Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MMEL1	79258	broad.mit.edu	37	1	2527477	2527477	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2527477C>T	uc001ajy.2	-	15	1685	c.1471G>A	c.(1471-1473)GAG>AAG	p.E491K	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	491	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		TTGGACTCCTCGTCCATCCAG	0.627													11	159	---	---	---	---	PASS
CELA2A	63036	broad.mit.edu	37	1	15793878	15793878	+	Intron	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15793878C>T	uc001awk.2	+							NM_033440	NP_254275	P08217	CEL2A_HUMAN	elastase 2A preproprotein						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						TGGCCTTCCTCAGGGAGACTC	0.572													6	41	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16256061	16256061	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16256061C>G	uc001axk.1	+	11	3530	c.3326C>G	c.(3325-3327)TCA>TGA	p.S1109*	SPEN_uc010obp.1_Nonsense_Mutation_p.S1068*	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	1109					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCCATTCCCTCAAAACCACAG	0.453													4	41	---	---	---	---	PASS
ARHGEF19	128272	broad.mit.edu	37	1	16534513	16534513	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16534513G>C	uc001ayc.1	-	3	757	c.620C>G	c.(619-621)TCT>TGT	p.S207C	ARHGEF19_uc009voo.1_5'Flank|ARHGEF19_uc001ayb.1_5'Flank	NM_153213	NP_694945	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	207					regulation of actin cytoskeleton organization	intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		GCGCAGAGAAGAGTGCAGCCG	0.667													18	54	---	---	---	---	PASS
PADI6	353238	broad.mit.edu	37	1	17701997	17701997	+	Intron	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17701997G>A	uc001bak.1	+							NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TGGCATTGGTGAGTGTTGCTC	0.582													4	19	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19477144	19477144	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19477144G>C	uc001bbi.2	-	49	7361	c.7357C>G	c.(7357-7359)CTG>GTG	p.L2453V	UBR4_uc001bbk.1_Missense_Mutation_p.L107V	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2453					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTCTGGTTCAGATTTGAAGGG	0.537													24	245	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19479796	19479796	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19479796G>A	uc001bbi.2	-	46	6835	c.6831C>T	c.(6829-6831)ATC>ATT	p.I2277I	UBR4_uc001bbk.1_5'Flank|UBR4_uc001bbl.1_Silent_p.I214I|UBR4_uc001bbm.1_Silent_p.I1489I	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2277					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GAGCCTTACTGATTGTAGCTG	0.488													4	98	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19479841	19479841	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19479841G>A	uc001bbi.2	-	46	6790	c.6786C>T	c.(6784-6786)GTC>GTT	p.V2262V	UBR4_uc001bbk.1_5'Flank|UBR4_uc001bbl.1_Silent_p.V199V|UBR4_uc001bbm.1_Silent_p.V1474V	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2262					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGATGCTGATGACACTGCTGG	0.522													5	109	---	---	---	---	PASS
USP48	84196	broad.mit.edu	37	1	22032632	22032632	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22032632G>A	uc001bfb.2	-	18	2498	c.2260C>T	c.(2260-2262)CGG>TGG	p.R754W	USP48_uc001bfa.2_Missense_Mutation_p.R292W|USP48_uc010odq.1_Missense_Mutation_p.R766W|USP48_uc009vqc.2_Missense_Mutation_p.R688W|USP48_uc001bfc.2_Missense_Mutation_p.R754W|USP48_uc001bfd.1_5'Flank	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a	754	DUSP 3.				ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ACAAATTTCCGCCACTCTTCT	0.358													9	49	---	---	---	---	PASS
C1orf128	57095	broad.mit.edu	37	1	24112168	24112168	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24112168C>G	uc001bhq.2	+	4	454	c.324C>G	c.(322-324)TAC>TAG	p.Y108*	C1orf128_uc010oeb.1_Nonsense_Mutation_p.Y15*	NM_020362	NP_065095	Q9GZP4	PITH1_HUMAN	chromosome 1 open reading frame 128	108	PITH.										0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.0034)|all_lung(284;0.00519)|Breast(348;0.0222)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.97e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		TTCTCAGGTACAAGAATATTC	0.378													11	84	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24413279	24413279	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24413279C>T	uc001bin.3	-	15	1816	c.1653G>A	c.(1651-1653)TCG>TCA	p.S551S	MYOM3_uc001bim.3_Silent_p.S208S|MYOM3_uc001bio.2_Silent_p.S551S|MYOM3_uc001bip.1_Silent_p.S208S	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	551	Fibronectin type-III 2.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		CAGGGCTTTCCGAGCTGATGG	0.552													27	90	---	---	---	---	PASS
THRAP3	9967	broad.mit.edu	37	1	36754981	36754981	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36754981C>T	uc001cae.3	+	5	1585	c.1361C>T	c.(1360-1362)TCT>TTT	p.S454F	THRAP3_uc001caf.3_Missense_Mutation_p.S454F|THRAP3_uc001cag.1_Missense_Mutation_p.S454F	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	454					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(5)|lung(3)|breast(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAATTTATGTCTAAAGTCATA	0.438			T	USP6	aneurysmal bone cysts								19	64	---	---	---	---	PASS
SLC2A1	6513	broad.mit.edu	37	1	43393491	43393491	+	Intron	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43393491G>A	uc001cik.2	-							NM_006516	NP_006507	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|energy reserve metabolic process|regulation of insulin secretion|water-soluble vitamin metabolic process	integral to membrane|melanosome|membrane fraction|midbody	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			central_nervous_system(2)|pancreas(2)|ovary(1)	5	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	TGTTGAGGATGACGGAGAGGG	0.552													4	9	---	---	---	---	PASS
DHCR24	1718	broad.mit.edu	37	1	55317994	55317994	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55317994G>A	uc001cyc.1	-	9	1592	c.1463C>T	c.(1462-1464)TCC>TTC	p.S488F	DHCR24_uc010ooi.1_Missense_Mutation_p.S131F|DHCR24_uc010ooj.1_Missense_Mutation_p.S302F|DHCR24_uc010ook.1_Missense_Mutation_p.S447F	NM_014762	NP_055577	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase precursor	488					anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1						GTGGTACAAGGAGCCATCAAA	0.597													20	104	---	---	---	---	PASS
DHCR24	1718	broad.mit.edu	37	1	55318065	55318065	+	Intron	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55318065G>C	uc001cyc.1	-						DHCR24_uc010ooi.1_Intron|DHCR24_uc010ooj.1_Intron|DHCR24_uc010ook.1_Intron	NM_014762	NP_055577	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase precursor						anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1						GGAAGCTGCAGAGGCAGAGAA	0.483													20	77	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62739866	62739866	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62739866C>T	uc001dah.3	-	3	1287	c.910G>A	c.(910-912)GAG>AAG	p.E304K	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	304	Pro-rich.									ovary(3)|skin(2)|lung(1)	6						ATGTTGAGCTCGATTTCTTCC	0.582													5	52	---	---	---	---	PASS
ALG6	29929	broad.mit.edu	37	1	63872080	63872080	+	Intron	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63872080C>G	uc010oow.1	+						ALG6_uc001daz.2_Intron|ALG6_uc009waj.2_Intron	NM_013339	NP_037471	Q9Y672	ALG6_HUMAN	dolichyl pyrophosphate Man9GlcNAc2						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity				0						GGTAGGTTTTCAAGCAGCCTG	0.348													11	37	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66058453	66058453	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66058453C>G	uc001dci.2	+	6	810	c.608C>G	c.(607-609)GCC>GGC	p.A203G	LEPR_uc001dcg.2_Missense_Mutation_p.A203G|LEPR_uc001dch.2_Missense_Mutation_p.A203G|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Missense_Mutation_p.A203G|LEPR_uc001dck.2_Missense_Mutation_p.A203G	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	203	Extracellular (Potential).				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		GTGCCAACAGCCAAACTCAAC	0.428													16	66	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76253581	76253581	+	Intron	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76253581G>T	uc001dgy.1	+						RABGGTB_uc009wbt.1_Intron|RABGGTB_uc001dha.1_Intron|SNORD45A_uc009wbu.1_RNA|SNORD45B_uc009wbv.1_5'Flank	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit						protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						CAAGGTCAATGATGTGTTGGC	0.358													3	43	---	---	---	---	PASS
BCAR3	8412	broad.mit.edu	37	1	94047999	94047999	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94047999G>A	uc001dpz.2	-	7	1820	c.1545C>T	c.(1543-1545)TTC>TTT	p.F515F	BCAR3_uc001dqa.2_Silent_p.F515F|BCAR3_uc001dqb.2_Silent_p.F515F|BCAR3_uc001dpx.3_Silent_p.F191F|BCAR3_uc001dpy.2_Silent_p.F424F|BCAR3_uc009wdm.1_Silent_p.F191F	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3	515					response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		CGTTGGGCCTGAAGGAGGAGA	0.493													33	100	---	---	---	---	PASS
CLCC1	23155	broad.mit.edu	37	1	109477412	109477412	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109477412C>T	uc001dwe.1	-	11	1628	c.1536G>A	c.(1534-1536)GCG>GCA	p.A512A	AKNAD1_uc010ovb.1_Intron|CLCC1_uc001dwf.1_Silent_p.A512A|CLCC1_uc001dwg.1_Silent_p.A462A|CLCC1_uc009wes.1_Silent_p.A391A|CLCC1_uc009wet.1_Silent_p.A327A	NM_001048210	NP_001041675	Q96S66	CLCC1_HUMAN	Mid-1-related chloride channel 1 isoform 1	512						endoplasmic reticulum|Golgi apparatus|integral to membrane|nucleus				liver(1)	1		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		GGGCCTTTTCCGCTGCGGGTG	0.597													27	126	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109807135	109807135	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109807135G>C	uc001dxa.3	+	11	5410	c.5349G>C	c.(5347-5349)GAG>GAC	p.E1783D		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1783	Extracellular (Potential).|Laminin G-like 2.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCCATGGGGAGAGCATCAACG	0.607													11	206	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109807624	109807624	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109807624G>C	uc001dxa.3	+	12	5660	c.5599G>C	c.(5599-5601)GAG>CAG	p.E1867Q		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1867	Extracellular (Potential).|EGF-like 6; calcium-binding.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCCATACTGTGAGACCAGGTA	0.602													14	142	---	---	---	---	PASS
OVGP1	5016	broad.mit.edu	37	1	111969081	111969081	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111969081C>G	uc001eba.2	-	3	294	c.238G>C	c.(238-240)GAG>CAG	p.E80Q	OVGP1_uc001eaz.2_Missense_Mutation_p.E20Q|OVGP1_uc010owb.1_5'UTR|OVGP1_uc010owc.1_Missense_Mutation_p.E70Q	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	80					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		TTGTTGAACTCTGGGTAGAGA	0.383													3	93	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113658995	113658995	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113658995G>A	uc001edf.1	+	16	2815	c.2617G>A	c.(2617-2619)GAG>AAG	p.E873K	LRIG2_uc009wgn.1_Missense_Mutation_p.E770K	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	873	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CAGCAACTCTGAGGCAGGCAG	0.478													9	64	---	---	---	---	PASS
AMPD1	270	broad.mit.edu	37	1	115218610	115218610	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115218610G>A	uc001efe.1	-	11	1487	c.1403C>T	c.(1402-1404)TCC>TTC	p.S468F	AMPD1_uc001eff.1_Missense_Mutation_p.S464F	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	468					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GAAATTCTTGGAACGGAACAC	0.433													11	131	---	---	---	---	PASS
CSDE1	7812	broad.mit.edu	37	1	115267844	115267844	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115267844G>C	uc001efk.2	-	15	2217	c.1751C>G	c.(1750-1752)TCA>TGA	p.S584*	CSDE1_uc001efi.2_Nonsense_Mutation_p.S630*|CSDE1_uc001efj.2_RNA|CSDE1_uc001efl.2_Nonsense_Mutation_p.S553*|CSDE1_uc001efm.2_Nonsense_Mutation_p.S599*|CSDE1_uc009wgv.2_Nonsense_Mutation_p.S584*|CSDE1_uc001efn.2_Nonsense_Mutation_p.S553*	NM_001007553	NP_001007554	O75534	CSDE1_HUMAN	upstream of NRAS isoform 1	584					male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding			ovary(1)	1	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTATTACCTGAGTGTGTTTT	0.413													14	203	---	---	---	---	PASS
HMGCS2	3158	broad.mit.edu	37	1	120293417	120293417	+	Intron	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120293417C>G	uc001eid.2	-						HMGCS2_uc010oxj.1_Intron|HMGCS2_uc001eie.2_Intron	NM_005518	NP_005509	P54868	HMCS2_HUMAN	hydroxymethylglutaryl-CoA synthase 2 isoform 1						acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity			ovary(2)	2	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		AACTCTCACTCACCACCTTTA	0.527													4	21	---	---	---	---	PASS
HIST2H2BE	8349	broad.mit.edu	37	1	149857978	149857978	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149857978G>C	uc001etc.2	-	1	255	c.213C>G	c.(211-213)TTC>TTG	p.F71L	HIST2H2AC_uc001etd.2_5'Flank	NM_003528	NP_003519	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	71					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CGATGCGCTCGAAGATGTCGT	0.622													24	285	---	---	---	---	PASS
APH1A	51107	broad.mit.edu	37	1	150240405	150240405	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150240405G>A	uc001ety.1	-	2	558	c.236C>T	c.(235-237)TCT>TTT	p.S79F	APH1A_uc010pbx.1_Intron|APH1A_uc001etz.1_Missense_Mutation_p.S79F|APH1A_uc001eua.1_Missense_Mutation_p.S79F|APH1A_uc010pby.1_Intron|APH1A_uc001eub.1_Intron|APH1A_uc010pbz.1_Intron	NM_001077628	NP_001071096	Q96BI3	APH1A_HUMAN	anterior pharynx defective 1 homolog A isoform	79	Helical; Name=3; (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	protein binding	p.S79C(1)		ovary(1)|lung(1)	2	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TAGAAGGACAGAGACAGCAGC	0.557													34	166	---	---	---	---	PASS
THBS3	7059	broad.mit.edu	37	1	155168227	155168227	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155168227G>A	uc001fix.2	-	17	2070	c.2047C>T	c.(2047-2049)CCC>TCC	p.P683S	RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Missense_Mutation_p.P674S|THBS3_uc001fiz.2_Missense_Mutation_p.P646S|THBS3_uc001fiy.2_Missense_Mutation_p.P212S|THBS3_uc010pfu.1_Missense_Mutation_p.P563S|THBS3_uc010pfv.1_RNA	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor	683	TSP type-3 7.				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TTGGGATTGGGTACCAGGCGG	0.547													12	220	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157773666	157773666	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157773666C>G	uc001frg.2	-	3	401	c.288G>C	c.(286-288)TTG>TTC	p.L96F	FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Missense_Mutation_p.L96F|FCRL1_uc001fri.2_Missense_Mutation_p.L96F|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	96	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCCTGCTCCTCAAGACTTTGG	0.557													10	58	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157789795	157789795	+	Intron	SNP	A	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157789795A>G	uc001frg.2	-						FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TGCCCAACTCACCACAGATCA	0.517													10	52	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158639538	158639538	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158639538G>A	uc001fst.1	-	13	1837	c.1638C>T	c.(1636-1638)GAC>GAT	p.D546D		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	546	Spectrin 6.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AATCATAATGGTCATCACCAA	0.408													63	70	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167088639	167088639	+	Silent	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167088639G>T	uc001geb.1	+	4	591	c.591G>T	c.(589-591)GTG>GTT	p.V197V		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	197					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						TTCCTGAGGTGGACATTTCCC	0.567													4	102	---	---	---	---	PASS
MPZL1	9019	broad.mit.edu	37	1	167757061	167757061	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167757061C>T	uc001geo.2	+	6	915	c.713C>T	c.(712-714)CCA>CTA	p.P238L	MPZL1_uc001gep.2_Nonsense_Mutation_p.Q204*|MPZL1_uc001geq.2_Missense_Mutation_p.P88L|MPZL1_uc009wvh.2_RNA	NM_003953	NP_003944	O95297	MPZL1_HUMAN	myelin protein zero-like 1 isoform a	238	Cytoplasmic (Potential).				cell-cell signaling|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	protein binding|structural molecule activity			ovary(2)	2	all_hematologic(923;0.215)					TTCCAGGGCCCAGTCATATAT	0.473													31	88	---	---	---	---	PASS
C1orf129	80133	broad.mit.edu	37	1	170967418	170967418	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170967418G>A	uc001ghg.2	+	15	1729	c.1599G>A	c.(1597-1599)GTG>GTA	p.V533V	C1orf129_uc009wvy.2_Silent_p.V340V|C1orf129_uc010plz.1_Intron	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	533							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TCACTGAAGTGAGTTTTGTAG	0.398													11	61	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179561978	179561978	+	Silent	SNP	G	A	A	rs144528038		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179561978G>A	uc001gnf.1	+	2	478	c.228G>A	c.(226-228)CTG>CTA	p.L76L	TDRD5_uc010pnp.1_Silent_p.L76L|uc010pno.1_5'Flank	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	76	Lotus/OST-HTH 1.				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						CTGTAATACTGAAAGGTAGGT	0.403													13	106	---	---	---	---	PASS
QSOX1	5768	broad.mit.edu	37	1	180165521	180165521	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180165521C>T	uc001gnz.2	+	12	1668	c.1593C>T	c.(1591-1593)CTC>CTT	p.L531L	QSOX1_uc001gny.2_Silent_p.L531L|QSOX1_uc001goa.2_Silent_p.L531L|QSOX1_uc001goc.2_Silent_p.L73L|FLJ23867_uc001god.3_5'Flank	NM_002826	NP_002817	O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1 isoform a	531					cell redox homeostasis|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity			ovary(1)|central_nervous_system(1)	2						TCAACTTCCTCAAGGCCCACT	0.617													19	352	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197237592	197237592	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197237592C>T	uc001gtz.2	+	1	185	c.50C>T	c.(49-51)TCA>TTA	p.S17L	CRB1_uc010poz.1_Intron|CRB1_uc001gty.1_Missense_Mutation_p.S17L|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.S17L|CRB1_uc010ppb.1_Missense_Mutation_p.S17L	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	17					cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						CTCAGTTTCTCACTGCTTATC	0.383													11	79	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200959075	200959075	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200959075C>G	uc001gvs.1	-	21	3444	c.3127G>C	c.(3127-3129)GAC>CAC	p.D1043H	KIF21B_uc001gvr.1_Missense_Mutation_p.D1043H|KIF21B_uc009wzl.1_Missense_Mutation_p.D1043H|KIF21B_uc010ppn.1_Missense_Mutation_p.D1043H	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	1043					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						CTTACCTTGTCAATGGATGCC	0.468													5	83	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207785320	207785320	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207785320A>G	uc001hfy.2	+	31	5299	c.5159A>G	c.(5158-5160)CAT>CGT	p.H1720R	CR1_uc001hfx.2_Missense_Mutation_p.H2170R	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1720	Extracellular (Potential).|Sushi 27.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						CAACTCCCTCATGGCCGTGTG	0.483													62	449	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214171506	214171506	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214171506C>T	uc001hkh.2	+	2	1900	c.1628C>T	c.(1627-1629)CCG>CTG	p.P543L	PROX1_uc001hkg.1_Missense_Mutation_p.P543L	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	543					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CCAGCACACCCGCCCAGCACC	0.522													5	166	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222801802	222801802	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222801802G>A	uc001hnl.2	+	4	1249	c.1240G>A	c.(1240-1242)GAT>AAT	p.D414N	MIA3_uc009xea.1_Missense_Mutation_p.D250N	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	414	Extracellular (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		AGAAAAAGAAGATGATGATGA	0.413													36	132	---	---	---	---	PASS
LEFTY2	7044	broad.mit.edu	37	1	226127637	226127637	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226127637G>A	uc001hpt.1	-	2	396	c.316C>T	c.(316-318)CGG>TGG	p.R106W	LEFTY2_uc010pvk.1_Intron|LEFTY2_uc009xek.1_Intron	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	106					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					GGCGGCAGCCGCTGCTCCATG	0.726													4	10	---	---	---	---	PASS
PARP1	142	broad.mit.edu	37	1	226578157	226578157	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226578157C>G	uc001hqd.3	-	4	742	c.571G>C	c.(571-573)GAT>CAT	p.D191H		NM_001618	NP_001609	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase family, member 1	191	PARP-type 2.|				cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			lung(3)|ovary(2)|breast(2)|skin(2)|upper_aerodigestive_tract(1)	10	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GCTTCTTTATCCTCTGTAGCA	0.587								Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					12	86	---	---	---	---	PASS
HIST3H2BB	128312	broad.mit.edu	37	1	228645863	228645863	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228645863C>G	uc001hsz.2	+	1	56	c.33C>G	c.(31-33)CCC>CCG	p.P11P	HIST3H2A_uc001hsy.2_5'Flank	NM_175055	NP_778225	Q8N257	H2B3B_HUMAN	histone cluster 3, H2bb	11					nucleosome assembly	nucleosome|nucleus	DNA binding			skin(1)	1		Prostate(94;0.183)				CTCCTGCGCCCAAGAAGGGTT	0.532													9	130	---	---	---	---	PASS
C1orf131	128061	broad.mit.edu	37	1	231376777	231376777	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231376777G>T	uc001hun.1	-	1	148	c.111C>A	c.(109-111)TAC>TAA	p.Y37*	C1orf131_uc001hul.2_Nonsense_Mutation_p.Y37*|C1orf131_uc001hum.2_Nonsense_Mutation_p.Y37*|C1orf131_uc010pwd.1_Nonsense_Mutation_p.Y37*|C1orf131_uc001huo.1_Nonsense_Mutation_p.Y37*|GNPAT_uc009xfo.1_5'Flank|GNPAT_uc001hup.3_5'Flank|GNPAT_uc009xfp.2_5'Flank	NM_152379	NP_689592	Q8NDD1	CA131_HUMAN	hypothetical protein LOC128061	37										central_nervous_system(1)|skin(1)	2	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				CACCAAAGTCGTAAAGGTTCT	0.602													14	222	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232650310	232650310	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232650310G>A	uc001hvg.2	-	1	934	c.776C>T	c.(775-777)TCA>TTA	p.S259L		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	259					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				ATCTAATCCTGAGATGCGGAC	0.502													24	83	---	---	---	---	PASS
GPR137B	7107	broad.mit.edu	37	1	236341882	236341882	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236341882C>G	uc001hxq.2	+	3	724	c.633C>G	c.(631-633)ATC>ATG	p.I211M	GPR137B_uc001hxr.1_Translation_Start_Site|GPR137B_uc009xge.2_RNA	NM_003272	NP_003263	O60478	G137B_HUMAN	G protein-coupled receptor 137B	211	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			CTCTCTCCATCTGTCTCTACA	0.473													24	155	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236744565	236744565	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236744565C>A	uc001hyd.1	-	20	2837	c.2712G>T	c.(2710-2712)CAG>CAT	p.Q904H	HEATR1_uc009xgh.1_Missense_Mutation_p.Q147H	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	904					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACTGTGTCTTCTGAGAAGAAA	0.413													8	176	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237774171	237774171	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237774171G>A	uc001hyl.1	+	36	4913	c.4793G>A	c.(4792-4794)AGA>AAA	p.R1598K		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1598	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGTGGAGCAGAATGCCCAAC	0.547													7	17	---	---	---	---	PASS
KIF26B	55083	broad.mit.edu	37	1	245850144	245850144	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245850144G>A	uc001ibf.1	+	12	4299	c.3859G>A	c.(3859-3861)GCG>ACG	p.A1287T	KIF26B_uc001ibg.1_Missense_Mutation_p.A905T|KIF26B_uc001ibh.1_Missense_Mutation_p.A529T	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1287					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGAGATGAGCGCGGGCAGTGA	0.607													6	32	---	---	---	---	PASS
ZNF692	55657	broad.mit.edu	37	1	249144939	249144939	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249144939G>A	uc001ifc.1	-	11	1362	c.1195C>T	c.(1195-1197)CGC>TGC	p.R399C	ZNF692_uc001iez.1_Missense_Mutation_p.R121C|ZNF692_uc001ifa.1_Missense_Mutation_p.R121C|ZNF692_uc001ifb.1_Missense_Mutation_p.R195C|ZNF692_uc001ifd.1_Missense_Mutation_p.R398C|ZNF692_uc001ife.1_RNA|ZNF692_uc001iff.1_Missense_Mutation_p.R354C|ZNF692_uc010pzr.1_Missense_Mutation_p.R404C	NM_017865	NP_060335	Q9BU19	ZN692_HUMAN	zinc finger protein 692 isoform 2	399	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CTGCTAGTGCGGAAAGACCGG	0.612													3	94	---	---	---	---	PASS
TCF23	150921	broad.mit.edu	37	2	27373157	27373157	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27373157G>A	uc010ylg.1	+	2	389	c.389G>A	c.(388-390)CGC>CAC	p.R130H		NM_175769	NP_786951	Q7RTU1	TCF23_HUMAN	transcription factor 23	130	Helix-loop-helix motif.				cell differentiation|muscle organ development|regulation of transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCTCACCCGCACACTCGGC	0.652													6	260	---	---	---	---	PASS
GTF3C2	2976	broad.mit.edu	37	2	27565859	27565859	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27565859G>A	uc002rjv.1	-	4	766	c.403C>T	c.(403-405)CTG>TTG	p.L135L	GTF3C2_uc002rju.1_Silent_p.L146L|GTF3C2_uc002rjw.1_Silent_p.L135L|GTF3C2_uc010eyz.1_Silent_p.L135L	NM_001521	NP_001512	Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide	135						transcription factor TFIIIC complex				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGTGGACAGAGGGTTGGAT	0.532													47	128	---	---	---	---	PASS
GTF3C2	2976	broad.mit.edu	37	2	27565900	27565900	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27565900G>T	uc002rjv.1	-	4	725	c.362C>A	c.(361-363)TCA>TAA	p.S121*	GTF3C2_uc002rju.1_Nonsense_Mutation_p.S132*|GTF3C2_uc002rjw.1_Nonsense_Mutation_p.S121*|GTF3C2_uc010eyz.1_Nonsense_Mutation_p.S121*	NM_001521	NP_001512	Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide	121						transcription factor TFIIIC complex				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGTGGGGCTGATGGAGGATT	0.557													39	112	---	---	---	---	PASS
TTC27	55622	broad.mit.edu	37	2	32889467	32889467	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32889467G>A	uc002rom.2	+	6	969	c.738G>A	c.(736-738)GAG>GAA	p.E246E	TTC27_uc010ymx.1_Silent_p.E196E	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	246							protein binding			central_nervous_system(1)	1						ATTATTATGAGTACAGAAAAG	0.313													41	124	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39552661	39552661	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39552661C>G	uc002rro.2	-	12	1007	c.916G>C	c.(916-918)GAG>CAG	p.E306Q	MAP4K3_uc002rrp.2_Missense_Mutation_p.E306Q|MAP4K3_uc010yns.1_5'UTR	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	306					JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				ATTCCTACCTCAGGATCATCA	0.289													4	36	---	---	---	---	PASS
EPAS1	2034	broad.mit.edu	37	2	46603685	46603685	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46603685G>A	uc002ruv.2	+	9	1530	c.1042G>A	c.(1042-1044)GAG>AAG	p.E348K		NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	348					angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TAGTGAGATTGAGAAGAATGA	0.488													20	271	---	---	---	---	PASS
FANCL	55120	broad.mit.edu	37	2	58388716	58388716	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58388716C>T	uc002rzw.3	-	12	1028	c.961G>A	c.(961-963)GAT>AAT	p.D321N	FANCL_uc002rzx.3_Missense_Mutation_p.D326N|FANCL_uc010fce.2_Missense_Mutation_p.D293N|FANCL_uc010fcf.1_Missense_Mutation_p.D262N	NM_018062	NP_060532	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L isoform	321	RING-type.				DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						CACACTTGATCAGGAATGGTA	0.313								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				17	51	---	---	---	---	PASS
AMMECR1L	83607	broad.mit.edu	37	2	128628868	128628868	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128628868G>C	uc002tpl.2	-	4	724	c.473C>G	c.(472-474)TCA>TGA	p.S158*	AMMECR1L_uc002tpm.2_Nonsense_Mutation_p.S158*	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN	AMME chromosomal region gene 1-like	158	AMMECR1.									central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		ATTCATGGCTGAGAAGGTCCC	0.458													5	36	---	---	---	---	PASS
CACNB4	785	broad.mit.edu	37	2	152695761	152695761	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152695761G>A	uc002tya.2	-	14	1503	c.1435C>T	c.(1435-1437)CAG>TAG	p.Q479*	CACNB4_uc002txy.2_Nonsense_Mutation_p.Q445*|CACNB4_uc002txz.2_Nonsense_Mutation_p.Q461*|CACNB4_uc010fnz.2_Nonsense_Mutation_p.Q417*	NM_000726	NP_000717	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4	479					axon guidance|membrane depolarization|synaptic transmission	cytosol|internal side of plasma membrane|plasma membrane|synapse|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.156)	Verapamil(DB00661)	CGGCTATGCTGAGAACTGGAA	0.458													28	43	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162757477	162757477	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162757477G>C	uc002ubx.3	+	12	1582	c.1398G>C	c.(1396-1398)GAG>GAC	p.E466D	SLC4A10_uc010fpa.1_Missense_Mutation_p.E478D|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.E436D|SLC4A10_uc010zcs.1_Missense_Mutation_p.E447D	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	466	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GGGAAGCAGAGCCCCACGGAG	0.438													2	1	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178096193	178096193	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178096193C>G	uc002ulh.3	-	5	1693	c.1138G>C	c.(1138-1140)GAG>CAG	p.E380Q	NFE2L2_uc002ulg.3_Missense_Mutation_p.E364Q|NFE2L2_uc010zfa.1_Missense_Mutation_p.E357Q|NFE2L2_uc002uli.3_Missense_Mutation_p.E364Q	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	380					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			CTATCTAGCTCTTCCACTTCA	0.478			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			33	146	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178097218	178097218	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178097218C>A	uc002ulh.3	-	4	1051	c.496G>T	c.(496-498)GAA>TAA	p.E166*	NFE2L2_uc002ulg.3_Nonsense_Mutation_p.E150*|NFE2L2_uc010zfa.1_Nonsense_Mutation_p.E143*|NFE2L2_uc002uli.3_Nonsense_Mutation_p.E150*|NFE2L2_uc010fra.2_3'UTR	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	166					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACAGAAGTTTCAGGTGACTGA	0.458			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			10	44	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179433734	179433734	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179433734C>T	uc010zfg.1	-	275	69645	c.69421G>A	c.(69421-69423)GAT>AAT	p.D23141N	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D16836N|TTN_uc010zfi.1_Missense_Mutation_p.D16769N|TTN_uc010zfj.1_Missense_Mutation_p.D16644N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24068							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGGTGACATCATCCACAGTT	0.438													11	64	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179585223	179585223	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179585223C>T	uc010zfg.1	-	77	19758	c.19534G>A	c.(19534-19536)GAT>AAT	p.D6512N	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.D3173N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	7439							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGACTTGTATCAAAATGTTTT	0.393													10	14	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179616503	179616503	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179616503G>A	uc002unb.2	-	46	10848	c.10624C>T	c.(10624-10626)CGG>TGG	p.R3542W	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGATGGGCCGATTGTTATGA	0.393													3	25	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179641067	179641067	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179641067C>T	uc010zfg.1	-	28	5748	c.5524G>A	c.(5524-5526)GAC>AAC	p.D1842N	TTN_uc010zfh.1_Missense_Mutation_p.D1796N|TTN_uc010zfi.1_Missense_Mutation_p.D1796N|TTN_uc010zfj.1_Missense_Mutation_p.D1796N|TTN_uc002unb.2_Missense_Mutation_p.D1842N|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1842							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGACAATGTCTGGCTTTTGC	0.473													13	76	---	---	---	---	PASS
PMS1	5378	broad.mit.edu	37	2	190719324	190719324	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190719324T>A	uc002urh.3	+	9	1855	c.1326T>A	c.(1324-1326)AGT>AGA	p.S442R	PMS1_uc010zga.1_Missense_Mutation_p.S403R|PMS1_uc010zgb.1_Missense_Mutation_p.S381R|PMS1_uc002urk.3_Missense_Mutation_p.S403R|PMS1_uc002uri.3_Missense_Mutation_p.S442R|PMS1_uc010zgc.1_Missense_Mutation_p.S266R|PMS1_uc010zgd.1_Missense_Mutation_p.S266R|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.S403R|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Missense_Mutation_p.S227R|PMS1_uc002urm.2_RNA|PMS1_uc002urn.1_Missense_Mutation_p.S110R	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	442					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TTTCAATGAGTAATGTATCAT	0.338			Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					3	54	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215855600	215855600	+	Nonsense_Mutation	SNP	A	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215855600A>C	uc002vew.2	-	24	3670	c.3450T>G	c.(3448-3450)TAT>TAG	p.Y1150*	ABCA12_uc002vev.2_Nonsense_Mutation_p.Y832*|ABCA12_uc010zjn.1_Nonsense_Mutation_p.Y77*	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	1150	Helical; (Potential).				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGTCCGAAAAATACAGGAACA	0.393													34	48	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225662651	225662651	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225662651C>G	uc010fwz.1	-	42	4781	c.4542G>C	c.(4540-4542)TTG>TTC	p.L1514F	DOCK10_uc002vob.2_Missense_Mutation_p.L1508F|DOCK10_uc002voa.2_Missense_Mutation_p.L170F|DOCK10_uc002voc.2_Missense_Mutation_p.L368F	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1514							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CCCTTTTCATCAATGAATTTT	0.353													5	32	---	---	---	---	PASS
SUMF1	285362	broad.mit.edu	37	3	4458918	4458918	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4458918G>C	uc003bpz.1	-	6	759	c.734C>G	c.(733-735)CCC>CGC	p.P245R	SUMF1_uc003bps.1_RNA|SUMF1_uc011ass.1_Missense_Mutation_p.P220R|SUMF1_uc010hby.1_Missense_Mutation_p.P245R|SUMF1_uc011ast.1_Intron	NM_182760	NP_877437	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1 isoform 1	245						endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		GTTGCCCCAGGGGAAAAGTCT	0.498													16	41	---	---	---	---	PASS
OXTR	5021	broad.mit.edu	37	3	8809033	8809033	+	Missense_Mutation	SNP	C	T	T	rs144814761	byFrequency	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8809033C>T	uc003brc.2	-	3	1463	c.841G>A	c.(841-843)GTG>ATG	p.V281M		NM_000916	NP_000907	P30559	OXYR_HUMAN	oxytocin receptor	281	Helical; Name=6; (Potential).				female pregnancy|lactation|muscle contraction	integral to plasma membrane	oxytocin receptor activity|vasopressin receptor activity				0				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)	AAGGCCAGCACGATGATGAAA	0.627													12	26	---	---	---	---	PASS
MYRIP	25924	broad.mit.edu	37	3	40223858	40223858	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40223858G>A	uc003cka.2	+	9	1156	c.1021G>A	c.(1021-1023)GAA>AAA	p.E341K	MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Missense_Mutation_p.E341K|MYRIP_uc010hhw.2_Missense_Mutation_p.E252K|MYRIP_uc011ayz.1_Missense_Mutation_p.E154K|uc003ckb.2_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	341	Myosin-binding.				intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CAGGCTGGATGAAACAAGTAA	0.527													12	19	---	---	---	---	PASS
ZNF589	51385	broad.mit.edu	37	3	48309748	48309748	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48309748C>G	uc003csl.3	+	4	633	c.567C>G	c.(565-567)CTC>CTG	p.L189L	ZNF589_uc010hjt.1_Silent_p.L186L|ZNF589_uc003csn.2_RNA|ZNF589_uc011bbg.1_Intron|ZNF589_uc003csm.2_Intron	NM_016089	NP_057173	Q86UQ0	ZN589_HUMAN	zinc finger protein 589	189					regulation of transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGATACAGCTCAGTCCAGCCC	0.502													3	89	---	---	---	---	PASS
FBXW12	285231	broad.mit.edu	37	3	48423302	48423302	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48423302C>T	uc003csr.2	+	9	1284	c.1098C>T	c.(1096-1098)TTC>TTT	p.F366F	FBXW12_uc010hjv.2_Silent_p.F347F|FBXW12_uc003css.2_Silent_p.F296F|FBXW12_uc010hjw.2_Silent_p.F265F	NM_207102	NP_996985	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12 isoform	366	WD 4.										0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGTTACTCTTCAGCATCACTG	0.473													24	57	---	---	---	---	PASS
DAG1	1605	broad.mit.edu	37	3	49569696	49569696	+	Silent	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49569696C>A	uc003cxc.3	+	3	2170	c.1752C>A	c.(1750-1752)GGC>GGA	p.G584G		NM_004393	NP_004384	Q14118	DAG1_HUMAN	dystroglycan 1 preproprotein	584	Peptidase S72.				cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		ACAAGGGGGGCCTGTCGGCTG	0.597													4	28	---	---	---	---	PASS
RNF123	63891	broad.mit.edu	37	3	49738941	49738941	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49738941C>A	uc003cxh.2	+	16	1381	c.1295C>A	c.(1294-1296)TCC>TAC	p.S432Y	RNF123_uc010hky.1_Missense_Mutation_p.S94Y|RNF123_uc003cxi.2_RNA	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	432						cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GTGCTCCGCTCCGTCGTCTTC	0.637											OREG0015570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	82	---	---	---	---	PASS
CAMKV	79012	broad.mit.edu	37	3	49898658	49898658	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49898658C>G	uc003cxt.1	-	6	710	c.517G>C	c.(517-519)GAA>CAA	p.E173Q	CAMKV_uc011bcy.1_Missense_Mutation_p.E98Q|CAMKV_uc003cxv.1_Missense_Mutation_p.E173Q|CAMKV_uc003cxw.1_5'UTR|CAMKV_uc003cxx.1_5'UTR|CAMKV_uc003cxu.2_Missense_Mutation_p.E173Q|CAMKV_uc011bcz.1_Missense_Mutation_p.E136Q|CAMKV_uc011bda.1_Missense_Mutation_p.E130Q|CAMKV_uc011bdb.1_RNA	NM_024046	NP_076951	Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	173	Protein kinase.					cytoplasmic vesicle membrane|plasma membrane	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|large_intestine(2)|central_nervous_system(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		AGGCCATTTTCTAGCTTAGCC	0.567													5	52	---	---	---	---	PASS
RRP9	9136	broad.mit.edu	37	3	51969651	51969651	+	Missense_Mutation	SNP	C	T	T	rs147742914		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51969651C>T	uc003dbw.1	-	9	832	c.793G>A	c.(793-795)GTG>ATG	p.V265M		NM_004704	NP_004695	O43818	U3IP2_HUMAN	RNA, U3 small nucleolar interacting protein 2	265	WD 3.				rRNA processing	nucleolus|small nuclear ribonucleoprotein complex|small nucleolar ribonucleoprotein complex	RNA binding			breast(2)|ovary(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CACACCTTCACGGAGCGATCG	0.592													6	44	---	---	---	---	PASS
SFMBT1	51460	broad.mit.edu	37	3	52947485	52947485	+	Intron	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52947485G>C	uc003dgf.2	-						SFMBT1_uc010hmr.2_Intron|SFMBT1_uc003dgg.2_Intron|SFMBT1_uc003dgh.2_Intron	NM_001005159	NP_001005159	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		CTCTAGGCCAGAACCTTACCT	0.443													9	19	---	---	---	---	PASS
PTPRG	5793	broad.mit.edu	37	3	62263226	62263226	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62263226G>A	uc003dlb.2	+	26	4356	c.3637G>A	c.(3637-3639)GGC>AGC	p.G1213S	PTPRG_uc003dlc.2_Missense_Mutation_p.G1184S|PTPRG_uc011bfi.1_Missense_Mutation_p.G459S|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1213	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity	p.G1213D(1)		ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCAACTGAAGGGCTATTATAG	0.338													7	9	---	---	---	---	PASS
HTR1F	3355	broad.mit.edu	37	3	88040735	88040735	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88040735G>A	uc003dqr.2	+	2	994	c.836G>A	c.(835-837)AGA>AAA	p.R279K		NM_000866	NP_000857	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F	279	Cytoplasmic (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity			ovary(3)	3	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	AAATCTTGGAGAAGGCAAAAG	0.388													5	13	---	---	---	---	PASS
OR5H6	79295	broad.mit.edu	37	3	97983880	97983880	+	Missense_Mutation	SNP	G	A	A	rs145676438	byFrequency	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97983880G>A	uc003dsi.1	+	1	752	c.752G>A	c.(751-753)CGA>CAA	p.R251Q		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	251	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						AAAGGGATACGAAAAGCTGTC	0.398													7	12	---	---	---	---	PASS
GPR156	165829	broad.mit.edu	37	3	119886955	119886955	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119886955C>G	uc011bjf.1	-	9	1369	c.1369G>C	c.(1369-1371)GAG>CAG	p.E457Q	GPR156_uc011bjg.1_Missense_Mutation_p.E453Q	NM_153002	NP_694547	Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	457	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)		CCAGGCCCCTCAAGGCTTTGT	0.537													11	84	---	---	---	---	PASS
CCDC14	64770	broad.mit.edu	37	3	123634465	123634465	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123634465G>A	uc011bjx.1	-	13	2114	c.2023C>T	c.(2023-2025)CAT>TAT	p.H675Y	CCDC14_uc003egv.3_Missense_Mutation_p.H316Y|CCDC14_uc003egx.3_Missense_Mutation_p.H475Y|CCDC14_uc010hrt.2_Missense_Mutation_p.H634Y|CCDC14_uc003egy.3_Missense_Mutation_p.H475Y|CCDC14_uc003egz.2_Intron	NM_022757	NP_073594	Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	675						centrosome					0		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		TGTTTATCATGAATGTTCAAG	0.408													42	168	---	---	---	---	PASS
CCDC14	64770	broad.mit.edu	37	3	123634573	123634573	+	Intron	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123634573G>A	uc011bjx.1	-						CCDC14_uc003egv.3_Intron|CCDC14_uc003egx.3_Intron|CCDC14_uc010hrt.2_Intron|CCDC14_uc003egy.3_Intron|CCDC14_uc003egz.2_Intron	NM_022757	NP_073594	Q49A88	CCD14_HUMAN	coiled-coil domain containing 14							centrosome					0		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		GTTCTGTTAAGAAGAATCCAG	0.373													19	114	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126737155	126737155	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126737155G>T	uc003ejg.2	+	19	3614	c.3610G>T	c.(3610-3612)GAG>TAG	p.E1204*		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	1227	Extracellular (Potential).|IPT/TIG 4.				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		AGGTGGCTTCGAGTTCTCGCC	0.647													4	10	---	---	---	---	PASS
TOPBP1	11073	broad.mit.edu	37	3	133372179	133372179	+	Intron	SNP	T	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133372179T>C	uc003eps.2	-							NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1						DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						TTAATCTCAATGAGACTCACT	0.343								Other_conserved_DNA_damage_response_genes					3	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	149700906	149700906	+	IGR	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149700906G>T								PFN2 (12165 upstream) : TSC22D2 (425882 downstream)																							ACTTCCTGCCGAACAGCGTTG	0.587													10	111	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	150873999	150873999	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150873999C>G	uc003eyp.2	+	5	646	c.608C>G	c.(607-609)TCT>TGT	p.S203C	MED12L_uc011bnz.1_Missense_Mutation_p.S203C|MED12L_uc003eym.1_Missense_Mutation_p.S203C|MED12L_uc003eyn.2_Missense_Mutation_p.S203C|MED12L_uc003eyo.2_Missense_Mutation_p.S203C	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	203					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GCCAAGATTTCTGACTTTTAC	0.458													30	105	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	150874128	150874128	+	Intron	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150874128G>C	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|MED12L_uc003eym.1_Intron|MED12L_uc003eyn.2_Intron|MED12L_uc003eyo.2_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTAACCTTTTGAAGACATGCA	0.433													12	63	---	---	---	---	PASS
C3orf79	152118	broad.mit.edu	37	3	153202446	153202446	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153202446C>T	uc003ezt.2	+	1	163	c.101C>T	c.(100-102)TCA>TTA	p.S34L		NM_001101337	NP_001094807	P0CE67	CC079_HUMAN	chromosome 3 open reading frame 79	34											0						CCTGAGCTTTCATCCAAGAGA	0.418													47	325	---	---	---	---	PASS
KCNAB1	7881	broad.mit.edu	37	3	156192551	156192551	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156192551G>A	uc003far.2	+	8	664	c.600G>A	c.(598-600)CAG>CAA	p.Q200Q	KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Silent_p.Q189Q|KCNAB1_uc003fat.2_Silent_p.Q182Q|KCNAB1_uc010hvt.1_Intron|KCNAB1_uc011boo.1_Silent_p.Q76Q	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related	200						cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AGAGGCTGCAGCTCGAGTATG	0.428													7	32	---	---	---	---	PASS
SERPINI1	5274	broad.mit.edu	37	3	167508190	167508190	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167508190C>G	uc003ffa.3	+	3	479	c.281C>G	c.(280-282)TCA>TGA	p.S94*	SERPINI1_uc003ffb.3_Nonsense_Mutation_p.S94*	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	94					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						AAGGAGTTTTCAAACATGGTA	0.363													17	95	---	---	---	---	PASS
ACTL6A	86	broad.mit.edu	37	3	179294463	179294463	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179294463C>T	uc003fjw.2	+	7	800	c.627C>T	c.(625-627)CTC>CTT	p.L209L	ACTL6A_uc003fjx.2_Silent_p.L167L|ACTL6A_uc003fjy.2_Silent_p.L167L	NM_004301	NP_004292	O96019	ACL6A_HUMAN	actin-like 6A isoform 1	209					chromatin remodeling|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|nervous system development|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	Ino80 complex|npBAF complex|NuA4 histone acetyltransferase complex|plasma membrane|SWI/SNF complex	ATP binding|chromatin binding			ovary(1)	1	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			GCAGAGAACTCTTCCAAGAAA	0.373													32	256	---	---	---	---	PASS
ALG3	10195	broad.mit.edu	37	3	183963307	183963307	+	Silent	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183963307G>T	uc003fne.2	-	3	424	c.393C>A	c.(391-393)CTC>CTA	p.L131L	ALG3_uc011brc.1_Silent_p.L96L|ALG3_uc011brd.1_Silent_p.L75L|ALG3_uc011bre.1_Silent_p.L83L|ALG3_uc003fnf.1_Silent_p.L91L|ALG3_uc011brf.1_Silent_p.L23L	NM_005787	NP_005778	Q92685	ALG3_HUMAN	alpha-1,3-mannosyltransferase ALG3 isoform a	131	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity				0	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TAGCCAGGTAGAGCACAGCAA	0.567													5	87	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3136143	3136143	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3136143C>G	uc011bvq.1	+	20	2660	c.2515C>G	c.(2515-2517)CTC>GTC	p.L839V		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	837	HEAT 4.				establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TGTCATGAGTCTCTGCAGCAG	0.522													33	84	---	---	---	---	PASS
ABLIM2	84448	broad.mit.edu	37	4	8055963	8055963	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8055963G>A	uc003gko.2	-	8	917	c.774C>T	c.(772-774)ATC>ATT	p.I258I	ABLIM2_uc003gkl.2_Silent_p.I8I|ABLIM2_uc003gkj.3_Silent_p.I258I|ABLIM2_uc003gkm.3_Silent_p.I258I|ABLIM2_uc003gkp.2_Silent_p.I258I|ABLIM2_uc003gkq.2_Silent_p.I258I|ABLIM2_uc003gkr.2_Silent_p.I258I|ABLIM2_uc003gks.3_Silent_p.I258I|ABLIM2_uc011bwl.1_Silent_p.I263I	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	258	LIM zinc-binding 4.				axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						CCGGATGCCAGATGGAGGAAC	0.522													3	35	---	---	---	---	PASS
POLR2B	5431	broad.mit.edu	37	4	57877271	57877271	+	Intron	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57877271G>C	uc003hcl.1	+						POLR2B_uc011cae.1_Intron|POLR2B_uc011caf.1_Intron|POLR2B_uc003hcm.1_Intron	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					TCTGAAGTAAGAATCTTTAGT	0.378													19	39	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71509510	71509510	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71509510G>C	uc011caw.1	+	9	2648	c.2367G>C	c.(2365-2367)CAG>CAC	p.Q789H		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	789					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			TCTGGGATCAGGCAACACATT	0.463													8	44	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79368028	79368028	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79368028G>A	uc003hlb.2	+	43	6444	c.6004G>A	c.(6004-6006)GAC>AAC	p.D2002N		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2001	CSPG 8.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						AAAAAAGCCTGACCACGGTAG	0.428													4	5	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85731460	85731460	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85731460C>G	uc003hpd.2	-	14	2333	c.1925G>C	c.(1924-1926)AGA>ACA	p.R642T	WDFY3_uc003hpf.2_Missense_Mutation_p.R642T	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	642						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AAAAACTGTTCTTGAACGATG	0.393													4	13	---	---	---	---	PASS
ADH1B	125	broad.mit.edu	37	4	100237128	100237128	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100237128G>T	uc003hus.3	-	5	578	c.494C>A	c.(493-495)TCG>TAG	p.S165*	ADH1A_uc011ceg.1_Intron|ADH1B_uc003hut.3_Nonsense_Mutation_p.S125*|ADH1B_uc011ceh.1_Nonsense_Mutation_p.S10*|ADH1B_uc011cei.1_Nonsense_Mutation_p.S125*	NM_000668	NP_000659	P00325	ADH1B_HUMAN	class I alcohol dehydrogenase, beta subunit	165					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|zinc ion binding			ovary(1)|breast(1)	2				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Fomepizole(DB01213)|NADH(DB00157)	CTCCAGGGGCGAGGCTGCATC	0.527													16	47	---	---	---	---	PASS
HADH	3033	broad.mit.edu	37	4	108940820	108940820	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108940820G>C	uc003hyq.2	+	4	693	c.544G>C	c.(544-546)GAG>CAG	p.E182Q	HADH_uc010ilx.2_Missense_Mutation_p.E182Q|HADH_uc010ily.2_Missense_Mutation_p.E5Q|HADH_uc003hyr.2_Missense_Mutation_p.E186Q	NM_005327	NP_005318	Q16836	HCDH_HUMAN	L-3-hydroxyacyl-Coenzyme A dehydrogenase	182					fatty acid beta-oxidation	mitochondrial matrix	3-hydroxyacyl-CoA dehydrogenase activity|NAD+ binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)	NADH(DB00157)	GAAACTTGTGGAGGTCAGTGG	0.532													4	158	---	---	---	---	PASS
PITX2	5308	broad.mit.edu	37	4	111542526	111542526	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111542526C>T	uc003iad.2	-	4	767	c.185_splice	c.e4-1	p.E62_splice	PITX2_uc003iac.2_Splice_Site_p.E69_splice|PITX2_uc003iae.2_Splice_Site_p.E16_splice|PITX2_uc010iml.2_Intron|PITX2_uc003iaf.2_Splice_Site_p.E62_splice|PITX2_uc003iag.1_Intron	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2						determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		TTATCTTTCTCTGAAAACGAA	0.597													13	71	---	---	---	---	PASS
SEC24D	9871	broad.mit.edu	37	4	119727121	119727121	+	Intron	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119727121G>C	uc003ici.3	-						SEC24D_uc003icj.3_Intron|SEC24D_uc003icl.2_Intron|SEC24D_uc010imz.1_Intron|SEC24D_uc011cgg.1_Intron	NM_014822	NP_055637	O94855	SC24D_HUMAN	Sec24-related protein D						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0						TGATAAATAAGACATCAAGAG	0.478													18	61	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126411397	126411397	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126411397C>G	uc003ifj.3	+	17	13420	c.13420C>G	c.(13420-13422)CCT>GCT	p.P4474A	FAT4_uc011cgp.1_Missense_Mutation_p.P2715A|FAT4_uc003ifi.1_Missense_Mutation_p.P1951A	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4474	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CGTCCTCTGTCCTCAGGGGAA	0.612													21	73	---	---	---	---	PASS
PCDH18	54510	broad.mit.edu	37	4	138453180	138453180	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138453180G>A	uc003ihe.3	-	1	450	c.63C>T	c.(61-63)TTC>TTT	p.F21F	PCDH18_uc003ihf.3_Silent_p.F14F|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Intron|PCDH18_uc011cha.1_Intron	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	21					brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					CATCGTGGTTGAAAGATACTA	0.383													17	81	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160253725	160253725	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160253725G>C	uc003iqg.3	+	11	1838	c.1528G>C	c.(1528-1530)GAA>CAA	p.E510Q		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	510					cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TGTAGATGTAGAACAGGTGAT	0.423													16	57	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162680551	162680551	+	Intron	SNP	T	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162680551T>A	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		GGAGAATGAATCTTGTACTCA	0.328													5	76	---	---	---	---	PASS
PALLD	23022	broad.mit.edu	37	4	169433387	169433387	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169433387G>A	uc011cjx.1	+	2	943	c.732G>A	c.(730-732)CAG>CAA	p.Q244Q	PALLD_uc003iru.2_Silent_p.Q244Q	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2	244					cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		ATTGCTACCAGGACAACCAGG	0.602									Pancreatic_Cancer_Familial_Clustering_of				23	48	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187540003	187540003	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187540003G>A	uc003izf.2	-	10	7925	c.7737C>T	c.(7735-7737)TTC>TTT	p.F2579F		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2579	Extracellular (Potential).|Cadherin 23.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TCACGGTGCAGAAAGCAACTT	0.443										HNSCC(5;0.00058)			11	43	---	---	---	---	PASS
TRIML1	339976	broad.mit.edu	37	4	189061706	189061706	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189061706C>G	uc003izm.1	+	2	548	c.433C>G	c.(433-435)CTT>GTT	p.L145V		NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	145	Potential.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		AATCCTGAATCTTTTGCGTGT	0.478													15	80	---	---	---	---	PASS
TRIML1	339976	broad.mit.edu	37	4	189068346	189068346	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189068346C>T	uc003izm.1	+	6	1342	c.1227C>T	c.(1225-1227)GTC>GTT	p.V409V	TRIML1_uc003izn.1_Silent_p.V133V	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	409	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		AGGTTGGTGTCTTCCTGGACT	0.488													84	196	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5146365	5146365	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5146365C>T	uc003jdl.2	+	3	436	c.298C>T	c.(298-300)CGG>TGG	p.R100W	ADAMTS16_uc003jdk.1_Missense_Mutation_p.R100W|ADAMTS16_uc003jdj.1_Missense_Mutation_p.R100W	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	100					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TCTTCACCTTCGGCTGAAAGG	0.567													4	101	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112174256	112174256	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112174256G>A	uc010jby.2	+	16	3345	c.2965G>A	c.(2965-2967)GAT>AAT	p.D989N	APC_uc011cvt.1_Missense_Mutation_p.D971N|APC_uc003kpz.3_Missense_Mutation_p.D989N|APC_uc003kpy.3_Missense_Mutation_p.D989N|APC_uc010jbz.2_Missense_Mutation_p.D706N|APC_uc010jca.2_Missense_Mutation_p.D289N	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	989	Ser-rich.|Responsible for down-regulation through a process mediated by direct ubiquitination.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTATTCTGAAGATGATGAAAG	0.353		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			4	108	---	---	---	---	PASS
PKD2L2	27039	broad.mit.edu	37	5	137235254	137235254	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137235254C>G	uc003lby.2	+	5	630	c.574C>G	c.(574-576)CTT>GTT	p.L192V	PKD2L2_uc010jep.1_Missense_Mutation_p.L132V|PKD2L2_uc003lbw.1_Missense_Mutation_p.L192V|PKD2L2_uc003lbx.2_Missense_Mutation_p.L192V|PKD2L2_uc011cyi.1_5'UTR	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	192	Extracellular (Potential).					integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTGGGGATTTCTTGGTGTTTA	0.388													13	125	---	---	---	---	PASS
WDR55	54853	broad.mit.edu	37	5	140047905	140047905	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140047905C>G	uc003lgr.3	+	2	392	c.278C>G	c.(277-279)TCT>TGT	p.S93C	WDR55_uc011czl.1_5'Flank	NM_017706	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55	93	WD 2.				rRNA processing	cytoplasm|nucleolus				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGCCTTCTCTGAAGATGGG	0.567													8	174	---	---	---	---	PASS
PCDHA13	56136	broad.mit.edu	37	5	140263677	140263677	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140263677G>A	uc003lif.2	+	1	1824	c.1824G>A	c.(1822-1824)TCG>TCA	p.S608S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Silent_p.S608S|PCDHA13_uc003lid.2_Silent_p.S608S	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	608	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGGCTTTCGTATGAATTGC	0.682													16	58	---	---	---	---	PASS
PCDHGA5	56110	broad.mit.edu	37	5	140744563	140744563	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140744563C>G	uc003lju.1	+	1	666	c.666C>G	c.(664-666)CTC>CTG	p.L222L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Silent_p.L222L	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	222	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCGGTACTCTCCGGCACCA	0.567													24	82	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140755498	140755498	+	Silent	SNP	T	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140755498T>C	uc003ljy.1	+	1	1848	c.1848T>C	c.(1846-1848)CTT>CTC	p.L616L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.L616L	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	616	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCAGGACTTTTCTCAGTGG	0.682													7	82	---	---	---	---	PASS
PDLIM7	9260	broad.mit.edu	37	5	176919445	176919445	+	Intron	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176919445G>C	uc003mhc.1	-						PDLIM7_uc003mha.1_5'Flank|PDLIM7_uc003mhb.1_Intron|PDLIM7_uc003mhd.1_Intron|PDLIM7_uc003mhe.1_Intron|PDLIM7_uc003mhf.2_Intron|PDLIM7_uc003mhg.1_Intron	NM_005451	NP_005442	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 isoform 1						cell differentiation|multicellular organismal development|ossification|receptor-mediated endocytosis	cytoplasm|focal adhesion	protein binding|zinc ion binding			breast(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCTGGAGGAGAAGGAAAGCG	0.706													7	9	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7581095	7581095	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7581095C>T	uc003mxp.1	+	23	4951	c.4672C>T	c.(4672-4674)CGG>TGG	p.R1558W	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1558	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GGATATCACGCGGTTCCAGAA	0.517													24	70	---	---	---	---	PASS
HIST1H3C	8352	broad.mit.edu	37	6	26045824	26045824	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26045824G>A	uc003nfv.2	+	1	186	c.186G>A	c.(184-186)CTG>CTA	p.L62L	HIST1H2BB_uc003nfu.2_5'Flank	NM_003531	NP_003522	P68431	H31_HUMAN	histone cluster 1, H3c	62					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						CCGAGCTGCTGATCCGGAAGC	0.647													4	41	---	---	---	---	PASS
HIST1H1E	3008	broad.mit.edu	37	6	26156923	26156923	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26156923C>T	uc003ngq.2	+	1	365	c.305C>T	c.(304-306)TCG>TTG	p.S102L	HIST1H2BD_uc003ngr.2_5'Flank|HIST1H2BD_uc003ngs.2_5'Flank	NM_005321	NP_005312	P10412	H14_HUMAN	histone cluster 1, H1e	102	H15.				nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			large_intestine(1)|ovary(1)	2						ACCGGCGCGTCGGGTTCCTTC	0.617													12	50	---	---	---	---	PASS
HIST1H2BK	85236	broad.mit.edu	37	6	27114365	27114365	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27114365G>C	uc003nix.1	-	1	255	c.213C>G	c.(211-213)TTC>TTG	p.F71L	HIST1H2AH_uc003niz.2_5'Flank|hsa-mir-3143|MI0014167_5'Flank	NM_080593	NP_542160	O60814	H2B1K_HUMAN	histone cluster 1, H2bk	71					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding				0						CGATGCGTTCGAAGATGTCGT	0.602													17	234	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27419369	27419369	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27419369G>A	uc003njj.2	-	5	2780	c.1969C>T	c.(1969-1971)CTA>TTA	p.L657L	ZNF184_uc010jqv.2_Silent_p.L657L|ZNF184_uc003nji.2_Silent_p.L657L	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	657	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGCTGAGTTAGATGGGAGCTC	0.423													21	73	---	---	---	---	PASS
TUBB	203068	broad.mit.edu	37	6	30691826	30691826	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30691826G>A	uc003nrl.2	+	4	1114	c.987G>A	c.(985-987)CAG>CAA	p.Q329Q	TUBB_uc003nrk.1_Silent_p.Q329Q|TUBB_uc011dmq.1_Silent_p.Q257Q	NM_178014	NP_821133	P07437	TBB5_HUMAN	tubulin, beta	329					cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding			ovary(1)	1					Colchicine(DB01394)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	TCGATGAGCAGATGCTTAACG	0.557													53	115	---	---	---	---	PASS
POU5F1	5460	broad.mit.edu	37	6	31133404	31133404	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31133404G>A	uc003nsv.2	-	3	655	c.601C>T	c.(601-603)CGG>TGG	p.R201W	POU5F1_uc003nsu.2_Missense_Mutation_p.R106W|uc011dnf.1_5'Flank	NM_002701	NP_002692	Q01860	PO5F1_HUMAN	POU domain, class 5, transcription factor 1	201	POU-specific.				anatomical structure morphogenesis|blastocyst development|BMP signaling pathway involved in heart induction|cardiac cell fate determination|cell fate commitment involved in formation of primary germ layers|mRNA transcription from RNA polymerase II promoter|negative regulation of gene silencing by miRNA|positive regulation of catenin import into nucleus|positive regulation of SMAD protein import into nucleus|positive regulation of transcription from RNA polymerase II promoter|regulation of asymmetric cell division|regulation of heart induction by regulation of canonical Wnt receptor signaling pathway|regulation of methylation-dependent chromatin silencing|response to wounding|somatic stem cell maintenance|somatic stem cell maintenance	cytosol|nucleoplasm|transcription factor complex	miRNA binding|sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding		EWSR1/POU5F1(10)	skin(7)|salivary_gland(2)|bone(2)|lung(1)|ovary(1)	13						AGCAAGGGCCGCAGCTTACAC	0.547			T	EWSR1	sarcoma								3	49	---	---	---	---	PASS
ZBTB12	221527	broad.mit.edu	37	6	31868109	31868109	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31868109G>A	uc003nyd.1	-	2	1150	c.974C>T	c.(973-975)TCA>TTA	p.S325L	EHMT2_uc003nxz.1_5'Flank|EHMT2_uc003nya.1_5'Flank|EHMT2_uc003nyb.1_5'Flank|C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_5'Flank	NM_181842	NP_862825	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	325	Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTTTCCACCTGAGAAGCCCCC	0.478													19	28	---	---	---	---	PASS
AGPAT1	10554	broad.mit.edu	37	6	32137054	32137054	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32137054C>T	uc003oae.2	-	7	1169	c.851G>A	c.(850-852)TGA>TAA	p.*284*	PPT2_uc003nzy.1_Intron|AGPAT1_uc011dpj.1_RNA|AGPAT1_uc011dpk.1_Silent_p.*248*|AGPAT1_uc003oaf.2_Silent_p.*284*|AGPAT1_uc003oag.2_Silent_p.*174*|AGPAT1_uc003oah.2_Silent_p.*284*|AGPAT1_uc003oai.1_Silent_p.*284*|AGPAT1_uc011dpl.1_Silent_p.*172*	NM_006411	NP_006402	Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	284					energy reserve metabolic process|phosphatidic acid biosynthetic process|positive regulation of cellular metabolic process|positive regulation of cytokine production|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			central_nervous_system(1)	1						AGCCAGGGTTCACCCACCGCC	0.607													19	55	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46657053	46657053	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46657053G>A	uc003oyj.2	+	1	1188	c.1188G>A	c.(1186-1188)CTG>CTA	p.L396L	TDRD6_uc010jze.2_Silent_p.L390L	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	396					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			TCGGTGACCTGAAGACACTGA	0.478													9	119	---	---	---	---	PASS
HMGCLL1	54511	broad.mit.edu	37	6	55360417	55360417	+	Intron	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55360417G>T	uc003pcn.2	-						HMGCLL1_uc003pco.2_Intron|HMGCLL1_uc010jzx.2_Intron|HMGCLL1_uc011dxc.1_Intron|HMGCLL1_uc011dxd.1_Intron|HMGCLL1_uc011dxe.1_Intron	NM_019036	NP_061909	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-Coenzyme A								hydroxymethylglutaryl-CoA lyase activity|metal ion binding			skin(2)|ovary(1)|pancreas(1)	4	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			TGTTGATAAAGGTGAAGTGCT	0.378													6	22	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56504768	56504768	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56504768C>G	uc003pdf.2	-	18	2507	c.2479G>C	c.(2479-2481)GAA>CAA	p.E827Q	DST_uc003pcz.3_Missense_Mutation_p.E649Q|DST_uc011dxj.1_Missense_Mutation_p.E678Q|DST_uc011dxk.1_Missense_Mutation_p.E689Q|DST_uc011dxl.1_Missense_Mutation_p.E678Q|DST_uc003pcy.3_Missense_Mutation_p.E323Q|DST_uc003pdb.2_Missense_Mutation_p.E323Q|DST_uc003pdc.3_Missense_Mutation_p.E323Q|DST_uc003pdd.3_Missense_Mutation_p.E323Q|DST_uc003pde.2_Missense_Mutation_p.E765Q	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	649					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCAAATTCTTCAATAGCTCTA	0.323													12	61	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128403634	128403634	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128403634C>T	uc003qbk.2	-	10	2092	c.1725G>A	c.(1723-1725)ACG>ACA	p.T575T	PTPRK_uc003qbj.2_Silent_p.T575T|PTPRK_uc010kfc.2_Silent_p.T575T|PTPRK_uc011ebu.1_Silent_p.T575T|PTPRK_uc003qbl.1_Silent_p.T445T|PTPRK_uc011ebv.1_Silent_p.T575T	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	575	Extracellular (Potential).|Fibronectin type-III 3.				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AGCCTTTGACCGTGCTGGCTC	0.428													4	16	---	---	---	---	PASS
IFNGR1	3459	broad.mit.edu	37	6	137519721	137519721	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137519721G>C	uc003qho.2	-	7	1020	c.917C>G	c.(916-918)TCA>TGA	p.S306*	IFNGR1_uc011edm.1_Nonsense_Mutation_p.S278*	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor	306	Cytoplasmic (Potential).				regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	CGTGATGAGTGATACATATTT	0.388													8	21	---	---	---	---	PASS
STX11	8676	broad.mit.edu	37	6	144508376	144508376	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144508376C>T	uc003qks.3	+	2	804	c.612C>T	c.(610-612)CTC>CTT	p.L204L		NM_003764	NP_003755	O75558	STX11_HUMAN	syntaxin 11	204	t-SNARE coiled-coil homology.			ARAALNEIESRHRELLRLESR -> RGPPTTRSRAATANCC AWRAA (in Ref. 2; AAC24031).	cellular membrane fusion|intracellular protein transport|vesicle-mediated transport	Golgi apparatus|membrane	SNAP receptor activity			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		GGGCCGCCCTCAACGAGATCG	0.637									Familial_Hemophagocytic_Lymphohistiocytosis				10	21	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161143571	161143571	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161143571C>A	uc003qtm.3	+	10	1291	c.1228C>A	c.(1228-1230)CAG>AAG	p.Q410K		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	410	Kringle 4.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ACACCGGCACCAGAAGACCCC	0.478													3	52	---	---	---	---	PASS
UNCX	340260	broad.mit.edu	37	7	1273287	1273287	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1273287G>C	uc011jvw.1	+	2	406	c.406G>C	c.(406-408)GAG>CAG	p.E136Q		NM_001080461	NP_001073930	A6NJT0	UNC4_HUMAN	UNC homeobox	136	Homeobox.				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GTTCATGCGCGAGGCGCTGGC	0.677													26	62	---	---	---	---	PASS
COL28A1	340267	broad.mit.edu	37	7	7412990	7412990	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7412990C>T	uc003src.1	-	32	2664	c.2547G>A	c.(2545-2547)GTG>GTA	p.V849V	COL28A1_uc011jxe.1_Silent_p.V532V	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	849	VWFA 2.				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TCAAATTAGCCACCTTCTCCA	0.488													5	104	---	---	---	---	PASS
ELMO1	9844	broad.mit.edu	37	7	37298896	37298896	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37298896C>T	uc003tfk.1	-	6	610	c.303G>A	c.(301-303)CTG>CTA	p.L101L	ELMO1_uc011kbc.1_Silent_p.L5L|ELMO1_uc010kxg.1_Silent_p.L101L	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	101					actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						TCAGGGCTTCCAGCTTGGCAT	0.537													5	28	---	---	---	---	PASS
AMPH	273	broad.mit.edu	37	7	38457484	38457484	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38457484C>T	uc003tgu.2	-	17	1408	c.1339G>A	c.(1339-1341)GCC>ACC	p.A447T	AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron|AMPH_uc003tgw.1_Intron|AMPH_uc010kxl.1_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	447					endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						AGACCAACGGCAGGTGTGACA	0.577													4	36	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55214393	55214393	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55214393C>G	uc003tqk.2	+	4	765	c.519C>G	c.(517-519)CTC>CTG	p.L173L	EGFR_uc003tqh.2_Silent_p.L173L|EGFR_uc003tqi.2_Silent_p.L173L|EGFR_uc003tqj.2_Silent_p.L173L|EGFR_uc010kzg.1_Intron|EGFR_uc011kco.1_Silent_p.L120L	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	173	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GTGACTTTCTCAGCAACATGT	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			23	41	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82595426	82595426	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82595426C>G	uc003uhx.2	-	4	3967	c.3678G>C	c.(3676-3678)AAG>AAC	p.K1226N	PCLO_uc003uhv.2_Missense_Mutation_p.K1226N	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1165					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CAGAACGTATCTTTTCTTCTT	0.388													46	280	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	91875842	91875842	+	Intron	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91875842C>G	uc003ulw.2	+						KRIT1_uc003ulq.1_5'Flank|KRIT1_uc003ulr.1_5'Flank|KRIT1_uc003uls.1_5'Flank|KRIT1_uc003ult.1_5'Flank|KRIT1_uc003ulu.1_5'Flank|KRIT1_uc003ulv.1_5'Flank	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1								protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCGTAAGTCTCAGCTTCGCGG	0.587													14	16	---	---	---	---	PASS
PDK4	5166	broad.mit.edu	37	7	95217138	95217138	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95217138C>T	uc003uoa.2	-	8	1092	c.772_splice	c.e8-1	p.N258_splice	PDK4_uc003unz.2_Splice_Site_p.N46_splice	NM_002612	NP_002603	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase 4 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity				0	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			GCATTGCATTCTAAAACAAAG	0.363													5	66	---	---	---	---	PASS
TAF6	6878	broad.mit.edu	37	7	99709583	99709583	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99709583G>C	uc003uti.2	-	8	841	c.760C>G	c.(760-762)CAG>GAG	p.Q254E	TAF6_uc003utg.2_Missense_Mutation_p.Q176E|TAF6_uc003uth.2_Missense_Mutation_p.Q311E|TAF6_uc003utk.2_Missense_Mutation_p.Q254E|TAF6_uc011kji.1_Missense_Mutation_p.Q291E|TAF6_uc003utj.2_Missense_Mutation_p.Q244E|TAF6_uc003utl.2_Missense_Mutation_p.Q254E|TAF6_uc003utm.2_Missense_Mutation_p.Q254E|TAF6_uc003utn.1_RNA	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha	254					negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCAGCATCTGATACAGTCCA	0.602													19	83	---	---	---	---	PASS
MBLAC1	255374	broad.mit.edu	37	7	99725636	99725636	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99725636G>C	uc003utp.2	+	2	1017	c.618G>C	c.(616-618)CTG>CTC	p.L206L		NM_203397	NP_981942	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	206							hydrolase activity|metal ion binding			breast(1)	1						GGCAGGCACTGAGTGAAGACC	0.667													3	32	---	---	---	---	PASS
ACHE	43	broad.mit.edu	37	7	100488959	100488959	+	Silent	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100488959C>A	uc003uxd.2	-	3	1710	c.1554G>T	c.(1552-1554)GGG>GGT	p.G518G	UFSP1_uc003uxc.3_5'Flank|ACHE_uc003uxe.2_Silent_p.G518G|ACHE_uc003uxf.2_Silent_p.G518G|ACHE_uc003uxg.2_Silent_p.G518G|ACHE_uc003uxh.2_Silent_p.G430G|ACHE_uc003uxi.2_Silent_p.G518G	NM_000665	NP_000656	P22303	ACES_HUMAN	acetylcholinesterase isoform E4-E6 precursor	518					acetylcholine catabolic process in synaptic cleft|amyloid precursor protein metabolic process|cell adhesion|cell proliferation|choline metabolic process|DNA replication|muscle organ development|neurotransmitter biosynthetic process|osteoblast development|positive regulation of protein secretion|regulation of axonogenesis|regulation of dendrite morphogenesis|response to wounding|synapse assembly	anchored to membrane|axon|basal lamina|cell junction|cell surface|dendrite|endoplasmic reticulum lumen|extracellular space|Golgi apparatus|neuromuscular junction|nucleus|perinuclear region of cytoplasm|postsynaptic membrane|presynaptic membrane|synaptic cleft	acetylcholine binding|acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|collagen binding|laminin-1 binding|protein homodimerization activity|serine hydrolase activity			skin(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Atropine(DB00572)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium bromide(DB00944)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tacrine(DB00382)|Tubocurarine(DB01199)	CATTGGGATCCCTGCGGAAGG	0.677													4	96	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100677044	100677044	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677044G>A	uc003uxp.1	+	3	2400	c.2347G>A	c.(2347-2349)GAA>AAA	p.E783K	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	783	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|11.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CACTTCTACTGAAGCCAGTTG	0.458													129	510	---	---	---	---	PASS
TRIM56	81844	broad.mit.edu	37	7	100730990	100730990	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100730990G>T	uc003uxq.2	+	3	628	c.397G>T	c.(397-399)GAC>TAC	p.D133Y	TRIM56_uc003uxr.2_Missense_Mutation_p.D133Y	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN	tripartite motif-containing 56	133	B box-type 1.				defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			kidney(1)|central_nervous_system(1)|skin(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)					GGCCTGTGCCGACGGGCACCG	0.726													5	19	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103141295	103141295	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103141295C>T	uc003vca.2	-	53	8724	c.8564G>A	c.(8563-8565)GGA>GAA	p.G2855E	RELN_uc010liz.2_Missense_Mutation_p.G2855E	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2855	EGF-like 7.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GTCCAAGCATCCAGGGCCCAG	0.493													27	176	---	---	---	---	PASS
IMMP2L	83943	broad.mit.edu	37	7	110526718	110526718	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110526718G>A	uc003vfq.1	-	5	782	c.339C>T	c.(337-339)GTC>GTT	p.V113V	IMMP2L_uc010ljr.1_Silent_p.V113V	NM_032549	NP_115938	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane protease-like	113					protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		GACCACGGGGGACTTTGACAT	0.413													14	25	---	---	---	---	PASS
TMEM168	64418	broad.mit.edu	37	7	112424409	112424409	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112424409C>T	uc003vgn.2	-	2	864	c.472G>A	c.(472-474)GAA>AAA	p.E158K	TMEM168_uc010lju.2_Missense_Mutation_p.E158K|TMEM168_uc011kmr.1_Intron	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN	transmembrane protein 168	158						integral to membrane|transport vesicle				ovary(1)|central_nervous_system(1)	2						TCCAGAAATTCAACTGTGGTT	0.428													14	64	---	---	---	---	PASS
GPR85	54329	broad.mit.edu	37	7	112723916	112723916	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112723916G>C	uc010ljv.2	-	2	1378	c.861C>G	c.(859-861)TTC>TTG	p.F287L	GPR85_uc003vgp.1_Missense_Mutation_p.F287L|GPR85_uc003vgq.2_Missense_Mutation_p.F287L|GPR85_uc010ljw.1_Missense_Mutation_p.F287L	NM_001146266	NP_001139738	P60893	GPR85_HUMAN	G protein-coupled receptor 85	287	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|central_nervous_system(1)	2						TCATTATATAGAACATTCTGC	0.463													15	153	---	---	---	---	PASS
MKLN1	4289	broad.mit.edu	37	7	131082109	131082109	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131082109C>T	uc011kpm.1	+	5	548	c.484C>T	c.(484-486)CAA>TAA	p.Q162*	MKLN1_uc011kpl.1_Nonsense_Mutation_p.Q139*|MKLN1_uc010lmh.2_Nonsense_Mutation_p.Q162*|MKLN1_uc003vqs.2_5'UTR	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing	162					signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					TGATATAGTACAACCTTGTCT	0.378													17	49	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141794572	141794572	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141794572T>C	uc003vwy.2	+	40	4733	c.4679T>C	c.(4678-4680)TTT>TCT	p.F1560S		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1560	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGTGGGTTCTTTCAAGATGCT	0.488													22	50	---	---	---	---	PASS
OR2A12	346525	broad.mit.edu	37	7	143792716	143792716	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143792716G>T	uc011kty.1	+	1	516	c.516G>T	c.(514-516)AAG>AAT	p.K172N		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					GCCCACAAAAGATCAACCACT	0.463													15	118	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151845151	151845151	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151845151C>A	uc003wla.2	-	52	14080	c.13861G>T	c.(13861-13863)GAA>TAA	p.E4621*	MLL3_uc003wkz.2_Nonsense_Mutation_p.E3739*|MLL3_uc003wkx.2_Nonsense_Mutation_p.E779*|MLL3_uc003wky.2_Nonsense_Mutation_p.E2185*	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	4621	FYR C-terminal.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ACCAGGTCTTCATGGCCTTGT	0.498			N		medulloblastoma								42	17	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30695564	30695564	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30695564G>C	uc003xil.2	-	3	7087	c.7087C>G	c.(7087-7089)CAT>GAT	p.H2363D		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2363										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CTTTTGGGATGAGATCCTGTA	0.299													8	60	---	---	---	---	PASS
PURG	29942	broad.mit.edu	37	8	30889906	30889906	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30889906C>G	uc003xin.2	-	1	412	c.393G>C	c.(391-393)CTG>CTC	p.L131L	WRN_uc003xio.3_5'Flank|PURG_uc003xim.1_Silent_p.L131L	NM_013357	NP_037489	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G isoform A	131	By similarity.					nucleus	DNA binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		GGTGGCCTTTCAGGCCCAGGT	0.592													32	160	---	---	---	---	PASS
PROSC	11212	broad.mit.edu	37	8	37630362	37630362	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37630362G>A	uc003xkh.2	+	5	486	c.409G>A	c.(409-411)GAA>AAA	p.E137K		NM_007198	NP_009129	O94903	PROSC_HUMAN	proline synthetase co-transcribed homolog	137							pyridoxal phosphate binding			central_nervous_system(1)	1		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)|Pyridoxal Phosphate(DB00114)	AGGTTCTCCTGAAAGGTTAAA	0.428													33	134	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41552217	41552217	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41552217C>T	uc003xok.2	-	28	3304	c.3220G>A	c.(3220-3222)GAC>AAC	p.D1074N	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.D390N|ANK1_uc003xoi.2_Missense_Mutation_p.D1074N|ANK1_uc003xoj.2_Missense_Mutation_p.D1074N|ANK1_uc003xol.2_Missense_Mutation_p.D1074N|ANK1_uc003xom.2_Missense_Mutation_p.D1115N	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1074					axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCGATGGTGTCGTAGTCCTGG	0.602													4	61	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48701765	48701765	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48701765G>C	uc003xqi.2	-	76	10762	c.10705C>G	c.(10705-10707)CAA>GAA	p.Q3569E	PRKDC_uc003xqj.2_Missense_Mutation_p.Q3569E|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	3569					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				ATAAAATCTTGAATCACTCCT	0.294								NHEJ					14	50	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48794602	48794602	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48794602C>G	uc003xqi.2	-	38	4890	c.4833G>C	c.(4831-4833)CAG>CAC	p.Q1611H	PRKDC_uc003xqj.2_Missense_Mutation_p.Q1611H|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	1611					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				CTTGGTGTTTCTGGTTTGCTC	0.443								NHEJ					33	149	---	---	---	---	PASS
GGH	8836	broad.mit.edu	37	8	63939811	63939811	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63939811C>T	uc003xuw.2	-	4	572	c.289G>A	c.(289-291)GGA>AGA	p.G97R		NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor	97	Gamma-glutamyl hydrolase.				glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)	ACACTTCCTCCAGGGAAAAGG	0.353													9	49	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71128948	71128948	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71128948G>A	uc003xyn.1	-	3	195	c.33C>T	c.(31-33)CCC>CCT	p.P11P		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	11					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CTGCCCTGGAGGGGTCAGAGG	0.433			T	RUNXBP2	AML								41	134	---	---	---	---	PASS
PSKH2	85481	broad.mit.edu	37	8	87076352	87076352	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87076352C>T	uc011lfy.1	-	2	694	c.694G>A	c.(694-696)GAG>AAG	p.E232K		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	232	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			AGCAAAACCTCAGGAGCTATG	0.438													21	65	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101154120	101154120	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101154120G>A	uc003yjd.2	-	2	1075	c.362C>T	c.(361-363)TCT>TTT	p.S121F	FBXO43_uc003yje.2_Missense_Mutation_p.S87F|FBXO43_uc010mbp.1_Missense_Mutation_p.S121F	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	121					meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			TTGAGTGGGAGATTCTAAAGG	0.363													11	219	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113256737	113256737	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113256737G>C	uc003ynu.2	-	65	10447	c.10288C>G	c.(10288-10290)CAT>GAT	p.H3430D	CSMD3_uc003yns.2_Missense_Mutation_p.H2632D|CSMD3_uc003ynt.2_Missense_Mutation_p.H3390D|CSMD3_uc011lhx.1_Missense_Mutation_p.H3261D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3430	Extracellular (Potential).|Sushi 28.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GTATACCCATGAGATGGAAGG	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			9	31	---	---	---	---	PASS
GPR20	2843	broad.mit.edu	37	8	142367298	142367298	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142367298G>A	uc003ywf.2	-	2	815	c.726C>T	c.(724-726)CTC>CTT	p.L242L		NM_005293	NP_005284	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	242	Helical; Name=6; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			CCGTGAGCAGGAGCTGCATGG	0.667													3	7	---	---	---	---	PASS
EXOSC4	54512	broad.mit.edu	37	8	145135043	145135043	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145135043C>G	uc003zau.2	+	2	479	c.369C>G	c.(367-369)ATC>ATG	p.I123M	GPAA1_uc003zav.1_5'Flank|GPAA1_uc003zaw.1_5'Flank|GPAA1_uc003zax.2_5'Flank	NM_019037	NP_061910	Q9NPD3	EXOS4_HUMAN	exosome component 4	123					DNA deamination|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear mRNA surveillance|positive regulation of cell growth	cytosol|exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.48e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGATTGATATCTATGTGCAGG	0.592													13	32	---	---	---	---	PASS
ADCK5	203054	broad.mit.edu	37	8	145603187	145603187	+	Intron	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145603187G>A	uc003zch.2	+						ADCK5_uc003zcg.2_Intron	NM_174922	NP_777582	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5							integral to membrane	protein serine/threonine kinase activity			stomach(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			AAGGTAACGAGTCCTCCACGG	0.607													5	33	---	---	---	---	PASS
KIFC2	90990	broad.mit.edu	37	8	145698053	145698053	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145698053C>T	uc003zcz.2	+	16	1890	c.1825C>T	c.(1825-1827)CGC>TGC	p.R609C	KIFC2_uc003zda.2_5'UTR	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	609	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GCTGACGCTGCGCGCGGCGTC	0.721													9	13	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	368025	368025	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:368025C>G	uc003zgf.2	+	15	1799	c.1687C>G	c.(1687-1689)CTC>GTC	p.L563V	DOCK8_uc010mgu.2_5'UTR|DOCK8_uc010mgv.2_Missense_Mutation_p.L495V|DOCK8_uc010mgw.1_5'UTR|DOCK8_uc003zgk.2_5'UTR|DOCK8_uc003zgh.2_RNA	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	563	DHR-1.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CAGAAACCTTCTCTATGTCTA	0.378													9	65	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84607959	84607959	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84607959G>T	uc004amn.2	+	4	2621	c.2574G>T	c.(2572-2574)AAG>AAT	p.K858N		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	858						integral to membrane					0						ACTCAGTCAAGCAGACAATGT	0.443													10	70	---	---	---	---	PASS
SYK	6850	broad.mit.edu	37	9	93636954	93636954	+	Missense_Mutation	SNP	G	A	A	rs139388374	byFrequency	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93636954G>A	uc004aqz.2	+	9	1209	c.1004G>A	c.(1003-1005)GGC>GAC	p.G335D	SYK_uc004ara.2_Missense_Mutation_p.G312D|SYK_uc004arb.2_Missense_Mutation_p.G312D|SYK_uc004arc.2_Missense_Mutation_p.G335D|SYK_uc011ltr.1_RNA|SYK_uc011lts.1_RNA|SYK_uc011ltt.1_RNA	NM_003177	NP_003168	P43405	KSYK_HUMAN	spleen tyrosine kinase isoform 1	335	Linker.				cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						TGCATTGCAGGCCCCCAGAGA	0.552			T	ETV6|ITK	MDS|peripheral T-cell lymphoma								61	136	---	---	---	---	PASS
PHF2	5253	broad.mit.edu	37	9	96339125	96339125	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96339125G>C	uc004aub.2	+	1	217	c.70G>C	c.(70-72)GAC>CAC	p.D24H	PHF2_uc011lug.1_Intron	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	24	PHD-type.			FMIECDACKDWFHGSCVGVEEEE -> PRAARPPARPGPTR AAQRRGRAT (in Ref. 2; BAA31637).	liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		GATCGAGTGCGACGCCTGCAA	0.438													2	4	---	---	---	---	PASS
RAD23B	5887	broad.mit.edu	37	9	110068879	110068879	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110068879G>A	uc004bde.2	+	4	815	c.448G>A	c.(448-450)GAA>AAA	p.E150K	RAD23B_uc011lwa.1_Missense_Mutation_p.E150K|RAD23B_uc011lwb.1_Missense_Mutation_p.E129K	NM_002874	NP_002865	P54727	RD23B_HUMAN	UV excision repair protein RAD23 homolog B	150					nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|regulation of proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|nucleoplasm|proteasome complex|XPC complex	damaged DNA binding|polyubiquitin binding|single-stranded DNA binding			ovary(1)	1						GAAGCCTGCAGAAAAGCCAGC	0.507								Direct_reversal_of_damage|NER					12	41	---	---	---	---	PASS
CTNNAL1	8727	broad.mit.edu	37	9	111745505	111745505	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111745505C>G	uc004bdo.1	-	6	862	c.820G>C	c.(820-822)GAA>CAA	p.E274Q	CTNNAL1_uc010mts.1_Missense_Mutation_p.E10Q|CTNNAL1_uc010mtt.1_Missense_Mutation_p.E274Q|CTNNAL1_uc004bdp.1_Missense_Mutation_p.E274Q	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1	274					cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)		GTCACAATTTCAATGACCTTA	0.363													8	47	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113198742	113198742	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113198742C>A	uc010mtz.2	-	28	5019	c.4682G>T	c.(4681-4683)GGA>GTA	p.G1561V		NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	1561	Pentaxin.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						GAATCCCTCTCCTTTTTTGTC	0.488													10	33	---	---	---	---	PASS
KIF12	113220	broad.mit.edu	37	9	116854235	116854235	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116854235C>T	uc004bif.2	-	16	1686	c.1448G>A	c.(1447-1449)AGA>AAA	p.R483K	KIF12_uc004big.2_RNA	NM_138424	NP_612433	Q96FN5	KIF12_HUMAN	kinesin family member 12	616					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						AATCTGGTCTCTGAGGGCCTC	0.677													7	14	---	---	---	---	PASS
DFNB31	25861	broad.mit.edu	37	9	117185765	117185765	+	Silent	SNP	C	T	T	rs141807746	byFrequency	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117185765C>T	uc004biz.3	-	7	2104	c.1455G>A	c.(1453-1455)CCG>CCA	p.P485P	DFNB31_uc004bix.2_Silent_p.P134P|DFNB31_uc004biy.3_Silent_p.P102P|DFNB31_uc004bja.3_Silent_p.P485P	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1	485					inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6						CTAGGTCTTGCGGGGAAATGG	0.632													4	121	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117810761	117810761	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117810761C>T	uc004bjj.3	-	16	4992	c.4630G>A	c.(4630-4632)GGG>AGG	p.G1544R	TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1544	Fibronectin type-III 11.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						ACTGTGAACCCGTAGGGATTA	0.502													5	27	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117838840	117838840	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117838840T>C	uc004bjj.3	-	8	3051	c.2689A>G	c.(2689-2691)AGG>GGG	p.R897G	TNC_uc010mvf.2_Missense_Mutation_p.R897G	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	897	Fibronectin type-III 4.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						CGAAGATTCCTGGGAGCATCG	0.458													73	318	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17110148	17110148	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17110148C>G	uc001ioo.2	-	21	2975	c.2923G>C	c.(2923-2925)GAA>CAA	p.E975Q		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	975	CUB 5.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGAAATGTTTCGAACATTAAA	0.408													37	40	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33502550	33502550	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33502550C>G	uc001iwx.3	-	9	1901	c.1378G>C	c.(1378-1380)GAA>CAA	p.E460Q	NRP1_uc001iwv.3_Missense_Mutation_p.E460Q|NRP1_uc009xlz.2_Missense_Mutation_p.E460Q|NRP1_uc001iww.3_Missense_Mutation_p.E279Q|NRP1_uc001iwy.3_Missense_Mutation_p.E460Q|NRP1_uc001iwz.2_Missense_Mutation_p.E460Q|NRP1_uc001ixa.2_Missense_Mutation_p.E460Q|NRP1_uc001ixb.1_Missense_Mutation_p.E460Q|NRP1_uc001ixc.1_Missense_Mutation_p.E460Q	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	460	Extracellular (Potential).|F5/8 type C 2.				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	CGGATGTTTTCAGGCATCCAG	0.517													22	209	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73500672	73500672	+	Missense_Mutation	SNP	G	A	A	rs149752120	by1000genomes	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73500672G>A	uc001jrx.3	+	35	4959	c.4582G>A	c.(4582-4584)GAG>AAG	p.E1528K	CDH23_uc001jsc.1_Missense_Mutation_p.E335K	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	1528	Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						TCCAGTCATCGAGAGCCCCTT	0.587													30	92	---	---	---	---	PASS
CHST3	9469	broad.mit.edu	37	10	73767018	73767018	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73767018C>T	uc001jsn.2	+	3	669	c.229C>T	c.(229-231)CTC>TTC	p.L77F		NM_004273	NP_004264	Q7LGC8	CHST3_HUMAN	chondroitin 6-sulfotransferase 3	77	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0						GAACGCATCTCTCTTGTCCCT	0.592													12	42	---	---	---	---	PASS
EXOC6	54536	broad.mit.edu	37	10	94675628	94675628	+	Silent	SNP	A	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94675628A>G	uc001kig.2	+	7	843	c.777A>G	c.(775-777)GTA>GTG	p.V259V	EXOC6_uc010qnr.1_Silent_p.V275V|EXOC6_uc001kie.2_Silent_p.V254V|EXOC6_uc009xub.2_Silent_p.V259V|EXOC6_uc009xuc.2_Silent_p.V259V	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a	259					protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				ATGAAACTGTATTGAAACATT	0.294													3	113	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95109574	95109574	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95109574G>T	uc001kin.2	-	36	4197	c.4074C>A	c.(4072-4074)TTC>TTA	p.F1358L	MYOF_uc001kio.2_Missense_Mutation_p.F1345L|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1358	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						CCACTTTCATGAAGAGAACAG	0.443													5	90	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97135792	97135792	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97135792C>G	uc001kkp.2	-	17	1720	c.1675G>C	c.(1675-1677)GAG>CAG	p.E559Q	SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Missense_Mutation_p.E161Q|SORBS1_uc001kkn.2_Missense_Mutation_p.E346Q|SORBS1_uc001kkm.2_Missense_Mutation_p.E415Q|SORBS1_uc001kko.2_Missense_Mutation_p.E581Q|SORBS1_uc001kkq.2_Missense_Mutation_p.E444Q|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Missense_Mutation_p.E513Q|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	559					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AAATCTATCTCTTCTGGGCTT	0.368													12	60	---	---	---	---	PASS
SUFU	51684	broad.mit.edu	37	10	104375151	104375151	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104375151C>G	uc001kvy.1	+	9	1295	c.1149C>G	c.(1147-1149)CTC>CTG	p.L383L	SUFU_uc001kvw.1_Silent_p.L383L|SUFU_uc001kvx.2_Silent_p.L383L|SUFU_uc009xxe.1_RNA|SUFU_uc009xxf.1_RNA	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused	383					negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		TCATTCCTCTCTGCCTAAGGT	0.612			D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				12	81	---	---	---	---	PASS
FRG2B	441581	broad.mit.edu	37	10	135440231	135440231	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135440231C>T	uc010qvg.1	-	1	69	c.16G>A	c.(16-18)GAA>AAA	p.E6K		NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	6						nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TCGGGGTCTTCATTTCCCTTT	0.512													9	316	---	---	---	---	PASS
PHRF1	57661	broad.mit.edu	37	11	610993	610993	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:610993G>A	uc001lqe.2	+	17	4848	c.4717G>A	c.(4717-4719)GAG>AAG	p.E1573K	PHRF1_uc010qwc.1_Missense_Mutation_p.E1572K|PHRF1_uc010qwd.1_Missense_Mutation_p.E1571K|PHRF1_uc010qwe.1_Missense_Mutation_p.E1569K|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1573	Potential.						RNA polymerase binding|zinc ion binding				0						TGCTGTGGAGGAGGTGAAGCT	0.597													4	33	---	---	---	---	PASS
OR56B1	387748	broad.mit.edu	37	11	5758571	5758571	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5758571G>A	uc001mbt.1	+	1	825	c.825G>A	c.(823-825)ATG>ATA	p.M275I	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005180	NP_001005180	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B,	275	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		TGACAGAGATGAAGGCTACTT	0.443													6	170	---	---	---	---	PASS
APBB1	322	broad.mit.edu	37	11	6423916	6423916	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6423916C>T	uc001mdb.1	-	7	1244	c.1144G>A	c.(1144-1146)GAG>AAG	p.E382K	APBB1_uc001mcz.1_Missense_Mutation_p.E3K|APBB1_uc001mdd.3_Missense_Mutation_p.E162K|APBB1_uc001mda.2_Intron|APBB1_uc001mdc.1_Missense_Mutation_p.E382K|APBB1_uc010rab.1_5'Flank|APBB1_uc010rac.1_5'Flank|APBB1_uc010rad.1_Missense_Mutation_p.E3K|APBB1_uc010rae.1_Missense_Mutation_p.E147K|APBB1_uc010raf.1_Missense_Mutation_p.E123K|APBB1_uc009yfa.2_Missense_Mutation_p.E123K|APBB1_uc009yey.2_Missense_Mutation_p.E123K|APBB1_uc010rag.1_Missense_Mutation_p.E123K|APBB1_uc009yfb.2_Missense_Mutation_p.E123K|APBB1_uc001mde.2_Missense_Mutation_p.E123K|APBB1_uc010rah.1_Missense_Mutation_p.E123K	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	382	PID 1.				apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		AGCTCCTCCTCGGTCATCTCT	0.572													22	87	---	---	---	---	PASS
OR2D3	120775	broad.mit.edu	37	11	6942438	6942438	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6942438C>T	uc010rav.1	+	1	206	c.206C>T	c.(205-207)TCT>TTT	p.S69F		NM_001004684	NP_001004684	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D,	69	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTCCTGGATTCTCGCCTTCAC	0.428													5	142	---	---	---	---	PASS
TUB	7275	broad.mit.edu	37	11	8120384	8120384	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8120384A>T	uc001mga.2	+	9	1227	c.1078A>T	c.(1078-1080)AGT>TGT	p.S360C	TUB_uc010rbk.1_Missense_Mutation_p.S366C|TUB_uc001mfy.2_Missense_Mutation_p.S415C	NM_177972	NP_813977	P50607	TUB_HUMAN	tubby isoform b	360					phagocytosis|positive regulation of phagocytosis|response to stimulus	cytoplasm|extracellular region|nucleus|plasma membrane				ovary(1)	1		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		CACTTTGGAAAGTGGAACCTT	0.488											OREG0020732	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	47	145	---	---	---	---	PASS
TEAD1	7003	broad.mit.edu	37	11	12886424	12886424	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12886424C>T	uc001mkj.3	+	5	927	c.262C>T	c.(262-264)CGT>TGT	p.R88C	TEAD1_uc009ygk.2_RNA	NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1	103					hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		AAGGAAATCTCGTGATTTTCA	0.458													29	92	---	---	---	---	PASS
COPB1	1315	broad.mit.edu	37	11	14491055	14491055	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14491055A>T	uc001mli.2	-	15	2099	c.1792T>A	c.(1792-1794)TCC>ACC	p.S598T	COPB1_uc001mlg.2_Missense_Mutation_p.S598T|COPB1_uc001mlh.2_Missense_Mutation_p.S598T	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	598					COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						GGAAGAGAGGATTTTCCCAAA	0.388													9	54	---	---	---	---	PASS
UEVLD	55293	broad.mit.edu	37	11	18566256	18566256	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18566256C>G	uc001mot.2	-	9	1054	c.974G>C	c.(973-975)AGA>ACA	p.R325T	UEVLD_uc001mou.2_Missense_Mutation_p.R325T|UEVLD_uc010rde.1_Missense_Mutation_p.R195T|UEVLD_uc010rdf.1_Missense_Mutation_p.R303T|UEVLD_uc010rdg.1_Missense_Mutation_p.R195T|UEVLD_uc001mov.2_Missense_Mutation_p.R303T	NM_001040697	NP_001035787	Q8IX04	UEVLD_HUMAN	ubiquitin-conjugating enzyme E2-like isoform a	325					cellular carbohydrate metabolic process|protein modification process|protein transport		binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor				0						ATACTGTAATCTCTGTGAATC	0.373													4	180	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26681913	26681913	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26681913G>A	uc001mqt.3	+	27	3013	c.2868G>A	c.(2866-2868)ATG>ATA	p.M956I	ANO3_uc010rdr.1_Missense_Mutation_p.M940I|ANO3_uc010rds.1_Missense_Mutation_p.M795I|ANO3_uc010rdt.1_Missense_Mutation_p.M810I	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	956	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TTCAAGAAATGATGTATGAGG	0.428													14	35	---	---	---	---	PASS
AMBRA1	55626	broad.mit.edu	37	11	46569790	46569790	+	Intron	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46569790C>A	uc010rgu.1	-						AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TAGCCATTTTCCTTACCTTGC	0.498													214	444	---	---	---	---	PASS
NR1H3	10062	broad.mit.edu	37	11	47290109	47290109	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47290109G>C	uc009ylm.2	+	10	1427	c.1206G>C	c.(1204-1206)CTG>CTC	p.L402L	MADD_uc001neq.2_5'Flank|MADD_uc001ner.1_5'Flank|MADD_uc001nev.1_5'Flank|MADD_uc001nes.1_5'Flank|MADD_uc001net.1_5'Flank|MADD_uc009yln.1_5'Flank|MADD_uc001neu.1_5'Flank|MADD_uc001nex.2_5'Flank|MADD_uc001nez.2_5'Flank|MADD_uc001new.2_5'Flank|NR1H3_uc010rhk.1_Silent_p.L408L|NR1H3_uc001nek.2_Silent_p.L357L|NR1H3_uc001nej.2_Silent_p.L342L|NR1H3_uc001nel.2_Silent_p.L421L|NR1H3_uc001nen.3_Silent_p.L342L|NR1H3_uc001nem.2_Silent_p.L402L|NR1H3_uc001nep.2_Silent_p.L251L	NM_005693	NP_005684	Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	402	Ligand-binding (Potential).				apoptotic cell clearance|cellular response to lipopolysaccharide|cholesterol homeostasis|negative regulation of cholesterol storage|negative regulation of inflammatory response|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of macrophage activation|negative regulation of pancreatic juice secretion|negative regulation of pinocytosis|negative regulation of secretion of lysosomal enzymes|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of cholesterol homeostasis|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor biosynthetic process|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of circadian rhythm|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to progesterone stimulus|triglyceride homeostasis	nuclear chromatin|nucleoplasm	cholesterol binding|steroid hormone receptor activity|sterol response element binding|transcription coactivator activity|zinc ion binding			ovary(2)|lung(1)	3						AGGACCGACTGATGTTCCCAC	0.562													4	219	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003766	50003766	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003766G>A	uc010ria.1	-	1	272	c.272C>T	c.(271-273)TCC>TTC	p.S91F		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	91	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						CCCATTAAAGGAGATGATTTT	0.428													12	79	---	---	---	---	PASS
MS4A2	2206	broad.mit.edu	37	11	59857928	59857928	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59857928C>T	uc001nop.2	+	3	408	c.306C>T	c.(304-306)TTC>TTT	p.F102F	MS4A2_uc009ymu.2_Silent_p.F102F	NM_000139	NP_000130	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member	102	Helical; (Potential).				cell proliferation|humoral immune response	integral to plasma membrane	calcium channel activity			ovary(1)	1		all_epithelial(135;0.245)			Omalizumab(DB00043)	GTTATCCATTCTGGGGAGCCA	0.343													5	120	---	---	---	---	PASS
C11orf83	790955	broad.mit.edu	37	11	62439341	62439341	+	Intron	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62439341G>A	uc001nui.3	+						C11orf48_uc001nue.2_5'Flank|C11orf48_uc001nuf.2_5'Flank|C11orf48_uc010rmd.1_5'Flank	NM_001085372	NP_001078841	Q6UW78	CK083_HUMAN	hypothetical protein LOC790955 precursor							extracellular region					0						GCTAAAGGTAGAAGCAACTGG	0.642													12	41	---	---	---	---	PASS
NPAS4	266743	broad.mit.edu	37	11	66188674	66188674	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66188674C>T	uc001ohx.1	+	1	200	c.24C>T	c.(22-24)GCC>GCT	p.A8A	NPAS4_uc010rpc.1_5'UTR	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	8	Potential.|Basic motif.				transcription, DNA-dependent		DNA binding|signal transducer activity				0						CCAAGGGCGCCTCCAAGGCGC	0.701													3	18	---	---	---	---	PASS
PELI3	246330	broad.mit.edu	37	11	66240739	66240739	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66240739G>A	uc001oic.3	+	6	648	c.484G>A	c.(484-486)GAC>AAC	p.D162N	PELI3_uc001oib.2_Missense_Mutation_p.D162N|PELI3_uc001oid.3_Missense_Mutation_p.D138N|PELI3_uc001oie.3_Missense_Mutation_p.D13N|PELI3_uc010rpd.1_Missense_Mutation_p.D3N	NM_145065	NP_659502	Q8N2H9	PELI3_HUMAN	pellino 3 alpha isoform 1	162						cytosol	protein binding			ovary(1)	1						GAACATGATTGACTTCGTGGT	0.597													41	81	---	---	---	---	PASS
SERPINH1	871	broad.mit.edu	37	11	75277832	75277832	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75277832C>T	uc001owr.2	+	2	667	c.438C>T	c.(436-438)TTC>TTT	p.F146F	SERPINH1_uc009yuf.2_Silent_p.F146F|SERPINH1_uc009yug.2_Silent_p.F146F|SERPINH1_uc001ows.2_Silent_p.F146F|SERPINH1_uc001owt.2_5'Flank	NM_001235	NP_001226	P50454	SERPH_HUMAN	serine (or cysteine) proteinase inhibitor, clade	146					regulation of proteolysis|response to unfolded protein	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	collagen binding|serine-type endopeptidase inhibitor activity			ovary(2)	2	Ovarian(111;0.11)					CTGATGACTTCGTGCGCAGCA	0.622													17	53	---	---	---	---	PASS
FZD4	8322	broad.mit.edu	37	11	86665891	86665891	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86665891C>G	uc001pce.2	-	1	543	c.237G>C	c.(235-237)CTG>CTC	p.L79L	uc001pcf.2_5'Flank	NM_012193	NP_036325	Q9ULV1	FZD4_HUMAN	frizzled 4 precursor	79	FZ.|Extracellular (Potential).				canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|negative regulation of cell-substrate adhesion|neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|progesterone secretion|regulation of vascular endothelial growth factor receptor signaling pathway|substrate adhesion-dependent cell spreading|vasculogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cell projection|cell surface|cytoplasm	cytokine binding|G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding			large_intestine(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGAAAGTTGTCAGCTGCAGCT	0.662													4	9	---	---	---	---	PASS
ACRBP	84519	broad.mit.edu	37	12	6752714	6752714	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6752714G>A	uc001qpu.1	-	6	1116	c.1068C>T	c.(1066-1068)TTC>TTT	p.F356F	ACRBP_uc010sfg.1_Silent_p.F323F	NM_032489	NP_115878	Q8NEB7	ACRBP_HUMAN	proacrosin binding protein sp32 precursor	356						acrosomal vesicle|extracellular region				central_nervous_system(1)	1						CCGACTTCCCGAAACCAAGGA	0.552													29	49	---	---	---	---	PASS
MCRS1	10445	broad.mit.edu	37	12	49958304	49958304	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49958304C>G	uc001ruk.1	-	6	708	c.517G>C	c.(517-519)GAG>CAG	p.E173Q	MCRS1_uc001rui.1_Missense_Mutation_p.E186Q|MCRS1_uc001ruj.1_Missense_Mutation_p.E160Q|MCRS1_uc001rul.1_Missense_Mutation_p.E173Q|MCRS1_uc009zlj.1_5'UTR|MCRS1_uc001rum.1_Missense_Mutation_p.E160Q|MCRS1_uc001run.1_Missense_Mutation_p.E173Q	NM_006337	NP_006328	Q96EZ8	MCRS1_HUMAN	microspherule protein 1 isoform 1	173					DNA recombination|DNA repair|protein modification process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|MLL1 complex|nucleolus	protein binding			large_intestine(1)	1						TACCAACGCTCCTGGACCTCC	0.602													4	29	---	---	---	---	PASS
MCRS1	10445	broad.mit.edu	37	12	49958552	49958552	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49958552C>T	uc001ruk.1	-	5	606	c.415G>A	c.(415-417)GAT>AAT	p.D139N	MCRS1_uc001rui.1_Missense_Mutation_p.D152N|MCRS1_uc001ruj.1_Missense_Mutation_p.D126N|MCRS1_uc001rul.1_Missense_Mutation_p.D139N|MCRS1_uc009zlj.1_5'UTR|MCRS1_uc001rum.1_Missense_Mutation_p.D126N|MCRS1_uc001run.1_Missense_Mutation_p.D139N	NM_006337	NP_006328	Q96EZ8	MCRS1_HUMAN	microspherule protein 1 isoform 1	139					DNA recombination|DNA repair|protein modification process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|MLL1 complex|nucleolus	protein binding			large_intestine(1)	1						AGGAGGTCATCTGCAGGCTTC	0.587													12	89	---	---	---	---	PASS
LIMA1	51474	broad.mit.edu	37	12	50625463	50625463	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50625463C>T	uc001rwj.3	-	3	324	c.150G>A	c.(148-150)ATG>ATA	p.M50I	LIMA1_uc001rwk.3_Missense_Mutation_p.M50I|LIMA1_uc010smr.1_RNA|LIMA1_uc010sms.1_RNA	NM_016357	NP_057441	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1 isoform b	50					actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1						TCTTCTTCTCCATGTTTGTTT	0.403													17	113	---	---	---	---	PASS
KRT84	3890	broad.mit.edu	37	12	52775182	52775182	+	Missense_Mutation	SNP	C	T	T	rs146876431		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52775182C>T	uc001sah.1	-	5	1088	c.1040G>A	c.(1039-1041)CGC>CAC	p.R347H		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	347	Rod.|Coil 2.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCCCGGCTGCGCCTGGCCAC	0.562													85	209	---	---	---	---	PASS
CSAD	51380	broad.mit.edu	37	12	53566403	53566403	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53566403C>G	uc001sby.2	-	4	282	c.156G>C	c.(154-156)CTG>CTC	p.L52L	CSAD_uc001sbw.2_Intron|CSAD_uc009zmt.2_5'UTR|CSAD_uc010snx.1_Silent_p.L79L|CSAD_uc001sbz.2_Silent_p.L52L|CSAD_uc009zmu.2_Intron|CSAD_uc001sca.3_RNA|CSAD_uc010sny.1_Silent_p.L52L	NM_015989	NP_057073	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	52					carboxylic acid metabolic process		pyridoxal phosphate binding|sulfinoalanine decarboxylase activity			ovary(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	GCAGCTGCTTCAGCTCCTCAG	0.607									Hereditary_Prostate_Cancer				8	18	---	---	---	---	PASS
CALCOCO1	57658	broad.mit.edu	37	12	54109651	54109651	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54109651C>T	uc001sef.2	-	9	1330	c.1186G>A	c.(1186-1188)GAG>AAG	p.E396K	CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Missense_Mutation_p.E311K|CALCOCO1_uc010son.1_Missense_Mutation_p.E273K|CALCOCO1_uc001seh.2_Missense_Mutation_p.E396K|CALCOCO1_uc009znd.2_Missense_Mutation_p.E396K|CALCOCO1_uc001seg.2_Missense_Mutation_p.E221K|CALCOCO1_uc010soo.1_Missense_Mutation_p.E389K	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	396					steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						AAACCGAGCTCAGCCAGCCTG	0.607													20	36	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56094855	56094855	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56094855G>A	uc001shh.2	-	4	718	c.498C>T	c.(496-498)CTC>CTT	p.L166L	ITGA7_uc001shg.2_Silent_p.L166L|ITGA7_uc010sps.1_Silent_p.L69L|ITGA7_uc009znx.2_Silent_p.L53L	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	166	FG-GAP 2.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						GGTCCTGGCTGAGCACAAAGC	0.587													24	63	---	---	---	---	PASS
RDH5	5959	broad.mit.edu	37	12	56117755	56117755	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56117755G>C	uc001shk.2	+	4	838	c.655G>C	c.(655-657)GAG>CAG	p.E219Q	RDH5_uc001shl.2_Missense_Mutation_p.E219Q	NM_002905	NP_002896	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis and 9-cis)	219					response to stimulus|visual perception	membrane	binding|retinol dehydrogenase activity			ovary(1)	1					NADH(DB00157)|Vitamin A(DB00162)	GGAGAGTCTGGAGAAAACCCT	0.617													6	65	---	---	---	---	PASS
GRIP1	23426	broad.mit.edu	37	12	66773106	66773106	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66773106C>T	uc001stk.2	-	19	2660	c.2419G>A	c.(2419-2421)GAT>AAT	p.D807N	GRIP1_uc010sta.1_Missense_Mutation_p.D751N|GRIP1_uc001stj.2_Missense_Mutation_p.D589N|GRIP1_uc001stl.1_Missense_Mutation_p.D699N|GRIP1_uc001stm.2_Missense_Mutation_p.D807N	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	859					androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		AGCCCCACATCTGGGTAAGTC	0.522													11	271	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94676114	94676114	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94676114C>T	uc001tdc.2	+	23	4065	c.3816C>T	c.(3814-3816)ATC>ATT	p.I1272I	PLXNC1_uc010sut.1_Silent_p.I319I|PLXNC1_uc009zsv.2_Silent_p.I11I	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	1272	Cytoplasmic (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						TTCTGGACATCGACAGTTCCT	0.428													36	109	---	---	---	---	PASS
C12orf63	374467	broad.mit.edu	37	12	97087524	97087524	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97087524C>G	uc001tet.1	+	12	1642	c.1564C>G	c.(1564-1566)CAA>GAA	p.Q522E		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	522										skin(6)|ovary(1)	7						TGCATTGTATCAATATTTTGT	0.294													10	72	---	---	---	---	PASS
APAF1	317	broad.mit.edu	37	12	99059471	99059471	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99059471G>A	uc001tfz.2	+	8	1673	c.1096G>A	c.(1096-1098)GAA>AAA	p.E366K	APAF1_uc001tfy.2_Missense_Mutation_p.E355K|APAF1_uc001tga.2_Missense_Mutation_p.E355K|APAF1_uc001tgb.2_Missense_Mutation_p.E366K|APAF1_uc001tgc.2_Intron	NM_181861	NP_863651	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1 isoform	366	NB-ARC.				activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding			ovary(2)|lung(1)	3					Adenosine triphosphate(DB00171)	GGCTCTAGATGAAGCCATGTC	0.388													14	57	---	---	---	---	PASS
SLC17A8	246213	broad.mit.edu	37	12	100787219	100787219	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100787219C>T	uc010svi.1	+	4	859	c.546C>T	c.(544-546)TAC>TAT	p.Y182Y	SLC17A8_uc009ztx.2_Silent_p.Y182Y	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	182	Vesicular (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						GAGTGCATTACGGATGCGTCA	0.453													15	64	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104092950	104092950	+	Missense_Mutation	SNP	G	A	A	rs151309446		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104092950G>A	uc001tjw.2	+	34	3845	c.3659G>A	c.(3658-3660)CGT>CAT	p.R1220H		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1220	Extracellular (Potential).|FAS1 4.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GGCATGCATCGTGAGACCATG	0.478													9	32	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105558478	105558478	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105558478G>A	uc001tld.2	+	32	3501	c.3414G>A	c.(3412-3414)AAG>AAA	p.K1138K	KIAA1033_uc010swr.1_Silent_p.K1139K|KIAA1033_uc010sws.1_Silent_p.K950K	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	1138	Potential.				endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						GAGCAGACAAGACTGCGGCTG	0.323													5	13	---	---	---	---	PASS
MYO1H	283446	broad.mit.edu	37	12	109834304	109834304	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109834304G>A	uc010sxn.1	+	3	358	c.358G>A	c.(358-360)GAG>AAG	p.E120K		NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H	Error:Variant_position_missing_in_B4DNW6_after_alignment						myosin complex	motor activity				0						GAAAATTCTCGAGTATTTTGC	0.493													6	42	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124416304	124416304	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124416304C>G	uc001uft.3	+	74	12709	c.12684C>G	c.(12682-12684)CTC>CTG	p.L4228L	DNAH10_uc001ufu.3_Silent_p.L141L	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4228					microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GAACAGGACTCTCCCCCACTT	0.527													4	122	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130856118	130856118	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130856118T>C	uc001uik.2	+	21	2651	c.2561T>C	c.(2560-2562)CTG>CCG	p.L854P		NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	854					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		AATCTGTCACTGTCAAACCGC	0.433													42	91	---	---	---	---	PASS
PAN3	255967	broad.mit.edu	37	13	28866556	28866556	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28866556C>T	uc001urz.2	+	18	2131	c.2123C>T	c.(2122-2124)TCC>TTC	p.S708F	PAN3_uc001ury.2_Missense_Mutation_p.S542F|PAN3_uc001urx.2_Missense_Mutation_p.S654F	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	854	Interaction with PAN2.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		AGCCTGATTTCCAGAGATGAG	0.363													13	79	---	---	---	---	PASS
NAA16	79612	broad.mit.edu	37	13	41936244	41936244	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41936244G>T	uc001uyf.2	+	13	1812	c.1488G>T	c.(1486-1488)CAG>CAT	p.Q496H	NAA16_uc010tfg.1_RNA	NM_024561	NP_078837	Q6N069	NAA16_HUMAN	NMDA receptor regulated 1-like protein isoform	496	TPR 7.				N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent	cytoplasm|transcription factor complex	binding			central_nervous_system(1)	1						CAGCTTATCAGCGTCTGGGGA	0.383													5	40	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76301162	76301162	+	Intron	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76301162C>T	uc010thv.1	+						LMO7_uc001vjt.1_Intron	NM_005358	NP_005349	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 1							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TATTTACTTTCAGTTTGATTA	0.323													4	33	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84455071	84455071	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84455071G>T	uc001vlk.2	-	1	1458	c.572C>A	c.(571-573)ACG>AAG	p.T191K		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	191	Extracellular (Potential).|LRR 6.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		ATAGGGCAGCGTTTTCAGCCT	0.527													28	78	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110829384	110829384	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110829384C>T	uc001vqw.3	-	34	2839	c.2717G>A	c.(2716-2718)GGG>GAG	p.G906E	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	906	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GCCATGGTCCCCTGCAGAGGA	0.587													4	69	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110839653	110839653	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110839653C>T	uc001vqw.3	-	25	1682	c.1560G>A	c.(1558-1560)CTG>CTA	p.L520L	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	520	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GCTGGCCTATCAGCCCTGGTG	0.547													15	61	---	---	---	---	PASS
TUBGCP3	10426	broad.mit.edu	37	13	113153502	113153502	+	Intron	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113153502G>A	uc001vse.1	-						TUBGCP3_uc010tjq.1_Intron|TUBGCP3_uc001vsf.2_Intron	NM_006322	NP_006313	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3						G2/M transition of mitotic cell cycle|microtubule nucleation|single fertilization	centriole|cytosol|polar microtubule	gamma-tubulin binding|structural constituent of cytoskeleton			central_nervous_system(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					AAAAGTGCCTGAAAGAGATGA	0.323													5	89	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20249054	20249054	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249054C>A	uc010tku.1	+	1	573	c.573C>A	c.(571-573)AAC>AAA	p.N191K		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	191	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTGTGCCAACACCTTCCCAG	0.483													35	141	---	---	---	---	PASS
NUBPL	80224	broad.mit.edu	37	14	32142755	32142755	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32142755C>T	uc001wrk.3	+	6	543	c.488C>T	c.(487-489)TCG>TTG	p.S163L	NUBPL_uc010amj.2_RNA|NUBPL_uc010tpl.1_Missense_Mutation_p.S67L	NM_025152	NP_079428	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like	163					mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)		ATGGTAATGTCGGCCATTGAG	0.353													5	110	---	---	---	---	PASS
PSMA6	5687	broad.mit.edu	37	14	35782140	35782140	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35782140G>A	uc001wtd.2	+	5	572	c.463G>A	c.(463-465)GAT>AAT	p.D155N	KIAA0391_uc001wta.2_RNA|PSMA6_uc010tpt.1_Missense_Mutation_p.D76N|PSMA6_uc010tpu.1_Missense_Mutation_p.D76N	NM_002791	NP_002782	P60900	PSA6_HUMAN	proteasome alpha 6 subunit	155					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nuclear matrix|polysome|proteasome core complex, alpha-subunit complex|sarcomere	NF-kappaB binding|purine ribonucleoside triphosphate binding|RNA binding|threonine-type endopeptidase activity				0	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		ATATAAGTGTGATCCTGCAGG	0.363													8	289	---	---	---	---	PASS
NFKBIA	4792	broad.mit.edu	37	14	35872941	35872941	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35872941C>T	uc001wtf.3	-	2	401	c.291G>A	c.(289-291)GTG>GTA	p.V97V	NFKBIA_uc001wte.3_Silent_p.V7V|NFKBIA_uc001wtg.3_Silent_p.V97V|NFKBIA_uc010amo.2_Intron	NM_020529	NP_065390	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene	97	ANK 1.				anti-apoptosis|apoptosis|cellular response to cold|cytoplasmic sequestering of NF-kappaB|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of DNA binding|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|I-kappaB/NF-kappaB complex|nucleus|plasma membrane	identical protein binding|NF-kappaB binding|nuclear localization sequence binding|ubiquitin protein ligase binding			breast(2)	2	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)		GGTCTCCCTTCACCTGGCGGA	0.582													10	28	---	---	---	---	PASS
SLC25A21	89874	broad.mit.edu	37	14	37283178	37283178	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37283178G>A	uc001wtz.1	-	3	458	c.148C>T	c.(148-150)CCA>TCA	p.P50S		NM_030631	NP_085134	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial	50	Solcar 1.				lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)		TAACTGTTTGGATCGGTTGCA	0.313													21	10	---	---	---	---	PASS
GALC	2581	broad.mit.edu	37	14	88442767	88442767	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88442767G>C	uc001xvt.2	-	7	1086	c.687C>G	c.(685-687)CTC>CTG	p.L229L	GALC_uc010tvw.1_RNA|GALC_uc010tvx.1_Silent_p.L203L|GALC_uc010tvy.1_Silent_p.L206L|GALC_uc010tvz.1_Silent_p.L173L|GALC_uc001xvu.1_Silent_p.L229L	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	229					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						TGGACTCCCAGAGATTATCAC	0.388													5	45	---	---	---	---	PASS
C14orf102	55051	broad.mit.edu	37	14	90755274	90755274	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90755274C>T	uc001xyi.1	-	11	2476	c.2445G>A	c.(2443-2445)CTG>CTA	p.L815L	C14orf102_uc010atp.1_Silent_p.L320L|C14orf102_uc001xyj.1_Silent_p.L584L|C14orf102_uc001xyk.1_Silent_p.L7L	NM_017970	NP_060440	Q9H7Z3	CN102_HUMAN	hypothetical protein LOC55051 isoform 1	815							protein binding			ovary(2)|lung(1)	3		all_cancers(154;0.118)		COAD - Colon adenocarcinoma(157;0.218)		CAGAGTCTTTCAGTTCTCTGC	0.532													12	185	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94089013	94089013	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94089013G>A	uc001ybv.1	+	28	5052	c.4969G>A	c.(4969-4971)GAA>AAA	p.E1657K	KIAA1409_uc001ybs.1_Missense_Mutation_p.E1635K	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1812						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ATCTGATACAGAACAGAATCC	0.483													4	38	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95688036	95688036	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95688036C>G	uc001yef.2	-	4	432	c.316G>C	c.(316-318)GAT>CAT	p.D106H		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	106	Actin-binding.|CH 1.					integral to membrane	actin binding				0				Epithelial(152;0.193)		ACATTGCTATCTTCCAAAAAC	0.408													42	85	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102498622	102498622	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102498622C>G	uc001yks.2	+	52	10061	c.9897C>G	c.(9895-9897)ATC>ATG	p.I3299M		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	3299	Stalk (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TGAAGTCGATCAAGAAGCAGC	0.577													27	477	---	---	---	---	PASS
SNRPN	6638	broad.mit.edu	37	15	25227220	25227220	+	Intron	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25227220C>A	uc001ywz.1	+						PAR-SN_uc001yxa.1_RNA|PAR-SN_uc001yxc.2_RNA|PAR-SN_uc001yxb.3_RNA|PAR5_uc001yxd.2_5'Flank			P63162	RSMN_HUMAN	Homo sapiens SNRPN upstream reading frame protein (SNURF) mRNA, complete cds.						RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		GAAATCCAGTCAGTGTGCCTC	0.363									Prader-Willi_syndrome				10	241	---	---	---	---	PASS
UBE3A	7337	broad.mit.edu	37	15	25620710	25620710	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25620710C>T	uc001zaq.2	-	3	272	c.272G>A	c.(271-273)GGA>GAA	p.G91E	UBE3A_uc001zar.2_Missense_Mutation_p.G68E|UBE3A_uc001zas.2_Missense_Mutation_p.G88E|UBE3A_uc001zat.2_Missense_Mutation_p.G68E	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	91					brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		TGAGCTTGCTCCTTTCTTGGA	0.413													7	91	---	---	---	---	PASS
C15orf41	84529	broad.mit.edu	37	15	37002110	37002110	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37002110G>A	uc001zje.3	+	10	914	c.664G>A	c.(664-666)GAA>AAA	p.E222K	C15orf41_uc001zjd.2_Missense_Mutation_p.E222K|C15orf41_uc010bbb.1_Missense_Mutation_p.E124K|C15orf41_uc001zjf.2_Missense_Mutation_p.E124K|C15orf41_uc010uci.1_Missense_Mutation_p.E124K	NM_001130010	NP_001123482	Q9Y2V0	CO041_HUMAN	hypothetical protein LOC84529 isoform 1	222							protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		ATTTGGTGATGAATGTAGCCA	0.418													9	23	---	---	---	---	PASS
GPR176	11245	broad.mit.edu	37	15	40093815	40093815	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40093815C>T	uc001zkj.1	-	3	1932	c.1066G>A	c.(1066-1068)GAG>AAG	p.E356K	GPR176_uc010uck.1_Missense_Mutation_p.E296K	NM_007223	NP_009154	Q14439	GP176_HUMAN	G protein-coupled receptor 176	356	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		AGGCTGGCCTCAGCCATGCCA	0.557													37	78	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70959889	70959889	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70959889C>G	uc002asr.2	-	16	3238	c.3134G>C	c.(3133-3135)AGA>ACA	p.R1045T	UACA_uc010uke.1_Missense_Mutation_p.R936T|UACA_uc002asq.2_Missense_Mutation_p.R1032T|UACA_uc010bin.1_Missense_Mutation_p.R1020T	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	1045	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						TGTCTTATCTCTCAAATCTTT	0.348													15	61	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72120336	72120336	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72120336C>T	uc002atl.3	-	41	7545	c.7072G>A	c.(7072-7074)GAA>AAA	p.E2358K	MYO9A_uc002atj.2_Missense_Mutation_p.E289K|MYO9A_uc002atk.2_Missense_Mutation_p.E1153K	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	2358	Potential.|Tail.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						GCACGGGGTTCCAGTACAAGC	0.423													9	29	---	---	---	---	PASS
SIN3A	25942	broad.mit.edu	37	15	75706655	75706655	+	Intron	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75706655G>A	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						TCCTCCACCTGAGGCAGGGAT	0.353													14	30	---	---	---	---	PASS
CRTC3	64784	broad.mit.edu	37	15	91150675	91150675	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91150675G>T	uc002bpp.2	+	6	648	c.542G>T	c.(541-543)GGA>GTA	p.G181V	CRTC3_uc002bpo.2_Missense_Mutation_p.G181V	NM_022769	NP_073606	Q6UUV7	CRTC3_HUMAN	transducer of regulated CREB protein 3 isoform	181	Poly-Gly.				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			CCCTATGGAGGAGGGGGCCAG	0.577			T	MAML2	salivary gland mucoepidermoid								7	165	---	---	---	---	PASS
TM2D3	80213	broad.mit.edu	37	15	102187096	102187096	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102187096C>G	uc002bxi.2	-	4	364	c.334G>C	c.(334-336)GAC>CAC	p.D112H	TM2D3_uc010usg.1_Missense_Mutation_p.D86H|TM2D3_uc002bxh.2_Missense_Mutation_p.D47H|TM2D3_uc002bxj.2_Missense_Mutation_p.D86H|TM2D3_uc002bxk.2_Missense_Mutation_p.D47H|TM2D3_uc010ush.1_Missense_Mutation_p.D112H	NM_078474	NP_510883	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3 isoform a	112						integral to membrane				ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GATTTGAAGTCTTGATCCTAT	0.403													19	124	---	---	---	---	PASS
MMP25	64386	broad.mit.edu	37	16	3107626	3107626	+	Intron	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3107626C>G	uc002cth.2	+						uc002ctj.1_Intron	NM_022468	NP_071913	Q9NPA2	MMP25_HUMAN	matrix metalloproteinase 25 preproprotein						inflammatory response|proteolysis	anchored to membrane|cell surface|plasma membrane|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0						TGAGTCATTTCACTTGGCCTC	0.398													39	142	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3828740	3828740	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3828740C>T	uc002cvv.2	-	9	2106	c.1902G>A	c.(1900-1902)AAG>AAA	p.K634K	CREBBP_uc002cvw.2_Silent_p.K596K	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	634	KIX.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CTTCCACTTTCTTAGCATAGG	0.502			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				58	124	---	---	---	---	PASS
VASN	114990	broad.mit.edu	37	16	4432189	4432189	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4432189G>A	uc002cwj.1	+	2	1466	c.1311G>A	c.(1309-1311)ACG>ACA	p.T437T	CORO7_uc002cwe.2_Intron|CORO7_uc002cwf.2_Intron|CORO7_uc002cwg.3_Intron|CORO7_uc002cwh.3_Intron|CORO7_uc010uxh.1_Intron|CORO7_uc010uxi.1_Intron|CORO7_uc002cwi.1_Intron|CORO7_uc010uxj.1_Intron|CORO7_uc010btp.1_Intron	NM_138440	NP_612449	Q6EMK4	VASN_HUMAN	slit-like 2 precursor	437	EGF-like.|Extracellular (Potential).					extracellular region|integral to membrane					0						AAGGCTTCACGGGCCTGTACT	0.697													3	12	---	---	---	---	PASS
C16orf72	29035	broad.mit.edu	37	16	9210517	9210517	+	Intron	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9210517C>T	uc002czm.2	+							NM_014117	NP_054836	Q14CZ0	CP072_HUMAN	hypothetical protein LOC29035											large_intestine(1)	1						CTTTTTTCTTCTTCCTAGGTC	0.433													50	121	---	---	---	---	PASS
RRN3	54700	broad.mit.edu	37	16	15155747	15155747	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15155747C>A	uc002dde.2	-	18	1878	c.1810G>T	c.(1810-1812)GAA>TAA	p.E604*	PDXDC1_uc002ddc.2_Intron|RRN3_uc010uzp.1_Nonsense_Mutation_p.E472*|RRN3_uc010uzq.1_Nonsense_Mutation_p.E574*	NM_018427	NP_060897	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor	604	Interaction with EIF3L.|Interaction with TWISTNB.				regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm				ovary(1)	1						TCATCATCTTCATCTTCCACT	0.443													31	84	---	---	---	---	PASS
VWA3A	146177	broad.mit.edu	37	16	22132909	22132909	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22132909C>T	uc010vbq.1	+	14	1423	c.1327C>T	c.(1327-1329)CAG>TAG	p.Q443*	VWA3A_uc010bxd.2_RNA|VWA3A_uc010bxc.2_Nonsense_Mutation_p.Q430*	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	443						extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		ACCTATTCTCCAGAAAACAGT	0.433													65	265	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27504517	27504517	+	Intron	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27504517C>T	uc002dov.1	-						GTF3C1_uc002dou.2_Intron	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						TCAATGGCCTCACCTCTTGTA	0.522													15	92	---	---	---	---	PASS
TAOK2	9344	broad.mit.edu	37	16	29990769	29990769	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29990769G>A	uc002dva.1	+	8	1378	c.595G>A	c.(595-597)GAG>AAG	p.E199K	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Missense_Mutation_p.E199K|TAOK2_uc002dvc.1_Missense_Mutation_p.E199K|TAOK2_uc010bzm.1_Missense_Mutation_p.E199K|TAOK2_uc002dvd.1_5'Flank	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN	TAO kinase 2 isoform 2	199	Protein kinase.				actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						GGCCATGGATGAGGGGCAGTA	0.552													3	30	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48125046	48125046	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48125046G>C	uc002efc.1	-	23	3616	c.3270C>G	c.(3268-3270)CTC>CTG	p.L1090L	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	1090						integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				TGTATTCCCTGAGCAGCTCCA	0.498													54	220	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48130714	48130714	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48130714C>T	uc002efc.1	-	22	3484	c.3138G>A	c.(3136-3138)CTG>CTA	p.L1046L	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	1046	ABC transmembrane type-1 2.|Helical; (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				AGGAGAAACTCAGGGTCACCA	0.502													44	136	---	---	---	---	PASS
CNOT1	23019	broad.mit.edu	37	16	58621282	58621282	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58621282C>G	uc002env.2	-	5	638	c.345G>C	c.(343-345)CTG>CTC	p.L115L	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Silent_p.L115L|CNOT1_uc002enx.2_Silent_p.L115L|CNOT1_uc002enz.1_Intron	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	115					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GCACTTTACTCAGCTGGGCAA	0.323													12	163	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	64984722	64984722	+	Silent	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64984722G>T	uc002eoi.2	-	12	2276	c.1842C>A	c.(1840-1842)GGC>GGA	p.G614G	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Silent_p.G614G|CDH11_uc010vin.1_Silent_p.G488G	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	614	Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CTGTGCTCAGGCCGGCGTTCA	0.627			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			9	22	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69874115	69874115	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69874115G>A	uc002exu.1	+	6	516	c.427G>A	c.(427-429)GGG>AGG	p.G143R	WWP2_uc002ext.2_Missense_Mutation_p.G143R|WWP2_uc002exv.1_Missense_Mutation_p.G143R|WWP2_uc010vlm.1_Missense_Mutation_p.G27R	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	143					entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity	p.G143R(1)		lung(3)|ovary(1)|breast(1)|skin(1)	6						TTTCCTGGACGGGCCAACTGT	0.582													19	55	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89805325	89805325	+	Missense_Mutation	SNP	G	A	A	rs139478274		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89805325G>A	uc002fou.1	-	42	4267	c.4225C>T	c.(4225-4227)CGG>TGG	p.R1409W	ZNF276_uc010ciq.2_3'UTR|ZNF276_uc002foq.3_3'UTR|ZNF276_uc010cir.2_RNA|ZNF276_uc002for.3_3'UTR|ZNF276_uc010cis.2_3'UTR|ZNF276_uc002fos.3_3'UTR|ZNF276_uc002fot.3_RNA|ZNF276_uc010vpm.1_3'UTR|FANCA_uc010vpn.1_Missense_Mutation_p.S1410L	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	1409					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TTCGGGCACCGAGGTATTAAC	0.507			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				34	83	---	---	---	---	PASS
RILP	83547	broad.mit.edu	37	17	1551691	1551691	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1551691G>C	uc002ftd.2	-	5	1068	c.774C>G	c.(772-774)CTC>CTG	p.L258L	SCARF1_uc002fsy.1_5'Flank|SCARF1_uc002fsz.1_5'Flank|SCARF1_uc002fta.1_5'Flank|SCARF1_uc010cjv.1_5'Flank	NM_031430	NP_113618	Q96NA2	RILP_HUMAN	Rab interacting lysosomal protein	258	RILP-like.			L->A: Reduces dimerization, interaction with RAB7 and localization to late endosomal/lysosomal compartments.	endosome to lysosome transport|protein transport	late endosome membrane|lysosomal membrane|phagocytic vesicle membrane	Rab GTPase binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CTTTGGCTTTGAGTTCATTCC	0.617													16	29	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7695328	7695328	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7695328G>T	uc002giu.1	+	44	7008	c.6994G>T	c.(6994-6996)GAG>TAG	p.E2332*		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2332					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGTGGATGAGGAGGGCCGGAA	0.542													47	107	---	---	---	---	PASS
NEK8	284086	broad.mit.edu	37	17	27061104	27061104	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27061104G>A	uc002hcp.2	+	2	151	c.151G>A	c.(151-153)GAG>AAG	p.E51K		NM_178170	NP_835464	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	51	Protein kinase.					cytoplasm|primary cilium	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|pancreas(1)|liver(1)|skin(1)	6	Lung NSC(42;0.0158)					AGCCCAGAATGAGTGCCAGGT	0.527													34	66	---	---	---	---	PASS
PHF12	57649	broad.mit.edu	37	17	27251098	27251098	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27251098C>A	uc002hdg.1	-	4	1074	c.544G>T	c.(544-546)GAT>TAT	p.D182Y	PHF12_uc010wbb.1_Missense_Mutation_p.D164Y|PHF12_uc002hdi.1_Missense_Mutation_p.D178Y|PHF12_uc002hdj.1_Missense_Mutation_p.D182Y|PHF12_uc010crw.1_Intron|uc002hdl.2_5'Flank|PHF12_uc002hdh.1_5'UTR	NM_001033561	NP_001028733	Q96QT6	PHF12_HUMAN	PHD finger protein 12 isoform 1	182	Interaction with SIN3A.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	protein binding|zinc ion binding			ovary(1)	1	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TCGTCGACATCATTCTGCTCA	0.592													4	40	---	---	---	---	PASS
LIG3	3980	broad.mit.edu	37	17	33310106	33310106	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33310106C>A	uc002hik.1	+	2	190	c.82C>A	c.(82-84)CAC>AAC	p.H28N	LIG3_uc002hii.2_Missense_Mutation_p.H28N|LIG3_uc002hij.2_Missense_Mutation_p.H28N|LIG3_uc010cth.1_Missense_Mutation_p.H37N	NM_013975	NP_039269	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent isoform alpha	28					base-excision repair|cell division|DNA ligation involved in DNA repair|DNA replication|reciprocal meiotic recombination|spermatogenesis	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|protein binding|zinc ion binding			skin(3)|lung(2)|ovary(2)|large_intestine(1)|pancreas(1)	9		Ovarian(249;0.17)			Bleomycin(DB00290)	CCGAAAACATCACTGGCGTGA	0.458								Other_BER_factors					4	88	---	---	---	---	PASS
KRT17	3872	broad.mit.edu	37	17	39777876	39777876	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39777876C>T	uc002hxh.2	-	4	924	c.803G>A	c.(802-804)CGC>CAC	p.R268H	JUP_uc010wfs.1_Intron	NM_000422	NP_000413	Q04695	K1C17_HUMAN	keratin 17	268	Coil 2.|Rod.				epidermis development	cytoplasm|intermediate filament	protein binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2		Breast(137;0.000307)				GGCATCCTTGCGGTTCTTCTC	0.592									Steatocystoma_Multiplex				12	110	---	---	---	---	PASS
COASY	80347	broad.mit.edu	37	17	40714701	40714701	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40714701C>G	uc002hzz.2	+	2	218	c.61C>G	c.(61-63)CGC>GGC	p.R21G	COASY_uc010cyj.2_Missense_Mutation_p.R50G|COASY_uc002iab.2_Intron|COASY_uc002iad.2_Missense_Mutation_p.R21G|COASY_uc002iac.2_Missense_Mutation_p.R21G|COASY_uc002iae.2_5'Flank	NM_001042529	NP_001035994	Q13057	COASY_HUMAN	coenzyme A synthase isoform a	21					coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial outer membrane	ATP binding|dephospho-CoA kinase activity|pantetheine-phosphate adenylyltransferase activity				0		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CCTAGCCCCTCGCCTGGCCTC	0.692													13	39	---	---	---	---	PASS
C17orf53	78995	broad.mit.edu	37	17	42239301	42239301	+	3'UTR	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42239301G>C	uc002ifi.1	+	10					C17orf53_uc010czq.1_3'UTR|C17orf53_uc002ifj.1_3'UTR|C17orf53_uc002ifk.1_RNA	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995												0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CAGTAGTTGAGACTGCCCCAA	0.547													30	123	---	---	---	---	PASS
BZRAP1	9256	broad.mit.edu	37	17	56382430	56382430	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56382430C>T	uc002ivx.3	-	30	6407	c.5536G>A	c.(5536-5538)GAG>AAG	p.E1846K	BZRAP1_uc002ivv.2_Missense_Mutation_p.E76K|BZRAP1_uc002ivw.2_Missense_Mutation_p.E78K|BZRAP1_uc010dcs.2_Missense_Mutation_p.E1786K|BZRAP1_uc010wnt.1_Missense_Mutation_p.E1837K	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	1846						mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ACCTGACTCTCAGCCTGGGGT	0.647													22	59	---	---	---	---	PASS
ACE	1636	broad.mit.edu	37	17	61559097	61559097	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61559097C>T	uc002jau.1	+	7	1138	c.1116C>T	c.(1114-1116)TTC>TTT	p.F372F	ACE_uc010wpi.1_Silent_p.F372F|ACE_uc010ddu.1_Silent_p.F189F	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	372	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GGAAAGACTTCAGGTTCAGAC	0.647													64	28	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67136770	67136770	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67136770C>G	uc002jhw.1	-	2	250	c.75G>C	c.(73-75)AGG>AGC	p.R25S	ABCA6_uc002jhy.2_Missense_Mutation_p.R23S	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	25					transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					CTCTTTTCATCCTCCATTTCT	0.358													3	27	---	---	---	---	PASS
RHBDF2	79651	broad.mit.edu	37	17	74473069	74473069	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74473069G>A	uc002jrq.1	-	9	1338	c.1045C>T	c.(1045-1047)CGC>TGC	p.R349C	RHBDF2_uc002jrp.1_Missense_Mutation_p.R320C|RHBDF2_uc002jrr.1_Missense_Mutation_p.R201C|RHBDF2_uc010wtf.1_Missense_Mutation_p.R320C|RHBDF2_uc002jrs.1_Missense_Mutation_p.R344C	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1	349	Cytoplasmic (Potential).				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						CGCTTGCCGCGCCGGGGCCCG	0.642													4	87	---	---	---	---	PASS
TMEM200C	645369	broad.mit.edu	37	18	5891558	5891558	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5891558C>T	uc002kmx.1	-	1	546	c.505G>A	c.(505-507)GGG>AGG	p.G169R		NM_001080209	NP_001073678	A6NKL6	T200C_HUMAN	transmembrane protein 200C	169	Helical; (Potential).					integral to membrane					0						ATGAGGGGCCCGAAGACCTTG	0.592													7	22	---	---	---	---	PASS
RNMT	8731	broad.mit.edu	37	18	13731930	13731930	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13731930G>A	uc002ksk.1	+	2	481	c.414G>A	c.(412-414)CAG>CAA	p.Q138Q	RNMT_uc002ksl.1_Silent_p.Q138Q|RNMT_uc002ksm.1_Silent_p.Q138Q|RNMT_uc010dlk.2_Silent_p.Q138Q|RNMT_uc010xae.1_Intron	NM_003799	NP_003790	O43148	MCES_HUMAN	RNA (guanine-7-) methyltransferase	138					mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	mRNA (guanine-N7-)-methyltransferase activity|RNA binding				0						CTGAAAAGCAGAAAGTATGTT	0.323													10	238	---	---	---	---	PASS
CELF4	56853	broad.mit.edu	37	18	34855193	34855193	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34855193G>A	uc002lae.2	-	4	858	c.462C>T	c.(460-462)CTC>CTT	p.L154L	CELF4_uc010dnd.1_Silent_p.L153L|CELF4_uc002lag.2_Silent_p.L144L|CELF4_uc002laf.2_Silent_p.L149L|CELF4_uc002lai.2_Silent_p.L139L|CELF4_uc002lah.1_5'Flank|CELF4_uc002laj.1_5'Flank	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	154	Sufficient for RNA-binding and MSE- dependent splicing activity.|RRM 2.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						TGCCCACGAAGAGTTTTCTAT	0.542													23	76	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43487976	43487976	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43487976G>C	uc002lbm.2	-	24	4376	c.4276C>G	c.(4276-4278)CTA>GTA	p.L1426V	KIAA1632_uc002lbo.1_Missense_Mutation_p.L1426V|KIAA1632_uc010xcq.1_5'UTR|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_RNA|KIAA1632_uc002lbn.2_Missense_Mutation_p.L301V	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	1426					autophagy						0						TGCTTTGGTAGAGAAGGGATA	0.308													7	143	---	---	---	---	PASS
SOCS6	9306	broad.mit.edu	37	18	67992741	67992741	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67992741C>T	uc002lkr.1	+	2	1153	c.837C>T	c.(835-837)ATC>ATT	p.I279I	SOCS6_uc010dqq.2_Silent_p.I279I	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	279					defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				CCCCAGAGATCTTCGTGGATC	0.582													27	106	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74620481	74620481	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74620481G>A	uc002lmi.2	+	14	2695	c.2497G>A	c.(2497-2499)GCA>ACA	p.A833T	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	833					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CACGGAGGAAGCAGGGCTGGG	0.587													24	73	---	---	---	---	PASS
FUT5	2527	broad.mit.edu	37	19	5867291	5867291	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5867291C>A	uc002mdo.3	-	2	534	c.446G>T	c.(445-447)AGC>ATC	p.S149I	FUT5_uc010duo.2_Missense_Mutation_p.S149I	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	149	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						GGACTCCATGCTGAACCAGAT	0.627													4	56	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9059312	9059312	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9059312C>T	uc002mkp.2	-	3	28338	c.28134G>A	c.(28132-28134)TCG>TCA	p.S9378S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9380	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGGTACCCTGCGAGGTAGCCC	0.512													17	66	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9073717	9073717	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9073717C>T	uc002mkp.2	-	3	13933	c.13729G>A	c.(13729-13731)GCT>ACT	p.A4577T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4579	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAAGCAAGAGCGTCCCCCATG	0.527													7	34	---	---	---	---	PASS
ZNF559	84527	broad.mit.edu	37	19	9453513	9453513	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9453513G>C	uc002mlg.2	+	7	2033	c.1386G>C	c.(1384-1386)GAG>GAC	p.E462D	ZNF559_uc002mlf.2_Missense_Mutation_p.E231D|ZNF559_uc010dwl.1_Missense_Mutation_p.E231D|ZNF559_uc010xkn.1_Missense_Mutation_p.E454D|ZNF559_uc010dwm.1_3'UTR|ZNF559_uc002mle.3_Missense_Mutation_p.E526D|ZNF559_uc010dwk.1_Missense_Mutation_p.E231D|ZNF559_uc002mld.2_3'UTR|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559	462					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ATACAGGGGAGAGGCCATATA	0.448													18	47	---	---	---	---	PASS
CD97	976	broad.mit.edu	37	19	14516740	14516740	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14516740G>A	uc002myl.2	+	14	1933	c.1810G>A	c.(1810-1812)GAA>AAA	p.E604K	CD97_uc002mym.2_Missense_Mutation_p.E555K|CD97_uc002myn.2_Missense_Mutation_p.E511K	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor	604	Extracellular (Potential).				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						CATCGAGAACGAAGGCGGCCA	0.697													17	26	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17025238	17025238	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17025238G>A	uc002nfb.2	-	29	4030	c.3998C>T	c.(3997-3999)TCA>TTA	p.S1333L		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1286						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						ACTCACCTCTGAGGCTGTGCC	0.597													9	72	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17263479	17263479	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17263479G>C	uc010eak.2	+	4	1113	c.961G>C	c.(961-963)GAA>CAA	p.E321Q	MYO9B_uc002nfi.2_Missense_Mutation_p.E321Q|MYO9B_uc002nfj.1_Missense_Mutation_p.E321Q	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	321	Myosin head-like.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						ATATCTGCTTGAAAAGTCTCG	0.378													30	84	---	---	---	---	PASS
GLT25D1	79709	broad.mit.edu	37	19	17690288	17690288	+	Intron	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17690288C>G	uc002nhc.1	+						GLT25D1_uc010eax.1_Intron|GLT25D1_uc010eay.1_5'Flank	NM_024656	NP_078932	Q8NBJ5	GT251_HUMAN	glycosyltransferase 25 domain containing 1						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0						CTTCCTCCCTCAGGTGGTGGA	0.547													4	77	---	---	---	---	PASS
FKBP8	23770	broad.mit.edu	37	19	18643524	18643524	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18643524G>T	uc002njk.1	-	8	1215	c.1102C>A	c.(1102-1104)CTG>ATG	p.L368M	FKBP8_uc002nji.1_Missense_Mutation_p.L206M|FKBP8_uc010xqi.1_Missense_Mutation_p.L397M|FKBP8_uc002njj.1_Missense_Mutation_p.L369M|FKBP8_uc002njl.1_Missense_Mutation_p.L369M|FKBP8_uc002njm.1_Missense_Mutation_p.L368M|FKBP8_uc010ebr.1_Missense_Mutation_p.L207M|FKBP8_uc002njn.2_RNA	NM_012181	NP_036313	Q14318	FKBP8_HUMAN	FK506-binding protein 8	368					apoptosis|interspecies interaction between organisms|intracellular signal transduction|protein folding	integral to endoplasmic reticulum membrane|mitochondrial membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|protein binding			ovary(1)	1						GGGTTGCCCAGCATTTTCCGG	0.647													18	30	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22362882	22362882	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22362882G>A	uc002nqs.1	-	3	1955	c.1637C>T	c.(1636-1638)TCA>TTA	p.S546L		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	546	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				AGTAAGGCTTGAGGATCTGCT	0.408													13	61	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23544661	23544661	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23544661C>T	uc002nre.2	-	4	1233	c.1120G>A	c.(1120-1122)GAA>AAA	p.E374K	ZNF91_uc010xrj.1_Missense_Mutation_p.E342K	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	374						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GGTTTCTCTTCAGTATGAGTT	0.348													14	160	---	---	---	---	PASS
ZNF681	148213	broad.mit.edu	37	19	23927435	23927435	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23927435C>T	uc002nrk.3	-	4	1059	c.917G>A	c.(916-918)AGA>AAA	p.R306K	ZNF681_uc002nrl.3_Missense_Mutation_p.R237K|ZNF681_uc002nrj.3_Missense_Mutation_p.R237K	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	306					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GAGTTTCTCTCTGGTATGAAT	0.368													10	109	---	---	---	---	PASS
ZFP30	22835	broad.mit.edu	37	19	38126264	38126264	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38126264C>T	uc002ogv.1	-	6	1694	c.1178G>A	c.(1177-1179)CGT>CAT	p.R393H	ZFP30_uc002ogw.1_Missense_Mutation_p.R393H|ZFP30_uc002ogx.1_Missense_Mutation_p.R393H|ZFP30_uc010xtt.1_Missense_Mutation_p.R392H	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog	393	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCTGAGTAACGACGAAAGAA	0.408													6	134	---	---	---	---	PASS
ARHGEF1	9138	broad.mit.edu	37	19	42406084	42406084	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42406084C>A	uc002orx.2	+	15	1424	c.1315C>A	c.(1315-1317)CAC>AAC	p.H439N	ARHGEF1_uc002ory.2_Missense_Mutation_p.H406N|ARHGEF1_uc002orz.2_Missense_Mutation_p.H277N|ARHGEF1_uc002osa.2_Missense_Mutation_p.H454N|ARHGEF1_uc002osb.2_Missense_Mutation_p.H421N|ARHGEF1_uc002osc.2_Missense_Mutation_p.H193N|ARHGEF1_uc002osd.2_Missense_Mutation_p.H98N|ARHGEF1_uc002ose.2_5'Flank	NM_004706	NP_004697	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor 1 isoform	439	DH.				cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GCGGGTGCTGCACGACCTCTT	0.622													3	37	---	---	---	---	PASS
ZNF227	7770	broad.mit.edu	37	19	44740265	44740265	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44740265C>G	uc002oyu.2	+	6	1887	c.1682C>G	c.(1681-1683)TCA>TGA	p.S561*	ZNF227_uc010xwu.1_Nonsense_Mutation_p.S510*|ZNF227_uc002oyv.2_Nonsense_Mutation_p.S561*|ZNF227_uc010xwv.1_Nonsense_Mutation_p.S510*|ZNF227_uc010xww.1_Nonsense_Mutation_p.S482*|ZNF227_uc002oyw.2_Nonsense_Mutation_p.S533*|ZNF227_uc010ejh.2_Nonsense_Mutation_p.S554*|ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_3'UTR	NM_182490	NP_872296	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	561	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0435)				AGTTATAGTTCAAATCTTAAA	0.413													14	70	---	---	---	---	PASS
ZNF615	284370	broad.mit.edu	37	19	52496664	52496664	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52496664G>C	uc002pye.1	-	6	1957	c.1665C>G	c.(1663-1665)CTC>CTG	p.L555L	ZNF615_uc002pyf.1_Silent_p.L566L|ZNF615_uc002pyg.1_Silent_p.L447L|ZNF615_uc002pyh.1_Silent_p.L566L|ZNF615_uc010epi.1_Silent_p.L562L|ZNF615_uc010ydg.1_Silent_p.L560L	NM_198480	NP_940882	Q8N8J6	ZN615_HUMAN	zinc finger protein 615	555	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		GATGTACATTGAGATGACTCT	0.448													36	133	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54327207	54327207	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54327207G>C	uc002qch.3	-	1	442	c.222C>G	c.(220-222)CTC>CTG	p.L74L	NLRP12_uc002qci.3_Silent_p.L74L|NLRP12_uc002qcj.3_Silent_p.L74L|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.L74L	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	74	DAPIN.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CAAAGGTGCTGAGAGCCAACC	0.607													41	175	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54782202	54782202	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54782202G>A	uc002qfb.2	-	7	1436	c.1170C>T	c.(1168-1170)CAC>CAT	p.H390H	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.H390H|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.H390H|LILRB2_uc010yet.1_Silent_p.H274H|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	390	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGTCCCCGCGTGGGCTGAGG	0.602													39	97	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56702270	56702270	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56702270C>T	uc010ygh.1	-	3	675	c.675G>A	c.(673-675)CTG>CTA	p.L225L		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	225					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TGTTTTCCTTCAGATCCTTCT	0.502													6	236	---	---	---	---	PASS
ZNF418	147686	broad.mit.edu	37	19	58438632	58438632	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58438632C>T	uc002qqs.1	-	4	1209	c.917G>A	c.(916-918)CGA>CAA	p.R306Q	ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Missense_Mutation_p.R221Q	NM_133460	NP_597717	Q8TF45	ZN418_HUMAN	zinc finger protein 418	306	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		AGTATGAACTCGCTGATGCTG	0.418													27	252	---	---	---	---	PASS
ATRN	8455	broad.mit.edu	37	20	3578567	3578567	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3578567G>C	uc002wim.2	+	22	3574	c.3484G>C	c.(3484-3486)GAC>CAC	p.D1162H	ATRN_uc002wil.2_Missense_Mutation_p.D1162H	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1	1162	Extracellular (Potential).				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						TCTTCTTATTGACTATCAGTT	0.333													16	220	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31673928	31673928	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31673928G>C	uc010zue.1	+	5	899	c.884G>C	c.(883-885)TGT>TCT	p.C295S		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	295						cytoplasm|extracellular region	lipid binding				0						ATTGAGCGATGTGACACCCTC	0.577													26	116	---	---	---	---	PASS
RBL1	5933	broad.mit.edu	37	20	35675483	35675483	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35675483G>C	uc002xgi.2	-	12	1657	c.1578C>G	c.(1576-1578)CTC>CTG	p.L526L	RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Silent_p.L526L	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a	526	Domain A.|Pocket; binds T and E1A.				cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				GTTGCAAGTTGAGAACTTCAA	0.343													6	92	---	---	---	---	PASS
CDH22	64405	broad.mit.edu	37	20	44879767	44879767	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44879767C>T	uc002xrm.2	-	1	568	c.167G>A	c.(166-168)GGA>GAA	p.G56E	CDH22_uc010ghk.1_Missense_Mutation_p.G56E	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor	56	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				GCGGCCGGCTCCCAGCGCGCC	0.592													4	11	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47621682	47621682	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47621682G>C	uc002xtx.3	+	26	3660	c.3508G>C	c.(3508-3510)GAG>CAG	p.E1170Q	ARFGEF2_uc010zyf.1_Missense_Mutation_p.E463Q	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	1170					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GAAGTTTCTTGAGAAGGGTGA	0.383													25	405	---	---	---	---	PASS
ITSN1	6453	broad.mit.edu	37	21	35140019	35140019	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35140019G>C	uc002yta.1	+	11	1197	c.929G>C	c.(928-930)AGA>ACA	p.R310T	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.R310T|ITSN1_uc010gmg.2_Missense_Mutation_p.R273T|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Missense_Mutation_p.R310T|ITSN1_uc010gmi.2_Missense_Mutation_p.R273T|ITSN1_uc010gmj.2_Missense_Mutation_p.R194T|ITSN1_uc002ysy.2_Missense_Mutation_p.R310T|ITSN1_uc002ysx.2_Missense_Mutation_p.R273T|ITSN1_uc002ytb.1_Missense_Mutation_p.R310T|ITSN1_uc002ytc.1_Missense_Mutation_p.R310T|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.R273T|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Missense_Mutation_p.R310T|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.R244T	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	310	EH 2.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						AATTGCAGAAGAGTTCGATCT	0.398													6	80	---	---	---	---	PASS
ITSN1	6453	broad.mit.edu	37	21	35140099	35140099	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35140099G>T	uc002yta.1	+	11	1277	c.1009G>T	c.(1009-1011)GAT>TAT	p.D337Y	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.D337Y|ITSN1_uc010gmg.2_Missense_Mutation_p.D300Y|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Missense_Mutation_p.D337Y|ITSN1_uc010gmi.2_Missense_Mutation_p.D300Y|ITSN1_uc010gmj.2_Missense_Mutation_p.D221Y|ITSN1_uc002ysy.2_Missense_Mutation_p.D337Y|ITSN1_uc002ysx.2_Missense_Mutation_p.D300Y|ITSN1_uc002ytb.1_Missense_Mutation_p.D337Y|ITSN1_uc002ytc.1_Missense_Mutation_p.D337Y|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.D300Y|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Missense_Mutation_p.D337Y|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.D271Y	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	337	KLERQ.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						AGTTTTAGAAGATGAACAACA	0.368													5	77	---	---	---	---	PASS
DSCR9	257203	broad.mit.edu	37	21	38593674	38593674	+	RNA	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38593674G>A	uc010gnk.2	+	1		c.786G>A								Homo sapiens mRNA, complete cds.												0						GCCTACAGCCGAAGAGGATGG	0.642													20	56	---	---	---	---	PASS
SEC14L3	266629	broad.mit.edu	37	22	30860844	30860844	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30860844C>G	uc003ahy.2	-	8	716	c.627G>C	c.(625-627)CTG>CTC	p.L209L	SEC14L3_uc003ahz.2_Silent_p.L132L|SEC14L3_uc003aia.2_Silent_p.L150L|SEC14L3_uc003aib.2_Silent_p.L150L	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	209	CRAL-TRIO.					integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	TGTCCTCACTCAGGAATGGCT	0.453													46	165	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38086698	38086698	+	Intron	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38086698C>T	uc003atq.1	+						NOL12_uc011anm.1_Intron|NOL12_uc003ato.1_Intron|NOL12_uc003atp.2_Intron	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					TCTTGTGCCTCTTTAGGGAGG	0.622													42	151	---	---	---	---	PASS
APOBEC3G	60489	broad.mit.edu	37	22	39477148	39477148	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39477148G>A	uc003awx.2	+	3	724	c.382G>A	c.(382-384)GAC>AAC	p.D128N	APOBEC3G_uc003awy.2_Missense_Mutation_p.D61N	NM_021822	NP_068594	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	128				D->K: Complete loss of VIF-induced degradation.	base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2	Melanoma(58;0.04)					CTACTTCTGGGACCCAGATTA	0.557													9	96	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42608264	42608264	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42608264C>G	uc003bcj.1	-	1	3182	c.3048G>C	c.(3046-3048)TTG>TTC	p.L1016F	TCF20_uc003bck.1_Missense_Mutation_p.L1016F|TCF20_uc003bnt.2_Missense_Mutation_p.L1016F	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1016					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						GAGACATTTTCAATTTTTCTG	0.557													18	49	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3228968	3228968	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3228968C>T	uc004crg.3	-	7	7433	c.7276G>A	c.(7276-7278)GAG>AAG	p.E2426K		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2426	Ig-like C2-type 8.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTCCTATCCTCTCCCGCGCTG	0.552													74	86	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11207064	11207064	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11207064G>A	uc004cup.1	-	4	1734	c.861C>T	c.(859-861)GTC>GTT	p.V287V	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Silent_p.V287V|ARHGAP6_uc004cum.1_Silent_p.V84V|ARHGAP6_uc004cun.1_Silent_p.V107V|ARHGAP6_uc010neb.1_Silent_p.V109V|ARHGAP6_uc011mif.1_Silent_p.V84V	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	287					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						CATTCGCAATGACTTGGGATA	0.458													21	51	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11207091	11207091	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11207091C>A	uc004cup.1	-	4	1707	c.834G>T	c.(832-834)CAG>CAT	p.Q278H	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.Q278H|ARHGAP6_uc004cum.1_Missense_Mutation_p.Q75H|ARHGAP6_uc004cun.1_Missense_Mutation_p.Q98H|ARHGAP6_uc010neb.1_Missense_Mutation_p.Q100H|ARHGAP6_uc011mif.1_Missense_Mutation_p.Q75H	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	278					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						TTCCAAATGCCTGTGGGATGA	0.438													16	34	---	---	---	---	PASS
PIGA	5277	broad.mit.edu	37	X	15349415	15349415	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15349415G>A	uc004cwr.2	-	2	738	c.638C>T	c.(637-639)ACT>ATT	p.T213I	PIGA_uc004cwq.2_Intron|PIGA_uc010nev.2_Intron|PIGA_uc004cws.2_Intron|PIGA_uc011miq.1_Intron|PIGA_uc010new.1_Intron	NM_002641	NP_002632	P37287	PIGA_HUMAN	phosphatidylinositol	213	Cytoplasmic (Potential).				C-terminal protein lipidation|positive regulation of metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity|protein binding				0	Hepatocellular(33;0.183)					AGTGAAGTCAGTAGGATCTAC	0.363													10	211	---	---	---	---	PASS
KLHL15	80311	broad.mit.edu	37	X	24024244	24024244	+	Silent	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24024244C>T	uc004dba.3	-	3	823	c.567G>A	c.(565-567)CTG>CTA	p.L189L		NM_030624	NP_085127	Q96M94	KLH15_HUMAN	kelch-like 15	189	BACK.									ovary(1)|breast(1)	2						GGAACCTGCTCAGATGATCAT	0.473													78	335	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028882	37028882	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028882G>A	uc004ddl.1	+	1	2413	c.2399G>A	c.(2398-2400)CGC>CAC	p.R800H		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	800										ovary(3)	3						TCCAGTCTCCGCCTGGAGCCT	0.592													6	70	---	---	---	---	PASS
FUNDC1	139341	broad.mit.edu	37	X	44383531	44383531	+	Intron	SNP	A	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44383531A>C	uc004dgc.2	-							NM_173794	NP_776155	Q8IVP5	FUND1_HUMAN	FUN14 domain containing 1												0						CCTGAAACAAAGTTtaaacaa	0.199													17	57	---	---	---	---	PASS
CCDC120	90060	broad.mit.edu	37	X	48925127	48925127	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48925127G>A	uc010nik.2	+	10	1879	c.1372G>A	c.(1372-1374)GGT>AGT	p.G458S	CCDC120_uc011mmq.1_Missense_Mutation_p.G446S|CCDC120_uc004dmf.2_Missense_Mutation_p.G458S|CCDC120_uc010nil.2_Missense_Mutation_p.G458S|CCDC120_uc011mmr.1_Missense_Mutation_p.G458S|CCDC120_uc011mms.1_Missense_Mutation_p.G446S	NM_033626	NP_296375	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120 isoform 3	458	Pro-rich.						protein binding			pancreas(1)	1						CCGCAGTGGCGGTGGAACAGG	0.706													10	18	---	---	---	---	PASS
IQSEC2	23096	broad.mit.edu	37	X	53280293	53280293	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53280293C>T	uc004dsd.2	-	5	1666	c.1465G>A	c.(1465-1467)GAG>AAG	p.E489K	IQSEC2_uc004dsc.2_Missense_Mutation_p.E284K	NM_001111125	NP_001104595	Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2 isoform1	479					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3						CCTGGCTCCTCAGACATGGGC	0.488													14	159	---	---	---	---	PASS
NXF2B	728343	broad.mit.edu	37	X	101615563	101615563	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101615563C>T	uc004ejb.3	-	34	3712	c.1840G>A	c.(1840-1842)GAG>AAG	p.E614K	NXF2B_uc004eiz.3_3'UTR|NXF2B_uc004eja.3_Missense_Mutation_p.E614K|NXF2_uc004eiy.3_Missense_Mutation_p.E614K	NM_001099686	NP_001093156	Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	614	TAP-C.				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|RNA binding			ovary(1)	1						ATCTTGCCCTCGGTCTAGAGA	0.507													5	170	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105152804	105152804	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105152804C>T	uc004emd.2	+	13	1474	c.1171C>T	c.(1171-1173)CAG>TAG	p.Q391*	NRK_uc010npc.1_Nonsense_Mutation_p.Q59*	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	391							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GGAACCCTCTCAGCCAAGGTG	0.552										HNSCC(51;0.14)			3	15	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105153049	105153049	+	Silent	SNP	G	C	C			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105153049G>C	uc004emd.2	+	13	1719	c.1416G>C	c.(1414-1416)CGG>CGC	p.R472R	NRK_uc010npc.1_Silent_p.R140R	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	472	Gln-rich.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CACGACTACGGAGGGCAGCCA	0.562										HNSCC(51;0.14)			6	15	---	---	---	---	PASS
CHRDL1	91851	broad.mit.edu	37	X	109964648	109964648	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109964648G>A	uc004eou.3	-	5	761	c.412C>T	c.(412-414)CGG>TGG	p.R138W	CHRDL1_uc004eov.2_Missense_Mutation_p.R132W|CHRDL1_uc004eow.2_Missense_Mutation_p.R137W|CHRDL1_uc010nps.2_Missense_Mutation_p.R137W|CHRDL1_uc004eot.2_Intron|CHRDL1_uc011mss.1_Intron|CHRDL1_uc004eox.3_Missense_Mutation_p.R131W	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 1 precursor	131	VWFC 2.				BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0						TTGGGTTGCCGATTCTGAAAG	0.483													30	430	---	---	---	---	PASS
SEPT6	23157	broad.mit.edu	37	X	118797452	118797452	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118797452C>T	uc004erv.2	-	3	599	c.334G>A	c.(334-336)GAG>AAG	p.E112K	SEPT6_uc010nqk.2_RNA|SEPT6_uc004ers.2_Missense_Mutation_p.E112K|SEPT6_uc004ert.2_Missense_Mutation_p.E112K|SEPT6_uc004eru.2_Missense_Mutation_p.E112K|SEPT6_uc004erw.2_Missense_Mutation_p.E54K|SEPT6_uc011mtv.1_Missense_Mutation_p.E54K|SEPT6_uc011mtw.1_Missense_Mutation_p.E142K	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B	112					cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						TACCTGTCCTCTTTGTTGATC	0.537													38	399	---	---	---	---	PASS
UTP14A	10813	broad.mit.edu	37	X	129041400	129041400	+	Silent	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129041400G>A	uc004euz.2	+	2	112	c.84G>A	c.(82-84)TTG>TTA	p.L28L	UTP14A_uc011mup.1_Silent_p.L28L|UTP14A_uc011muq.1_5'UTR	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	28					rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						actacctcttgagtgagagtg	0.269													21	87	---	---	---	---	PASS
BRS3	680	broad.mit.edu	37	X	135570361	135570361	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135570361G>A	uc004ezv.1	+	1	237	c.88G>A	c.(88-90)GAT>AAT	p.D30N		NM_001727	NP_001718	P32247	BRS3_HUMAN	bombesin-like receptor 3	30	Extracellular (Potential).				adult feeding behavior|glucose metabolic process|regulation of blood pressure	integral to membrane|plasma membrane	bombesin receptor activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GGTTTCTAACGATAACACAAA	0.413													29	50	---	---	---	---	PASS
F9	2158	broad.mit.edu	37	X	138630515	138630515	+	Intron	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138630515C>G	uc004fas.1	+						F9_uc004fat.1_Intron	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein						blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	TATTTTGCTTCTTTTAGATGT	0.368													28	56	---	---	---	---	PASS
CDR1	1038	broad.mit.edu	37	X	139866366	139866366	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139866366C>A	uc004fbg.1	-	1	358	c.166G>T	c.(166-168)GAT>TAT	p.D56Y	uc004fbf.1_RNA	NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	56	23 X 6 AA approximate repeats.|9.										0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				TCCAGCAAATCCACGTCTTCC	0.443													26	45	---	---	---	---	PASS
MTMR1	8776	broad.mit.edu	37	X	149931144	149931144	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149931144C>A	uc004fei.2	+	15	2075	c.1940C>A	c.(1939-1941)TCA>TAA	p.S647*	MTMR1_uc011mya.1_Nonsense_Mutation_p.S553*|MTMR1_uc004feh.1_Nonsense_Mutation_p.S655*|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_Intron	NM_003828	NP_003819	Q13613	MTMR1_HUMAN	myotubularin-related protein 1	647	Poly-Ser.					plasma membrane	protein tyrosine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GTCTCATCCTCATCTGAGCGG	0.672													16	80	---	---	---	---	PASS
PNCK	139728	broad.mit.edu	37	X	152938520	152938520	+	Silent	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152938520C>G	uc011myu.1	-	2	447	c.261G>C	c.(259-261)CTG>CTC	p.L87L	PNCK_uc011myt.1_Silent_p.L21L|PNCK_uc004fia.2_Silent_p.L16L|PNCK_uc004fhz.3_5'UTR|PNCK_uc010nuh.2_Silent_p.L87L|PNCK_uc011myv.1_5'UTR|PNCK_uc011myw.1_5'UTR	NM_001039582	NP_001034671	Q6P2M8	KCC1B_HUMAN	pregnancy upregulated non-ubiquitously expressed	4						cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGTGTTTCTTCAGCAGCAGCA	0.527													3	25	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153696208	153696208	+	Silent	SNP	T	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153696208T>G	uc004flm.2	+	21	3857	c.3684T>G	c.(3682-3684)GGT>GGG	p.G1228G		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	1228	Helical; (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGGCGGGGGGTGGGCTCCTGC	0.677													6	21	---	---	---	---	PASS
GAB3	139716	broad.mit.edu	37	X	153928285	153928285	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153928285C>G	uc004fmj.1	-	5	1164	c.1116G>C	c.(1114-1116)TTG>TTC	p.L372F	GAB3_uc004fmk.1_Missense_Mutation_p.L373F|GAB3_uc010nve.1_Missense_Mutation_p.L373F|GAB3_uc004fml.1_5'UTR	NM_080612	NP_542179	Q8WWW8	GAB3_HUMAN	Gab3 protein isoform 2	372										ovary(1)	1	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTACCAAATTCAAACTAAGCC	0.373													4	142	---	---	---	---	PASS
PDPN	10630	broad.mit.edu	37	1	13940365	13940366	+	Intron	INS	-	TT	TT	rs34784418		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13940365_13940366insTT	uc001avd.2	+						PDPN_uc001avc.2_Intron|PDPN_uc009vob.2_Intron|PDPN_uc009voc.2_Intron|PDPN_uc001ave.2_Intron|PDPN_uc001avf.2_Intron	NM_006474	NP_006465	Q86YL7	PDPN_HUMAN	lung type-I cell membrane-associated						cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		AGATTTCAAGCttttttttttt	0.322													4	2	---	---	---	---	
TMCO4	255104	broad.mit.edu	37	1	20027035	20027037	+	Intron	DEL	TCT	-	-	rs71704175		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20027035_20027037delTCT	uc001bcn.2	-						TMCO4_uc001bcm.2_Intron|TMCO4_uc001bco.1_Intron|TMCO4_uc001bcp.1_Intron	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4							integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CACAGAAACATCTTCTCAGAATC	0.621													3	3	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245851229	245851231	+	In_Frame_Del	DEL	CAG	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245851229_245851231delCAG	uc001ibf.1	+	12	5384_5386	c.4944_4946delCAG	c.(4942-4947)GCCAGC>GCC	p.S1652del	KIF26B_uc001ibg.1_In_Frame_Del_p.S1270del|KIF26B_uc001ibh.1_In_Frame_Del_p.S894del	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1652	Ser-rich.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGAAGGACGCCAGCAGCAGCAGC	0.665													4	2	---	---	---	---	
ARMC9	80210	broad.mit.edu	37	2	232121160	232121160	+	Intron	DEL	A	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232121160delA	uc002vrq.3	+						ARMC9_uc002vrp.3_Intron	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9								binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		GTTTCAAGTTAAAAAAAAAAA	0.393													10	5	---	---	---	---	
ATP2C1	27032	broad.mit.edu	37	3	130659455	130659456	+	Intron	INS	-	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130659455_130659456insT	uc003enl.2	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron|ATP2C1_uc011bli.1_Intron|ATP2C1_uc003enk.2_Intron|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Intron|ATP2C1_uc003eno.2_Intron|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_Intron|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Intron|ATP2C1_uc003ent.2_Intron	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	TTAAATTCTACTTTTTTTTGTT	0.292									Hailey-Hailey_disease				31	28	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189295780	189295800	+	IGR	DEL	TTCCTTCCTTCCTTCTTTCTT	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189295780_189295800delTTCCTTCCTTCCTTCTTTCTT								TPRG1 (254510 upstream) : TP63 (53416 downstream)																							tttcttttccttccttccttccttctttcttttccttcctt	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195378243	195378243	+	Intron	DEL	T	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195378243delT	uc011bta.1	-											Homo sapiens, clone IMAGE:5171739, mRNA.																		CCAGTGACAGTTTTTCAGTAT	0.403													22	10	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	99996377	99996377	+	Intron	DEL	T	-	-	rs112636325		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99996377delT	uc003hui.2	-						ADH5_uc003huk.1_3'UTR|ADH5_uc003huj.2_Intron	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	ttttttgttgttttttttttt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	171526512	171526514	+	IGR	DEL	CTG	-	-	rs450510	by1000genomes	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171526512_171526514delCTG								AADAT (515140 upstream) : None (None downstream)																							tcttcttcttctgcttgtcacca	0.251													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	128147553	128147556	+	IGR	DEL	CTTT	-	-	rs10040342		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128147553_128147556delCTTT								FBN2 (273637 upstream) : SLC27A6 (153654 downstream)																							tccttccttcctttcttccttcct	0.142													4	2	---	---	---	---	
C6orf218	221718	broad.mit.edu	37	6	10430699	10430701	+	Intron	DEL	TTT	-	-	rs139837855		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10430699_10430701delTTT	uc003myz.2	-							NR_027793				Homo sapiens chromosome 6 open reading frame 218, mRNA (cDNA clone IMAGE:3917693).												0	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.124)				CTCTGACTAGttttttttttttt	0.202													4	4	---	---	---	---	
SLC17A5	26503	broad.mit.edu	37	6	74320414	74320415	+	Intron	INS	-	A	A	rs139677205	by1000genomes	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74320414_74320415insA	uc003phn.3	-						SLC17A5_uc010kax.2_Intron|SLC17A5_uc010kay.2_Intron|SLC17A5_uc011dyo.1_Intron	NM_012434	NP_036566	Q9NRA2	S17A5_HUMAN	sialin						anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity			skin(5)|central_nervous_system(1)	6						AATTTCATGAGAAAAAAAAAAT	0.307													4	3	---	---	---	---	
C7orf30	115416	broad.mit.edu	37	7	23340877	23340877	+	Intron	DEL	T	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23340877delT	uc003swd.1	+							NM_138446	NP_612455	Q96EH3	CG030_HUMAN	hypothetical protein LOC115416							mitochondrion					0			GBM - Glioblastoma multiforme(13;0.154)			GCAAGGAAGAttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67101794	67101795	+	IGR	INS	-	TTCCTCCCTCCCTCCCCC	TTCCTCCCTCCCTCCCCC	rs149922731	by1000genomes	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67101794_67101795insTTCCTCCCTCCCTCCCCC								STAG3L4 (315282 upstream) : None (None downstream)																							tccttccttctttcctccctcc	0.000													4	2	---	---	---	---	
ST7	7982	broad.mit.edu	37	7	116590678	116590678	+	5'Flank	DEL	T	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116590678delT	uc003vin.2	+						ST7_uc011knl.1_5'Flank|ST7_uc003vio.2_5'Flank	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ccttccttccttccttcctcc	0.080													4	3	---	---	---	---	
JHDM1D	80853	broad.mit.edu	37	7	139878082	139878089	+	5'Flank	DEL	TCCCTCCC	-	-	rs142303955		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139878082_139878089delTCCCTCCC	uc003vvm.2	-						LOC100134229_uc011kqy.1_RNA	NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					cttccttccttccctccctccCTTTCCT	0.106													3	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157944098	157944101	+	Intron	DEL	CTCT	-	-	rs71971342	by1000genomes	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157944098_157944101delCTCT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ctattcctgcctctccctgcccac	0.240													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	89498121	89498122	+	IGR	INS	-	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89498121_89498122insA								MMP16 (158404 upstream) : None (None downstream)																							gaacagctatgaaaaaaaaaac	0.158													6	3	---	---	---	---	
RFK	55312	broad.mit.edu	37	9	79002634	79002637	+	Intron	DEL	GGCC	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79002634_79002637delGGCC	uc004akd.2	-						RFK_uc004ake.2_Intron	NM_018339	NP_060809	Q969G6	RIFK_HUMAN	riboflavin kinase						riboflavin biosynthetic process	cytosol	ATP binding|metal ion binding|riboflavin kinase activity				0					Riboflavin(DB00140)	TATGTCCCTAggccgggggcagtg	0.142													7	4	---	---	---	---	
WDR38	401551	broad.mit.edu	37	9	127616793	127616794	+	Intron	DEL	AC	-	-	rs145755574		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127616793_127616794delAC	uc004box.2	+						WDR38_uc011lzn.1_Intron|WDR38_uc011lzo.1_Intron|WDR38_uc011lzp.1_Intron	NM_001045476	NP_001038941	Q5JTN6	WDR38_HUMAN	WD repeat domain 38												0						TTCTTTAAAAacacacacacac	0.351													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	106059242	106059243	+	5'Flank	INS	-	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106059242_106059243insT	uc001kyd.1	+											Homo sapiens cDNA FLJ37540 fis, clone BRCAN2026117.																		Cttttttttccttttttttttt	0.178													4	2	---	---	---	---	
TRAF6	7189	broad.mit.edu	37	11	36511976	36511977	+	Frame_Shift_Ins	INS	-	A	A			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36511976_36511977insA	uc001mwr.1	-	8	1320_1321	c.980_981insT	c.(979-981)GTAfs	p.V327fs	uc001mwq.1_5'Flank|TRAF6_uc001mws.1_Frame_Shift_Ins_p.V327fs	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6	327	Potential.|Interaction with TAX1BP1.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)				TGAGCTCACTTACATACATACT	0.421													155	85	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	103187327	103187327	+	Frame_Shift_Del	DEL	C	-	-	rs144624858	by1000genomes	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103187327delC	uc001pho.2	+	80	11847	c.11703delC	c.(11701-11703)AACfs	p.N3901fs	DYNC2H1_uc001phn.1_Frame_Shift_Del_p.N3908fs|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3901	AAA 6 (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CTGGGTACAACATTATTGACA	0.264													4	2	---	---	---	---	
TMPO	7112	broad.mit.edu	37	12	98925326	98925326	+	Intron	DEL	T	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98925326delT	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						TTATATGGTATTTTTTTTTTT	0.164													6	3	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101763831	101763831	+	Intron	DEL	A	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101763831delA	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						gtgtctacataaaaaaaaaaa	0.000													4	2	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109845512	109845512	+	Intron	DEL	T	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109845512delT	uc010sxn.1	+							NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H							myosin complex	motor activity				0						caTTATTTTATTTTTTTTTTA	0.184													10	5	---	---	---	---	
PRKD1	5587	broad.mit.edu	37	14	30396622	30396623	+	In_Frame_Ins	INS	-	CCCGGA	CCCGGA	rs144938427	by1000genomes	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30396622_30396623insCCCGGA	uc001wqh.2	-	1	277_278	c.96_97insTCCGGG	c.(94-99)insTCCGGG	p.32_33insSG		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	32_33					cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GCGGGCCCGGGCCCGGACCCTG	0.757													3	3	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72932370	72932373	+	Intron	DEL	GTGA	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72932370_72932373delGTGA	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc001xmz.1_Intron|RGS6_uc010arg.2_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		ggatggatgggtgaatgggtgaat	0.132													17	8	---	---	---	---	
KIAA0284	283638	broad.mit.edu	37	14	105344189	105344192	+	Intron	DEL	CCCC	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105344189_105344192delCCCC	uc010axb.2	+						INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Intron|KIAA0284_uc001yps.2_5'Flank	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1							cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		CCGCGCAGCTCCCCCCCCCCCCCC	0.667													6	6	---	---	---	---	
CHD2	1106	broad.mit.edu	37	15	93488926	93488927	+	Intron	INS	-	T	T	rs113903945		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93488926_93488927insT	uc002bsp.2	+						CHD2_uc002bsn.2_Intron|CHD2_uc002bso.1_Intron|CHD2_uc010urb.1_Intron|CHD2_uc010bof.1_Intron	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			cTATAATCCCATTTTTTTTTTT	0.129													5	3	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4952694	4952694	+	Intron	DEL	T	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4952694delT	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						TCCCATGCACttttttttttt	0.299													4	2	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3134953	3134954	+	Intron	INS	-	TT	TT			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3134953_3134954insTT	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TTATTTTACGAttttttttttt	0.168													4	3	---	---	---	---	
TXNL4A	10907	broad.mit.edu	37	18	77737811	77737815	+	Intron	DEL	TTTTG	-	-	rs71338078		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77737811_77737815delTTTTG	uc002lnp.2	-						TXNL4A_uc002lnr.2_Intron|TXNL4A_uc002lnq.2_Intron|TXNL4A_uc010drf.2_Intron|TXNL4A_uc010drg.2_Intron	NM_006701	NP_006692	P83876	TXN4A_HUMAN	thioredoxin-like 4A						cell division|mitosis|spliceosome assembly	nucleoplasm|spliceosomal complex	protein binding				0		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		TCAGGGCAAtttttgttttgttttt	0.137													10	6	---	---	---	---	
REXO1	57455	broad.mit.edu	37	19	1821344	1821344	+	Intron	DEL	A	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1821344delA	uc002lua.3	-						REXO1_uc010dsq.2_Intron|REXO1_uc010xgs.1_Intron|REXO1_uc010dsp.1_5'Flank|uc002lub.1_5'Flank	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3							nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actccatctcaaaaaaaaaaa	0.294													20	9	---	---	---	---	
MYO9B	4650	broad.mit.edu	37	19	17315960	17315960	+	Intron	DEL	A	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17315960delA	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron|MYO9B_uc002nfl.1_Intron|MYO9B_uc002nfm.1_5'Flank	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						actccatctcaaaaaaaaaaa	0.284													8	4	---	---	---	---	
JAK3	3718	broad.mit.edu	37	19	17950547	17950547	+	Intron	DEL	C	-	-	rs10685173		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17950547delC	uc002nhn.3	-						JAK3_uc010ebh.2_Intron|JAK3_uc002nho.2_Intron|JAK3_uc010xpx.1_Intron	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3						B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						CCttttttttctttttttttt	0.249		2	Mis		acute megakaryocytic leukemia|								8	5	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49409222	49409232	+	Intron	DEL	GTGCTAGGCAG	-	-	rs113033245		TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49409222_49409232delGTGCTAGGCAG	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		AGGTGGTTGTGTGCTAGGCAGGTGAGGCCTC	0.602													4	3	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29745509	29745510	+	Intron	INS	-	T	T			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29745509_29745510insT	uc003afj.2	-						AP1B1_uc003afi.2_Intron|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron|AP1B1_uc011ako.1_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						TCTGAGttttgttttttttttt	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2042213	2042214	+	IGR	DEL	CA	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2042213_2042214delCA								ASMT (280240 upstream) : DHRSX (95343 downstream)																							GTGCACCACCCACACACACACA	0.109													9	4	---	---	---	---	
WWC3	55841	broad.mit.edu	37	X	10059047	10059048	+	Intron	DEL	AC	-	-			TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10059047_10059048delAC	uc004csx.3	+						WWC3_uc010nds.2_Intron|WWC3_uc010ndt.2_Intron	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3											ovary(4)	4						TGTATATAATacacacacacac	0.158													4	2	---	---	---	---	
SHROOM4	57477	broad.mit.edu	37	X	50378792	50378792	+	Intron	DEL	G	-	-	rs5915290	by1000genomes	TCGA-C5-A1BL-01	TCGA-C5-A1BL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378792delG	uc004dpe.2	-						SHROOM4_uc004dpd.3_Intron|SHROOM4_uc004dpf.1_Intron	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4						actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					AAAAAAAAAAGGGGGAAGAAA	0.483													4	3	---	---	---	---	
