Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRDM16	63976	broad.mit.edu	37	1	3319365	3319365	+	Silent	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3319365G>A	uc001akf.2	+	6	767	c.687G>A	c.(685-687)ACG>ACA	p.T229T	PRDM16_uc001akc.2_Silent_p.T229T|PRDM16_uc001akd.2_Silent_p.T229T|PRDM16_uc001ake.2_Silent_p.T229T|PRDM16_uc009vlh.2_5'UTR	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	229					brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGGAGCCCACGTTCCGCTGTG	0.622			T	EVI1	MDS|AML								11	27	---	---	---	---	PASS
NPPA	4878	broad.mit.edu	37	1	11907423	11907423	+	Missense_Mutation	SNP	G	A	A	rs150794709		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11907423G>A	uc001ati.2	-	2	296	c.197C>T	c.(196-198)CCG>CTG	p.P66L	CLCN6_uc010oav.1_Intron|CLCN6_uc010oaw.1_Intron|CLCN6_uc010oax.1_Intron|CLCN6_uc010oay.1_Intron|CLCN6_uc010oaz.1_Intron|CLCN6_uc010oba.1_Intron	NM_006172	NP_006163	P01160	ANF_HUMAN	natriuretic peptide precursor A preproprotein	66					cGMP biosynthetic process|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size	extracellular region	hormone activity			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTCTTCATTCGGCTCACTGAG	0.567													21	47	---	---	---	---	PASS
ZBTB40	9923	broad.mit.edu	37	1	22832730	22832730	+	Silent	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22832730C>A	uc001bft.2	+	7	1867	c.1356C>A	c.(1354-1356)ACC>ACA	p.T452T	ZBTB40_uc001bfu.2_Silent_p.T452T|ZBTB40_uc009vqi.1_Silent_p.T340T|ZBTB40_uc001bfv.1_Silent_p.T81T	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	452					bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		TGCCAAGCACCACAGGTATTA	0.468													3	34	---	---	---	---	PASS
COL16A1	1307	broad.mit.edu	37	1	32121067	32121067	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32121067C>A	uc001btk.1	-	67	4503	c.4138G>T	c.(4138-4140)GGA>TGA	p.G1380*	COL16A1_uc001bti.1_Translation_Start_Site|COL16A1_uc001btj.1_Nonsense_Mutation_p.G1178*	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	1380	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCCTTCTCTCCTGCCTGGCCC	0.483													4	121	---	---	---	---	PASS
CLCA4	22802	broad.mit.edu	37	1	87038329	87038329	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87038329C>T	uc009wcs.2	+	9	1437	c.1393C>T	c.(1393-1395)CAG>TAG	p.Q465*	CLCA4_uc009wct.2_Nonsense_Mutation_p.Q228*|CLCA4_uc009wcu.2_Nonsense_Mutation_p.Q285*	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	465	VWFA.					apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		AGATGAAGCTCAGAACAATGG	0.353													15	40	---	---	---	---	PASS
ATXN7L2	127002	broad.mit.edu	37	1	110031523	110031523	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110031523G>A	uc001dxr.2	+	7	853	c.838G>A	c.(838-840)GTG>ATG	p.V280M	ATXN7L2_uc001dxs.2_Translation_Start_Site|ATXN7L2_uc001dxt.2_5'Flank	NM_153340	NP_699171	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	280	SCA7.									ovary(2)	2		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		GGACTTTGACGTGCTGGTGGC	0.607													25	40	---	---	---	---	PASS
BCL9	607	broad.mit.edu	37	1	147091935	147091935	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147091935G>A	uc001epq.2	+	8	2714	c.1974G>A	c.(1972-1974)ATG>ATA	p.M658I	BCL9_uc010ozr.1_Missense_Mutation_p.M584I	NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	658	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					GCATGGAGATGAACAGGATGA	0.562			T	IGH@|IGL@	B-ALL								29	29	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186275501	186275501	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186275501C>A	uc001gru.3	+	7	701	c.650C>A	c.(649-651)CCA>CAA	p.P217Q	PRG4_uc001grt.3_Missense_Mutation_p.P176Q|PRG4_uc009wyl.2_Missense_Mutation_p.P124Q|PRG4_uc009wym.2_Missense_Mutation_p.P83Q|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	217					cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CCCAAACCACCAGTTGTAGAT	0.373													51	155	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1805482	1805482	+	Nonsense_Mutation	SNP	T	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1805482T>A	uc002qxe.2	-	23	4089	c.3262A>T	c.(3262-3264)AAA>TAA	p.K1088*	MYT1L_uc002qxd.2_Nonsense_Mutation_p.K1086*|MYT1L_uc010ewk.2_Nonsense_Mutation_p.K84*	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1088	Potential.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GTTCTGAGTTTAATCATATCG	0.368													46	103	---	---	---	---	PASS
FAM49A	81553	broad.mit.edu	37	2	16746924	16746924	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16746924T>C	uc010exm.1	-	3	330	c.182A>G	c.(181-183)GAG>GGG	p.E61G	FAM49A_uc002rck.1_Missense_Mutation_p.E61G	NM_030797	NP_110424	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	61						intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			ATCTCGGATCTCTGGGCCTGC	0.507													5	140	---	---	---	---	PASS
FAM161A	84140	broad.mit.edu	37	2	62066902	62066902	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62066902C>G	uc010ypo.1	-	3	1339	c.1237G>C	c.(1237-1239)GAA>CAA	p.E413Q	FAM161A_uc002sbm.3_Missense_Mutation_p.E413Q|FAM161A_uc002sbn.3_Missense_Mutation_p.E223Q|FAM161A_uc010fcm.1_RNA|FAM161A_uc010fcn.1_Missense_Mutation_p.E304Q	NM_032180	NP_115556	Q3B820	F161A_HUMAN	hypothetical protein LOC84140	413					response to stimulus|visual perception	centrosome				large_intestine(2)|ovary(1)	3						ACAGCCTGTTCAGGACACCTG	0.488													3	84	---	---	---	---	PASS
SEMA4F	10505	broad.mit.edu	37	2	74902126	74902126	+	Silent	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74902126C>T	uc002sna.1	+	9	1224	c.1113C>T	c.(1111-1113)GTC>GTT	p.V371V	SEMA4F_uc010ffq.1_Silent_p.V338V|SEMA4F_uc010ffr.1_5'UTR|SEMA4F_uc002snb.1_5'UTR|SEMA4F_uc002snc.1_Silent_p.V216V	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	371	Sema.|Extracellular (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						GACTGCCTGTCGTGGACAATG	0.532											OREG0014721	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	61	---	---	---	---	PASS
KCTD18	130535	broad.mit.edu	37	2	201371660	201371660	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201371660C>T	uc002uvs.2	-	2	597	c.80G>A	c.(79-81)CGG>CAG	p.R27Q	KCTD18_uc002uvt.2_Missense_Mutation_p.R27Q|KCTD18_uc002uvu.1_Missense_Mutation_p.R27Q	NM_152387	NP_689600	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain	27	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1						CAAGGACTCCCGCCGGGCTGT	0.502													22	21	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207173954	207173954	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207173954A>C	uc002vbp.2	+	5	4952	c.4702A>C	c.(4702-4704)ATT>CTT	p.I1568L		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1568							nucleic acid binding|zinc ion binding			ovary(3)	3						TACAGAATGTATTGATATAGA	0.358													6	10	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216243844	216243844	+	Intron	SNP	A	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216243844A>T	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vez.2_Intron|FN1_uc010zjp.1_Intron|FN1_uc002vfk.1_5'Flank|FN1_uc010fva.1_5'Flank|FN1_uc010fvb.1_5'Flank|FN1_uc010fvc.1_Intron|FN1_uc010fvd.1_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AACAACGGTCATGTCTTACCA	0.413													19	41	---	---	---	---	PASS
TM4SF20	79853	broad.mit.edu	37	2	228228737	228228737	+	Intron	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228228737C>A	uc002vpb.2	-							NM_024795	NP_079071	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20							integral to membrane|plasma membrane					0		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		CACTGAAAAACAAAAGATAAA	0.363													3	32	---	---	---	---	PASS
NEU2	4759	broad.mit.edu	37	2	233899464	233899464	+	Silent	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233899464C>T	uc010zmn.1	+	2	840	c.840C>T	c.(838-840)CCC>CCT	p.P280P		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	280							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		TCAGCTTCCCCAGCCCCCGCT	0.672													14	9	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238287552	238287552	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238287552G>A	uc002vwl.2	-	6	2509	c.2224C>T	c.(2224-2226)CAC>TAC	p.H742Y	COL6A3_uc002vwo.2_Missense_Mutation_p.H536Y|COL6A3_uc010znj.1_Intron|COL6A3_uc002vwq.2_Missense_Mutation_p.H536Y|COL6A3_uc002vwr.2_Missense_Mutation_p.H335Y|COL6A3_uc010znk.1_Intron	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	742	VWFA 4.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGCGGCACGTGTTCACGGATC	0.597													13	8	---	---	---	---	PASS
TBC1D5	9779	broad.mit.edu	37	3	17279867	17279867	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17279867T>C	uc003cbf.2	-	17	3041	c.1376A>G	c.(1375-1377)AAT>AGT	p.N459S	TBC1D5_uc010heu.2_Missense_Mutation_p.N46S|TBC1D5_uc010hev.2_Missense_Mutation_p.N459S|TBC1D5_uc003cbe.2_Missense_Mutation_p.N459S|TBC1D5_uc010hew.1_Missense_Mutation_p.N411S	NM_014744	NP_055559	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5 isoform b	459						intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						AATCAGGCTATTAGAGACCTT	0.428													16	6	---	---	---	---	PASS
PTH1R	5745	broad.mit.edu	37	3	46944832	46944832	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46944832G>A	uc003cqm.2	+	16	1671	c.1468G>A	c.(1468-1470)GGG>AGG	p.G490R	PTH1R_uc003cqn.2_Missense_Mutation_p.G490R	NM_000316	NP_000307	Q03431	PTH1R_HUMAN	parathyroid hormone receptor 1 precursor	490	Cytoplasmic (Potential).					cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association			breast(1)	1						GGCACGCAGCGGGAGCAGCAG	0.617									Ollier_disease_/_Maffuci_syndrome				16	6	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47162506	47162506	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47162506G>C	uc003cqs.2	-	3	3673	c.3620C>G	c.(3619-3621)TCT>TGT	p.S1207C	SETD2_uc003cqv.2_Missense_Mutation_p.S1196C	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1207					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTCAAAATCAGAAGAATAAAT	0.418			N|F|S|Mis		clear cell renal carcinoma								54	37	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121186375	121186375	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121186375G>T	uc003eee.3	-	24	7087	c.6958C>A	c.(6958-6960)CCT>ACT	p.P2320T	POLQ_uc003eed.2_Missense_Mutation_p.P1492T	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	2320					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		CCTGGGAAAGGCACAAAGGCA	0.458								DNA_polymerases_(catalytic_subunits)					16	22	---	---	---	---	PASS
RHO	6010	broad.mit.edu	37	3	129247936	129247936	+	Silent	SNP	C	T	T	rs79765751	byFrequency	TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129247936C>T	uc003emt.2	+	1	455	c.360C>T	c.(358-360)GGC>GGT	p.G120G		NM_000539	NP_000530	P08100	OPSD_HUMAN	rhodopsin	120	Retinal chromophore binding (By similarity).|Helical; Name=3; (Potential).				protein-chromophore linkage|rhodopsin mediated signaling pathway	Golgi apparatus|integral to plasma membrane|photoreceptor inner segment membrane|photoreceptor outer segment membrane	G-protein coupled receptor activity|metal ion binding|photoreceptor activity|protein binding				0		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	CCACCCTGGGCGGTATGAGCC	0.637													24	52	---	---	---	---	PASS
SSR3	6747	broad.mit.edu	37	3	156271474	156271474	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156271474T>C	uc003fau.2	-	2	287	c.230A>G	c.(229-231)TAC>TGC	p.Y77C	SSR3_uc011bop.1_Missense_Mutation_p.Y77C	NM_007107	NP_009038	Q9UNL2	SSRG_HUMAN	signal sequence receptor gamma subunit	77	Lumenal (Potential).				cotranslational protein targeting to membrane	integral to endoplasmic reticulum membrane|microsome|Sec61 translocon complex	protein binding|signal sequence binding				0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CACATTCTTGTATGCAAAGGC	0.333													17	36	---	---	---	---	PASS
MYNN	55892	broad.mit.edu	37	3	169496994	169496994	+	Silent	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169496994C>A	uc003fft.2	+	3	1134	c.705C>A	c.(703-705)CTC>CTA	p.L235L	MYNN_uc011bpm.1_Silent_p.L121L|MYNN_uc003ffu.2_Silent_p.L235L|MYNN_uc003ffv.2_5'UTR|MYNN_uc010hwo.2_Silent_p.L235L|MYNN_uc003ffw.1_RNA	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin	235						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			ATTCAGAACTCGAGTTGACAT	0.383													8	21	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170819317	170819317	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170819317T>G	uc003fhh.2	-	22	2857	c.2512A>C	c.(2512-2514)AGT>CGT	p.S838R	TNIK_uc003fhi.2_Missense_Mutation_p.S783R|TNIK_uc003fhj.2_Missense_Mutation_p.S809R|TNIK_uc003fhk.2_Missense_Mutation_p.S830R|TNIK_uc003fhl.2_Missense_Mutation_p.S754R|TNIK_uc003fhm.2_Missense_Mutation_p.S775R|TNIK_uc003fhn.2_Missense_Mutation_p.S801R|TNIK_uc003fho.2_Missense_Mutation_p.S746R|TNIK_uc003fhg.2_Missense_Mutation_p.S16R	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	838	Mediates interaction with NEDD4.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TCCTCGCTACTTTCTGACTCC	0.483													82	126	---	---	---	---	PASS
MCCC1	56922	broad.mit.edu	37	3	182755000	182755000	+	Intron	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182755000C>G	uc003fle.2	-						MCCC1_uc010hxi.2_Intron|MCCC1_uc011bqo.1_Intron|MCCC1_uc003flf.2_Intron|MCCC1_uc003flg.2_Intron|MCCC1_uc011bqp.1_Intron	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)						biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	GAAAAGCCTTCCATACCATGT	0.468													20	21	---	---	---	---	PASS
PAQR3	152559	broad.mit.edu	37	4	79841684	79841684	+	3'UTR	SNP	A	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79841684A>G	uc003hlp.1	-	6					PAQR3_uc003hlm.2_Intron|PAQR3_uc003hln.2_Intron|PAQR3_uc003hlq.1_3'UTR	NM_001040202	NP_001035292	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III							Golgi membrane|integral to membrane	receptor activity				0						CCAGGTGGCCATACCTAATTC	0.368													27	7	---	---	---	---	PASS
SPARCL1	8404	broad.mit.edu	37	4	88415045	88415045	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88415045C>T	uc010ikm.2	-	5	1479	c.907G>A	c.(907-909)GAA>AAA	p.E303K	SPARCL1_uc011cdc.1_Missense_Mutation_p.E178K|SPARCL1_uc003hqs.3_Missense_Mutation_p.E303K|SPARCL1_uc011cdd.1_Missense_Mutation_p.E178K|SPARCL1_uc003hqt.2_Missense_Mutation_p.E303K	NM_001128310	NP_001121782	Q14515	SPRL1_HUMAN	SPARC-like 1 precursor	303					signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		CTGATAGCTTCTAGGCCAGTT	0.433													103	63	---	---	---	---	PASS
SPARCL1	8404	broad.mit.edu	37	4	88415720	88415720	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88415720C>G	uc010ikm.2	-	5	804	c.232G>C	c.(232-234)GAG>CAG	p.E78Q	SPARCL1_uc011cdc.1_Intron|SPARCL1_uc003hqs.3_Missense_Mutation_p.E78Q|SPARCL1_uc011cdd.1_5'UTR|SPARCL1_uc003hqt.2_Missense_Mutation_p.E78Q	NM_001128310	NP_001121782	Q14515	SPRL1_HUMAN	SPARC-like 1 precursor	78					signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		TGGCTTTCCTCTTTTGACTTT	0.363													30	3	---	---	---	---	PASS
HIST1H4E	8367	broad.mit.edu	37	6	26205164	26205164	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26205164C>G	uc003ngy.2	+	1	292	c.292C>G	c.(292-294)CTT>GTT	p.L98V		NM_003545	NP_003536	P62805	H4_HUMAN	histone cluster 1, H4e	98					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1		all_hematologic(11;0.196)				GGGACGCACTCTTTACGGCTT	0.532													45	11	---	---	---	---	PASS
HIST1H3H	8357	broad.mit.edu	37	6	27776279	27776279	+	5'Flank	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27776279C>A	uc003njm.2	+						HIST1H2BL_uc003njl.2_5'Flank	NM_003536	NP_003527	P68431	H31_HUMAN	histone cluster 1, H3h						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						CAACAAGCTTCTGGGCAAAGT	0.617													22	26	---	---	---	---	PASS
OR10C1	442194	broad.mit.edu	37	6	29408113	29408113	+	Silent	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29408113C>T	uc011dlp.1	+	1	321	c.321C>T	c.(319-321)GGC>GGT	p.G107G	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	107	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCTTCTTTGGCGCCACGGAGT	0.612													23	62	---	---	---	---	PASS
ABCF1	23	broad.mit.edu	37	6	30557571	30557571	+	Intron	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30557571C>G	uc003nql.2	+						ABCF1_uc003nqm.2_Intron|ABCF1_uc010jsb.2_Intron	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1						inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						ACCTCCCTCTCTTCTCGGGCA	0.532													82	11	---	---	---	---	PASS
CAPN11	11131	broad.mit.edu	37	6	44150853	44150853	+	Intron	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44150853C>G	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTCCCTCTCTCAGGCATCAAG	0.557													4	83	---	---	---	---	PASS
RUNX2	860	broad.mit.edu	37	6	45514677	45514677	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45514677A>C	uc011dvx.1	+	9	1411	c.1201A>C	c.(1201-1203)ACC>CCC	p.T401P	RUNX2_uc011dvy.1_Missense_Mutation_p.T379P|RUNX2_uc003oxt.2_Missense_Mutation_p.T387P	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a	401	Interaction with MYST3 (By similarity).|Pro/Ser/Thr-rich.|Interaction with MYST4.				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						CTTTACTTACACCCCGCCAGT	0.587													7	51	---	---	---	---	PASS
FIG4	9896	broad.mit.edu	37	6	110037660	110037660	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110037660C>A	uc003ptt.2	+	3	393	c.178C>A	c.(178-180)CAA>AAA	p.Q60K	FIG4_uc011eau.1_Intron	NM_014845	NP_055660	Q92562	FIG4_HUMAN	Sac domain-containing inositol phosphatase 3	60					cell death	endosome membrane	protein binding			ovary(1)	1		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		TGTCTATACTCAACAAGAAGT	0.373													3	42	---	---	---	---	PASS
DSE	29940	broad.mit.edu	37	6	116757050	116757050	+	Silent	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116757050C>T	uc003pws.2	+	6	1613	c.1419C>T	c.(1417-1419)TAC>TAT	p.Y473Y	DSE_uc011ebg.1_Silent_p.Y492Y|DSE_uc003pwt.2_Silent_p.Y473Y|DSE_uc003pwu.2_Silent_p.Y140Y	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	473					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		AGGCTCTGTACGGGCCAAAGT	0.448													19	29	---	---	---	---	PASS
REPS1	85021	broad.mit.edu	37	6	139241454	139241454	+	Splice_Site	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139241454C>G	uc003qii.2	-	12	2006	c.1427_splice	c.e12-1	p.D476_splice	REPS1_uc003qig.3_Splice_Site_p.D449_splice|REPS1_uc011edr.1_Splice_Site_p.D476_splice|REPS1_uc003qij.2_Splice_Site_p.D449_splice|REPS1_uc003qik.2_Splice_Site_p.D82_splice	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1							coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		TTTGTATGATCTAATAGAGAA	0.313													21	41	---	---	---	---	PASS
SBDS	51119	broad.mit.edu	37	7	66460413	66460413	+	5'UTR	SNP	T	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66460413T>C	uc003tvm.1	-	1					TYW1_uc003tvn.2_5'Flank|TYW1_uc010lai.2_5'Flank	NM_016038	NP_057122	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome protein						bone marrow development|bone mineralization|leukocyte chemotaxis|mature ribosome assembly|mitotic spindle stabilization|positive regulation of translation|ribosomal large subunit biogenesis|rRNA processing	cytoplasm|nucleolus|nucleoplasm|spindle pole	microtubule binding|ribosome binding|rRNA binding			ovary(1)	1						ATCGCGGCTGTTCAAAGACCC	0.652			Gene Conversion			AML|MDS			Shwachman-Diamond_syndrome				11	102	---	---	---	---	PASS
MLL5	55904	broad.mit.edu	37	7	104746151	104746151	+	Intron	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104746151C>G	uc003vcm.2	+						MLL5_uc010ljc.2_Intron|MLL5_uc010lje.1_Intron|MLL5_uc010ljf.1_5'Flank|MLL5_uc010ljg.2_5'Flank	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						GTAAACTTTTCTTTGGAAGTA	0.353													19	13	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151962139	151962139	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151962139C>T	uc003wla.2	-	8	1387	c.1168G>A	c.(1168-1170)GTG>ATG	p.V390M		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	390	PHD-type 1.|PHD-type 2.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTCTGGCACACTTTGCACTCA	0.403			N		medulloblastoma								8	248	---	---	---	---	PASS
SPAG11B	10407	broad.mit.edu	37	8	7308358	7308358	+	3'UTR	SNP	A	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7308358A>G	uc003wrk.2	-	4					SPAG11B_uc003wrg.1_Silent_p.F93F|SPAG11B_uc003wrh.1_Intron|SPAG11B_uc003wri.2_3'UTR|SPAG11B_uc003wrj.2_Silent_p.F40F|SPAG11B_uc003wrl.2_Silent_p.F93F	NM_016512	NP_057596	Q08648	SG11B_HUMAN	sperm associated antigen 11B isoform A						spermatogenesis	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		AATGGCAGAAAAAAAGTCTGC	0.423													12	32	---	---	---	---	PASS
ADRA1A	148	broad.mit.edu	37	8	26721793	26721793	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26721793C>A	uc003xfh.1	-	1	1130	c.694G>T	c.(694-696)GTG>TTG	p.V232L	ADRA1A_uc003xfc.1_Missense_Mutation_p.V232L|ADRA1A_uc010lul.1_Missense_Mutation_p.V232L|ADRA1A_uc003xfd.1_RNA|ADRA1A_uc003xfe.1_Missense_Mutation_p.V232L|ADRA1A_uc010lum.1_Missense_Mutation_p.V232L|ADRA1A_uc003xff.1_RNA|ADRA1A_uc003xfg.1_Missense_Mutation_p.V232L	NM_000680	NP_000671	P35348	ADA1A_HUMAN	alpha-1A-adrenergic receptor isoform 1	232	Cytoplasmic (By similarity).				activation of phospholipase C activity|aging|apoptosis|calcium ion transport into cytosol|cell-cell signaling|intracellular protein kinase cascade|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of synaptic transmission, GABAergic|positive regulation of action potential|positive regulation of cardiac muscle contraction|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase C signaling cascade|positive regulation of vasoconstriction|response to drug|response to hormone stimulus|response to stress|smooth muscle contraction	integral to plasma membrane	alpha1-adrenergic receptor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amphetamine(DB00182)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Carvedilol(DB01136)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Maprotiline(DB00934)|Mephentermine(DB01365)|Metaraminol(DB00610)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Nefazodone(DB01149)|Nicergoline(DB00699)|Nilutamide(DB00665)|Norepinephrine(DB00368)|Norgestrel(DB00506)|Oxymetazoline(DB00935)|Perphenazine(DB00850)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Prazosin(DB00457)|Promazine(DB00420)|Promethazine(DB01069)|Propericiazine(DB01608)|Propiomazine(DB00777)|Pseudoephedrine(DB00852)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioridazine(DB00679)|Tolazoline(DB00797)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Ziprasidone(DB00246)	CGGAGCGTCACTTGCTCCGAG	0.617													8	18	---	---	---	---	PASS
CPA6	57094	broad.mit.edu	37	8	68658352	68658352	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68658352C>T	uc003xxq.3	-	1	269	c.13G>A	c.(13-15)GGG>AGG	p.G5R	CPA6_uc003xxr.3_5'UTR|CPA6_uc003xxs.2_Missense_Mutation_p.G5R	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor	5					proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			CTGCGCTTCCCGAGACACTTC	0.542													8	21	---	---	---	---	PASS
FAM164A	51101	broad.mit.edu	37	8	79598747	79598747	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79598747G>A	uc003ybd.2	+	4	358	c.256G>A	c.(256-258)GAA>AAA	p.E86K		NM_016010	NP_057094	Q96GY0	F164A_HUMAN	hypothetical protein LOC51101	86										ovary(1)	1						GAAACATGAAGAATTCATTGC	0.358													8	7	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104973324	104973324	+	Silent	SNP	T	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104973324T>C	uc003yls.2	+	13	2308	c.2067T>C	c.(2065-2067)TCT>TCC	p.S689S	RIMS2_uc003ylp.2_Silent_p.S911S|RIMS2_uc003ylw.2_Silent_p.S703S|RIMS2_uc003ylq.2_Silent_p.S703S|RIMS2_uc003ylr.2_Silent_p.S750S|RIMS2_uc003ylt.2_Silent_p.S296S	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	973					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTGAAGTCTCTGACTATGACT	0.303										HNSCC(12;0.0054)			19	56	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90220066	90220066	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90220066C>T	uc004apc.2	+	3	398	c.260C>T	c.(259-261)ACG>ATG	p.T87M	DAPK1_uc004ape.2_Missense_Mutation_p.T87M|DAPK1_uc004apd.2_Missense_Mutation_p.T87M|DAPK1_uc011ltg.1_Missense_Mutation_p.T87M|DAPK1_uc011lth.1_Translation_Start_Site	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	87	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						GAGAACAAGACGGACGTCATC	0.617									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				12	21	---	---	---	---	PASS
OLFML2A	169611	broad.mit.edu	37	9	127570102	127570102	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127570102C>T	uc004bov.2	+	7	1324	c.1211C>T	c.(1210-1212)CCC>CTC	p.P404L	OLFML2A_uc004bow.2_Missense_Mutation_p.P190L	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor	404	Olfactomedin-like.										0						GCTGTGGACCCCCCTGTGAGG	0.642													10	16	---	---	---	---	PASS
PTRH1	138428	broad.mit.edu	37	9	130476435	130476435	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130476435C>T	uc004bro.2	-	5	607	c.589G>A	c.(589-591)GAC>AAC	p.D197N	PTRH1_uc004brm.2_Intron|PTRH1_uc010mxm.2_Silent_p.P194P|PTRH1_uc011mah.1_Missense_Mutation_p.D210N|TTC16_uc004brq.1_5'Flank|TTC16_uc011mai.1_5'Flank|TTC16_uc004brr.1_5'Flank	NM_001002913	NP_001002913	Q86Y79	PTH_HUMAN	peptidyl-tRNA hydrolase 1 homolog	197					translation		aminoacyl-tRNA hydrolase activity|protein binding				0						AAGATCAGGTCGGTGGCTCGA	0.667													9	19	---	---	---	---	PASS
REXO4	57109	broad.mit.edu	37	9	136277936	136277936	+	Silent	SNP	G	A	A	rs143883166		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136277936G>A	uc004cdm.2	-	3	878	c.678C>T	c.(676-678)AGC>AGT	p.S226S	ADAMTS13_uc004cdp.3_5'Flank|REXO4_uc011mde.1_Silent_p.S89S|REXO4_uc011mdf.1_Silent_p.S89S|REXO4_uc004cdn.2_5'UTR|REXO4_uc004cdo.2_Intron	NM_020385	NP_065118	Q9GZR2	REXO4_HUMAN	XPMC2 prevents mitotic catastrophe 2 homolog	226						nucleolus	exonuclease activity|nucleic acid binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		TGAGGCTGACGCTGCCCTCGC	0.622													18	30	---	---	---	---	PASS
BICC1	80114	broad.mit.edu	37	10	60566844	60566844	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60566844C>T	uc001jki.1	+	17	2302	c.2302C>T	c.(2302-2304)CCA>TCA	p.P768S	BICC1_uc001jkj.1_Missense_Mutation_p.P409S	NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1	768					multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						TAAATCCATGCCAGCTGAAAC	0.433													120	43	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61847994	61847994	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61847994C>T	uc001jky.2	-	29	3643	c.3451G>A	c.(3451-3453)GGT>AGT	p.G1151S	ANK3_uc001jkw.2_Missense_Mutation_p.G285S|ANK3_uc009xpa.2_Missense_Mutation_p.G285S|ANK3_uc001jkx.2_Missense_Mutation_p.G329S|ANK3_uc010qih.1_Missense_Mutation_p.G1152S|ANK3_uc001jkz.3_Missense_Mutation_p.G1145S|ANK3_uc001jla.1_Missense_Mutation_p.G217S|ANK3_uc001jlb.1_Missense_Mutation_p.G669S	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1151					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						AGAATTCCACCTTCAGGACCA	0.483													46	179	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64943286	64943286	+	Silent	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64943286G>C	uc001jmn.2	-	22	7305	c.7005C>G	c.(7003-7005)CTC>CTG	p.L2335L	JMJD1C_uc001jml.2_Silent_p.L2098L|JMJD1C_uc001jmm.2_Silent_p.L2047L|JMJD1C_uc010qiq.1_Silent_p.L2153L|JMJD1C_uc009xpi.2_Silent_p.L2153L|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmo.2_Silent_p.L242L	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	2335	JmjC.				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					CTTCAATATGGAGATTTGTTG	0.274													5	256	---	---	---	---	PASS
ABLIM1	3983	broad.mit.edu	37	10	116203811	116203811	+	Missense_Mutation	SNP	C	T	T	rs138272125	byFrequency	TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116203811C>T	uc010qsg.1	-	17	2009	c.1910G>A	c.(1909-1911)CGC>CAC	p.R637H	ABLIM1_uc010qsh.1_Missense_Mutation_p.R605H|ABLIM1_uc010qsi.1_Missense_Mutation_p.R577H|ABLIM1_uc010qsk.1_Missense_Mutation_p.R514H|ABLIM1_uc009xyp.2_Missense_Mutation_p.R601H|ABLIM1_uc010qsf.1_Missense_Mutation_p.R314H|ABLIM1_uc009xyn.2_Missense_Mutation_p.R253H|ABLIM1_uc010qsj.1_Missense_Mutation_p.R232H|ABLIM1_uc009xyo.2_Missense_Mutation_p.R450H	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a	637					axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		AGAATCGTAGCGACTGGCTAA	0.493													30	63	---	---	---	---	PASS
INPP5F	22876	broad.mit.edu	37	10	121586539	121586539	+	Silent	SNP	A	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121586539A>T	uc001leo.2	+	20	2812	c.2646A>T	c.(2644-2646)GTA>GTT	p.V882V	INPP5F_uc001lep.2_Silent_p.V272V	NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	882							phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		TAGAGAGTGTAGGGCCAATAG	0.453													32	55	---	---	---	---	PASS
SPDYC	387778	broad.mit.edu	37	11	64939411	64939411	+	Intron	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64939411C>G	uc010rnz.1	+							NM_001008778	NP_001008778	Q5MJ68	SPDYC_HUMAN	speedy C						cell cycle	nucleus	protein kinase binding				0						TCTCTACCCTCAGAGGACAGT	0.517													7	35	---	---	---	---	PASS
C11orf57	55216	broad.mit.edu	37	11	111948979	111948979	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111948979A>C	uc001pmr.3	+	3	791	c.110A>C	c.(109-111)GAA>GCA	p.E37A	C11orf57_uc001pmu.2_Missense_Mutation_p.E37A|C11orf57_uc001pmw.3_Missense_Mutation_p.E37A|C11orf57_uc001pmt.3_Missense_Mutation_p.E37A|C11orf57_uc001pmv.3_Missense_Mutation_p.E37A|C11orf57_uc001pms.3_Missense_Mutation_p.E8A	NM_001082970	NP_001076439	Q6ZUT1	CK057_HUMAN	hypothetical protein LOC55216 isoform b	37										breast(2)|ovary(1)	3		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AGAGAACTGGAAAAACAGATG	0.333													9	11	---	---	---	---	PASS
POU2F3	25833	broad.mit.edu	37	11	120186099	120186099	+	Silent	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120186099C>G	uc001pxc.2	+	11	1200	c.1098C>G	c.(1096-1098)CTC>CTG	p.L366L	POU2F3_uc010rzk.1_Silent_p.L320L|POU2F3_uc010rzl.1_Silent_p.L296L|POU2F3_uc001pxe.1_Silent_p.L151L|POU2F3_uc001pxf.1_5'Flank	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor	366	Ser-rich.				negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		TGGGCCCCCTCTCTGTCCCTC	0.438													33	30	---	---	---	---	PASS
GALNT6	11226	broad.mit.edu	37	12	51759209	51759209	+	Intron	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51759209C>T	uc001ryk.2	-						GALNT6_uc009zma.1_Intron|GALNT6_uc001ryl.1_Intron	NM_007210	NP_009141	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6						protein O-linked glycosylation	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						TGCCCTGGTACTCACAGTGGG	0.677													18	27	---	---	---	---	PASS
SLC26A10	65012	broad.mit.edu	37	12	58019065	58019065	+	Silent	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58019065C>T	uc001spe.2	+	12	1736	c.1425C>T	c.(1423-1425)ACC>ACT	p.T475T	SLC26A10_uc001spf.2_RNA|SLC26A10_uc009zpz.1_Intron	NM_133489	NP_597996	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	475	STAS.					integral to membrane	antiporter activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(17;0.122)					GTGGTGTCACCTTTGCAGATG	0.542													42	58	---	---	---	---	PASS
COQ5	84274	broad.mit.edu	37	12	120966892	120966892	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120966892G>A	uc001tyn.2	-	1	73	c.53C>T	c.(52-54)TCG>TTG	p.S18L	COQ5_uc001tyo.2_5'UTR|COQ5_uc010szj.1_Missense_Mutation_p.S18L	NM_032314	NP_115690	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase	18					ubiquinone biosynthetic process	mitochondrion	methyltransferase activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CATCGCCCGCGACCACCCACG	0.647													16	19	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19751573	19751573	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19751573G>T	uc009zzj.2	-	4	599	c.550C>A	c.(550-552)CCC>ACC	p.P184T		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	184					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GAGTTGTAGGGCTCCACCACG	0.547													46	29	---	---	---	---	PASS
ACTN1	87	broad.mit.edu	37	14	69349243	69349243	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69349243C>A	uc001xkl.2	-	16	2195	c.1885G>T	c.(1885-1887)GAG>TAG	p.E629*	ACTN1_uc001xkk.2_Nonsense_Mutation_p.E225*|ACTN1_uc010ttb.1_Nonsense_Mutation_p.E564*|ACTN1_uc001xkm.2_Nonsense_Mutation_p.E629*|ACTN1_uc001xkn.2_Nonsense_Mutation_p.E629*|ACTN1_uc010ttc.1_Nonsense_Mutation_p.E214*	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	629	Interaction with DDN.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CGTAGCCTCTCATTGTGCTGC	0.622													14	18	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33757973	33757973	+	Intron	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33757973G>A	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		gatgcaagatggtacaatcac	0.000													40	61	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	41988737	41988737	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41988737C>T	uc001zog.1	+	3	1620	c.1529C>T	c.(1528-1530)ACA>ATA	p.T510I	MGA_uc010ucy.1_Missense_Mutation_p.T510I|MGA_uc010ucz.1_Missense_Mutation_p.T510I	NM_001080541	NP_001074010	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 2	510						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		TATTTGCCTACATACATTGAA	0.378													20	35	---	---	---	---	PASS
TMOD3	29766	broad.mit.edu	37	15	52188684	52188684	+	Silent	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52188684C>T	uc002abm.2	+	7	915	c.696C>T	c.(694-696)TTC>TTT	p.F232F	TMOD3_uc010bfc.1_RNA	NM_014547	NP_055362	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)	232						cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		TGAAATGTTTCAGTCTTGCAG	0.398													34	74	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52517147	52517147	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52517147C>A	uc010bff.2	-	28	3534	c.3397G>T	c.(3397-3399)GAG>TAG	p.E1133*	MYO5C_uc010uga.1_RNA	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	1133	Potential.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		TCTCCATCCTCATTTAAATGT	0.338													3	45	---	---	---	---	PASS
KIAA0430	9665	broad.mit.edu	37	16	15704957	15704957	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15704957G>C	uc002ddr.2	-	19	3819	c.3626C>G	c.(3625-3627)TCA>TGA	p.S1209*	KIAA0430_uc002ddq.2_Nonsense_Mutation_p.S1043*|KIAA0430_uc010uzv.1_Nonsense_Mutation_p.S1205*|KIAA0430_uc010uzw.1_Nonsense_Mutation_p.S1208*	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1	1208						peroxisome	nucleotide binding|RNA binding				0						CCAGTCCTTTGAGAAACACCT	0.358													34	65	---	---	---	---	PASS
KIAA0430	9665	broad.mit.edu	37	16	15706402	15706402	+	Intron	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15706402G>A	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1							peroxisome	nucleotide binding|RNA binding				0						GTAATCCCGTGACACGCCTTA	0.458													22	37	---	---	---	---	PASS
LCMT1	51451	broad.mit.edu	37	16	25186283	25186283	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25186283G>A	uc002dnx.1	+	10	1068	c.910G>A	c.(910-912)GAA>AAA	p.E304K	LCMT1_uc002dny.1_Missense_Mutation_p.E249K|LCMT1_uc002dnz.1_Missense_Mutation_p.E204K|LCMT1_uc002doa.1_Missense_Mutation_p.E149K	NM_016309	NP_057393	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1 isoform a	304							protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity				0				GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	ATTCCTGGATGAAATGGAGCT	0.443													5	10	---	---	---	---	PASS
ATP2A1	487	broad.mit.edu	37	16	28913228	28913228	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28913228G>C	uc002dro.1	+	16	2329	c.2145G>C	c.(2143-2145)GAG>GAC	p.E715D	uc010vct.1_Intron|ATP2A1_uc002drn.1_Missense_Mutation_p.E715D|ATP2A1_uc002drp.1_Missense_Mutation_p.E590D	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform	715	Cytoplasmic (By similarity).				apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						AGAAGGCTGAGATTGGCATTG	0.572													5	29	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10304986	10304986	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10304986G>C	uc002gmm.2	-	23	2900	c.2805C>G	c.(2803-2805)ATC>ATG	p.I935M	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	935	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GCTCAGCATTGATCTCTTCCT	0.443									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				111	56	---	---	---	---	PASS
TRAF4	9618	broad.mit.edu	37	17	27075426	27075426	+	Silent	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27075426C>G	uc002hcs.2	+	5	717	c.609C>G	c.(607-609)GTC>GTG	p.V203V	TRAF4_uc002hcq.1_Intron	NM_004295	NP_004286	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	203	TRAF-type 2.				apoptosis|positive regulation of JNK cascade|positive regulation of protein homodimerization activity|positive regulation of protein kinase activity|regulation of apoptosis|signal transduction	cytoskeleton|nucleus|perinuclear region of cytoplasm|tight junction	DNA binding|ubiquitin-protein ligase activity|WW domain binding|zinc ion binding			upper_aerodigestive_tract(1)|lung(1)	2	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			AGGAGTTCGTCTTTGACACCA	0.597													13	17	---	---	---	---	PASS
KRTAP9-4	85280	broad.mit.edu	37	17	39406378	39406378	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39406378G>A	uc002hwi.2	+	1	440	c.406G>A	c.(406-408)GAG>AAG	p.E136K	KRTAP9-9_uc010wfq.1_Intron	NM_033191	NP_149461	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4	136	14.|15 X 5 AA repeats of C-C-[RQVGE]-[SPTN]- [TASPF].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			AGCCTGCTGTGAGACCACTTG	0.567													4	129	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44115926	44115926	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44115926G>T	uc002ikb.2	-	9	2604	c.2519C>A	c.(2518-2520)TCA>TAA	p.S840*	KIAA1267_uc002ikc.2_Nonsense_Mutation_p.S840*|KIAA1267_uc002ikd.2_Nonsense_Mutation_p.S840*|KIAA1267_uc010dav.2_Nonsense_Mutation_p.S840*|KIAA1267_uc010wkb.1_Nonsense_Mutation_p.S171*|KIAA1267_uc010wkc.1_Nonsense_Mutation_p.S108*	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	840						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				TGTAACCTGTGAGCTAGAGCT	0.602													8	16	---	---	---	---	PASS
UNK	85451	broad.mit.edu	37	17	73819469	73819469	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73819469G>A	uc002jpm.2	+	16	2371	c.2371G>A	c.(2371-2373)GAG>AAG	p.E791K		NM_001080419	NP_001073888	Q9C0B0	UNK_HUMAN	zinc finger CCCH-type domain containing 5	715	Potential.						nucleic acid binding|zinc ion binding				0			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAAGCTCCAGGAGGAGCTGGA	0.711													8	4	---	---	---	---	PASS
SNAPC2	6618	broad.mit.edu	37	19	7985266	7985266	+	Silent	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7985266C>A	uc002miw.1	+	1	38	c.15C>A	c.(13-15)CCC>CCA	p.P5P	SNAPC2_uc002mix.1_5'Flank	NM_003083	NP_003074	Q13487	SNPC2_HUMAN	small nuclear RNA activating complex,	5					snRNA transcription|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	sequence-specific DNA binding transcription factor activity				0						AGCCACCTCCCAGGCGGCGAG	0.706													3	13	---	---	---	---	PASS
ACP5	54	broad.mit.edu	37	19	11685947	11685947	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11685947C>T	uc002msg.3	-	5	1002	c.856G>A	c.(856-858)GAA>AAA	p.E286K	uc002msf.2_Intron|ACP5_uc002msh.3_Missense_Mutation_p.E286K|ACP5_uc002msi.3_Missense_Mutation_p.E286K|ACP5_uc002msj.3_Missense_Mutation_p.E286K	NM_001611	NP_001602	P13686	PPA5_HUMAN	acid phosphatase 5, tartrate resistant	286					water-soluble vitamin metabolic process	cytosol|integral to membrane|lysosome	acid phosphatase activity|ferric iron binding|ferrous iron binding			central_nervous_system(1)	1						AGTGAGTCTTCAGTCCCATAG	0.567													23	39	---	---	---	---	PASS
F2RL3	9002	broad.mit.edu	37	19	17001291	17001291	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17001291C>G	uc002nfa.2	+	2	1192	c.1017C>G	c.(1015-1017)ATC>ATG	p.I339M		NM_003950	NP_003941	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	339	Helical; Name=7; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation|positive regulation of release of sequestered calcium ion into cytosol	extracellular region|integral to plasma membrane	thrombin receptor activity				0						ATCCCTTCATCTACTACTACG	0.657													5	14	---	---	---	---	PASS
ZNF566	84924	broad.mit.edu	37	19	36940268	36940268	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36940268T>C	uc002oea.3	-	5	950	c.868A>G	c.(868-870)AAG>GAG	p.K290E	ZNF566_uc010xte.1_Missense_Mutation_p.K290E|ZNF566_uc010xtf.1_Missense_Mutation_p.K291E|ZNF566_uc002oeb.3_Missense_Mutation_p.K290E|ZNF566_uc002oec.3_Missense_Mutation_p.K186E|ZNF566_uc010xtg.1_Missense_Mutation_p.K186E	NM_032838	NP_116227	Q969W8	ZN566_HUMAN	zinc finger protein 566 isoform 1	290	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)					CTAAAGGCCTTCCCGCATTCT	0.418													33	88	---	---	---	---	PASS
ZNF569	148266	broad.mit.edu	37	19	37903935	37903935	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37903935C>G	uc002ogi.2	-	6	2183	c.1625G>C	c.(1624-1626)AGA>ACA	p.R542T	ZNF569_uc002ogh.2_Missense_Mutation_p.R383T|ZNF569_uc002ogj.2_Missense_Mutation_p.R566T	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	542	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGTATGACTTCTCAAATGAAG	0.378													27	101	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38976785	38976785	+	Silent	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38976785C>T	uc002oit.2	+	34	5620	c.5490C>T	c.(5488-5490)GTC>GTT	p.V1830V	RYR1_uc002oiu.2_Silent_p.V1830V	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1830	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GCGACCCCGTCGGGGGCTCCG	0.662													55	138	---	---	---	---	PASS
PAF1	54623	broad.mit.edu	37	19	39877206	39877206	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39877206G>A	uc002old.2	-	13	1274	c.1099C>T	c.(1099-1101)CGG>TGG	p.R367W	PAF1_uc002ole.1_Missense_Mutation_p.R357W|PAF1_uc010xuv.1_RNA	NM_019088	NP_061961	Q8N7H5	PAF1_HUMAN	Paf1, RNA polymerase II associated factor,	367	Potential.|Glu-rich.				histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			pancreas(1)	1	all_cancers(60;9.14e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			TGGGCCTTCCGTGCCTCCTGG	0.458													19	36	---	---	---	---	PASS
CLEC11A	6320	broad.mit.edu	37	19	51228632	51228632	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51228632G>C	uc002psy.2	+	4	1058	c.880G>C	c.(880-882)GAG>CAG	p.E294Q		NM_002975	NP_002966	Q9Y240	CLC11_HUMAN	stem cell growth factor precursor	294	C-type lectin.				positive regulation of cell proliferation	cytoplasm|extracellular region	growth factor activity|sugar binding			ovary(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TGGCACGCTCGAGAACTGCGT	0.711													3	13	---	---	---	---	PASS
ZNF470	388566	broad.mit.edu	37	19	57088530	57088530	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57088530C>T	uc002qnl.3	+	6	1409	c.733C>T	c.(733-735)CTT>TTT	p.L245F	ZNF470_uc010etn.2_Intron	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	245	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		AACCCTTACTCTTCACCAAAG	0.378													29	64	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58596432	58596432	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58596432C>T	uc002qri.2	-	7	1462	c.1153G>A	c.(1153-1155)GTC>ATC	p.V385I	ZSCAN18_uc002qrj.3_Missense_Mutation_p.V384I|ZSCAN18_uc010yhs.1_Missense_Mutation_p.V249I|ZSCAN18_uc002qrh.2_Missense_Mutation_p.V385I|ZSCAN18_uc010yht.1_Missense_Mutation_p.V441I|ZSCAN18_uc002qrk.1_3'UTR|ZSCAN18_uc002qrl.2_3'UTR	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	385					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GAGCTAGAGACGCCCTCGAGG	0.726													8	10	---	---	---	---	PASS
TH1L	51497	broad.mit.edu	37	20	57564055	57564055	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57564055G>C	uc002yag.2	+	5	537	c.510G>C	c.(508-510)TTG>TTC	p.L170F	TH1L_uc010zzu.1_Missense_Mutation_p.L170F|TH1L_uc002yaf.1_RNA|TH1L_uc002yah.2_Missense_Mutation_p.L170F	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	TH1-like protein	170					negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)			CAGACTGTTTGATGCTGAACT	0.443													7	35	---	---	---	---	PASS
C20orf11	54994	broad.mit.edu	37	20	61574475	61574475	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61574475G>C	uc002ydy.2	+	3	432	c.255G>C	c.(253-255)TTG>TTC	p.L85F		NM_017896	NP_060366	Q9NWU2	CT011_HUMAN	chromosome 20 open reading frame 11	85	CTLH.					nucleus	protein binding				0	Breast(26;5.68e-08)					CCATCGCCTTGATCAACAGCC	0.458													22	46	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	30953833	30953833	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30953833G>T	uc002yno.1	-	13	2288	c.1824C>A	c.(1822-1824)CAC>CAA	p.H608Q	GRIK1_uc002ynn.2_Missense_Mutation_p.H593Q|GRIK1_uc011acs.1_Missense_Mutation_p.H608Q|GRIK1_uc011act.1_Missense_Mutation_p.H469Q|GRIK1_uc010glq.1_Missense_Mutation_p.H451Q	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	608	Cytoplasmic (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	GGTTGCATGGGTGGGGGTTAT	0.443													34	26	---	---	---	---	PASS
TRMT2A	27037	broad.mit.edu	37	22	20103949	20103949	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20103949C>G	uc002zrk.1	-	3	426	c.211G>C	c.(211-213)GAG>CAG	p.E71Q	TRMT2A_uc002zrl.1_Missense_Mutation_p.E71Q|TRMT2A_uc002zrm.1_5'UTR|TRMT2A_uc002zrn.1_Missense_Mutation_p.E71Q|TRMT2A_uc011ahk.1_Missense_Mutation_p.E71Q|RANBP1_uc011ahl.1_5'Flank|RANBP1_uc002zro.1_5'Flank|RANBP1_uc002zrp.2_5'Flank	NM_182984	NP_892029	Q8IZ69	TRM2A_HUMAN	HpaII tiny fragments locus 9C	71					RNA processing		nucleotide binding|RNA binding|RNA methyltransferase activity			breast(1)	1						TTAAAGATCTCAGAGGTAAAC	0.622													27	39	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50582543	50582543	+	Silent	SNP	G	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50582543G>A	uc003bjj.2	+	18	2459	c.2376G>A	c.(2374-2376)CCG>CCA	p.P792P	MOV10L1_uc003bjk.3_Silent_p.P792P|MOV10L1_uc011arp.1_Silent_p.P772P|MOV10L1_uc003bjl.2_5'Flank	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	792					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TTGCCTTGCCGGACAGTCGGA	0.552													57	108	---	---	---	---	PASS
CXorf23	256643	broad.mit.edu	37	X	19947987	19947987	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19947987C>G	uc004czp.2	-	10	1935	c.1935G>C	c.(1933-1935)CAG>CAC	p.Q645H	CXorf23_uc010nfn.2_RNA|CXorf23_uc011mjg.1_Intron|CXorf23_uc004czo.2_Missense_Mutation_p.Q624H	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643	674						mitochondrion				lung(1)|skin(1)	2						GATACTTAGCCTGAATGTACA	0.388													71	154	---	---	---	---	PASS
LOC100133957	100133957	broad.mit.edu	37	X	47518369	47518369	+	Silent	SNP	C	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47518369C>T	uc011mlt.1	+	1	118	c.45C>T	c.(43-45)ACC>ACT	p.T15T	UXT_uc004dim.2_5'UTR|UXT_uc004din.2_Intron|LOC100133957_uc011mls.1_Silent_p.T15T	NR_027444				SubName: Full=cDNA FLJ53557;												0						CCATGTTGACCGATCCAGTTT	0.637													11	14	---	---	---	---	PASS
MAGEE1	57692	broad.mit.edu	37	X	75649151	75649151	+	Silent	SNP	C	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75649151C>A	uc004ecm.1	+	1	1035	c.828C>A	c.(826-828)GCC>GCA	p.A276A		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	276	Pro-rich.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						TGCCCGCCGCCTCTGACGGAC	0.701													11	22	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76938875	76938875	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76938875C>G	uc004ecp.3	-	9	2105	c.1873G>C	c.(1873-1875)GAG>CAG	p.E625Q	ATRX_uc004ecq.3_Missense_Mutation_p.E587Q|ATRX_uc004eco.3_Missense_Mutation_p.E410Q|ATRX_uc004ecr.2_Missense_Mutation_p.E557Q|ATRX_uc010nlx.1_Missense_Mutation_p.E596Q|ATRX_uc010nly.1_Missense_Mutation_p.E570Q	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	625					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	CCACATTTCTCTAACTTGGGG	0.393			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						130	218	---	---	---	---	PASS
CYLC1	1538	broad.mit.edu	37	X	83129330	83129330	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83129330C>G	uc004eei.1	+	4	1635	c.1614C>G	c.(1612-1614)ATC>ATG	p.I538M	CYLC1_uc004eeh.1_Missense_Mutation_p.I537M	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	538	8.|8 X approximate tandem repeats.				cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5						CTACAAAAATCAAAGGTTCAG	0.363													9	25	---	---	---	---	PASS
MUM1L1	139221	broad.mit.edu	37	X	105451166	105451166	+	Silent	SNP	A	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105451166A>C	uc004emf.1	+	4	2390	c.1741A>C	c.(1741-1743)AGA>CGA	p.R581R	MUM1L1_uc004emg.1_Silent_p.R581R	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	581										ovary(2)|pancreas(1)|skin(1)	4						AAAAGGATCCAGATGGCTGAA	0.418													6	17	---	---	---	---	PASS
USP26	83844	broad.mit.edu	37	X	132161143	132161143	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132161143G>T	uc010nrm.1	-	6	1576	c.1106C>A	c.(1105-1107)TCA>TAA	p.S369*	USP26_uc011mvf.1_Nonsense_Mutation_p.S369*	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	369					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					TGCAGCTGCTGAAATGGCCTT	0.368													37	63	---	---	---	---	PASS
MAGEC2	51438	broad.mit.edu	37	X	141291726	141291726	+	Silent	SNP	G	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141291726G>C	uc004fbu.1	-	3	396	c.48C>G	c.(46-48)TCC>TCG	p.S16S		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	16						cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CTGAGGTCGGGGAGTCGTTGT	0.517										HNSCC(46;0.14)			65	98	---	---	---	---	PASS
C1orf141	400757	broad.mit.edu	37	1	67591685	67591686	+	Intron	DEL	AC	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67591685_67591686delAC	uc001ddl.1	-						C1orf141_uc001ddm.1_Intron|C1orf141_uc001ddn.1_Intron	NM_001013674	NP_001013696	Q5JVX7	CA141_HUMAN	hypothetical protein LOC400757											ovary(1)	1						ATCTCACTTTACACACACACAC	0.347													4	2	---	---	---	---	
AGL	178	broad.mit.edu	37	1	100318112	100318113	+	Intron	DEL	TG	-	-	rs58176899		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100318112_100318113delTG	uc001dsi.1	+						AGL_uc001dsj.1_Intron|AGL_uc001dsk.1_Intron|AGL_uc001dsl.1_Intron|AGL_uc001dsm.1_Intron	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		tttttttttttgtagaaactgg	0.000													4	2	---	---	---	---	
TAF13	6884	broad.mit.edu	37	1	109617402	109617402	+	Intron	DEL	A	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109617402delA	uc001dwm.1	-							NM_005645	NP_005636	Q15543	TAF13_HUMAN	TBP-associated factor 13						transcription elongation from RNA polymerase II promoter|viral reproduction	transcription factor TFIID complex	protein C-terminus binding|sequence-specific DNA binding transcription factor activity				0		all_epithelial(167;0.000102)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0138)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.166)|all cancers(265;0.191)|LUSC - Lung squamous cell carcinoma(189;0.228)		actccgtctcaaaaaaaaaaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	111360021	111360022	+	IGR	INS	-	TTTA	TTTA	rs139066422	by1000genomes	TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111360021_111360022insTTTA								KCNA3 (142366 upstream) : CD53 (53799 downstream)																							tcctttcttccttccttccttc	0.104													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121137803	121137805	+	IGR	DEL	CCA	-	-	rs60375635	by1000genomes	TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121137803_121137805delCCA								FCGR1B (201859 upstream) : LOC647121 (123105 downstream)																							ACCGCCGCCGCCACGGCTTTTTG	0.645													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	154350593	154350594	+	IGR	INS	-	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154350593_154350594insT								ATP8B2 (26814 upstream) : IL6R (27075 downstream)																							TTCTTTTTTTCTTTTTTTTTTT	0.342													4	2	---	---	---	---	
TNN	63923	broad.mit.edu	37	1	175049669	175049670	+	Intron	INS	-	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175049669_175049670insC	uc001gkl.1	+						TNN_uc010pmx.1_Intron	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGTTTGAAAAACACACCTGCCA	0.490													16	7	---	---	---	---	
SNAP47	116841	broad.mit.edu	37	1	227946501	227946502	+	Intron	INS	-	CC	CC	rs139094765	by1000genomes	TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227946501_227946502insCC	uc001hrf.2	+						SNAP47_uc001hqz.2_Intron|SNAP47_uc001hra.2_Intron|SNAP47_uc001hrd.2_Intron|SNAP47_uc001hre.2_Intron|SNAP47_uc001hrg.1_Intron	NM_053052	NP_444280	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa							endomembrane system|membrane|perinuclear region of cytoplasm				ovary(1)	1						TGTTCTCACTGCTGGCCCCCAG	0.475													4	2	---	---	---	---	
HADHB	3032	broad.mit.edu	37	2	26486167	26486167	+	Intron	DEL	A	-	-	rs139107013		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26486167delA	uc002rgz.2	+						HADHB_uc010yku.1_Intron|HADHB_uc010ykv.1_Intron|HADHB_uc010ykw.1_Intron|HADHB_uc002rha.2_Intron	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta						fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					actccatcttaaaaaaaaaaa	0.104													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92075328	92075329	+	IGR	DEL	TG	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92075328_92075329delTG								GGT8P (105175 upstream) : FKSG73 (53830 downstream)																							cctgagtagctgggaCTGGTTA	0.119													4	2	---	---	---	---	
STK36	27148	broad.mit.edu	37	2	219563225	219563225	+	Intron	DEL	C	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219563225delC	uc002viu.2	+						STK36_uc002viv.2_Intron|STK36_uc002viw.2_Intron|STK36_uc002vix.2_Intron	NM_015690	NP_056505	Q9NRP7	STK36_HUMAN	serine/threonine kinase 36						cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding			ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		TGTGGCATTTCTCACCATAGC	0.488													20	21	---	---	---	---	
PSMD1	5707	broad.mit.edu	37	2	232011261	232011262	+	Intron	INS	-	AC	AC	rs3835946		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232011261_232011262insAC	uc002vrn.1	+						PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	ATGTATTTTTTAGACTTAATGG	0.193													4	2	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241724244	241724244	+	Intron	DEL	A	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241724244delA	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGGGGGGGGGACGTCCACACC	0.657													6	3	---	---	---	---	
SLMAP	7871	broad.mit.edu	37	3	57882415	57882416	+	Intron	INS	-	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57882415_57882416insA	uc003dje.1	+						SLMAP_uc003djc.1_Intron|SLMAP_uc003djd.1_Intron|SLMAP_uc003djf.1_Intron|SLMAP_uc003djg.1_Intron|SLMAP_uc011bez.1_Intron|SLMAP_uc011bfa.1_Intron|SLMAP_uc003djh.2_Intron|SLMAP_uc003dji.1_Intron|SLMAP_uc011bfb.1_Intron|SLMAP_uc011bfc.1_Intron	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein						muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		TGTGTTTGGGGAAAAAAAAAAC	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	24170611	24170612	+	Intron	INS	-	A	A			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24170611_24170612insA	uc003jgq.1	+											Homo sapiens cDNA FLJ34836 fis, clone NT2NE2010400.																		CTTCTATTCCCAAAAATGCTTT	0.485													63	29	---	---	---	---	
CCNH	902	broad.mit.edu	37	5	86705006	86705007	+	Intron	DEL	TC	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86705006_86705007delTC	uc003kjb.2	-						CCNH_uc003kiy.1_5'Flank|CCNH_uc003kiz.1_Intron|CCNH_uc003kja.2_Intron	NM_001239	NP_001230	P51946	CCNH_HUMAN	cyclin H						G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cyclin-dependent protein kinase activating kinase holoenzyme complex|holo TFIIH complex	protein kinase binding			ovary(2)|kidney(1)	3		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		GGAAGTCAGTTCTCTCTCTCTC	0.297								Direct_reversal_of_damage|NER					6	3	---	---	---	---	
LARS	51520	broad.mit.edu	37	5	145518604	145518606	+	Intron	DEL	AAA	-	-	rs112008700		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145518604_145518606delAAA	uc003lnx.1	-						LARS_uc011dbq.1_Intron|LARS_uc011dbr.1_Intron|LARS_uc011dbs.1_Intron	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase						leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	TGGATTTGTGaaaaaaaaaaaaa	0.192													4	2	---	---	---	---	
ABCF1	23	broad.mit.edu	37	6	30548152	30548152	+	Intron	DEL	C	-	-	rs9278734		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30548152delC	uc003nql.2	+						ABCF1_uc003nqk.2_Intron|ABCF1_uc003nqm.2_Intron|ABCF1_uc010jsb.2_Intron	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1						inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						aaaaaaaaaaCATTTCATCAG	0.184													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32547924	32547925	+	Intron	INS	-	CAGG	CAGG			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32547924_32547925insCAGG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						ctcttgtaagaaaagttctcca	0.084													5	4	---	---	---	---	
FAM184A	79632	broad.mit.edu	37	6	119344988	119344989	+	Intron	DEL	AA	-	-	rs66591966		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119344988_119344989delAA	uc003pyj.2	-						FAM184A_uc003pyk.3_Intron|FAM184A_uc003pyl.3_Intron	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1											ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						AGGAAAAGTTaaaaaaaaaaaa	0.327													4	3	---	---	---	---	
PMS2CL	441194	broad.mit.edu	37	7	6775144	6775144	+	Intron	DEL	C	-	-	rs66809022		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6775144delC	uc011jxb.1	+						PMS2CL_uc003squ.2_Intron|PMS2CL_uc003sqv.1_Intron					SubName: Full=cDNA FLJ60281, highly similar to PMS1 protein homolog 2;												0						TTTTTTTTTTCTTTTTGAGAC	0.244													16	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61822074	61822074	+	IGR	DEL	C	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61822074delC								None (None upstream) : LOC643955 (929598 downstream)																							AAGGACCTCACCCAGCAGGAG	0.637													9	6	---	---	---	---	
NET1	10276	broad.mit.edu	37	10	5495688	5495688	+	Intron	DEL	A	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5495688delA	uc001iia.2	+						NET1_uc010qar.1_Intron|NET1_uc001iib.2_Intron|NET1_uc010qas.1_Intron	NM_001047160	NP_001040625	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming gene 1 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity			breast(1)	1						CAGTCTGTTTAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38450723	38450723	+	IGR	DEL	C	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38450723delC								ZNF37A (38447 upstream) : LOC100129055 (13876 downstream)																							CATACTTCATCtttttttttt	0.204													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49104713	49104713	+	IGR	DEL	C	-	-	rs149147831		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49104713delC								OR4A47 (593441 upstream) : FOLH1 (63475 downstream)																							tttcttCCTTCCCCCCGCAAA	0.428													4	3	---	---	---	---	
NUP107	57122	broad.mit.edu	37	12	69085637	69085637	+	Intron	DEL	G	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69085637delG	uc001suf.2	+						NUP107_uc001sug.2_Intron|NUP107_uc010stj.1_Intron	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			aaaaaaaaaaGACGCATACAT	0.134													4	3	---	---	---	---	
ZDHHC17	23390	broad.mit.edu	37	12	77209614	77209614	+	Intron	DEL	T	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77209614delT	uc001syk.1	+						ZDHHC17_uc001syi.1_Intron|ZDHHC17_uc001syj.2_Intron	NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						TTGTTGTTTGTTTTTTTTTTT	0.308													4	2	---	---	---	---	
KLF5	688	broad.mit.edu	37	13	73650108	73650109	+	3'UTR	INS	-	A	A	rs148760123	by1000genomes	TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73650108_73650109insA	uc001vje.2	+	4					KLF5_uc001vjd.2_3'UTR	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5						transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		ACAACAAAAACAAACAAAAGCA	0.396													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22409533	22409539	+	Intron	DEL	CTCTCTC	-	-	rs111263278		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22409533_22409539delCTCTCTC	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010ajb.1_Intron|uc001wck.2_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		ctctctctctctctctctTTTTTTTTT	0.362													5	3	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48059138	48059138	+	Intron	DEL	T	-	-	rs35781153		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48059138delT	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		atttatagtcttttttttttt	0.229													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74419429	74419431	+	Intron	DEL	CTC	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74419429_74419431delCTC	uc010vmt.1	+											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		TTCTCACCTTCTCCTCTCCTCAC	0.453													8	6	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	15938342	15938342	+	Intron	DEL	G	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15938342delG	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpl.2_Intron|NCOR1_uc002gpm.2_Intron|NCOR1_uc010vwb.1_Intron|NCOR1_uc010coy.2_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ATTGCTAAATGAAAAAAAAGC	0.269													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518762	21518763	+	IGR	DEL	AT	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518762_21518763delAT								C17orf51 (41031 upstream) : FAM27L (306607 downstream)																							TCTCTGTCACATATTTTTTTCT	0.307													4	2	---	---	---	---	
PSMD11	5717	broad.mit.edu	37	17	30773823	30773823	+	Intron	DEL	T	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30773823delT	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TGGCTTAGAGTTTTTTTTTTT	0.274													4	3	---	---	---	---	
TBC1D3P2	440452	broad.mit.edu	37	17	60347260	60347260	+	Intron	DEL	T	-	-	rs71934275		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60347260delT	uc002izq.2	-						TBC1D3P2_uc010woz.1_Intron|uc010wpa.1_5'Flank					SubName: Full=Putative uncharacterized protein TBC1D3E;												0						CTCTGAATGATTTTTTTTTTT	0.448													4	3	---	---	---	---	
RFX1	5989	broad.mit.edu	37	19	14094267	14094268	+	Intron	INS	-	C	C			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14094267_14094268insC	uc002mxv.2	-						RFX1_uc010dzi.2_Intron	NM_002918	NP_002909	P22670	RFX1_HUMAN	regulatory factor X1						immune response	nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			lung(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			TCCCGGGCCCTCCCCCACCCCC	0.693													5	3	---	---	---	---	
HAUS5	23354	broad.mit.edu	37	19	36104492	36104493	+	Intron	DEL	AG	-	-	rs34133946		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36104492_36104493delAG	uc002oam.1	+							NM_015302	NP_056117	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle					0						aaaaaaaaaaaggcaaaaaaaA	0.233													4	2	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													4	2	---	---	---	---	
ZNF530	348327	broad.mit.edu	37	19	58115504	58115512	+	Intron	DEL	GGCATCAGT	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58115504_58115512delGGCATCAGT	uc002qpk.2	+						ZNF547_uc002qpm.3_Intron|ZNF530_uc002qpl.2_Intron	NM_020880	NP_065931	Q6P9A1	ZN530_HUMAN	zinc finger protein 530						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGAGAGAGTAGGCATCAGTGGCATCAGGG	0.512													14	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499414	40499415	+	IGR	INS	-	T	T	rs147438953	by1000genomes	TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499414_40499415insT								ETS2 (302538 upstream) : PSMG1 (47975 downstream)																							Ttttttttttgttttgttttgt	0.307													2	5	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33230144	33230144	+	Intron	DEL	T	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33230144delT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron|TIMP3_uc003anb.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						TGAGCCCAGCttttttttttt	0.229													4	2	---	---	---	---	
USP11	8237	broad.mit.edu	37	X	47104944	47104944	+	Intron	DEL	T	-	-			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47104944delT	uc004dhp.2	+						USP11_uc004dhq.2_Intron	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TATATTTAGCttttttttttt	0.274													4	3	---	---	---	---	
FAAH2	158584	broad.mit.edu	37	X	57368048	57368049	+	Intron	INS	-	T	T			TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57368048_57368049insT	uc004dvc.2	+							NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						tataatagttgttttttttttt	0.005										HNSCC(52;0.14)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	92829490	92829490	+	IGR	DEL	A	-	-	rs112218234		TCGA-C5-A1BN-01	TCGA-C5-A1BN-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92829490delA								PCDH11X (951264 upstream) : NAP1L3 (96439 downstream)																							CAGATGTGGGAAAAAAAAAAA	0.393													4	2	---	---	---	---	
