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118962882G>C	uc001puz.1	+						HMBS_uc009zao.1_Missense_Mutation_p.L165F|HMBS_uc001pvc.1_Intron|HMBS_uc009zap.1_Intron|HMBS_uc001pva.1_Intron|HMBS_uc001pvb.1_Intron|HMBS_uc001pvd.1_Intron|HMBS_uc001pve.1_Intron|HMBS_uc001pvf.1_Intron	NM_000190	NP_000181	P08397	HEM3_HUMAN	hydroxymethylbilane synthase isoform 1						peptidyl-pyrromethane cofactor linkage	cytosol	hydroxymethylbilane synthase activity				0	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		AGGTACACTTGACCAGGGAAG	0.522									Porphyria_Acute_Intermittent				6	41	---	---	---	---	PASS
OR8D1	283159	broad.mit.edu	37	11	124180213	124180213	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124180213G>C	uc010sag.1	-	1	450	c.450C>G	c.(448-450)TTC>TTG	p.F150L		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GAAAGCCCAAGAAGAAGGCAG	0.468													3	1	---	---	---	---	PASS
TNFRSF1A	7132	broad.mit.edu	37	12	6438466	6438466	+	3'UTR	SNP	A	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6438466A>G	uc001qnu.2	-	10					TNFRSF1A_uc001qnt.2_3'UTR|TNFRSF1A_uc010sey.1_3'UTR|TNFRSF1A_uc010sez.1_3'UTR|TNFRSF1A_uc009zek.2_3'UTR	NM_001065	NP_001056	P19438	TNR1A_HUMAN	tumor necrosis factor receptor 1 precursor						apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|inflammatory response|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of inflammatory response|positive regulation of transcription from RNA polymerase II promoter|prostaglandin metabolic process	extracellular region|integral to plasma membrane|membrane raft	tumor necrosis factor receptor activity			lung(2)|skin(1)	3						AGCTGCCCGCAGGGGCGCAGC	0.532													3	13	---	---	---	---	PASS
CLSTN3	9746	broad.mit.edu	37	12	7301578	7301578	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7301578G>A	uc001qsr.2	+	13	2136	c.1858G>A	c.(1858-1860)GAA>AAA	p.E620K	CLSTN3_uc001qss.2_Missense_Mutation_p.E632K	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	620	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						GTGCTTCAGCGAAGAGTCCTG	0.577													17	59	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9010593	9010593	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9010593C>G	uc001quz.3	+	26	3257	c.3159C>G	c.(3157-3159)TTC>TTG	p.F1053L	A2ML1_uc001qva.1_Missense_Mutation_p.F633L|A2ML1_uc010sgm.1_Missense_Mutation_p.F553L	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	897						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						AATTCATCTTCATTGATCCCA	0.473													4	176	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32975436	32975436	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32975436C>G	uc001rlj.3	-	9	2051	c.1936G>C	c.(1936-1938)GGA>CGA	p.G646R	PKP2_uc001rlk.3_Missense_Mutation_p.G602R|PKP2_uc010skj.1_Missense_Mutation_p.G602R	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	646					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CCAAAACATCCAATACTTTTG	0.403													12	58	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49434361	49434361	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49434361G>C	uc001rta.3	-	31	7192	c.7192C>G	c.(7192-7194)CTG>GTG	p.L2398V		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2398	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CGAGGGGGCAGAGCACAGCAG	0.647			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			3	37	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52180553	52180553	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52180553G>A	uc001ryw.2	+	22	4348	c.4170G>A	c.(4168-4170)AAG>AAA	p.K1390K	SCN8A_uc010snl.1_Silent_p.K1214K|SCN8A_uc001rza.1_RNA	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1390	III.				axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	TCAGATGGAAGAACGTGAAGA	0.358													6	44	---	---	---	---	PASS
ESYT1	23344	broad.mit.edu	37	12	56525276	56525276	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56525276C>T	uc001sjq.2	+	6	780	c.730C>T	c.(730-732)CGG>TGG	p.R244W	ESYT1_uc001sjr.2_Missense_Mutation_p.R244W	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	244						integral to membrane				ovary(4)|skin(1)	5						TGGCGTTTTGCGGGTGATACT	0.517													7	461	---	---	---	---	PASS
DDIT3	1649	broad.mit.edu	37	12	57910970	57910970	+	Intron	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57910970G>A	uc001soi.2	-						MARS_uc001sof.1_Intron|DDIT3_uc009zps.2_Intron|DDIT3_uc009zpt.2_Intron	NM_004083	NP_004074	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3						cell cycle arrest|cell redox homeostasis|mRNA transcription from RNA polymerase II promoter|negative regulation of determination of dorsal identity|regulation of DNA-dependent transcription in response to stress|response to DNA damage stimulus	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription factor binding		FUS/DDIT3(623)|EWSR1/DDIT3(43)	soft_tissue(666)|large_intestine(1)|central_nervous_system(1)|lung(1)|skin(1)|ovary(1)	671						CTTCCTTCAAGGAAATGAGGA	0.468			T	FUS	liposarcoma								10	123	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62974171	62974171	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62974171C>T	uc001sre.2	+	32	5061	c.4670C>T	c.(4669-4671)TCA>TTA	p.S1557L	MON2_uc009zqj.2_Missense_Mutation_p.S1557L|MON2_uc010ssl.1_Missense_Mutation_p.S1485L|MON2_uc010ssm.1_Missense_Mutation_p.S1528L|MON2_uc010ssn.1_Missense_Mutation_p.S1551L|MON2_uc001srf.2_Missense_Mutation_p.S1320L|MON2_uc001srg.2_Missense_Mutation_p.S426L	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	1558					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		AACAAGGGCTCAATACATTCT	0.289													4	78	---	---	---	---	PASS
BBS10	79738	broad.mit.edu	37	12	76740354	76740354	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76740354C>T	uc001syd.1	-	2	1495	c.1411G>A	c.(1411-1413)GAC>AAC	p.D471N		NM_024685	NP_078961	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	471					cellular protein metabolic process|nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	cilium	ATP binding			ovary(1)|skin(1)	2						GCAACTGTGTCCTGATAAGGC	0.333									Bardet-Biedl_syndrome				5	210	---	---	---	---	PASS
DEPDC4	120863	broad.mit.edu	37	12	100649877	100649877	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100649877G>C	uc001thi.2	-	4	831	c.828C>G	c.(826-828)ATC>ATG	p.I276M	DEPDC4_uc001thh.1_RNA|DEPDC4_uc001thj.1_Missense_Mutation_p.I222M|DEPDC4_uc009ztv.1_Missense_Mutation_p.I276M|DEPDC4_uc001thk.1_Missense_Mutation_p.I87M|DEPDC4_uc001thl.1_RNA	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	276					intracellular signal transduction						0						AAGTGTTAGTGATAACAAGAT	0.333													11	179	---	---	---	---	PASS
DAO	1610	broad.mit.edu	37	12	109293228	109293228	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109293228C>T	uc001tnr.3	+	10	1042	c.889C>T	c.(889-891)CGC>TGC	p.R297C	DAO_uc001tnq.3_Missense_Mutation_p.R231C|DAO_uc009zvb.2_RNA|DAO_uc001tns.3_RNA	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase	297					glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2						AGAACAGCTTCGCACTGGACC	0.498													6	31	---	---	---	---	PASS
PPTC7	160760	broad.mit.edu	37	12	110989723	110989723	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110989723G>C	uc001trh.1	-	2	502	c.274C>G	c.(274-276)CAA>GAA	p.Q92E		NM_139283	NP_644812	Q8NI37	PPTC7_HUMAN	T-cell activation protein phosphatase 2C	92	PP2C-like.						metal ion binding|phosphoprotein phosphatase activity				0						CCTGAGAATTGAGATGGATCA	0.418													14	144	---	---	---	---	PASS
TRAFD1	10906	broad.mit.edu	37	12	112587655	112587655	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112587655G>A	uc001ttp.2	+	9	1345	c.1259G>A	c.(1258-1260)AGG>AAG	p.R420K	TRAFD1_uc001tto.2_Missense_Mutation_p.R420K|TRAFD1_uc010syj.1_RNA	NM_006700	NP_006691	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	420					negative regulation of innate immune response	intracellular	protein binding|zinc ion binding				0						GAGCTGCCCAGGAGGCGTGTC	0.582													3	52	---	---	---	---	PASS
SCARB1	949	broad.mit.edu	37	12	125298775	125298775	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125298775G>A	uc001ugo.3	-	4	856	c.603C>T	c.(601-603)TTC>TTT	p.F201F	SCARB1_uc001ugn.3_Silent_p.F201F|SCARB1_uc001ugm.3_Silent_p.F201F|SCARB1_uc010tbd.1_Silent_p.F201F|SCARB1_uc010tbe.1_Silent_p.F160F|SCARB1_uc001ugp.3_Silent_p.F201F	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1	201	Extracellular (Potential).				adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	ACTTGTCCTTGAAGGGGAACA	0.522													20	209	---	---	---	---	PASS
DZIP1	22873	broad.mit.edu	37	13	96274674	96274674	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96274674C>G	uc001vmk.2	-	9	1885	c.1033G>C	c.(1033-1035)GAT>CAT	p.D345H	DZIP1_uc001vml.2_Missense_Mutation_p.D345H	NM_198968	NP_945319	Q86YF9	DZIP1_HUMAN	DAZ interacting protein 1 isoform 2	345					germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TCGTGTGCATCTTTTAATGTG	0.408													16	93	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23857021	23857021	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23857021C>G	uc001wjv.2	-	31	4538	c.4471G>C	c.(4471-4473)GAG>CAG	p.E1491Q		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1491	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		AGGGACTCCTCGTAGGCGTTC	0.577													16	231	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23871733	23871733	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23871733C>T	uc001wjv.2	-	12	1148	c.1081G>A	c.(1081-1083)GGG>AGG	p.G361R	MYH6_uc010akp.1_Missense_Mutation_p.G361R	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	361	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TTCATGTTCCCGTAGTGCATG	0.607													37	149	---	---	---	---	PASS
ADCY4	196883	broad.mit.edu	37	14	24801114	24801114	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24801114G>A	uc001wov.2	-	4	555	c.549C>T	c.(547-549)TGC>TGT	p.C183C	ADCY4_uc001wow.2_Silent_p.C183C|ADCY4_uc010toh.1_5'UTR|ADCY4_uc001wox.2_Silent_p.C183C|ADCY4_uc001woy.2_Silent_p.C183C	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	183	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		CCACGTTCCCGCACAGGAACA	0.662											OREG0022624	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	25	---	---	---	---	PASS
ARHGAP5	394	broad.mit.edu	37	14	32615493	32615493	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32615493G>T	uc001wrl.2	+	4	4129	c.3890G>T	c.(3889-3891)CGT>CTT	p.R1297L	ARHGAP5_uc001wrm.2_Missense_Mutation_p.R1296L|ARHGAP5_uc001wrn.2_Missense_Mutation_p.R1297L|ARHGAP5_uc001wro.2_Missense_Mutation_p.R36L|ARHGAP5_uc001wrp.2_Missense_Mutation_p.R32L	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	1297	Rho-GAP.				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GGACTCTACCGTGTCAGCGGG	0.284													5	24	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33290861	33290861	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33290861C>G	uc001wrq.2	+	13	4012	c.3842C>G	c.(3841-3843)TCT>TGT	p.S1281C		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1281					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ACTGCCCCCTCTAGTCCACAC	0.468													5	16	---	---	---	---	PASS
ZFP36L1	677	broad.mit.edu	37	14	69256314	69256314	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69256314G>A	uc001xkh.1	-	2	1083	c.953C>T	c.(952-954)TCC>TTC	p.S318F	ZFP36L1_uc001xki.1_Missense_Mutation_p.S318F	NM_004926	NP_004917	Q07352	TISB_HUMAN	butyrate response factor 1	318					regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CAAGGTCGGGGAGTCTGAGCC	0.597											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	154	---	---	---	---	PASS
ZFP36L1	677	broad.mit.edu	37	14	69256775	69256775	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69256775G>A	uc001xkh.1	-	2	622	c.492C>T	c.(490-492)ATC>ATT	p.I164I	ZFP36L1_uc001xki.1_Silent_p.I164I	NM_004926	NP_004917	Q07352	TISB_HUMAN	butyrate response factor 1	164	C3H1-type 2.				regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GGCAAAAGCCGATGGTGTGGA	0.687											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	41	---	---	---	---	PASS
BTBD7	55727	broad.mit.edu	37	14	93708927	93708927	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93708927C>G	uc001ybo.2	-	11	3417	c.3091G>C	c.(3091-3093)GAG>CAG	p.E1031Q	BTBD7_uc010aur.2_Missense_Mutation_p.E556Q|BTBD7_uc010two.1_Missense_Mutation_p.E851Q|BTBD7_uc001ybp.2_Missense_Mutation_p.E680Q	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1	1031										pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GGAGGTTGCTCAACGACATCC	0.507													6	233	---	---	---	---	PASS
SNURF	8926	broad.mit.edu	37	15	25213164	25213164	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25213164G>A	uc001ywu.2	+	3	322	c.196G>A	c.(196-198)GAG>AAG	p.E66K	SNRPN_uc001ywp.1_5'UTR|SNRPN_uc001ywq.1_5'UTR|SNRPN_uc001ywr.1_5'UTR|SNRPN_uc001yws.1_Intron|SNRPN_uc001ywt.1_5'UTR|SNRPN_uc001ywv.1_5'UTR|SNRPN_uc001yww.1_5'UTR|SNRPN_uc001ywx.1_5'UTR|SNRPN_uc001ywz.1_Intron|PAR-SN_uc001yxa.1_RNA|SNRPN_uc001ywy.1_Missense_Mutation_p.E66K	NM_022804	NP_073715	Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame protein	66						nucleus					0		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		ATTCTTAGCTGAGACACCAAG	0.473													7	52	---	---	---	---	PASS
GANC	2595	broad.mit.edu	37	15	42641575	42641575	+	Intron	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42641575C>T	uc001zpi.2	+						CAPN3_uc001zpk.1_Intron|CAPN3_uc001zpl.1_Intron	NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C						carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		GTGATTCATTCTCCAGGGTTC	0.378													11	149	---	---	---	---	PASS
EFTUD1	79631	broad.mit.edu	37	15	82512459	82512459	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82512459C>T	uc002bgt.1	-	13	1573	c.1404G>A	c.(1402-1404)GGG>GGA	p.G468G	EFTUD1_uc002bgu.1_Silent_p.G417G	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain	468					mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity			ovary(1)	1						CAATGGCACTCCCATCTTGGG	0.493													13	55	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84683325	84683325	+	Silent	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84683325G>A	uc002bjz.3	+	24	4229	c.4005G>A	c.(4003-4005)AAG>AAA	p.K1335K	ADAMTSL3_uc010bmt.1_Silent_p.K1335K|ADAMTSL3_uc010bmu.1_Silent_p.K1335K	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	1335	Ig-like C2-type 3.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTTGGTTGAAGAGAGGAGGAT	0.418													9	126	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86076934	86076934	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86076934C>G	uc002blv.1	+	4	471	c.301C>G	c.(301-303)CAA>GAA	p.Q101E	AKAP13_uc002bls.2_Missense_Mutation_p.Q101E|AKAP13_uc002blt.1_Missense_Mutation_p.Q101E|AKAP13_uc002blu.1_Missense_Mutation_p.Q101E	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	101					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						TGATGCAGCTCAATTCCTAGC	0.493													20	102	---	---	---	---	PASS
ZNF774	342132	broad.mit.edu	37	15	90904047	90904047	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90904047C>T	uc002bpk.3	+	4	1170	c.984C>T	c.(982-984)TTC>TTT	p.F328F		NM_001004309	NP_001004309	Q6NX45	ZN774_HUMAN	zinc finger protein 774	328	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GGAAGGGCTTCAGAGATAGTT	0.507													14	231	---	---	---	---	PASS
ZNF774	342132	broad.mit.edu	37	15	90904058	90904058	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90904058C>T	uc002bpk.3	+	4	1181	c.995C>T	c.(994-996)TCT>TTT	p.S332F		NM_001004309	NP_001004309	Q6NX45	ZN774_HUMAN	zinc finger protein 774	332	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AGAGATAGTTCTCATTTTGTA	0.507													13	233	---	---	---	---	PASS
ZNF774	342132	broad.mit.edu	37	15	90904152	90904152	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90904152C>T	uc002bpk.3	+	4	1275	c.1089C>T	c.(1087-1089)GTC>GTT	p.V363V		NM_001004309	NP_001004309	Q6NX45	ZN774_HUMAN	zinc finger protein 774	363	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CACATTTGGTCACGCACCAAA	0.483													4	178	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2487156	2487156	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2487156G>C	uc002cqd.1	+	5	461	c.373G>C	c.(373-375)GAA>CAA	p.E125Q	CCNF_uc002cqe.1_5'UTR	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	125					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				GGCCCGCGCAGAAGTGAATGG	0.592													20	225	---	---	---	---	PASS
ZNF200	7752	broad.mit.edu	37	16	3274470	3274470	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3274470G>A	uc002cuj.2	-	5	1242	c.610C>T	c.(610-612)CGA>TGA	p.R204*	ZNF200_uc002cum.3_Nonsense_Mutation_p.R203*|ZNF200_uc010bti.2_Nonsense_Mutation_p.R203*|ZNF200_uc002cuk.2_Nonsense_Mutation_p.R204*|ZNF200_uc002cui.2_Nonsense_Mutation_p.R203*|ZNF200_uc002cul.3_Nonsense_Mutation_p.R203*	NM_003454	NP_003445	P98182	ZN200_HUMAN	zinc finger protein 200 isoform 1	204					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						GTATTTAGTCGTTCCTTTTCC	0.368													31	144	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3900422	3900422	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3900422G>A	uc002cvv.2	-	2	878	c.674C>T	c.(673-675)CCG>CTG	p.P225L	CREBBP_uc002cvw.2_Missense_Mutation_p.P225L	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	225					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGTAGGGTACGGCATTCCAGC	0.582			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				18	85	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18840660	18840660	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18840660G>T	uc002dfm.2	-	54	9914	c.9551C>A	c.(9550-9552)TCT>TAT	p.S3184Y	SMG1_uc010bwb.2_Missense_Mutation_p.S3044Y|SMG1_uc010bwa.2_Missense_Mutation_p.S1915Y	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	3184					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						CTTACAAGAAGAAATACTGGT	0.433													9	35	---	---	---	---	PASS
ITGAM	3684	broad.mit.edu	37	16	31282368	31282368	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31282368C>G	uc002ebq.2	+	6	619	c.521C>G	c.(520-522)TCA>TGA	p.S174*	ITGAM_uc002ebr.2_Nonsense_Mutation_p.S174*	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	174	VWFA.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						GAGTTTGTCTCAACTGTGATG	0.433													29	224	---	---	---	---	PASS
PLCG2	5336	broad.mit.edu	37	16	81892744	81892744	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81892744C>G	uc002fgt.2	+	5	607	c.455C>G	c.(454-456)TCT>TGT	p.S152C	PLCG2_uc010chg.1_Missense_Mutation_p.S152C	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	152					intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						CAGATATATTCTGTGGATCAA	0.373													23	89	---	---	---	---	PASS
FAM92B	339145	broad.mit.edu	37	16	85143960	85143960	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85143960G>A	uc010vok.1	-	2	283	c.127C>T	c.(127-129)CGG>TGG	p.R43W		NM_198491	NP_940893	Q6ZTR7	FA92B_HUMAN	hypothetical protein LOC339145	43										central_nervous_system(1)	1						GCCTTGTCCCGCAGCCGGGCC	0.642													11	59	---	---	---	---	PASS
PITPNA	5306	broad.mit.edu	37	17	1437392	1437392	+	Splice_Site	SNP	C	G	G	rs113883904		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1437392C>G	uc002fst.3	-	9	1024	c.768_splice	c.e9+1	p.E256_splice	PITPNA_uc010cjt.2_Splice_Site_p.E140_splice|PITPNA_uc010cju.2_Splice_Site_p.E154_splice	NM_006224	NP_006215	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha						axon guidance|lipid metabolic process|visual perception	cytoplasm	phosphatidylcholine transmembrane transporter activity|phosphatidylinositol transporter activity|protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		CCCCCACTTACTTCATCCAGC	0.507													6	442	---	---	---	---	PASS
NLGN2	57555	broad.mit.edu	37	17	7318956	7318956	+	Silent	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7318956C>G	uc002ggt.1	+	6	1237	c.1164C>G	c.(1162-1164)CTC>CTG	p.L388L		NM_020795	NP_065846	Q8NFZ4	NLGN2_HUMAN	neuroligin 2 precursor	388	Extracellular (Potential).				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity			central_nervous_system(1)	1		Prostate(122;0.157)				GAGAGGGCCTCAAGTTCGTGG	0.577													24	146	---	---	---	---	PASS
EIF4A1	1973	broad.mit.edu	37	17	7477958	7477958	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7477958C>G	uc002gho.1	+	11	1492	c.167C>G	c.(166-168)TCT>TGT	p.S56C	EIF4A1_uc002ghr.1_Missense_Mutation_p.S56C|EIF4A1_uc002ghq.1_Missense_Mutation_p.S56C|EIF4A1_uc002ghp.1_Missense_Mutation_p.S56C|SNORA48_uc002ghs.1_5'Flank|SNORD10_uc002ght.2_5'Flank	NM_001416	NP_001407	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A	56	Q motif.				nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity			ovary(1)	1						GAGAAGCCCTCTGCCATCCAG	0.517													3	132	---	---	---	---	PASS
AURKB	9212	broad.mit.edu	37	17	8109913	8109913	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8109913C>T	uc002gkm.2	-	7	643	c.582G>A	c.(580-582)AAG>AAA	p.K194K	AURKB_uc010cnu.2_Silent_p.K14K|AURKB_uc002gkn.2_Silent_p.K195K|AURKB_uc010vuu.1_Silent_p.K153K|AURKB_uc002gko.2_RNA	NM_004217	NP_004208	Q96GD4	AURKB_HUMAN	aurora kinase B	194	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|mitotic prometaphase|protein localization to kinetochore	chromosome passenger complex|condensed nuclear chromosome, centromeric region|cytosol|spindle	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(1)|central_nervous_system(1)	4						GAATCACCTTCTTCCCATGGC	0.532													12	105	---	---	---	---	PASS
TADA2A	6871	broad.mit.edu	37	17	35804837	35804837	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35804837G>C	uc002hnt.2	+	8	728	c.571G>C	c.(571-573)GAT>CAT	p.D191H	TADA2A_uc002hnu.1_Missense_Mutation_p.D191H|TADA2A_uc002hnv.2_Missense_Mutation_p.D191H|TADA2A_uc010wdd.1_Missense_Mutation_p.D191H|TADA2A_uc002hnw.2_Missense_Mutation_p.D90H|TADA2A_uc010cvb.2_5'UTR	NM_001488	NP_001479	O75478	TAD2A_HUMAN	transcriptional adaptor 2A isoform a	191					histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4						GAGAGACATTGATTTTGTTGA	0.284													22	290	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37566919	37566919	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37566919G>A	uc002hrv.3	-	17	1767	c.1555C>T	c.(1555-1557)CAA>TAA	p.Q519*	MED1_uc010wee.1_Nonsense_Mutation_p.Q347*|MED1_uc002hru.2_Nonsense_Mutation_p.Q519*	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	519	Interaction with ESR1.|Interaction with THRA.|Interaction with the Mediator complex and THRA.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GTGTCGGCTTGAATGGTTTCA	0.488										HNSCC(31;0.082)			30	95	---	---	---	---	PASS
CDK12	51755	broad.mit.edu	37	17	37618749	37618749	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37618749C>T	uc010cvv.2	+	1	1011	c.425C>T	c.(424-426)TCG>TTG	p.S142L	CDK12_uc010wef.1_Missense_Mutation_p.S142L|CDK12_uc002hrw.3_Missense_Mutation_p.S142L	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	142					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						AAGTCGGGATCGATGAAGGAC	0.502										TCGA Ovarian(9;0.13)			8	94	---	---	---	---	PASS
PGAP3	93210	broad.mit.edu	37	17	37842189	37842189	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37842189G>C	uc002hsj.2	-	2	308	c.265C>G	c.(265-267)CAG>GAG	p.Q89E	ERBB2_uc002hsm.2_5'Flank|ERBB2_uc010cwa.2_5'Flank|PGAP3_uc010cvy.2_5'Flank|PGAP3_uc010wej.1_Missense_Mutation_p.Q89E|PGAP3_uc002hsk.2_Missense_Mutation_p.Q89E|PGAP3_uc010cvz.2_Missense_Mutation_p.Q89E|ERBB2_uc002hsl.2_5'Flank	NM_033419	NP_219487	Q96FM1	PGAP3_HUMAN	per1-like domain containing 1 precursor	89	Lumenal (Potential).				GPI anchor biosynthetic process	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	hydrolase activity, acting on ester bonds			upper_aerodigestive_tract(1)	1						CCATGGAACTGAGGCACTTTG	0.527													3	84	---	---	---	---	PASS
KRTAP4-12	83755	broad.mit.edu	37	17	39280341	39280341	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39280341C>G	uc002hwa.2	-	1	79	c.34G>C	c.(34-36)GAC>CAC	p.D12H		NM_031854	NP_114060	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	12	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCCCTGGTCAGAGCACACA	0.612													15	91	---	---	---	---	PASS
EFTUD2	9343	broad.mit.edu	37	17	42932283	42932283	+	Intron	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42932283C>G	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				GCCCTGTTCTCACCTGTTCCA	0.522													9	115	---	---	---	---	PASS
SKAP1	8631	broad.mit.edu	37	17	46239875	46239875	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46239875C>T	uc002ini.1	-	11	1046	c.934G>A	c.(934-936)GAA>AAA	p.E312K	SKAP1_uc002inj.1_Missense_Mutation_p.E311K|SKAP1_uc010dbd.1_Missense_Mutation_p.E217K|SKAP1_uc010dbe.1_Missense_Mutation_p.E312K	NM_003726	NP_003717	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1 isoform	312	SH3.				positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0						AAGGACAGTTCATCTGGCTGG	0.423													5	41	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49082631	49082631	+	Intron	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49082631G>C	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			AGCTCTAGTGGGGAAAAAACA	0.333													8	25	---	---	---	---	PASS
DNAI2	64446	broad.mit.edu	37	17	72285782	72285782	+	Missense_Mutation	SNP	G	A	A	rs150649080		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72285782G>A	uc002jkf.2	+	5	616	c.517G>A	c.(517-519)GAT>AAT	p.D173N	DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate polypeptide 2	173	WD 1.				cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3						CTGGCACCCCGATGGCAACAG	0.577									Kartagener_syndrome				5	80	---	---	---	---	PASS
ZFP161	7541	broad.mit.edu	37	18	5291996	5291996	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5291996C>G	uc002kmq.2	-	4	372	c.211G>C	c.(211-213)GAT>CAT	p.D71H	ZFP161_uc002kmr.2_Missense_Mutation_p.D71H|ZFP161_uc010dkp.2_Missense_Mutation_p.D71H	NM_003409	NP_003400	O43829	ZF161_HUMAN	zinc finger protein 161 homolog	71	BTB.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GAAGAACTATCAACCTCAAGC	0.373													6	101	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13114219	13114219	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13114219G>C	uc010xac.1	+	42	7338	c.7258G>C	c.(7258-7260)GCT>CCT	p.A2420P	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.A1945P|CEP192_uc002kru.2_Intron|CEP192_uc002krv.2_Missense_Mutation_p.A842P|CEP192_uc002krw.2_Missense_Mutation_p.A569P|CEP192_uc002krx.2_Missense_Mutation_p.A424P|CEP192_uc002kry.2_Intron	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	2420										ovary(4)|pancreas(1)	5						CCGAAGACAAGCTGTGTCAGA	0.398													50	185	---	---	---	---	PASS
KLHL14	57565	broad.mit.edu	37	18	30350010	30350010	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30350010G>A	uc002kxm.1	-	2	933	c.545C>T	c.(544-546)TCG>TTG	p.S182L		NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	182						cytosol|endoplasmic reticulum membrane				ovary(1)	1						GTTCTGCACCGAGATCTGGTC	0.602													24	98	---	---	---	---	PASS
POLRMT	5442	broad.mit.edu	37	19	621805	621805	+	Silent	SNP	C	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:621805C>A	uc002lpf.1	-	10	1949	c.1893G>T	c.(1891-1893)CTG>CTT	p.L631L		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	631					transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCCTTCTCCAGCAGCTGCA	0.682													3	42	---	---	---	---	PASS
CHAF1A	10036	broad.mit.edu	37	19	4430573	4430573	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4430573G>A	uc002mal.2	+	11	1982	c.1882G>A	c.(1882-1884)GAA>AAA	p.E628K		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	628					cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGAGAGGATGAAGATGAGGA	0.463								Chromatin_Structure					27	118	---	---	---	---	PASS
EMR1	2015	broad.mit.edu	37	19	6937662	6937662	+	Intron	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6937662G>C	uc002mfw.2	+						EMR1_uc010dvc.2_Intron|EMR1_uc010dvb.2_Intron|EMR1_uc010xji.1_Intron|EMR1_uc010xjj.1_Intron	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					CCAAGACGGTGAGAGACTGCA	0.587													6	80	---	---	---	---	PASS
MCOLN1	57192	broad.mit.edu	37	19	7593569	7593569	+	Nonsense_Mutation	SNP	C	T	T	rs121908371		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7593569C>T	uc002mgo.2	+	8	1089	c.964C>T	c.(964-966)CGA>TGA	p.R322*	MCOLN1_uc002mgp.2_Nonsense_Mutation_p.R287*	NM_020533	NP_065394	Q9GZU1	MCLN1_HUMAN	mucolipin 1	322					calcium ion transport|cellular iron ion homeostasis|transferrin transport	integral to plasma membrane|late endosome membrane|lysosomal membrane	cation channel activity|iron ion transmembrane transporter activity			breast(1)	1						CTCACTCCTTCGAGGCTTCCT	0.632													7	80	---	---	---	---	PASS
PCP2	126006	broad.mit.edu	37	19	7696640	7696640	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7696640G>C	uc002mgz.2	-	4	573	c.346C>G	c.(346-348)CAG>GAG	p.Q116E	XAB2_uc002mgx.2_5'Flank	NM_174895	NP_777555	Q8IVA1	PCP2_HUMAN	Purkinje cell protein 2	116					signal transduction		GTPase activator activity				0						GTCGGGTCCTGAGGGGTGAGC	0.682													8	50	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10116602	10116602	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10116602G>C	uc002mmq.1	-	3	393	c.307C>G	c.(307-309)CAG>GAG	p.Q103E		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	103	TSP N-terminal.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			AGGACAGACTGATTGGCTGGC	0.622													3	52	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10478851	10478851	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10478851C>T	uc002moc.3	-	5	723	c.345G>A	c.(343-345)ATG>ATA	p.M115I	TYK2_uc010dxe.2_Intron|TYK2_uc002mod.2_Missense_Mutation_p.M115I	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	115	FERM.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CCCGAGGATTCATGCCATGCC	0.592													22	91	---	---	---	---	PASS
HOOK2	29911	broad.mit.edu	37	19	12874590	12874590	+	Silent	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12874590G>C	uc002muy.2	-	21	2001	c.1830C>G	c.(1828-1830)GTC>GTG	p.V610V	HOOK2_uc010xmq.1_Silent_p.V15V|HOOK2_uc002muz.2_Silent_p.V608V	NM_013312	NP_037444	Q96ED9	HOOK2_HUMAN	hook homolog 2 isoform 1	610	Sufficient for interaction with CEP110.|Required for localization to the centrosome and induction of aggresome formation.				early endosome to late endosome transport|endocytosis|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|protein transport	centrosome|FHF complex|microtubule	identical protein binding|microtubule binding			ovary(1)|breast(1)|skin(1)	3						TGGTCTGCATGACCTACAGGT	0.522													3	78	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14627775	14627775	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627775G>T	uc002myz.1	-	2	335	c.295C>A	c.(295-297)CAT>AAT	p.H99N	DNAJB1_uc010xnr.1_5'UTR	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	99					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		AACATGGCATGAGGGTCTCCA	0.537													9	169	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14627804	14627804	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627804G>C	uc002myz.1	-	2	306	c.266C>G	c.(265-267)TCT>TGT	p.S89C	DNAJB1_uc010xnr.1_5'UTR	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	89					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		GTAGCTGAAAGAGGTACCATT	0.542													8	108	---	---	---	---	PASS
CCDC105	126402	broad.mit.edu	37	19	15132520	15132520	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15132520C>G	uc002nae.2	+	5	1233	c.1134C>G	c.(1132-1134)ATC>ATG	p.I378M		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	378					microtubule cytoskeleton organization	microtubule				ovary(1)	1						ACGGTCTCATCAAGGTACGGT	0.572													8	45	---	---	---	---	PASS
FAM129C	199786	broad.mit.edu	37	19	17643146	17643146	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17643146C>G	uc010xpr.1	+	4	492	c.354C>G	c.(352-354)ATC>ATG	p.I118M	FAM129C_uc010xpq.1_Missense_Mutation_p.I118M|FAM129C_uc010xps.1_Missense_Mutation_p.I87M|FAM129C_uc010xpt.1_RNA	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	118											0						GGCAGCCGATCTTCTGTGTTC	0.642													5	117	---	---	---	---	PASS
CAPNS1	826	broad.mit.edu	37	19	36633599	36633599	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36633599G>C	uc002odj.2	+	4	446	c.289G>C	c.(289-291)GAG>CAG	p.E97Q	CAPNS1_uc002odi.1_Missense_Mutation_p.E97Q|CAPNS1_uc002odk.2_Missense_Mutation_p.E97Q|CAPNS1_uc002odl.2_Missense_Mutation_p.E97Q	NM_001749	NP_001740	P04632	CPNS1_HUMAN	calpain, small subunit 1	97	EF-hand 1; atypical.				positive regulation of cell proliferation	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGAGAGTGAGGAGGTCCGGCA	0.622													9	293	---	---	---	---	PASS
ZNF570	148268	broad.mit.edu	37	19	37975515	37975515	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37975515G>A	uc002ogk.1	+	5	1520	c.991G>A	c.(991-993)GAA>AAA	p.E331K	ZNF570_uc010efl.1_Missense_Mutation_p.E387K|ZNF570_uc010xtr.1_Missense_Mutation_p.E128K	NM_144694	NP_653295	Q96NI8	ZN570_HUMAN	zinc finger protein 570	331	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAACCCTATGAATGTATCGA	0.433													6	387	---	---	---	---	PASS
CABP5	56344	broad.mit.edu	37	19	48543956	48543956	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48543956G>C	uc002phu.1	-	3	269	c.144C>G	c.(142-144)ATC>ATG	p.I48M		NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5	48	EF-hand 1.|1 (Potential).				signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		CCTTACAAGAGATGAACCCAT	0.502													7	122	---	---	---	---	PASS
CABP5	56344	broad.mit.edu	37	19	48544017	48544017	+	Intron	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48544017G>C	uc002phu.1	-							NM_019855	NP_062829	Q9NP86	CABP5_HUMAN	calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		TGAAAGTTAAGAGAGAACTTT	0.478													3	68	---	---	---	---	PASS
ZNF114	163071	broad.mit.edu	37	19	48789626	48789626	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48789626G>A	uc002pil.1	+	6	1242	c.745G>A	c.(745-747)GAT>AAT	p.D249N	ZNF114_uc010elv.1_Missense_Mutation_p.D249N|ZNF114_uc002pim.1_Missense_Mutation_p.D249N|ZNF114_uc002pin.2_Missense_Mutation_p.D215N	NM_153608	NP_705836	Q8NC26	ZN114_HUMAN	zinc finger protein 114	249					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		GAAAATGTATGATTTTACTCA	0.473													5	230	---	---	---	---	PASS
RPL13A	23521	broad.mit.edu	37	19	49993803	49993803	+	Missense_Mutation	SNP	C	T	T	rs11539139		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49993803C>T	uc002pny.2	+	4	248	c.226C>T	c.(226-228)CCC>TCC	p.P76S	RPL13A_uc002pnz.2_Missense_Mutation_p.P15S|RPL13A_uc002poa.2_Missense_Mutation_p.P66S|SNORD33_uc010emz.1_5'Flank|SNORD34_uc010ena.1_5'Flank|SNORD35A_uc010enb.1_5'Flank	NM_012423	NP_036555	P40429	RL13A_HUMAN	ribosomal protein L13a	76					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	structural constituent of ribosome				0		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CTTCCGGGCCCCCAGCCGCAT	0.647													3	42	---	---	---	---	PASS
PRRG2	5639	broad.mit.edu	37	19	50093638	50093638	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50093638C>G	uc002pon.3	+	7	766	c.601C>G	c.(601-603)CCT>GCT	p.P201A	PRRG2_uc010yaz.1_Missense_Mutation_p.P178A|PRR12_uc002poo.3_5'Flank	NM_000951	NP_000942	O14669	TMG2_HUMAN	proline rich Gla (G-carboxyglutamic acid) 2	201	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	calcium ion binding			skin(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0121)		CCTCAGGAGGCCTCACTGAAG	0.592													109	156	---	---	---	---	PASS
ZNF808	388558	broad.mit.edu	37	19	53057628	53057628	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53057628G>C	uc010epq.1	+	5	1636	c.1459G>C	c.(1459-1461)GAG>CAG	p.E487Q	ZNF808_uc002pzq.2_RNA|ZNF808_uc010epr.1_5'Flank	NM_001039886	NP_001034975	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	487	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		CAAGTGTAATGAGTGTCGCAA	0.423													25	107	---	---	---	---	PASS
ZNF415	55786	broad.mit.edu	37	19	53612640	53612640	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53612640C>G	uc002qax.2	-	7	1151	c.802G>C	c.(802-804)GAG>CAG	p.E268Q	ZNF415_uc002qat.2_Missense_Mutation_p.E232Q|ZNF415_uc002qaw.2_Missense_Mutation_p.E220Q|ZNF415_uc010yds.1_Missense_Mutation_p.E220Q|ZNF415_uc010ydt.1_Missense_Mutation_p.E220Q|ZNF415_uc002qau.2_Missense_Mutation_p.E207Q|ZNF415_uc002qav.2_Missense_Mutation_p.E232Q|ZNF415_uc002qba.2_5'UTR|ZNF415_uc002qay.2_Missense_Mutation_p.E207Q|ZNF415_uc002qaz.2_Missense_Mutation_p.E268Q	NR_028343		Q09FC8	ZN415_HUMAN	RecName: Full=Zinc finger protein 415;	268	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.0191)		TTGTCGCACTCAATATATCTG	0.383													8	184	---	---	---	---	PASS
ZNF470	388566	broad.mit.edu	37	19	57088950	57088950	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57088950C>A	uc002qnl.3	+	6	1829	c.1153C>A	c.(1153-1155)CGT>AGT	p.R385S	ZNF470_uc010etn.2_Intron	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	385	C2H2-type 6.|Nuclear localization signal (Potential).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		TTCTCTTATACGTCATCGGCG	0.418													3	44	---	---	---	---	PASS
TGM6	343641	broad.mit.edu	37	20	2411091	2411091	+	Splice_Site	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2411091G>A	uc002wfy.1	+	11	1740	c.1679_splice	c.e11-1	p.E560_splice	TGM6_uc010gal.1_Splice_Site_p.E560_splice	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6						cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	TTCCCTTCCAGAGAAGAGAAT	0.433													23	82	---	---	---	---	PASS
VPS16	64601	broad.mit.edu	37	20	2843585	2843585	+	Intron	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2843585C>T	uc002whe.2	+						VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_5'Flank|VPS16_uc002whf.2_Intron|VPS16_uc002whd.2_Intron|VPS16_uc002whg.2_Intron|VPS16_uc002whi.2_5'Flank	NM_022575	NP_072097	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 isoform 1						intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome				ovary(2)|pancreas(1)|skin(1)	4						TAGCCAGTATCCCTGTGCACG	0.587													14	186	---	---	---	---	PASS
CENPB	1059	broad.mit.edu	37	20	3765549	3765549	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3765549C>G	uc002wjk.2	-	1	1789	c.1582G>C	c.(1582-1584)GAC>CAC	p.D528H	CDC25B_uc010zqk.1_5'Flank|CDC25B_uc010zql.1_5'Flank|CDC25B_uc010zqm.1_5'Flank	NM_001810	NP_001801	P07199	CENPB_HUMAN	centromere protein B	528	Asp/Glu-rich (acidic).				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|satellite DNA binding				0						tcatcgtcgtcttcatcttca	0.388													3	63	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8637821	8637821	+	Intron	SNP	T	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8637821T>A	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						TCCGTTGTTTTATTTCCCAGA	0.244													4	32	---	---	---	---	PASS
REM1	28954	broad.mit.edu	37	20	30064251	30064251	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30064251G>A	uc002wwa.2	+	2	287	c.3G>A	c.(1-3)ATG>ATA	p.M1I		NM_014012	NP_054731	O75628	REM1_HUMAN	RAS-like GTP-binding protein REM	1					small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TACCAAAGATGACACTCAACA	0.577													20	103	---	---	---	---	PASS
LOC388796	388796	broad.mit.edu	37	20	37062622	37062622	+	Intron	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37062622G>A	uc002xii.3	-						LOC388796_uc002xig.3_Intron|LOC388796_uc002xih.3_Intron|LOC388796_uc002xij.3_Intron|LOC388796_uc002xif.3_Intron|SNORA71D_uc002xio.1_RNA	NR_015366				Homo sapiens cDNA FLJ12683 fis, clone NT2RM4002457.												0						GGCAGCCCACGATCACTTTCG	0.562													40	143	---	---	---	---	PASS
SLC32A1	140679	broad.mit.edu	37	20	37357039	37357039	+	Silent	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37357039C>G	uc002xjc.2	+	2	1598	c.1335C>G	c.(1333-1335)CTC>CTG	p.L445L		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	445	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	TCACGCTGCTCATGGCCATTT	0.672													3	75	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47592587	47592587	+	Silent	SNP	T	C	C	rs142912624		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47592587T>C	uc002xtx.3	+	14	1961	c.1809T>C	c.(1807-1809)GAT>GAC	p.D603D		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	603					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AAATAGGGGATGGGAAAGGCC	0.532													12	47	---	---	---	---	PASS
B4GALT5	9334	broad.mit.edu	37	20	48252850	48252850	+	Nonstop_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48252850C>G	uc002xuu.3	-	9	1360	c.1166G>C	c.(1165-1167)TGA>TCA	p.*389S		NM_004776	NP_004767	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	389					post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			TCTCTCCTCTCAGTACTCGTT	0.473													29	88	---	---	---	---	PASS
C21orf63	59271	broad.mit.edu	37	21	33887494	33887494	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33887494C>T	uc002ypr.1	+	8	1730	c.1320C>T	c.(1318-1320)TTC>TTT	p.F440F	C21orf63_uc002yps.1_RNA|C21orf63_uc010glw.1_Silent_p.F437F|C21orf63_uc002ypt.1_RNA|C21orf63_uc002ypu.1_Silent_p.F345F|C21orf63_uc011adq.1_3'UTR	NM_058187	NP_478067	P58658	CU063_HUMAN	hypothetical protein LOC59271 precursor	440	Cytoplasmic (Potential).					integral to membrane	sugar binding			ovary(2)|pancreas(1)	3						TGGGCCAGTTCTACTGAAAAC	0.488													4	207	---	---	---	---	PASS
SLC2A11	66035	broad.mit.edu	37	22	24219356	24219356	+	Silent	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24219356C>G	uc002zyn.3	+	5	633	c.534C>G	c.(532-534)CTC>CTG	p.L178L	SLC2A11_uc002zyl.1_Silent_p.L185L|SLC2A11_uc002zym.3_Silent_p.L185L|SLC2A11_uc002zyo.3_RNA|SLC2A11_uc011ajc.1_Silent_p.L185L|SLC2A11_uc011ajd.1_Silent_p.L172L|SLC2A11_uc002zyp.3_Silent_p.L181L	NM_001024938	NP_001020109	Q9BYW1	GTR11_HUMAN	glucose transporter protein 10 isoform c	178	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1						TGGTCGGACTCAGGTAAGCAC	0.547													5	181	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25007114	25007114	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25007114C>T	uc003aan.1	+	5	553	c.66C>T	c.(64-66)CTC>CTT	p.L22L	GGT1_uc003aas.1_Silent_p.L22L|GGT1_uc003aat.1_Silent_p.L22L|GGT1_uc003aau.1_Silent_p.L22L|GGT1_uc003aav.1_Silent_p.L22L|GGT1_uc003aaw.1_Silent_p.L22L|GGT1_uc003aax.1_Silent_p.L22L	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	22	Helical; Signal-anchor for type II membrane protein; (Probable).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	TTGTCGGCCTCTGTCTCTGGC	0.587													3	8	---	---	---	---	PASS
SGSM1	129049	broad.mit.edu	37	22	25294203	25294203	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25294203G>A	uc003abg.2	+	20	2609	c.2452G>A	c.(2452-2454)GAG>AAG	p.E818K	SGSM1_uc003abh.2_Missense_Mutation_p.E757K|SGSM1_uc010guu.1_Missense_Mutation_p.E763K|SGSM1_uc003abj.2_Missense_Mutation_p.E702K|SGSM1_uc003abi.1_Missense_Mutation_p.E738K	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1	818	Rab-GAP TBC.					Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5						GCAGAGCAGCGAGGCCACCAC	0.637													13	41	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31838014	31838014	+	Missense_Mutation	SNP	G	A	A	rs150972596	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31838014G>A	uc003akz.1	-	17	2461	c.2297C>T	c.(2296-2298)TCG>TTG	p.S766L	EIF4ENIF1_uc003akx.1_Missense_Mutation_p.S421L|EIF4ENIF1_uc003aky.1_Missense_Mutation_p.S446L|EIF4ENIF1_uc003ala.1_Missense_Mutation_p.S766L|EIF4ENIF1_uc003alb.1_Missense_Mutation_p.S592L|EIF4ENIF1_uc003akw.1_Missense_Mutation_p.S256L	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	766						nucleus	protein binding|protein transporter activity			ovary(1)	1						GGTGGAACACGAAGACCTCTG	0.498													36	117	---	---	---	---	PASS
SMC1B	27127	broad.mit.edu	37	22	45768062	45768062	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45768062C>G	uc003bgc.2	-	13	2221	c.2169G>C	c.(2167-2169)AAG>AAC	p.K723N	SMC1B_uc003bgd.2_Missense_Mutation_p.K723N|SMC1B_uc003bge.1_Missense_Mutation_p.K506N	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	723	Potential.				chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GGTGCTTCTTCTTAATCATCT	0.333													7	94	---	---	---	---	PASS
TUBGCP6	85378	broad.mit.edu	37	22	50657188	50657188	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50657188C>T	uc003bkb.1	-	21	5277	c.4765G>A	c.(4765-4767)GAG>AAG	p.E1589K	TUBGCP6_uc003bka.1_Missense_Mutation_p.E676K|TUBGCP6_uc010har.1_Missense_Mutation_p.E1581K|TUBGCP6_uc010has.1_RNA	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1589					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GCAAACACCTCGGGCAGGTAC	0.672													17	66	---	---	---	---	PASS
SFRS17A	8227	broad.mit.edu	37	X	1719891	1719891	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1719891G>C	uc004cqa.2	+	5	1688	c.1492G>C	c.(1492-1494)GAG>CAG	p.E498Q	SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_Intron	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	498					B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGCCCCCAAGGAGAGCCCGGC	0.716													4	15	---	---	---	---	PASS
CD99	4267	broad.mit.edu	37	X	2609849	2609849	+	Intron	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2609849C>T	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						CCTGCGTCTTCAGGCCGCGCG	0.627													4	16	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47101546	47101546	+	Silent	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47101546C>T	uc004dhp.2	+	10	1374	c.1374C>T	c.(1372-1374)TTC>TTT	p.F458F	USP11_uc004dhq.2_Silent_p.F185F	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	458					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TGGACACTTTCCACGGCCTCT	0.562													10	44	---	---	---	---	PASS
ZNF182	7569	broad.mit.edu	37	X	47837064	47837064	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47837064C>G	uc004dir.2	-	7	768	c.422G>C	c.(421-423)GGA>GCA	p.G141A	ZNF182_uc004dis.2_Missense_Mutation_p.G122A|ZNF182_uc004dit.2_Missense_Mutation_p.G141A|ZNF182_uc011mlu.1_Missense_Mutation_p.G121A	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1	141					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						AAGTATGTTTCCAAACTCATG	0.353													8	42	---	---	---	---	PASS
RHOXF1	158800	broad.mit.edu	37	X	119249758	119249758	+	Silent	SNP	G	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119249758G>T	uc004esk.1	-	1	90	c.15C>A	c.(13-15)CTC>CTA	p.L5L	uc004esi.1_Intron	NM_139282	NP_644811	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	5					gamete generation|multicellular organismal development|steroid hormone receptor signaling pathway	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGTCGTGGACGAGCGAACGCG	0.597													6	50	---	---	---	---	PASS
RHOXF1	158800	broad.mit.edu	37	X	119249759	119249759	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119249759A>G	uc004esk.1	-	1	89	c.14T>C	c.(13-15)CTC>CCC	p.L5P	uc004esi.1_Intron	NM_139282	NP_644811	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	5					gamete generation|multicellular organismal development|steroid hormone receptor signaling pathway	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GTCGTGGACGAGCGAACGCGC	0.597													7	50	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123554517	123554517	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123554517C>G	uc004euj.2	-	24	4669	c.4605G>C	c.(4603-4605)GAG>GAC	p.E1535D	ODZ1_uc011muj.1_Missense_Mutation_p.E1541D|ODZ1_uc010nqy.2_Missense_Mutation_p.E1542D	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1535	YD 1.|Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GTGAAGCAATCTCATAAATGT	0.458													4	66	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140993644	140993644	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140993644C>G	uc004fbt.2	+	4	740	c.454C>G	c.(454-456)CAA>GAA	p.Q152E	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	152							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGAGTACTCAAAGTCCTTT	0.502										HNSCC(15;0.026)			4	256	---	---	---	---	PASS
DKC1	1736	broad.mit.edu	37	X	154004501	154004501	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154004501C>T	uc004fmm.2	+	14	1588	c.1378C>T	c.(1378-1380)CCA>TCA	p.P460S	DKC1_uc010nvf.2_Missense_Mutation_p.P455S	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1	460	Nuclear and nucleolar localization.				cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CGAGACTCCTCCAGCAGCTCC	0.428									Congenital_Dyskeratosis				16	122	---	---	---	---	PASS
C1orf201	90529	broad.mit.edu	37	1	24706438	24706439	+	Intron	INS	-	G	G	rs138697925	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24706438_24706439insG	uc001bjc.2	-						C1orf201_uc001bja.2_Intron|C1orf201_uc001bjb.2_Intron|C1orf201_uc001bjd.2_Intron|C1orf201_uc001bje.1_Intron|C1orf201_uc001bjf.2_Intron			Q5TH74	CA201_HUMAN	RecName: Full=UPF0490 protein C1orf201;											ovary(1)|breast(1)	2		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.0191)|all_lung(284;0.0251)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.056)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.48e-25)|Colorectal(126;7.29e-08)|COAD - Colon adenocarcinoma(152;3.85e-06)|GBM - Glioblastoma multiforme(114;0.000399)|BRCA - Breast invasive adenocarcinoma(304;0.00107)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00393)|READ - Rectum adenocarcinoma(331;0.0672)|Lung(427;0.145)		AAACTCTGGCAGTAACAATGAT	0.396													5	7	---	---	---	---	
KANK4	163782	broad.mit.edu	37	1	62719084	62719085	+	Intron	INS	-	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62719084_62719085insC	uc001dah.3	-						KANK4_uc001dai.3_Intron|KANK4_uc001daf.3_Intron|KANK4_uc001dag.3_Intron	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38											ovary(3)|skin(2)|lung(1)	6						tttctttctttttttttttttt	0.153													4	3	---	---	---	---	
URB2	9816	broad.mit.edu	37	1	229763687	229763687	+	Intron	DEL	T	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229763687delT	uc001hts.1	+						URB2_uc009xfd.1_Intron|TAF5L_uc001htq.2_5'Flank|TAF5L_uc001htr.2_5'Flank	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog							nucleolus				central_nervous_system(2)|ovary(1)	3						CATTAATACATTTTTTTTTTC	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293343	12293351	+	Intron	DEL	TTCCTTCCC	-	-	rs112549370		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293343_12293351delTTCCTTCCC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		cttcattcctttccttcccttccttccct	0.000													6	3	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61447286	61447287	+	Intron	INS	-	A	A	rs10525195		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61447286_61447287insA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			TTTCCTATCCTaaaaaaaaaaa	0.292													4	2	---	---	---	---	
UGGT1	56886	broad.mit.edu	37	2	128941483	128941484	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs142590190		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128941483_128941484insGTGTGTGTGT	uc002tps.2	+						UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						GTTTTTTCATGgtgtgtgtgtg	0.297													4	3	---	---	---	---	
DNAH7	56171	broad.mit.edu	37	2	196640388	196640388	+	Intron	DEL	C	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196640388delC	uc002utj.3	-						DNAH7_uc002uti.3_Intron	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						AAAAAAAAAACACACGTTCAG	0.159													4	2	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49339623	49339623	+	Intron	DEL	A	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49339623delA	uc003cwq.2	-						USP4_uc003cwo.2_Intron|USP4_uc003cwp.2_Intron|USP4_uc003cwr.2_Intron	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		gtctctatttaaaaaaaaaaa	0.209													4	2	---	---	---	---	
ATP6V1A	523	broad.mit.edu	37	3	113516902	113516902	+	Intron	DEL	C	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113516902delC	uc003eao.2	+						ATP6V1A_uc011bik.1_Intron	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						attgtttgaacccatgaggtg	0.010													4	2	---	---	---	---	
CPB1	1360	broad.mit.edu	37	3	148575476	148575477	+	Intron	INS	-	AA	AA	rs139871842		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148575476_148575477insAA	uc003ewl.2	+							NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			GTTTTCTGTTCAAAAAAAAAAA	0.213													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9053504	9053504	+	IGR	DEL	A	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9053504delA								LOC650293 (101378 upstream) : USP17 (306605 downstream)																							cattacaaacaaaaaaaaaCA	0.224													4	2	---	---	---	---	
ATP10D	57205	broad.mit.edu	37	4	47492948	47492948	+	Intron	DEL	T	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47492948delT	uc003gxk.1	+						ATP10D_uc003gxj.3_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						CAAATACATCTTTTTTTTTTT	0.378													3	3	---	---	---	---	
SMAD1	4086	broad.mit.edu	37	4	146479231	146479232	+	3'UTR	INS	-	A	A	rs34142651		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146479231_146479232insA	uc003ikc.2	+	7					SMAD1_uc003ikd.2_3'UTR|SMAD1_uc010iov.2_3'UTR|SMAD1_uc011cic.1_3'UTR	NM_005900	NP_005891	Q15797	SMAD1_HUMAN	Sma- and Mad-related protein 1						BMP signaling pathway|embryonic pattern specification|primary miRNA processing|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|nuclear inner membrane	co-SMAD binding|I-SMAD binding|identical protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity			ovary(1)	1	all_hematologic(180;0.151)					GAAATTTAAACAAAAAAAAAAA	0.332											OREG0016348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10489309	10489320	+	IGR	DEL	AGAGAGAGAGAC	-	-	rs71582424		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10489309_10489320delAGAGAGAGAGAC								ROPN1L (24172 upstream) : DAP (190023 downstream)																							AGAAaaagaaagagagagagacagagagagag	0.269													4	2	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31840576	31840576	+	Intron	DEL	T	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31840576delT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TCCAGAGGTCTTTTTTTTTTT	0.289													4	3	---	---	---	---	
CHD1	1105	broad.mit.edu	37	5	98199048	98199049	+	Intron	INS	-	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98199048_98199049insA	uc003knf.2	-						CHD1_uc010jbn.2_Intron	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	GGAAAGAAAACAAAAAAAAAAA	0.252													5	3	---	---	---	---	
XPO5	57510	broad.mit.edu	37	6	43492091	43492091	+	Intron	DEL	A	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43492091delA	uc003ovp.2	-						POLR1C_uc003ovo.1_Intron	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			accccatctcaaaaaaaaaaa	0.169													6	3	---	---	---	---	
GTF2H5	404672	broad.mit.edu	37	6	158618450	158618451	+	3'UTR	DEL	AA	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158618450_158618451delAA	uc003qrd.2	+	3						NM_207118	NP_997001	Q6ZYL4	TF2H5_HUMAN	general transcription factor IIH, polypeptide 5						nucleotide-excision repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;5.98e-18)|BRCA - Breast invasive adenocarcinoma(81;2.83e-05)		AACATAAAAGAAAAAAAAaaga	0.134								Direct_reversal_of_damage|NER					4	2	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100230357	100230357	+	Intron	DEL	G	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100230357delG	uc003uvv.1	-						TFR2_uc010lhc.1_Intron|TFR2_uc003uvu.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					aaaaaaaaaagaacctttttt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128210234	128210235	+	IGR	INS	-	TT	TT			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128210234_128210235insTT								METTL2B (67257 upstream) : FLJ45340 (71060 downstream)																							agttttagttcttTTTTTTTTT	0.193													4	2	---	---	---	---	
RP1L1	94137	broad.mit.edu	37	8	10479846	10479846	+	Intron	DEL	A	-	-	rs150586051		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10479846delA	uc003wtc.2	-							NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1						intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		aaacaaagccaaaaaaaaaaa	0.174													6	3	---	---	---	---	
SLC18A1	6570	broad.mit.edu	37	8	20007084	20007087	+	Intron	DEL	TCTC	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20007084_20007087delTCTC	uc011kyq.1	-						SLC18A1_uc003wzl.2_Intron|SLC18A1_uc003wzm.2_Intron|SLC18A1_uc011kyr.1_Intron|SLC18A1_uc003wzn.2_Intron|SLC18A1_uc010ltf.2_Intron|SLC18A1_uc003wzo.2_Intron	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),						neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		TCTGTGtctttctctctctctctc	0.265													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144138674	144138674	+	IGR	DEL	T	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144138674delT								C8orf31 (2954 upstream) : LY6H (100658 downstream)																							attatttttattttttttttt	0.159													4	2	---	---	---	---	
TLE4	7091	broad.mit.edu	37	9	82269146	82269146	+	Intron	DEL	T	-	-	rs35639126		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82269146delT	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5						GTGTGGTTGattttttttttt	0.303													6	3	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137618892	137618893	+	Intron	INS	-	GGAT	GGAT	rs151194206	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137618892_137618893insGGAT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		gatgagtgaacggatggatgga	0.168													3	3	---	---	---	---	
ARHGAP12	94134	broad.mit.edu	37	10	32141657	32141657	+	Intron	DEL	C	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32141657delC	uc001ivz.1	-						ARHGAP12_uc001ivy.1_Intron|ARHGAP12_uc009xls.2_Intron|ARHGAP12_uc001iwb.1_Intron|ARHGAP12_uc001iwc.1_Intron|ARHGAP12_uc009xlq.1_Intron|ARHGAP12_uc001iwd.1_Intron|ARHGAP12_uc009xlr.1_Intron	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				ACAAAAAAttctttttttttt	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	72679194	72679194	+	IGR	DEL	C	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72679194delC								PCBD1 (30653 upstream) : UNC5B (293104 downstream)																							CGCCTCACCGCCCCCGCCCGG	0.607													4	2	---	---	---	---	
NRAP	4892	broad.mit.edu	37	10	115370114	115370114	+	Intron	DEL	A	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115370114delA	uc001laj.2	-						NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Intron|NRAP_uc001lal.3_Intron	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		atctcaaattaaaaaaaaaaa	0.154													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													7	4	---	---	---	---	
HRAS	3265	broad.mit.edu	37	11	534404	534415	+	Intron	DEL	CCCAGGCCCAGC	-	-	rs45443193		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:534404_534415delCCCAGGCCCAGC	uc001lpv.2	-						HRAS_uc010qvw.1_Intron|HRAS_uc010qvx.1_Intron|HRAS_uc010qvy.1_Intron	NM_005343	NP_005334	P01112	RASH_HUMAN	v-Ha-ras Harvey rat sarcoma viral oncogene						activation of MAPKK activity|axon guidance|blood coagulation|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|Ras protein signal transduction|synaptic transmission	cytosol|Golgi membrane|plasma membrane	GTP binding|GTPase activity|protein C-terminus binding			urinary_tract(174)|thyroid(155)|skin(126)|upper_aerodigestive_tract(112)|soft_tissue(37)|prostate(29)|salivary_gland(24)|cervix(23)|stomach(14)|pituitary(10)|lung(9)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|testis(5)|endometrium(4)|bone(3)|large_intestine(2)|oesophagus(2)|penis(2)|kidney(1)|adrenal_gland(1)|thymus(1)	749		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Sulindac(DB00605)	CTCAGCCAGGCCCAGGCCCAGCCCCAGGCCCC	0.698		6	Mis		infrequent sarcomas|rare other types	rhadomyosarcoma|ganglioneuroblastoma|bladder			Costello_syndrome	HNSCC(11;0.0054)			7	4	---	---	---	---	
EPS8L2	64787	broad.mit.edu	37	11	725877	725878	+	Intron	INS	-	C	C	rs144060424	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:725877_725878insC	uc001lqt.2	+						EPS8L2_uc001lqu.2_Intron|EPS8L2_uc010qwk.1_Intron|EPS8L2_uc001lqv.2_Intron|EPS8L2_uc001lqw.2_Intron|EPS8L2_uc001lqx.2_Intron|EPS8L2_uc001lqy.2_Intron	NM_022772	NP_073609	Q9H6S3	ES8L2_HUMAN	epidermal growth factor receptor pathway							cytoplasm				pancreas(1)	1		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGGGTCGCAGCCCCCAGCTTC	0.752													4	3	---	---	---	---	
TRPM5	29850	broad.mit.edu	37	11	2428308	2428337	+	Intron	DEL	CTCGGCCTCACCCAGGTGCTCCCGCTTGTG	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2428308_2428337delCTCGGCCTCACCCAGGTGCTCCCGCTTGTG	uc001lwm.3	-						TRPM5_uc010qxl.1_Intron|TRPM5_uc009ydn.2_Intron	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GACCCGCCACCTCGGCCTCACCCAGGTGCTCCCGCTTGTGCTCGGCCTCA	0.696													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	32139451	32139451	+	IGR	DEL	A	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32139451delA								RCN1 (12180 upstream) : WT1 (269874 downstream)																							ggaaggaaggaaaggagggag	0.104													4	2	---	---	---	---	
GDPD5	81544	broad.mit.edu	37	11	75152589	75152590	+	Intron	DEL	GT	-	-	rs34643232		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75152589_75152590delGT	uc001owo.3	-						GDPD5_uc001owp.3_Intron|GDPD5_uc001own.3_Intron|GDPD5_uc009yuc.2_Intron|GDPD5_uc009yud.2_Intron	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						CTGCCCGACCgtgtgtgtgtgt	0.569													4	5	---	---	---	---	
CLEC4D	338339	broad.mit.edu	37	12	8674036	8674037	+	3'UTR	INS	-	TG	TG	rs138070495	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8674036_8674037insTG	uc001qun.2	+	6						NM_080387	NP_525126	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D						innate immune response	integral to membrane	sugar binding				0	Lung SC(5;0.184)					ACAtgtgtgtatgtgtgtgtgt	0.287													6	3	---	---	---	---	
DCLK1	9201	broad.mit.edu	37	13	36402578	36402579	+	Intron	INS	-	T	T	rs144573272	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36402578_36402579insT	uc001uvf.2	-						DCLK1_uc001uve.3_Intron|DCLK1_uc010teh.1_Intron|DCLK1_uc010abk.2_Intron	NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		ATTTCCTTTCCTTTTTTAAAAA	0.317													3	3	---	---	---	---	
DDHD1	80821	broad.mit.edu	37	14	53513710	53513710	+	Intron	DEL	A	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53513710delA	uc001xai.2	-						DDHD1_uc001xaj.2_Intron|DDHD1_uc001xah.2_Intron|DDHD1_uc001xag.2_Intron	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c						lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					AGATTATAATAAAATATGTTC	0.318													4	2	---	---	---	---	
HSPA2	3306	broad.mit.edu	37	14	65009534	65009535	+	3'UTR	INS	-	T	T	rs148978517	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65009534_65009535insT	uc001xhj.2	+	2					HSPA2_uc001xhk.3_3'UTR	NM_021979	NP_068814	P54652	HSP72_HUMAN	heat shock 70kDa protein 2						response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding			skin(1)	1				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CTCTCTCTCTCTTTTTTTTTGT	0.411													7	5	---	---	---	---	
AHSA1	10598	broad.mit.edu	37	14	77934393	77934396	+	Intron	DEL	TCTT	-	-	rs138877566	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77934393_77934396delTCTT	uc001xtw.2	+						AHSA1_uc010tvk.1_Intron	NM_012111	NP_036243	O95433	AHSA1_HUMAN	activator of heat shock 90kDa protein ATPase						protein folding|response to stress	cytosol|endoplasmic reticulum	ATPase activator activity|chaperone binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		ATCTTCTGCCTCtttttttttttt	0.485													4	2	---	---	---	---	
RAD51	5888	broad.mit.edu	37	15	40993575	40993575	+	Intron	DEL	T	-	-	rs67977099		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40993575delT	uc001zmi.3	+						RAD51_uc010bbw.2_Intron|RAD51_uc010bbx.2_Intron|RAD51_uc001zmk.3_Intron|RAD51_uc001zml.3_Intron|RAD51_uc001zmm.1_Intron|RAD51_uc001zmn.1_Intron	NM_002875	NP_002866	Q06609	RAD51_HUMAN	RAD51 homolog protein isoform 1						DNA recombinase assembly|DNA unwinding involved in replication|mitotic recombination|positive regulation of DNA ligation|protein homooligomerization|reciprocal meiotic recombination	mitochondrial matrix|nucleus|perinuclear region of cytoplasm|PML body	ATP binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|protein C-terminus binding|single-stranded DNA binding|single-stranded DNA-dependent ATPase activity				0		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		tttttctttcttttttttttt	0.124								Homologous_recombination					8	5	---	---	---	---	
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAAC	AAAC	rs140336932	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190	Q86UW2	OSTB_HUMAN	organic solute transporter beta							integral to membrane|plasma membrane					0						CAAGCTGTTaaaaacaaacaaa	0.465													3	3	---	---	---	---	
TLE3	7090	broad.mit.edu	37	15	70347816	70347817	+	Intron	INS	-	G	G	rs72531987	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70347816_70347817insG	uc002asm.2	-						TLE3_uc002ask.2_Intron|TLE3_uc002asl.2_Intron|TLE3_uc010ukd.1_Intron|TLE3_uc010bik.1_Intron|TLE3_uc010bil.1_Intron|TLE3_uc002asn.2_Intron|TLE3_uc002asp.2_Intron|TLE3_uc002aso.2_Intron	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a						organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						CGAGGTAGACATGATTAACAGA	0.520													9	4	---	---	---	---	
MTHFS	10588	broad.mit.edu	37	15	80181816	80181817	+	Intron	INS	-	G	G	rs74835341		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80181816_80181817insG	uc002bex.3	-							NM_006441	NP_006432	P49914	MTHFS_HUMAN	5,10-methenyltetrahydrofolate synthetase						folic acid-containing compound biosynthetic process|formate metabolic process|tetrahydrofolate metabolic process	cytosol|Golgi apparatus|plasma membrane	5-formyltetrahydrofolate cyclo-ligase activity|ATP binding|folic acid binding				0				all cancers(203;0.00467)		AGAAAAAAAAAGGGGGGGGGAC	0.391													9	6	---	---	---	---	
PDIA2	64714	broad.mit.edu	37	16	332904	332912	+	5'UTR	DEL	CCCCTGCTG	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:332904_332912delCCCCTGCTG	uc002cgn.1	+	6					ARHGDIG_uc002cgm.1_3'UTR|PDIA2_uc010bqt.1_5'UTR|PDIA2_uc002cgo.1_5'Flank	NM_006849	NP_006840	Q13087	PDIA2_HUMAN	protein disulfide isomerase A2 precursor						apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding			central_nervous_system(1)|skin(1)	2		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				ACCAGACCCTcccctgctgcccctgctgc	0.541											OREG0003697	type=REGULATORY REGION|Gene=PDIA2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25031511	25031512	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs7498498	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25031511_25031512insGGAAGGAA								ARHGAP17 (4836 upstream) : LCMT1 (91535 downstream)																							gaaggaaggacggaaggaagga	0.144													7	5	---	---	---	---	
TRIM37	4591	broad.mit.edu	37	17	57094987	57094987	+	Intron	DEL	T	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57094987delT	uc002iwy.3	-						TRIM37_uc002iwz.3_Intron|TRIM37_uc002ixa.3_Intron|TRIM37_uc010woc.1_Intron	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein							perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GAGCAGAATCttttttttttt	0.179									Mulibrey_Nanism				4	2	---	---	---	---	
USP32	84669	broad.mit.edu	37	17	58332410	58332410	+	Intron	DEL	T	-	-	rs35284371		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58332410delT	uc002iyo.1	-						USP32_uc002iyn.1_Intron|USP32_uc010wov.1_Intron	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32						protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AATGTAGTTCttttttttttt	0.353													4	2	---	---	---	---	
FTSJ3	117246	broad.mit.edu	37	17	61898063	61898064	+	Intron	INS	-	GCTTGAACCTGGAAGACGG	GCTTGAACCTGGAAGACGG	rs142835534	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61898063_61898064insGCTTGAACCTGGAAGACGG	uc002jbz.2	-						FTSJ3_uc002jca.2_Intron	NM_017647	NP_060117	Q8IY81	RRMJ3_HUMAN	FtsJ homolog 3						RNA methylation|rRNA processing	nucleolus	methyltransferase activity|nucleic acid binding			ovary(1)	1						caaggagaatcaggctgcagtg	0.059													9	7	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46384245	46384246	+	Intron	INS	-	CTAGACAGAG	CTAGACAGAG	rs141966725	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46384245_46384246insCTAGACAGAG	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron|KIAA0427_uc002lde.3_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GAAGTGATTCCCAGTGGCATTG	0.550													4	2	---	---	---	---	
ACAA2	10449	broad.mit.edu	37	18	47328930	47328931	+	Intron	INS	-	A	A	rs74176744		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47328930_47328931insA	uc002ldw.3	-						ACAA2_uc002ldx.3_Intron	NM_006111	NP_006102	P42765	THIM_HUMAN	acetyl-coenzyme A acyltransferase 2						anti-apoptosis|cholesterol biosynthetic process		acetyl-CoA C-acyltransferase activity|protein binding			ovary(1)	1						gactccatctcaaaaaaaaaaa	0.104													7	5	---	---	---	---	
C19orf6	91304	broad.mit.edu	37	19	1014538	1014547	+	Intron	DEL	CGTGATGGGG	-	-	rs143052245		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1014538_1014547delCGTGATGGGG	uc002lqr.1	-						C19orf6_uc002lqq.1_5'Flank|C19orf6_uc002lqs.1_Intron	NM_001033026	NP_001028198	Q4ZIN3	MBRL_HUMAN	membralin isoform 1							cytoplasm|integral to membrane				pancreas(2)|breast(1)	3		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.0252)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGGCCTACGTGATGGGGCGTGATGGGG	0.681													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3298938	3298942	+	IGR	DEL	AAGGA	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3298938_3298942delAAGGA								CELF5 (1867 upstream) : NFIC (60674 downstream)																							gaaggaaaggaaggaaaggaaagga	0.000													9	6	---	---	---	---	
DENND1C	79958	broad.mit.edu	37	19	6469043	6469043	+	Intron	DEL	T	-	-			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6469043delT	uc002mfe.2	-						DENND1C_uc002mfb.2_Intron|DENND1C_uc002mfc.2_Intron|DENND1C_uc002mfd.2_Intron|DENND1C_uc010xje.1_Intron	NM_024898	NP_079174	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1						TTAGTTAGtcttttttttttt	0.264													5	3	---	---	---	---	
PPFIA3	8541	broad.mit.edu	37	19	49644858	49644859	+	Intron	INS	-	GT	GT	rs147872140		TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49644858_49644859insGT	uc002pmr.2	+						PPFIA3_uc010yai.1_Intron|PPFIA3_uc010yaj.1_Intron|PPFIA3_uc002pms.2_Intron|PPFIA3_uc002pmt.2_5'Flank	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3							cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		tgtgtgtatgagtgtgtgtgtg	0.198													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21025306	21025307	+	IGR	INS	-	C	C			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21025306_21025307insC								MED15 (83388 upstream) : POM121L4P (18536 downstream)																							CTCCACCGGGGCCCCCGCCAAC	0.752													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25092133	25092134	+	IGR	INS	-	TCC	TCC	rs140281622	by1000genomes	TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25092133_25092134insTCC								POM121L10P (37019 upstream) : PIWIL3 (22867 downstream)																							ctccttcccattcctcctcctc	0.292													4	3	---	---	---	---	
TRMT2B	79979	broad.mit.edu	37	X	100276463	100276464	+	Intron	INS	-	A	A			TCGA-C5-A1BJ-01	TCGA-C5-A1BJ-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100276463_100276464insA	uc004egq.2	-						TRMT2B_uc004egp.2_Intron|TRMT2B_uc004egr.2_Intron|TRMT2B_uc004egs.2_Intron|TRMT2B_uc004egt.2_Intron|TRMT2B_uc004egu.2_Intron|TRMT2B_uc004egv.2_Intron	NM_024917	NP_079193	Q96GJ1	TRM2_HUMAN	TRM2 tRNA methyltransferase 2 homolog B								tRNA (uracil-5-)-methyltransferase activity			ovary(1)	1						actgaaaatacaaaaattagcc	0.000													4	2	---	---	---	---	
