Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC45A1	50651	broad.mit.edu	37	1	8399602	8399602	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8399602C>A	uc001apb.2	+	7	1824	c.1824C>A	c.(1822-1824)TTC>TTA	p.F608L	SLC45A1_uc001apc.2_Missense_Mutation_p.F306L	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	608	Helical; (Potential).				carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTCTACTTCATCGCCTATC	0.612													16	160	---	---	---	---	PASS
SLC45A1	50651	broad.mit.edu	37	1	8399734	8399734	+	Silent	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8399734C>A	uc001apb.2	+	7	1956	c.1956C>A	c.(1954-1956)CTC>CTA	p.L652L	SLC45A1_uc001apc.2_Silent_p.L350L	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	652					carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		ACTCGCTGCTCTGCGATTACT	0.507													34	240	---	---	---	---	PASS
FBXO42	54455	broad.mit.edu	37	1	16577862	16577862	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16577862C>T	uc001ayg.2	-	10	1673	c.1457G>A	c.(1456-1458)CGA>CAA	p.R486Q	FBXO42_uc001aye.3_Missense_Mutation_p.R204Q|FBXO42_uc001ayf.2_Missense_Mutation_p.R393Q	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42	486										upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		TAGTGATCCTCGTCGGGGGGC	0.483													15	121	---	---	---	---	PASS
FBXO42	54455	broad.mit.edu	37	1	16577905	16577905	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16577905C>T	uc001ayg.2	-	10	1630	c.1414G>A	c.(1414-1416)GAA>AAA	p.E472K	FBXO42_uc001aye.3_Missense_Mutation_p.E190K|FBXO42_uc001ayf.2_Missense_Mutation_p.E379K	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42	472										upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		TCGTATCCTTCAGGAGCAGAT	0.498													13	72	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	20998569	20998569	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20998569C>A	uc001bdr.3	-	12	2702	c.2584G>T	c.(2584-2586)GAG>TAG	p.E862*	KIF17_uc001bdp.3_Nonsense_Mutation_p.E140*|KIF17_uc001bdq.3_Nonsense_Mutation_p.E140*|KIF17_uc009vpx.2_Nonsense_Mutation_p.E232*|KIF17_uc001bds.3_Nonsense_Mutation_p.E862*	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	862					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGCACCTGCTCCAGGAGCTGC	0.552													24	67	---	---	---	---	PASS
GPATCH3	63906	broad.mit.edu	37	1	27223812	27223812	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27223812C>G	uc001bne.2	-	2	885	c.856G>C	c.(856-858)GAA>CAA	p.E286Q	GPATCH3_uc009vsp.1_Missense_Mutation_p.E97Q	NM_022078	NP_071361	Q96I76	GPTC3_HUMAN	G patch domain containing 3	286	Glu-rich.					intracellular	nucleic acid binding				0		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		TGAGACTCTTCTTCCTCTTCC	0.507													38	228	---	---	---	---	PASS
PHC2	1912	broad.mit.edu	37	1	33794581	33794581	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33794581A>C	uc001bxg.1	-	13	2366	c.2312T>G	c.(2311-2313)CTC>CGC	p.L771R	PHC2_uc001bxh.1_Missense_Mutation_p.L743R|PHC2_uc009vuh.1_Missense_Mutation_p.L772R|PHC2_uc001bxe.1_Missense_Mutation_p.L236R|PHC2_uc001bxf.1_Missense_Mutation_p.L186R	NM_198040	NP_932157	Q8IXK0	PHC2_HUMAN	polyhomeotic-like 2 isoform a	771					multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CATGTCGGGGAGCTCCAGGTC	0.577													34	97	---	---	---	---	PASS
RNF220	55182	broad.mit.edu	37	1	45115398	45115398	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45115398G>A	uc001clv.1	+	13	1871	c.1511G>A	c.(1510-1512)CGG>CAG	p.R504Q	RNF220_uc001clw.1_Missense_Mutation_p.R504Q|RNF220_uc010oky.1_Missense_Mutation_p.R291Q|RNF220_uc010okz.1_Missense_Mutation_p.R246Q|RNF220_uc001clx.1_Missense_Mutation_p.R220Q|RNF220_uc001cly.1_Missense_Mutation_p.R184Q|RNF220_uc001clz.1_Missense_Mutation_p.R183Q|RNF220_uc001cma.1_Missense_Mutation_p.R183Q|TMEM53_uc001cmb.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220	504	Potential.				protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GAACTTGAACGGCAGCTATCT	0.527													24	151	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	63044519	63044519	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63044519C>T	uc001daq.2	-	17	2024	c.1990G>A	c.(1990-1992)GAA>AAA	p.E664K	DOCK7_uc001dan.2_Missense_Mutation_p.E556K|DOCK7_uc001dao.2_Missense_Mutation_p.E556K|DOCK7_uc001dap.2_Missense_Mutation_p.E664K	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	664	DHR-1.				activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						ACTGGTGTTTCAAGAGGAGTA	0.308													17	143	---	---	---	---	PASS
ALG6	29929	broad.mit.edu	37	1	63902674	63902674	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63902674C>G	uc010oow.1	+	15	1812	c.1507C>G	c.(1507-1509)CAG>GAG	p.Q503E	ALG6_uc001daz.2_RNA|ALG6_uc009waj.2_RNA|ALG6_uc010oox.1_Missense_Mutation_p.Q250E	NM_013339	NP_037471	Q9Y672	ALG6_HUMAN	dolichyl pyrophosphate Man9GlcNAc2	503					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity				0						TGGAAGAAATCAGAAGAAAAT	0.323													29	79	---	---	---	---	PASS
LRRC40	55631	broad.mit.edu	37	1	70625092	70625092	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70625092T>C	uc001der.1	-	10	1193	c.1141A>G	c.(1141-1143)ACT>GCT	p.T381A		NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	381										ovary(1)	1						GCAGTCTCAGTAGCAGACTCA	0.303													8	53	---	---	---	---	PASS
AKNAD1	254268	broad.mit.edu	37	1	109394361	109394361	+	Nonsense_Mutation	SNP	G	C	C	rs139331299	byFrequency	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109394361G>C	uc001dwa.2	-	2	1195	c.926C>G	c.(925-927)TCA>TGA	p.S309*	AKNAD1_uc010ovb.1_Intron|AKNAD1_uc001dwb.2_RNA	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268	309										ovary(3)	3						AACACAGTTTGACTCAGGCGT	0.383													103	280	---	---	---	---	PASS
DENND2C	163259	broad.mit.edu	37	1	115166155	115166155	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115166155C>T	uc001efd.1	-	5	1618	c.916G>A	c.(916-918)GAG>AAG	p.E306K	DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.E306K	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	306										skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATATTGTCCTCAGACTGTGTG	0.358													8	72	---	---	---	---	PASS
REG4	83998	broad.mit.edu	37	1	120342438	120342438	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120342438C>T	uc001eig.2	-	5	653	c.213G>A	c.(211-213)CTG>CTA	p.L71L	REG4_uc001eif.2_Silent_p.L71L	NM_001159352	NP_001152824	Q9BYZ8	REG4_HUMAN	regenerating islet-derived family, member 4	71	C-type lectin.					extracellular region	sugar binding			ovary(1)	1	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)		CCTTTAAACTCAGGATAGATG	0.498													70	169	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152276558	152276558	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152276558G>C	uc001ezu.1	-	3	10840	c.10804C>G	c.(10804-10806)CAT>GAT	p.H3602D		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3602	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCTCTGCATGATGAGTGCCT	0.562									Ichthyosis				20	530	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152286055	152286055	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152286055G>C	uc001ezu.1	-	3	1343	c.1307C>G	c.(1306-1308)TCA>TGA	p.S436*	uc001ezv.2_RNA	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	436	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTGACACTGATTGTGTGTC	0.592									Ichthyosis				51	257	---	---	---	---	PASS
CRTC2	200186	broad.mit.edu	37	1	153920586	153920586	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153920586C>T	uc010ped.1	-	14	2151	c.2081G>A	c.(2080-2082)TGA>TAA	p.*694*	DENND4B_uc001fdd.1_5'Flank|CRTC2_uc001fde.3_RNA|CRTC2_uc001fdf.3_Silent_p.*230*	NM_181715	NP_859066	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	694					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)	2	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GAGGTGCCCTCATTGGAGCCG	0.607													15	40	---	---	---	---	PASS
MIR190B	100126346	broad.mit.edu	37	1	154166153	154166153	+	RNA	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154166153G>C	hsa-mir-190b|MI0005545	-			c.67G>C			TPM3_uc001fec.1_5'Flank																	0						GCTGCTGTAAGAATATGTTTG	0.453													6	28	---	---	---	---	PASS
SLC25A44	9673	broad.mit.edu	37	1	156177684	156177684	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156177684C>T	uc001fnp.2	+	3	955	c.633C>T	c.(631-633)CTC>CTT	p.L211L	SLC25A44_uc010phc.1_Silent_p.L102L|SLC25A44_uc009wrr.2_Silent_p.L219L|SLC25A44_uc010phd.1_RNA|SLC25A44_uc010phe.1_Intron	NM_014655	NP_055470	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	211					transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1	Hepatocellular(266;0.158)					CAGAGCAGCTCTCCTACCTGT	0.562													14	56	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158636105	158636105	+	Splice_Site	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158636105C>A	uc001fst.1	-	16	2419	c.2220_splice	c.e16+1	p.Q740_splice		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TAACAACAAACCTGACGAGCA	0.458													6	8	---	---	---	---	PASS
AIM2	9447	broad.mit.edu	37	1	159035774	159035774	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159035774C>T	uc001ftj.1	-	4	987	c.742G>A	c.(742-744)GAA>AAA	p.E248K		NM_004833	NP_004824	O14862	AIM2_HUMAN	absent in melanoma 2	248	HIN-200.				cellular response to drug|immune response|interleukin-1 beta secretion	mitochondrion|nucleus				ovary(2)|pancreas(1)	3	all_hematologic(112;0.0429)					TTCGGGGTTTCACCAGCTTTT	0.413													25	142	---	---	---	---	PASS
PRELP	5549	broad.mit.edu	37	1	203453017	203453017	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203453017G>T	uc001gzs.2	+	2	905	c.705G>T	c.(703-705)AAG>AAT	p.K235N	PRELP_uc001gzt.2_Missense_Mutation_p.K235N	NM_002725	NP_002716	P51888	PRELP_HUMAN	proline arginine-rich end leucine-rich repeat	235	LRR 7.				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(1)|central_nervous_system(1)|pancreas(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.109)			TCCTGAGAAAGATGCCGCCCA	0.552													51	171	---	---	---	---	PASS
KCTD3	51133	broad.mit.edu	37	1	215749313	215749313	+	Silent	SNP	T	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215749313T>C	uc001hks.2	+	4	547	c.253T>C	c.(253-255)TTA>CTA	p.L85L	KCTD3_uc001hkt.2_Silent_p.L85L|KCTD3_uc010pub.1_5'UTR	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN	potassium channel tetramerisation domain	85	BTB.					voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(3)	3				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		AGAACTAGACTTAAGGTAAGA	0.234													4	32	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222712018	222712018	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222712018G>A	uc001hnh.1	-	5	1607	c.1549C>T	c.(1549-1551)CTG>TTG	p.L517L		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	517					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		AAGATATACAGGCCATTGAGA	0.373													23	55	---	---	---	---	PASS
ENAH	55740	broad.mit.edu	37	1	225699534	225699534	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225699534C>T	uc001hpc.1	-	10	1903	c.1450G>A	c.(1450-1452)GCC>ACC	p.A484T	ENAH_uc001hpd.1_Missense_Mutation_p.A484T|ENAH_uc001hpb.1_Missense_Mutation_p.A103T	NM_001008493	NP_001008493	Q8N8S7	ENAH_HUMAN	enabled homolog isoform a	484	EVH2.				axon guidance|intracellular transport|T cell receptor signaling pathway	cytosol|filopodium|focal adhesion|lamellipodium|synapse	actin binding|SH3 domain binding|WW domain binding			ovary(1)|skin(1)	2	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		GTTGAAGAGGCCTTAGAAGTT	0.323													8	24	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248550938	248550938	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248550938G>A	uc001iei.1	+	1	29	c.29G>A	c.(28-30)AGA>AAA	p.R10K		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCTTGACCAGAGGCTTTACC	0.408													19	124	---	---	---	---	PASS
HNRPLL	92906	broad.mit.edu	37	2	38804675	38804675	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38804675C>T	uc002rqw.2	-	7	1213	c.803_splice	c.e7-1	p.D268_splice	HNRPLL_uc002rqv.2_Splice_Site|HNRPLL_uc002rqx.2_Splice_Site_p.D263_splice	NM_138394	NP_612403	Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like						mRNA processing|positive regulation of RNA splicing	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding			skin(1)	1		all_hematologic(82;0.248)				TTTCCTCTATCTGACACAAAA	0.398													7	60	---	---	---	---	PASS
ATP6V1B1	525	broad.mit.edu	37	2	71192255	71192255	+	3'UTR	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71192255C>T	uc002shj.2	+	14					ATP6V1B1_uc010fdv.2_3'UTR|ATP6V1B1_uc010fdw.2_RNA|ATP6V1B1_uc010fdx.2_3'UTR	NM_001692	NP_001683	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1						ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1						GCTCTAGCCCCGCGCGCCGTG	0.706											OREG0014686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	31	---	---	---	---	PASS
IL18RAP	8807	broad.mit.edu	37	2	103040290	103040290	+	Silent	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103040290C>G	uc002tbx.2	+	4	574	c.90C>G	c.(88-90)CTC>CTG	p.L30L	IL18RAP_uc010fiz.2_Intron	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	30	Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						CAAAAAAACTCCTTTGGACAT	0.338													6	52	---	---	---	---	PASS
IL18RAP	8807	broad.mit.edu	37	2	103040354	103040354	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103040354C>T	uc002tbx.2	+	4	638	c.154C>T	c.(154-156)CAG>TAG	p.Q52*	IL18RAP_uc010fiz.2_Intron	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	52	Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						ACCAGAGCCACAGAAATCACA	0.398													7	56	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163694971	163694971	+	Silent	SNP	G	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163694971G>T	uc002uch.1	-	1	270	c.58C>A	c.(58-60)CGG>AGG	p.R20R	KCNH7_uc002uci.2_Silent_p.R20R	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	20	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TCAAATTTCCGAATGATGGTC	0.567													5	36	---	---	---	---	PASS
GPR155	151556	broad.mit.edu	37	2	175330601	175330601	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175330601C>G	uc002uit.2	-	8	1687	c.1296G>C	c.(1294-1296)TGG>TGC	p.W432C	GPR155_uc002uiu.2_Missense_Mutation_p.W432C|GPR155_uc002uiv.2_Missense_Mutation_p.W432C|GPR155_uc010fqs.2_Missense_Mutation_p.W404C	NM_001033045	NP_001028217	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155 isoform 9	432	Helical; (Potential).				intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1						TAACAAAATTCCATATCATCA	0.318													8	52	---	---	---	---	PASS
ANKRD44	91526	broad.mit.edu	37	2	197990563	197990563	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197990563C>T	uc002uuc.2	-	5	627	c.460G>A	c.(460-462)GAG>AAG	p.E154K	ANKRD44_uc002uua.1_Missense_Mutation_p.E129K|ANKRD44_uc002uub.2_Missense_Mutation_p.E154K|ANKRD44_uc010zgw.1_Missense_Mutation_p.E82K	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	154	ANK 5.						protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATACCCACCTCCACGTGGCCG	0.507													14	121	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202619275	202619275	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202619275A>T	uc002uyo.2	-	6	1947	c.1591T>A	c.(1591-1593)TGG>AGG	p.W531R	ALS2_uc002uyp.3_Missense_Mutation_p.W531R|ALS2_uc002uyq.2_Missense_Mutation_p.W531R	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	531	RCC1 4.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						CCTTTCCCCCAGGTCCACACT	0.527													20	90	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202619287	202619287	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202619287C>A	uc002uyo.2	-	6	1935	c.1579G>T	c.(1579-1581)GAA>TAA	p.E527*	ALS2_uc002uyp.3_Nonsense_Mutation_p.E527*|ALS2_uc002uyq.2_Nonsense_Mutation_p.E527*	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	527	RCC1 4.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity	p.E527K(1)		skin(5)|lung(1)|breast(1)	7						GTCCACACTTCTGTTCTCAGA	0.542													19	88	---	---	---	---	PASS
NRP2	8828	broad.mit.edu	37	2	206630245	206630245	+	Silent	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206630245C>A	uc002vaw.2	+	14	3146	c.2355C>A	c.(2353-2355)GCC>GCA	p.A785A	NRP2_uc002vau.2_Silent_p.A785A|NRP2_uc002vav.2_Silent_p.A785A|NRP2_uc002vax.2_Silent_p.A785A|NRP2_uc002vay.2_Silent_p.A785A	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor	785	Extracellular (Potential).|MAM.				angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						GAGAGATTGCCATTGATGACA	0.468													19	106	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9784651	9784651	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9784651C>G	uc003bse.2	+	7	2406	c.2007C>G	c.(2005-2007)ATC>ATG	p.I669M	BRPF1_uc003bsf.2_Missense_Mutation_p.I675M|BRPF1_uc003bsg.2_Missense_Mutation_p.I669M|BRPF1_uc011ati.1_Missense_Mutation_p.I669M	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	669	Required for RUNX1 and RUNX2 transcriptional activation.|Interaction with MEAF6 and ING5.|Bromo.				histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					TAGACCACATCAAAAAGCCCA	0.488													20	54	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47098367	47098367	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47098367G>A	uc003cqs.2	-	15	6960	c.6907C>T	c.(6907-6909)CCA>TCA	p.P2303S	SETD2_uc003cqv.2_Missense_Mutation_p.P2370S	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2303	Gln-rich.|Low charge region.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TAGACTGTTGGACATGTCTGT	0.403			N|F|S|Mis		clear cell renal carcinoma								37	103	---	---	---	---	PASS
RBM5	10181	broad.mit.edu	37	3	50141706	50141706	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50141706G>C	uc003cyg.2	+	8	741	c.593G>C	c.(592-594)AGA>ACA	p.R198T	RBM5_uc011bdj.1_Missense_Mutation_p.R142T|RBM5_uc011bdk.1_Missense_Mutation_p.R26T	NM_005778	NP_005769	P52756	RBM5_HUMAN	RNA binding motif protein 5	198	RanBP2-type.				apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TTCAGGAAAAGACTAAAATGC	0.348													18	39	---	---	---	---	PASS
DTX3L	151636	broad.mit.edu	37	3	122287480	122287480	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122287480G>C	uc003efk.2	+	3	633	c.544G>C	c.(544-546)GAA>CAA	p.E182Q	DTX3L_uc010hrj.2_Intron	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN	deltex 3-like	182					histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)	4				GBM - Glioblastoma multiforme(114;0.0459)		CCAAGACATTGAAAGAATACA	0.438													16	79	---	---	---	---	PASS
TMCC1	23023	broad.mit.edu	37	3	129370401	129370401	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129370401C>A	uc003emz.3	-	7	2386	c.1885G>T	c.(1885-1887)GTT>TTT	p.V629F	TMCC1_uc003emy.3_Missense_Mutation_p.V305F|TMCC1_uc011blc.1_Missense_Mutation_p.V450F|TMCC1_uc010htg.2_Missense_Mutation_p.V515F	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	629	Helical; (Potential).					integral to membrane				skin(1)	1						GCAATAAAAACCACAAGGAAT	0.493													13	142	---	---	---	---	PASS
CCRL1	51554	broad.mit.edu	37	3	132319907	132319907	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132319907C>T	uc003eow.2	+	2	749	c.666C>T	c.(664-666)ATC>ATT	p.I222I	ACAD11_uc003eov.3_Intron|ACAD11_uc011blr.1_Intron|CCRL1_uc003eox.2_Silent_p.I222I	NM_016557	NP_057641	Q9NPB9	CCRL1_HUMAN	chemokine (C-C motif) receptor-like 1	222	Helical; Name=5; (Potential).				chemotaxis|immune response	integral to plasma membrane	C-C chemokine receptor activity				0						GCTACTTTATCACAGCAAGGA	0.403													51	103	---	---	---	---	PASS
FAIM	55179	broad.mit.edu	37	3	138341033	138341033	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138341033G>A	uc003esr.2	+	3	375	c.115G>A	c.(115-117)GAG>AAG	p.E39K	FAIM_uc003eso.1_Missense_Mutation_p.E73K|FAIM_uc003esp.2_Missense_Mutation_p.E73K|FAIM_uc003esq.2_Missense_Mutation_p.E61K|FAIM_uc003ess.2_Missense_Mutation_p.E39K	NM_001033032	NP_001028204	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule isoform c	39					apoptosis	cytoplasm					0						TATGTAGGAAGAGATAAGAAA	0.318													23	57	---	---	---	---	PASS
TBL1XR1	79718	broad.mit.edu	37	3	176769478	176769478	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176769478G>C	uc003fiw.3	-	5	501	c.241C>G	c.(241-243)CTG>GTG	p.L81V	TBL1XR1_uc003fix.3_Missense_Mutation_p.L81V|TBL1XR1_uc011bpz.1_5'UTR|TBL1XR1_uc003fiy.2_Missense_Mutation_p.L81V	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	81	F-box-like.				canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			ATCAGGGACAGAGACTCTATT	0.403													9	53	---	---	---	---	PASS
SENP5	205564	broad.mit.edu	37	3	196654691	196654691	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196654691G>A	uc003fwz.3	+	8	2296	c.2047G>A	c.(2047-2049)GAA>AAA	p.E683K	SENP5_uc011bty.1_Missense_Mutation_p.E637K	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	683	Protease.				cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		TTTGCTGACTGAAGCCAGAGA	0.413													5	74	---	---	---	---	PASS
TACC3	10460	broad.mit.edu	37	4	1730122	1730122	+	Silent	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1730122G>C	uc003gdo.2	+	4	1101	c.993G>C	c.(991-993)TCG>TCC	p.S331S	TACC3_uc010ibz.2_Silent_p.S331S|TACC3_uc003gdp.2_Intron|TACC3_uc010ica.2_5'Flank	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing	331						centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CCAGCTCCTCGAGGAGCGGAC	0.597													8	33	---	---	---	---	PASS
TACC3	10460	broad.mit.edu	37	4	1730411	1730411	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1730411G>A	uc003gdo.2	+	4	1390	c.1282G>A	c.(1282-1284)GAG>AAG	p.E428K	TACC3_uc010ibz.2_Missense_Mutation_p.E428K|TACC3_uc003gdp.2_Intron|TACC3_uc010ica.2_5'Flank	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing	428						centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			TGGTTGCAGTGAGGCCCAGCC	0.622													5	59	---	---	---	---	PASS
RUFY3	22902	broad.mit.edu	37	4	71588332	71588332	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71588332C>T	uc003hfq.2	+	1	637	c.42C>T	c.(40-42)ACC>ACT	p.T14T	RUFY3_uc003hfp.3_Intron|RUFY3_uc011cax.1_Silent_p.T14T|RUFY3_uc003hfr.2_Silent_p.T14T	NM_014961	NP_055776	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 2	14					negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			CAACCCCCACCACTGACAAGA	0.438													17	68	---	---	---	---	PASS
USP53	54532	broad.mit.edu	37	4	120192932	120192932	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120192932G>A	uc003ics.3	+	15	2983	c.1917G>A	c.(1915-1917)ATG>ATA	p.M639I	USP53_uc003icr.3_Missense_Mutation_p.M639I|USP53_uc003icu.3_Missense_Mutation_p.M262I|USP53_uc003ict.2_Missense_Mutation_p.M262I	NM_019050	NP_061923	Q70EK8	UBP53_HUMAN	ubiquitin specific protease 53	639					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			ovary(1)|breast(1)|kidney(1)|skin(1)	4						AAGGTTTAATGACCATATATG	0.363													15	66	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9119177	9119177	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9119177G>A	uc003jek.2	-	15	2570	c.1858C>T	c.(1858-1860)CGC>TGC	p.R620C		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	620	TSP type-1 2.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						CTGCAGGAGCGCTGCCGCACC	0.667													13	12	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13868031	13868031	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13868031A>T	uc003jfd.2	-	25	3947	c.3905T>A	c.(3904-3906)CTG>CAG	p.L1302Q		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1302	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGCATAGTGCAGTGTATCAAC	0.408									Kartagener_syndrome				77	85	---	---	---	---	PASS
ISL1	3670	broad.mit.edu	37	5	50685569	50685569	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50685569G>C	uc003jor.2	+	4	1116	c.568G>C	c.(568-570)GAG>CAG	p.E190Q		NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1	190	Homeobox.				generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				TGTGCTGAACGAGAAGCAGCT	0.672													4	33	---	---	---	---	PASS
NDUFS4	4724	broad.mit.edu	37	5	52979020	52979020	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52979020G>C	uc003jpe.2	+	5	525	c.497G>C	c.(496-498)TGG>TCG	p.W166S		NM_002495	NP_002486	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4	166					brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1		Lung NSC(810;8.27e-05)|Breast(144;0.0848)			NADH(DB00157)	AACTTTTCTTGGAACAAAAGA	0.388													12	87	---	---	---	---	PASS
ACOT12	134526	broad.mit.edu	37	5	80626633	80626633	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80626633G>A	uc003khl.3	-	14	1573	c.1518C>T	c.(1516-1518)ATC>ATT	p.I506I	RNU5E_uc011cto.1_Intron	NM_130767	NP_570123	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	506	START.				acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		TCAAACTTACGATGCATGAAT	0.398													12	85	---	---	---	---	PASS
FEM1C	56929	broad.mit.edu	37	5	114860238	114860238	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114860238G>A	uc003krb.1	-	3	2183	c.1621C>T	c.(1621-1623)CCA>TCA	p.P541S		NM_020177	NP_064562	Q96JP0	FEM1C_HUMAN	feminization 1 homolog a	541	ANK 9.					cytoplasm				breast(2)|ovary(1)	3		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		ATGATGTCTGGATGGTTGTTA	0.428													10	164	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127800434	127800434	+	Missense_Mutation	SNP	C	T	T	rs148971572	byFrequency	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127800434C>T	uc003kuu.2	-	6	1248	c.809G>A	c.(808-810)CGC>CAC	p.R270H	FBN2_uc003kuv.2_Missense_Mutation_p.R237H|FBN2_uc003kuw.3_Missense_Mutation_p.R270H|FBN2_uc003kux.1_Missense_Mutation_p.R270H	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	270					bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGCTCCAGTGCGGATGTTGGG	0.592													12	65	---	---	---	---	PASS
PCDHB15	56121	broad.mit.edu	37	5	140627400	140627400	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140627400G>A	uc003lje.2	+	1	2254	c.2254G>A	c.(2254-2256)GAG>AAG	p.E752K		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	752	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTACCAGTACGAGGTGTGTCT	0.552													39	138	---	---	---	---	PASS
GTPBP2	54676	broad.mit.edu	37	6	43591721	43591721	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43591721G>A	uc003ovs.2	-	8	1222	c.1185C>T	c.(1183-1185)CTC>CTT	p.L395L	GTPBP2_uc010jyv.2_Silent_p.L307L|GTPBP2_uc003ovt.1_Silent_p.L395L	NM_019096	NP_061969	Q9BX10	GTPB2_HUMAN	GTP binding protein 2	395							GTP binding|GTPase activity			liver(1)|skin(1)	2	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			TGCTGTTGGTGAGTGGCGGCA	0.527													23	112	---	---	---	---	PASS
IRAK1BP1	134728	broad.mit.edu	37	6	79577385	79577385	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79577385G>T	uc003pim.2	+	1	197	c.92G>T	c.(91-93)AGA>ATA	p.R31I	IRAK1BP1_uc010kbg.1_RNA	NM_001010844	NP_001010844	Q5VVH5	IKBP1_HUMAN	interleukin-1 receptor-associated kinase 1	31	Intrinsically disordered.				I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus					0		all_cancers(76;0.0398)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)		BRCA - Breast invasive adenocarcinoma(397;0.21)		GCCTCAGGGAGAGAGACGCTA	0.622													9	88	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79650622	79650622	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79650622C>T	uc003pir.2	-	40	5480	c.5254G>A	c.(5254-5256)GAG>AAG	p.E1752K	PHIP_uc003piq.2_Missense_Mutation_p.E776K|PHIP_uc011dyp.1_Missense_Mutation_p.E1751K|IRAK1BP1_uc010kbg.1_Intron|PHIP_uc003pio.3_Missense_Mutation_p.E638K	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1752	Poly-Glu.				insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TCTTCTTCCTCATCTATAGGA	0.398													261	648	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146248395	146248395	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146248395G>A	uc003qlf.2	-	15	3530	c.3131C>T	c.(3130-3132)GCA>GTA	p.A1044V	SHPRH_uc003qld.2_Missense_Mutation_p.A1053V|SHPRH_uc003qle.2_Missense_Mutation_p.A1053V|SHPRH_uc003qlg.1_Missense_Mutation_p.A600V|SHPRH_uc003qlh.2_5'UTR|SHPRH_uc003qli.1_5'UTR	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	1044					DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GTACAATTCTGCTGCCAAGGC	0.358													4	62	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159655334	159655334	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159655334C>T	uc010kjv.2	+	11	3990	c.3790C>T	c.(3790-3792)CGC>TGC	p.R1264C	FNDC1_uc010kjw.1_Missense_Mutation_p.R1149C	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1264						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		ACTGCCGCCTCGCAGCGCTGC	0.736													3	5	---	---	---	---	PASS
C6orf118	168090	broad.mit.edu	37	6	165715629	165715629	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165715629G>C	uc003qum.3	-	2	218	c.182C>G	c.(181-183)TCT>TGT	p.S61C	C6orf118_uc011egi.1_RNA	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN	hypothetical protein LOC168090	61											0		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CAGGTGTCCAGAGATGTAGAG	0.577													32	91	---	---	---	---	PASS
HOXA4	3201	broad.mit.edu	37	7	27169043	27169043	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27169043G>A	uc003sym.3	-	2	811	c.764C>T	c.(763-765)TCT>TTT	p.S255F	HOXA3_uc003syk.2_5'Flank	NM_002141	NP_002132	Q00056	HXA4_HUMAN	homeobox A4	255	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						CTGGCGCTCAGACAAACAGAG	0.567													19	96	---	---	---	---	PASS
HOXA4	3201	broad.mit.edu	37	7	27170293	27170293	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27170293G>A	uc003sym.3	-	1	107	c.60C>T	c.(58-60)TTC>TTT	p.F20F		NM_002141	NP_002132	Q00056	HXA4_HUMAN	homeobox A4	20	Pro-rich (part of the transcriptional activation domain).					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						CGTACTCCTCGAAGGGAGGGA	0.478													3	5	---	---	---	---	PASS
TMEM60	85025	broad.mit.edu	37	7	77423294	77423294	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77423294C>G	uc003ugn.2	-	2	624	c.397G>C	c.(397-399)GAC>CAC	p.D133H		NM_032936	NP_116325	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	133						integral to membrane					0						AGAAGTCAGTCTCTCACAAAA	0.388													8	50	---	---	---	---	PASS
ASB4	51666	broad.mit.edu	37	7	95157138	95157138	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95157138C>T	uc011kij.1	+	3	501	c.501C>T	c.(499-501)AAC>AAT	p.N167N	ASB4_uc003unx.2_Silent_p.N167N	NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4	167	ANK 3.				intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			CGAATGTGAACATGAAGACCA	0.463											OREG0018172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	44	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98574696	98574696	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98574696G>A	uc003upp.2	+	55	8570	c.8361G>A	c.(8359-8361)GAG>GAA	p.E2787E	TRRAP_uc011kis.1_Silent_p.E2769E|TRRAP_uc003upr.2_Silent_p.E2486E	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	2787	FAT.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGTTCTTTGAGCAGGTAAACC	0.473													9	67	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	157985024	157985024	+	Missense_Mutation	SNP	C	T	T	rs35442624		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157985024C>T	uc003wno.2	-	5	665	c.544G>A	c.(544-546)GCT>ACT	p.A182T	PTPRN2_uc003wnp.2_Missense_Mutation_p.A165T|PTPRN2_uc003wnq.2_Missense_Mutation_p.A182T|PTPRN2_uc003wnr.2_Missense_Mutation_p.A144T|PTPRN2_uc011kwa.1_Missense_Mutation_p.A205T	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	182	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GTCACCTCAGCGGGGGGTCTG	0.667													3	28	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131072983	131072983	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131072983G>C	uc003yta.1	-	27	3062	c.3034C>G	c.(3034-3036)CAG>GAG	p.Q1012E	ASAP1_uc003ysz.1_Missense_Mutation_p.Q823E|ASAP1_uc011liw.1_Missense_Mutation_p.Q1005E	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	1012					cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						GAGGGTTGCTGAGCCTTGGGT	0.527													40	143	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143623644	143623644	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143623644C>T	uc003ywm.2	+	27	4232	c.4049C>T	c.(4048-4050)ACG>ATG	p.T1350M		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1350	Cytoplasmic (Potential).				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ATCCTGCCCACGGCCACGGCC	0.647													4	35	---	---	---	---	PASS
CPSF1	29894	broad.mit.edu	37	8	145624185	145624185	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145624185G>A	uc003zcj.2	-	17	1697	c.1622C>T	c.(1621-1623)CCG>CTG	p.P541L		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	541					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CTTACGCACCGGGGCGATGAC	0.642													12	73	---	---	---	---	PASS
KDM4C	23081	broad.mit.edu	37	9	7015889	7015889	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7015889G>A	uc003zkh.2	+	15	2799	c.2219G>A	c.(2218-2220)GGA>GAA	p.G740E	KDM4C_uc010mhu.2_Missense_Mutation_p.G762E|KDM4C_uc011lmi.1_Missense_Mutation_p.G740E|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Missense_Mutation_p.G740E|KDM4C_uc011lmk.1_Missense_Mutation_p.G485E|KDM4C_uc011lml.1_Missense_Mutation_p.G427E	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1	740	PHD-type 1.				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						ATCTGTGATGGATGGCTGTGT	0.403													7	66	---	---	---	---	PASS
CTSL1	1514	broad.mit.edu	37	9	90343497	90343497	+	Intron	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90343497C>T	uc004aph.2	+						CTSL1_uc004api.2_Intron|CTSL1_uc004apj.2_Intron|CTSL1_uc010mqh.2_Intron|CTSL1_uc004apk.2_Intron|CTSL1_uc004apl.2_Intron	NM_001912	NP_001903	P07711	CATL1_HUMAN	cathepsin L1 preproprotein						macrophage apoptosis|proteolysis	extracellular region|lysosome|nucleus	cysteine-type endopeptidase activity|histone binding			ovary(3)	3					Glucagon recombinant(DB00040)	ATTCCCTTTTCAGGGTCAGTG	0.398													26	109	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101748328	101748328	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101748328G>T	uc004azb.1	+	3	788	c.582G>T	c.(580-582)TTG>TTT	p.L194F	COL15A1_uc004aza.2_Missense_Mutation_p.L194F	NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	194	TSP N-terminal.				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				CCCAGGCTTTGGCTTTTGAGT	0.567													13	64	---	---	---	---	PASS
CCBL1	883	broad.mit.edu	37	9	131607662	131607662	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131607662C>T	uc004bwh.2	-	2	208	c.23G>A	c.(22-24)CGA>CAA	p.R8Q	CCBL1_uc004bwf.2_Missense_Mutation_p.R42Q|CCBL1_uc004bwg.2_RNA|CCBL1_uc010myn.2_Missense_Mutation_p.R8Q|CCBL1_uc004bwj.2_Missense_Mutation_p.R8Q|CCBL1_uc011mbl.1_Missense_Mutation_p.R102Q|CCBL1_uc004bwi.2_RNA|CCBL1_uc010myo.2_Missense_Mutation_p.R8Q	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a	8					kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	GTCTAGCCTTCGGGCCTGCAG	0.612													5	32	---	---	---	---	PASS
METTL11A	28989	broad.mit.edu	37	9	132397623	132397623	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132397623C>T	uc004byd.1	+	4	746	c.552C>T	c.(550-552)TGC>TGT	p.C184C	METTL11A_uc010myw.1_RNA|METTL11A_uc011mbs.1_3'UTR|ASB6_uc004bye.1_3'UTR|ASB6_uc004byf.1_3'UTR|ASB6_uc004byg.1_3'UTR|ASB6_uc011mbt.1_3'UTR|ASB6_uc010myx.1_3'UTR	NM_014064	NP_054783	Q9BV86	NTM1A_HUMAN	methyltransferase like 11A	184					chromosome segregation|N-terminal peptidyl-proline dimethylation|N-terminal peptidyl-serine dimethylation|N-terminal peptidyl-serine trimethylation|spindle organization	nucleus	protein binding|protein methyltransferase activity				0						GCAGCGTGTGCCGGGACCTTG	0.627													18	74	---	---	---	---	PASS
TPRN	286262	broad.mit.edu	37	9	140093513	140093513	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140093513C>G	uc004clt.2	-	1	1468	c.1468G>C	c.(1468-1470)GAG>CAG	p.E490Q	TPRN_uc004clu.2_Missense_Mutation_p.E490Q	NM_173691	NP_775962	Q4KMQ1	TPRN_HUMAN	hypothetical protein LOC286262 isoform 2	551					sensory perception of sound	stereocilium					0						ACCTCGATCTCATGCACGGTG	0.647													15	50	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7621922	7621922	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7621922G>A	uc001ijq.2	-	9	1293	c.1214C>T	c.(1213-1215)ACG>ATG	p.T405M	ITIH5_uc001ijp.2_Missense_Mutation_p.T191M|ITIH5_uc001ijr.1_Missense_Mutation_p.T405M	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	405	VWFA.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						CTTCCCATCCGTCAGGAAGAC	0.617													9	38	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29762860	29762860	+	Silent	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29762860G>C	uc001iut.1	-	30	6189	c.5436C>G	c.(5434-5436)GTC>GTG	p.V1812V	LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Silent_p.V726V|SVIL_uc001iuu.1_Silent_p.V1386V	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1812	Gelsolin-like 3.				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				AGAAGAAGTAGACGCACTTCT	0.617													10	29	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37431083	37431083	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37431083G>C	uc001iza.1	+	7	1189	c.1090G>C	c.(1090-1092)GAG>CAG	p.E364Q		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	420						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						GATCGCATGGGAGAAAAAAGA	0.393													13	61	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37431223	37431223	+	Intron	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37431223G>A	uc001iza.1	+							NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						CCAATGGTAAGATGCTAGAGC	0.348													7	36	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50948750	50948750	+	Intron	SNP	A	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50948750A>T	uc001jie.2	-						OGDHL_uc009xog.2_Intron|OGDHL_uc010qgt.1_Intron|OGDHL_uc010qgu.1_Intron	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a						glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						GAGAGCGTGGACCCACCCAGG	0.662													3	26	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61835654	61835654	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61835654G>C	uc001jky.2	-	37	5177	c.4985C>G	c.(4984-4986)TCA>TGA	p.S1662*	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1662	Ser-rich.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TGTAATAATTGACTTAAATGG	0.398													23	94	---	---	---	---	PASS
CAMK2G	818	broad.mit.edu	37	10	75608805	75608805	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75608805G>A	uc001jvv.1	-	7	583	c.459C>T	c.(457-459)GCC>GCT	p.A153A	CAMK2G_uc001jvm.1_Silent_p.A161A|CAMK2G_uc001jvo.1_Silent_p.A161A|CAMK2G_uc001jvq.1_Silent_p.A161A|CAMK2G_uc001jvr.1_Silent_p.A161A|CAMK2G_uc001jvp.1_Silent_p.A161A|CAMK2G_uc001jvs.1_Silent_p.A161A|CAMK2G_uc001jvt.1_RNA|CAMK2G_uc001jvu.1_Silent_p.A139A|CAMK2G_uc010qkv.1_Intron	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II	161	Protein kinase.				insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					GTACTTCGATGGCTAGGCCAA	0.567											OREG0020267	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	85	---	---	---	---	PASS
CEND1	51286	broad.mit.edu	37	11	788486	788486	+	Missense_Mutation	SNP	C	T	T	rs149620345		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:788486C>T	uc001lrh.1	-	2	270	c.91G>A	c.(91-93)GAT>AAT	p.D31N		NM_016564	NP_057648	Q8N111	CEND_HUMAN	cell cycle exit and neuronal differentiation 1	31	Cytoplasmic (Potential).					integral to membrane					0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTTTCCCATCGGCTGCCGGG	0.687													10	50	---	---	---	---	PASS
MRVI1	10335	broad.mit.edu	37	11	10622540	10622540	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10622540C>G	uc010rcc.1	-	15	2328	c.1942G>C	c.(1942-1944)GAG>CAG	p.E648Q	MRVI1_uc001miw.2_Missense_Mutation_p.E639Q|MRVI1_uc010rcb.1_Missense_Mutation_p.E640Q|MRVI1_uc009ygb.1_Missense_Mutation_p.E333Q|MRVI1_uc001mix.2_Missense_Mutation_p.E333Q|MRVI1_uc001miz.2_Missense_Mutation_p.E557Q|MRVI1_uc009ygc.1_Missense_Mutation_p.E557Q|MRVI1_uc010rcd.1_Missense_Mutation_p.E442Q|MRVI1_uc009ygd.1_Missense_Mutation_p.E333Q|MRVI1_uc010rce.1_RNA	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c	621					platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		TGGTCCTTCTCATACGTCCTC	0.522													59	206	---	---	---	---	PASS
ALX4	60529	broad.mit.edu	37	11	44289058	44289058	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44289058C>T	uc001myb.2	-	3	996	c.892G>A	c.(892-894)GAG>AAG	p.E298K		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	298					hair follicle development						0						GCGTAGTTCTCAGCTCGGGTG	0.642													5	39	---	---	---	---	PASS
CHST1	8534	broad.mit.edu	37	11	45671568	45671568	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45671568G>A	uc001mys.1	-	4	1577	c.906C>T	c.(904-906)TAC>TAT	p.Y302Y		NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	302	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		CCAGGTCCTCGTAGCGCACCA	0.622													11	73	---	---	---	---	PASS
CRY2	1408	broad.mit.edu	37	11	45882477	45882477	+	Silent	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45882477C>A	uc010rgn.1	+	4	631	c.609C>A	c.(607-609)CCC>CCA	p.P203P	CRY2_uc009ykw.2_Silent_p.P121P|CRY2_uc010rgo.1_5'Flank	NM_021117	NP_066940	Q49AN0	CRY2_HUMAN	cryptochrome 2 (photolyase-like) isoform 1	182	DNA photolyase.				DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	blue light photoreceptor activity|damaged DNA binding|DNA photolyase activity|nucleotide binding|protein binding|single-stranded DNA binding			central_nervous_system(1)	1						TGGAGCTGCCCAAGAAGCCAG	0.602													6	24	---	---	---	---	PASS
MED17	9440	broad.mit.edu	37	11	93523779	93523779	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93523779C>G	uc001pem.3	+	3	732	c.457C>G	c.(457-459)CTT>GTT	p.L153V		NM_004268	NP_004259	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	153					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AAAGAAGTCACTTGCTGGAGC	0.373													6	127	---	---	---	---	PASS
JRKL	8690	broad.mit.edu	37	11	96124074	96124074	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96124074C>G	uc009ywu.2	+	2	513	c.261C>G	c.(259-261)TTC>TTG	p.F87L	CCDC82_uc001pfx.3_5'Flank|CCDC82_uc009ywr.2_5'Flank|CCDC82_uc009ywt.1_5'Flank|JRKL_uc001pfy.2_Missense_Mutation_p.F87L	NM_003772	NP_003763	Q9Y4A0	JERKL_HUMAN	jerky homolog-like	87	HTH CENPB-type.				central nervous system development|regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		TGGAATGGTTCAACCAGCAAA	0.428													9	107	---	---	---	---	PASS
H2AFX	3014	broad.mit.edu	37	11	118965672	118965672	+	3'UTR	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118965672C>G	uc001pvg.2	-	1					H2AFX_uc001pvh.1_RNA	NM_002105	NP_002096	P16104	H2AX_HUMAN	H2A histone family, member X						DNA damage checkpoint|double-strand break repair via homologous recombination|meiosis|nucleosome assembly|positive regulation of DNA repair|response to ionizing radiation	nucleoplasm|nucleosome	DNA binding|enzyme binding|histone binding				0	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		cgcgggcccTCTTAGTACTCC	0.577								Chromatin_Structure|Direct_reversal_of_damage			OREG0021395	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	18	---	---	---	---	PASS
H2AFX	3014	broad.mit.edu	37	11	118965703	118965703	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118965703C>G	uc001pvg.2	-	1	475	c.402G>C	c.(400-402)AAG>AAC	p.K134N	H2AFX_uc001pvh.1_RNA	NM_002105	NP_002096	P16104	H2AX_HUMAN	H2A histone family, member X	134					DNA damage checkpoint|double-strand break repair via homologous recombination|meiosis|nucleosome assembly|positive regulation of DNA repair|response to ionizing radiation	nucleoplasm|nucleosome	DNA binding|enzyme binding|histone binding				0	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		GGGTGGCCTTCTTGCCGCCCG	0.587								Chromatin_Structure|Direct_reversal_of_damage			OREG0021395	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	26	---	---	---	---	PASS
C2CD2L	9854	broad.mit.edu	37	11	118983583	118983583	+	Silent	SNP	A	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118983583A>G	uc001pvo.2	+	10	1745	c.1386A>G	c.(1384-1386)TTA>TTG	p.L462L	C2CD2L_uc001pvn.2_Silent_p.L462L	NM_014807	NP_055622	O14523	C2C2L_HUMAN	transmembrane protein 24	462						integral to membrane					0						ACGGCAAATTAGGTAAAGAGA	0.567													3	38	---	---	---	---	PASS
HSN2	378465	broad.mit.edu	37	12	977921	977921	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:977921G>A	uc001qiq.2	+	1	1052	c.926G>A	c.(925-927)GGA>GAA	p.G309E	WNK1_uc001qio.3_Intron|WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_Intron	NM_213655	NP_998820			hereditary sensory neuropathy, type II												0	all_cancers(10;0.0107)|all_epithelial(11;0.0151)|Ovarian(42;0.0512)|all_lung(10;0.0521)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.000967)|BRCA - Breast invasive adenocarcinoma(9;0.0178)			CAATCAGTTGGATTACATGGC	0.473													15	69	---	---	---	---	PASS
KRT2	3849	broad.mit.edu	37	12	53038879	53038879	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53038879C>T	uc001sat.2	-	9	1877	c.1844G>A	c.(1843-1845)GGA>GAA	p.G615E		NM_000423	NP_000414	P35908	K22E_HUMAN	keratin 2	615	Tail.				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.19)		ACCCCCACCTCCAGAGCCATA	0.552													24	107	---	---	---	---	PASS
OBFC2B	79035	broad.mit.edu	37	12	56618691	56618691	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56618691G>A	uc001ski.2	+	2	175	c.51G>A	c.(49-51)CTG>CTA	p.L17L	OBFC2B_uc001skk.2_Silent_p.L42L|OBFC2B_uc001skj.2_Silent_p.L33L|RNF41_uc001ske.1_5'Flank|RNF41_uc001skf.1_5'Flank|RNF41_uc001skg.1_5'Flank|RNF41_uc010sqg.1_5'Flank|RNF41_uc010sqh.1_5'Flank|RNF41_uc001skh.2_5'Flank	NM_024068	NP_076973	Q9BQ15	SOSB1_HUMAN	oligonucleotide/oligosaccharide-binding fold	17					double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	protein binding|single-stranded DNA binding			ovary(1)	1						TCAAGAATCTGAACCTTATCT	0.577								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function			OREG0021922	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	68	---	---	---	---	PASS
R3HDM2	22864	broad.mit.edu	37	12	57677635	57677635	+	Silent	SNP	G	A	A	rs139077619		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57677635G>A	uc009zpm.1	-	11	1136	c.1101C>T	c.(1099-1101)GGC>GGT	p.G367G	R3HDM2_uc010srn.1_RNA|R3HDM2_uc001snu.2_Silent_p.G28G|R3HDM2_uc001snr.2_Silent_p.G94G|R3HDM2_uc001sns.2_Silent_p.G367G|R3HDM2_uc001snt.2_Silent_p.G381G	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	367	Ser-rich.					nucleus	nucleic acid binding			ovary(2)	2						CCGCACTGCCGCCTTTACTGC	0.522													24	150	---	---	---	---	PASS
MDM1	56890	broad.mit.edu	37	12	68709007	68709007	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68709007G>A	uc001stz.2	-	9	1356	c.1220C>T	c.(1219-1221)TCT>TTT	p.S407F	MDM1_uc010stc.1_Missense_Mutation_p.S372F|MDM1_uc009zqv.1_Missense_Mutation_p.S127F	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1	407						nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TGGTTCTGTAGAAGGACATTT	0.393													30	139	---	---	---	---	PASS
BEST3	144453	broad.mit.edu	37	12	70048731	70048731	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70048731C>G	uc001svg.2	-	10	2190	c.1963G>C	c.(1963-1965)GAT>CAT	p.D655H	BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.D442H|BEST3_uc010stm.1_Missense_Mutation_p.D549H	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	655	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			TCTATGATATCTGTTTCCTTG	0.448													14	66	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85450557	85450557	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85450557T>G	uc001tac.2	+	8	2097	c.1986T>G	c.(1984-1986)GAT>GAG	p.D662E	LRRIQ1_uc001tab.1_Missense_Mutation_p.D662E|LRRIQ1_uc001taa.1_Missense_Mutation_p.D637E	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	662										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		ACACAACTGATACCATGATAA	0.338													5	71	---	---	---	---	PASS
NFYB	4801	broad.mit.edu	37	12	104522200	104522200	+	Splice_Site	SNP	A	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104522200A>T	uc001tkl.1	-	3	301	c.100_splice	c.e3+1	p.D34_splice	NFYB_uc001tkk.1_Splice_Site_p.D32_splice	NM_006166	NP_006157	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta							CCAAT-binding factor complex	repressing transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						TGGCTTGCTTACCATCATGAG	0.378													9	49	---	---	---	---	PASS
PHF11	51131	broad.mit.edu	37	13	50097352	50097352	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50097352G>A	uc001vdb.2	+	7	949	c.612G>A	c.(610-612)GTG>GTA	p.V204V	PHF11_uc001vdc.2_Silent_p.V165V|PHF11_uc001vdd.2_RNA	NM_001040443	NP_001035533	Q9UIL8	PHF11_HUMAN	PHD finger protein 11 isoform a	204					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		TAAGACAAGTGAAAGAAGAGC	0.348													8	48	---	---	---	---	PASS
DHRS12	79758	broad.mit.edu	37	13	52346018	52346018	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52346018C>T	uc001vfq.2	-	8	693	c.645G>A	c.(643-645)TGG>TGA	p.W215*	DHRS12_uc001vfr.1_Nonsense_Mutation_p.W166*|DHRS12_uc001vfs.1_Nonsense_Mutation_p.W166*			A0PJE2	DHR12_HUMAN	RecName: Full=Dehydrogenase/reductase SDR family member 12;          EC=1.1.-.-;	215							binding|oxidoreductase activity				0		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		GCCCTTGGGCCCACCGCTCCG	0.587													19	67	---	---	---	---	PASS
THSD1	55901	broad.mit.edu	37	13	52952233	52952233	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52952233C>T	uc001vgo.2	-	5	2417	c.1872G>A	c.(1870-1872)CTG>CTA	p.L624L	THSD1_uc001vgp.2_Silent_p.L571L|THSD1_uc010tgz.1_Silent_p.L245L|THSD1_uc010aea.2_Silent_p.L85L	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1	624	Cytoplasmic (Potential).					extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		ACTTGCGGATCAGAGTCTGGC	0.622													9	52	---	---	---	---	PASS
MCF2L	23263	broad.mit.edu	37	13	113729377	113729377	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113729377C>T	uc001vsu.2	+	11	1375	c.1353C>T	c.(1351-1353)TAC>TAT	p.Y451Y	MCF2L_uc001vsq.2_Silent_p.Y451Y|MCF2L_uc010tjr.1_Silent_p.Y394Y|MCF2L_uc001vsr.2_Silent_p.Y398Y|MCF2L_uc001vss.3_Silent_p.Y392Y|MCF2L_uc010tjs.1_Silent_p.Y392Y|MCF2L_uc001vst.1_Silent_p.Y356Y	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming	424	Spectrin.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				ACAAGCACTACGCGGTAGACT	0.657													18	65	---	---	---	---	PASS
COCH	1690	broad.mit.edu	37	14	31358871	31358871	+	Silent	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31358871G>C	uc001wqr.2	+	12	1607	c.1527G>C	c.(1525-1527)CTG>CTC	p.L509L	COCH_uc001wqp.2_Silent_p.L509L|COCH_uc001wqq.3_Intron|uc001wqs.2_RNA|COCH_uc001wqt.1_Silent_p.L360L	NM_004086	NP_004077	O43405	COCH_HUMAN	cochlin precursor	509	VWFA 2.				sensory perception of sound	proteinaceous extracellular matrix				pancreas(1)|central_nervous_system(1)|skin(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TGGATGACCTGAAAGATATGG	0.388													7	56	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63473102	63473102	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63473102G>A	uc001xfx.2	-	3	337	c.286C>T	c.(286-288)CTT>TTT	p.L96F	KCNH5_uc001xfy.2_Missense_Mutation_p.L96F|KCNH5_uc001xfz.1_Missense_Mutation_p.L38F|KCNH5_uc001xga.2_Missense_Mutation_p.L38F	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	96	PAC.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TTGTACAGAAGAACTTCAAAG	0.353													13	61	---	---	---	---	PASS
NEK9	91754	broad.mit.edu	37	14	75580938	75580938	+	Silent	SNP	A	G	G	rs146775388		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75580938A>G	uc001xrl.2	-	7	995	c.841T>C	c.(841-843)TTG>CTG	p.L281L	NEK9_uc001xrk.2_5'UTR	NM_033116	NP_149107	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	281	Protein kinase.				cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(2)|stomach(2)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00718)		ATTTGGATCAATTCCAAAGAG	0.448													3	50	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102516087	102516087	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102516087G>A	uc001yks.2	+	76	13716	c.13552G>A	c.(13552-13554)GAG>AAG	p.E4518K		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	4518					cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GTTCGTGCCTGAGGCGTACAT	0.627													17	35	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28515957	28515957	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28515957G>C	uc001zbj.2	-	10	1247	c.1141C>G	c.(1141-1143)CAA>GAA	p.Q381E	HERC2_uc001zbl.1_Missense_Mutation_p.Q76E	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	381					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCGTTGTCTTGTGGAAGGGTG	0.498													8	23	---	---	---	---	PASS
LTK	4058	broad.mit.edu	37	15	41797683	41797683	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41797683G>A	uc001zoa.3	-	14	1921	c.1743C>T	c.(1741-1743)CTC>CTT	p.L581L	LTK_uc001zob.3_Silent_p.L520L|LTK_uc010ucx.1_Silent_p.L451L|LTK_uc010bcg.2_Silent_p.L279L	NM_002344	NP_002335	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase isoform 1	581	Protein kinase.|Cytoplasmic (Potential).				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|central_nervous_system(1)	7		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		GGGTGGCCCTGAGGCTGAGCC	0.572										TSP Lung(18;0.14)			8	32	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48058194	48058194	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058194G>T	uc010bek.2	+	14	1916	c.1556G>T	c.(1555-1557)GGA>GTA	p.G519V	SEMA6D_uc001zvw.2_Missense_Mutation_p.G519V|SEMA6D_uc001zvy.2_Missense_Mutation_p.G519V|SEMA6D_uc001zvz.2_Missense_Mutation_p.G519V|SEMA6D_uc001zwa.2_Missense_Mutation_p.G519V|SEMA6D_uc001zwb.2_Missense_Mutation_p.G519V|SEMA6D_uc001zwc.2_Missense_Mutation_p.G519V	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	519	PSI.|Extracellular (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GAGCGTTATGGATCATGTAAA	0.418													5	108	---	---	---	---	PASS
SLC27A2	11001	broad.mit.edu	37	15	50526076	50526076	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50526076C>T	uc001zxw.2	+	9	1799	c.1567C>T	c.(1567-1569)CGC>TGC	p.R523C	SLC27A2_uc010bes.2_Missense_Mutation_p.R470C|SLC27A2_uc001zxx.2_Missense_Mutation_p.R288C	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	523	Cytoplasmic (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		TCATGAGGGTCGCATTGGCAT	0.368													13	54	---	---	---	---	PASS
LINGO1	84894	broad.mit.edu	37	15	77906661	77906661	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77906661C>T	uc002bct.1	-	2	1640	c.1588G>A	c.(1588-1590)GCT>ACT	p.A530T	LINGO1_uc002bcu.1_Missense_Mutation_p.A524T	NM_032808	NP_116197	Q96FE5	LIGO1_HUMAN	leucine-rich repeat neuronal 6A	530	Extracellular (Potential).				negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2						GAGATGAAAGCGAAGGTCTTG	0.647													4	55	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85326241	85326241	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85326241C>T	uc002bld.2	+	4	671	c.335C>T	c.(334-336)TCT>TTT	p.S112F	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	112					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AAATTTGATTCTACTTTTATG	0.498													21	95	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16180761	16180761	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16180761C>T	uc010bvi.2	+	18	2548	c.2373C>T	c.(2371-2373)TTC>TTT	p.F791F	ABCC1_uc010bvj.2_Silent_p.F732F|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Silent_p.F791F|ABCC1_uc010bvm.2_Intron|ABCC1_uc002del.3_Silent_p.F675F	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	791	ABC transporter 1.|Cytoplasmic.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	TTTACCTCTTCGATGATCCCC	0.582													27	85	---	---	---	---	PASS
SEZ6L2	26470	broad.mit.edu	37	16	29899991	29899991	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29899991C>T	uc002duq.3	-	6	1149	c.909G>A	c.(907-909)GTG>GTA	p.V303V	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Silent_p.V233V|SEZ6L2_uc002dur.3_Silent_p.V233V|SEZ6L2_uc002dus.3_Silent_p.V189V|SEZ6L2_uc010vec.1_Silent_p.V303V|SEZ6L2_uc010ved.1_Silent_p.V259V	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	303	Sushi 1.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						GCAGGTCCGTCACACTCACGT	0.647													5	48	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69874086	69874086	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69874086C>T	uc002exu.1	+	6	487	c.398C>T	c.(397-399)TCA>TTA	p.S133L	WWP2_uc002ext.2_Missense_Mutation_p.S133L|WWP2_uc002exv.1_Missense_Mutation_p.S133L|WWP2_uc010vlm.1_Missense_Mutation_p.S17L	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	133					entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						AGCGTTGTCTCAGGCGGAGAG	0.547													14	75	---	---	---	---	PASS
FLCN	201163	broad.mit.edu	37	17	17131259	17131259	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17131259C>G	uc002gra.3	-	4	697	c.193G>C	c.(193-195)GAG>CAG	p.E65Q	PLD6_uc010cpn.2_Intron|FLCN_uc002grb.3_Missense_Mutation_p.E65Q|FLCN_uc002grc.2_Missense_Mutation_p.E65Q	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN	folliculin isoform 1	65					regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						CTGGCCCCCTCTGCGGGGCTG	0.607									Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer				6	62	---	---	---	---	PASS
CDK12	51755	broad.mit.edu	37	17	37627763	37627763	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37627763C>T	uc010cvv.2	+	2	2264	c.1678C>T	c.(1678-1680)CTT>TTT	p.L560F	CDK12_uc010wef.1_Missense_Mutation_p.L559F|CDK12_uc002hrw.3_Missense_Mutation_p.L560F	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	560					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						AATACCAGCTCTTCCACAGCA	0.537										TCGA Ovarian(9;0.13)			49	211	---	---	---	---	PASS
ACLY	47	broad.mit.edu	37	17	40070105	40070105	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40070105C>G	uc002hyg.2	-	2	185	c.22G>C	c.(22-24)GAG>CAG	p.E8Q	ACLY_uc002hyh.2_Missense_Mutation_p.E8Q|ACLY_uc002hyi.2_Missense_Mutation_p.E62Q|ACLY_uc010wfx.1_Missense_Mutation_p.E62Q|ACLY_uc010wfy.1_Missense_Mutation_p.E8Q	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1	8					ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				CCCGTCTGCTCTGAAATTGCC	0.547													27	123	---	---	---	---	PASS
TMC6	11322	broad.mit.edu	37	17	76120084	76120084	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76120084G>A	uc002juj.1	-	8	1194	c.1068C>T	c.(1066-1068)ATC>ATT	p.I356I	TMC6_uc002jui.1_5'Flank|TMC6_uc010dhf.1_Silent_p.I189I|TMC6_uc002juk.2_Silent_p.I356I|TMC6_uc010dhg.1_Silent_p.I356I|TMC6_uc002jul.1_Silent_p.I356I|TMC6_uc002jum.3_Silent_p.I147I|TMC6_uc002jun.3_Silent_p.I356I|TMC6_uc002juo.2_Silent_p.I129I	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	356	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			ACACCAGGGTGATGCAGGTGA	0.453									Epidermodysplasia_Verruciformis_Familial_Clustering_of				9	52	---	---	---	---	PASS
TMC6	11322	broad.mit.edu	37	17	76120120	76120120	+	Silent	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76120120G>C	uc002juj.1	-	8	1158	c.1032C>G	c.(1030-1032)CTC>CTG	p.L344L	TMC6_uc002jui.1_5'Flank|TMC6_uc010dhf.1_Silent_p.L177L|TMC6_uc002juk.2_Silent_p.L344L|TMC6_uc010dhg.1_Silent_p.L344L|TMC6_uc002jul.1_Silent_p.L344L|TMC6_uc002jum.3_Silent_p.L135L|TMC6_uc002jun.3_Silent_p.L344L|TMC6_uc002juo.2_Silent_p.L117L	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	344	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CCACAGTGGAGAGGTAGGCCA	0.577									Epidermodysplasia_Verruciformis_Familial_Clustering_of				13	50	---	---	---	---	PASS
BAIAP2	10458	broad.mit.edu	37	17	79073865	79073865	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79073865G>A	uc002jzg.2	+	7	735	c.627G>A	c.(625-627)GCG>GCA	p.A209A	BAIAP2_uc002jyz.3_Silent_p.A209A|BAIAP2_uc002jza.2_Silent_p.A209A|BAIAP2_uc002jzc.2_Silent_p.A209A|BAIAP2_uc002jzb.2_5'UTR|BAIAP2_uc002jzd.2_Silent_p.A209A|BAIAP2_uc002jzf.2_Silent_p.A209A|BAIAP2_uc002jze.2_Silent_p.A242A|BAIAP2_uc010wuh.1_Silent_p.A131A|BAIAP2_uc002jzh.2_Silent_p.A210A|BAIAP2_uc010wui.1_Silent_p.A72A	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2	209	IMD.				axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AGAACTCCGCGGCCTACCACT	0.672													3	25	---	---	---	---	PASS
ARHGDIA	396	broad.mit.edu	37	17	79827245	79827245	+	Silent	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79827245C>A	uc002kbp.2	-	3	351	c.312G>T	c.(310-312)CTG>CTT	p.L104L	ARHGDIA_uc002kjk.1_5'UTR|ARHGDIA_uc002kbq.2_Silent_p.L104L|ARHGDIA_uc002kbr.2_Silent_p.L104L|ARHGDIA_uc002kbs.1_Intron|ARHGDIA_uc002kbt.1_Silent_p.L104L|ARHGDIA_uc010dig.1_Intron	NM_004309	NP_004300	P52565	GDIR1_HUMAN	Rho GDP dissociation inhibitor (GDI) alpha	104					anti-apoptosis|cellular component movement|negative regulation of axonogenesis|negative regulation of cell adhesion|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoskeleton|cytosol	GTPase activator activity|identical protein binding|Rho GDP-dissociation inhibitor activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CACCCTCCTTCAGCACAAACG	0.637													19	107	---	---	---	---	PASS
B3GNTL1	146712	broad.mit.edu	37	17	80963069	80963069	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80963069C>T	uc002kgg.1	-	6	440	c.426G>A	c.(424-426)GTG>GTA	p.V142V	B3GNTL1_uc002kgf.1_Silent_p.V31V|B3GNTL1_uc002kge.1_RNA	NM_001009905	NP_001009905	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal	142							transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			GATCTCTCCTCACTCTGCAAC	0.532													11	38	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43532381	43532381	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43532381G>A	uc002lbm.2	-	3	1337	c.1237C>T	c.(1237-1239)CAC>TAC	p.H413Y	KIAA1632_uc002lbo.1_Missense_Mutation_p.H413Y	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	413					autophagy						0						CCTTGCTGGTGAATTGCTGAA	0.403													40	63	---	---	---	---	PASS
CDH19	28513	broad.mit.edu	37	18	64172548	64172548	+	Intron	SNP	G	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64172548G>T	uc002lkc.1	-						CDH19_uc010dql.1_Intron|CDH19_uc010xey.1_Intron	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				CCCTGATGAAGAAAGCACATC	0.299													15	75	---	---	---	---	PASS
SH3GL1	6455	broad.mit.edu	37	19	4362616	4362616	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4362616C>G	uc002maj.2	-	8	952	c.846G>C	c.(844-846)AAG>AAC	p.K282N	SH3GL1_uc002mak.2_Missense_Mutation_p.K218N|SH3GL1_uc010xig.1_Missense_Mutation_p.K234N	NM_003025	NP_003016	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	282					central nervous system development|endocytosis|signal transduction	early endosome membrane	lipid binding|protein binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		TACCTGCGATCTTGGGGGCTG	0.652			T	MLL	AL								5	38	---	---	---	---	PASS
FBXW9	84261	broad.mit.edu	37	19	12805444	12805444	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12805444G>C	uc010dyx.2	-	3	612	c.612C>G	c.(610-612)ATC>ATG	p.I204M	FBXW9_uc010xmp.1_RNA|FBXW9_uc002mum.1_Missense_Mutation_p.I214M|FBXW9_uc002mun.1_Missense_Mutation_p.I51M	NM_032301	NP_115677	Q5XUX1	FBXW9_HUMAN	F-box and WD-40 domain protein 9	214							protein binding			ovary(1)	1						CTAAGGTCTTGATCAGAACCT	0.498													6	32	---	---	---	---	PASS
ZNF568	374900	broad.mit.edu	37	19	37441146	37441146	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37441146G>A	uc002ofc.2	+	7	1606	c.1091G>A	c.(1090-1092)TGT>TAT	p.C364Y	ZNF568_uc010efg.2_Intron|ZNF568_uc010xtn.1_Intron|ZNF568_uc002ofd.2_Missense_Mutation_p.C288Y|ZNF568_uc010efe.2_Missense_Mutation_p.C288Y|ZNF568_uc010eff.1_Intron	NM_198539	NP_940941	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	364	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCTTATGCATGTAATGAATGT	0.383													13	109	---	---	---	---	PASS
ETHE1	23474	broad.mit.edu	37	19	44030500	44030500	+	Silent	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44030500C>A	uc002owp.2	-	3	295	c.228G>T	c.(226-228)GTG>GTT	p.V76V	ZNF575_uc002owq.2_Intron|ETHE1_uc010eiu.1_Silent_p.V76V	NM_014297	NP_055112	O95571	ETHE1_HUMAN	ETHE1 protein precursor	76						mitochondrial matrix|nucleus	hydrolase activity|metal ion binding				0		Prostate(69;0.0153)				AGTGGGTATTCACTGGGAGAG	0.453													3	21	---	---	---	---	PASS
C20orf132	140699	broad.mit.edu	37	20	35748155	35748155	+	Silent	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35748155G>C	uc010zvu.1	-	20	2437	c.2346C>G	c.(2344-2346)CTC>CTG	p.L782L	C20orf132_uc002xgk.2_Silent_p.L404L	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1	341											0		Myeloproliferative disorder(115;0.00878)				GAATTCTAAAGAGATGATTTC	0.468													17	65	---	---	---	---	PASS
DHX35	60625	broad.mit.edu	37	20	37597864	37597864	+	Intron	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37597864C>A	uc002xjh.2	+						DHX35_uc010zwa.1_Intron|DHX35_uc010zwb.1_Intron|DHX35_uc010zwc.1_Intron	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35							catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				CAAGGTACGTCAAATAATCAT	0.473													5	59	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44665958	44665958	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44665958C>T	uc010zxl.1	+	6	691	c.615C>T	c.(613-615)CTC>CTT	p.L205L	SLC12A5_uc002xra.2_Silent_p.L182L|SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Silent_p.L182L	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	205	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCGTGGGCCTCTGCTTCTACC	0.587													5	29	---	---	---	---	PASS
HLCS	3141	broad.mit.edu	37	21	38302646	38302646	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38302646C>T	uc010gnb.2	-	5	2285	c.1084G>A	c.(1084-1086)GAA>AAA	p.E362K	HLCS_uc002yvs.2_Missense_Mutation_p.E362K|HLCS_uc010gnc.1_Missense_Mutation_p.E509K	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase	362					cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CTAAGGACTTCGTATCTTCTA	0.458													4	61	---	---	---	---	PASS
KRTAP10-3	386682	broad.mit.edu	37	21	45978218	45978218	+	Silent	SNP	G	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45978218G>A	uc002zfj.1	-	1	426	c.381C>T	c.(379-381)CCC>CCT	p.P127P	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198696	NP_941969	P60369	KR103_HUMAN	keratin associated protein 10-3	127	18 X 5 AA repeats of C-C-X(3).|12.					keratin filament				skin(1)	1						CAGAgcagacgggcacacagc	0.308													4	114	---	---	---	---	PASS
XKR3	150165	broad.mit.edu	37	22	17288683	17288683	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17288683C>G	uc002zlv.2	-	2	379	c.281G>C	c.(280-282)AGA>ACA	p.R94T	XKR3_uc011agf.1_Missense_Mutation_p.R94T	NM_175878	NP_787074	Q5GH77	XKR3_HUMAN	X Kell blood group precursor-related family,	94						integral to membrane|plasma membrane				large_intestine(1)|ovary(1)|skin(1)	3	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				AGCCTTATTTCTCCTCAAGTC	0.358													18	122	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22712567	22712567	+	RNA	SNP	G	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22712567G>T	uc011aim.1	+	41		c.4355G>T								Parts of antibodies, mostly variable regions.												0						CGAGGATGAGGCTGATTATTA	0.597													24	130	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	C	C	rs142470496	byFrequency	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091840T>C	uc003adu.1	-	11	1189	c.1117A>G	c.(1117-1119)AAG>GAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				4	65	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	A	A	rs146546850	byFrequency	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091841G>A	uc003adu.1	-	11	1188	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	372	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				4	65	---	---	---	---	PASS
DRG1	4733	broad.mit.edu	37	22	31823084	31823084	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31823084C>T	uc003aku.2	+	8	1051	c.920C>T	c.(919-921)TCC>TTC	p.S307F		NM_004147	NP_004138	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	307					multicellular organismal development|transcription, DNA-dependent	cytoplasm|intermediate filament cytoskeleton|nucleus	GTP binding|transcription factor binding			central_nervous_system(1)	1						GATTACACATCCCCAGTGGTG	0.398													40	153	---	---	---	---	PASS
NHP2L1	4809	broad.mit.edu	37	22	42071172	42071172	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42071172G>C	uc003bat.2	-	3	346	c.152C>G	c.(151-153)TCT>TGT	p.S51C	NHP2L1_uc003bau.2_Missense_Mutation_p.S51C|NHP2L1_uc003bav.2_Missense_Mutation_p.S51C|NHP2L1_uc003baw.2_Missense_Mutation_p.S51C	NM_005008	NP_004999	P55769	NH2L1_HUMAN	NHP2 non-histone chromosome protein 2-like 1	51					nuclear mRNA splicing, via spliceosome|ribosome biogenesis	box C/D snoRNP complex|nucleoplasm|spliceosomal complex	protein binding|RNA binding				0						GATGAACTCAGAGATGCCCCT	0.557													9	70	---	---	---	---	PASS
SAPS2	9701	broad.mit.edu	37	22	50876597	50876597	+	Intron	SNP	C	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50876597C>G	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron|SAPS2_uc003bld.1_Intron	NM_014678	NP_055493	O75170	PP6R2_HUMAN	SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)		GCGTTTTACTCTGCAGCCCAG	0.602													22	100	---	---	---	---	PASS
ACR	49	broad.mit.edu	37	22	51183146	51183146	+	Silent	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51183146C>T	uc003bnh.3	+	5	789	c.777C>T	c.(775-777)ATC>ATT	p.I259I		NM_001097	NP_001088	P10323	ACRO_HUMAN	acrosin precursor	259	Peptidase S1.				acrosome matrix dispersal|activation of adenylate cyclase activity	acrosomal matrix|protein complex	amidase activity|copper ion binding|DNA binding|drug binding|fucose binding|mannose binding|protein binding|serine-type endopeptidase activity|zinc ion binding				0		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		TCGTGGGAATCACAAGCTGGG	0.592													5	21	---	---	---	---	PASS
CFP	5199	broad.mit.edu	37	X	47485863	47485863	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47485863C>T	uc004dig.3	-	7	1122	c.996G>A	c.(994-996)ATG>ATA	p.M332I	CFP_uc004dih.2_Missense_Mutation_p.M332I|CFP_uc004dii.1_Missense_Mutation_p.M268I|CFP_uc010nhu.2_Missense_Mutation_p.M332I	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor	332	TSP type-1 5.				complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						TGATGGACTTCATGTTCCGTC	0.612													8	29	---	---	---	---	PASS
ALAS2	212	broad.mit.edu	37	X	55039934	55039934	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55039934T>A	uc004dua.3	-	10	1723	c.1585A>T	c.(1585-1587)ATG>TTG	p.M529L	ALAS2_uc004dub.3_Missense_Mutation_p.M516L|ALAS2_uc004dud.3_Missense_Mutation_p.M492L	NM_000032	NP_000023	P22557	HEM0_HUMAN	5-aminolevulinate synthase 2 isoform a	529					cellular iron ion homeostasis|erythrocyte differentiation|heme biosynthetic process|hemoglobin biosynthetic process|oxygen homeostasis|response to hypoxia	mitochondrial inner membrane|mitochondrial matrix	5-aminolevulinate synthase activity|coenzyme binding|glycine binding|protein binding|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(1)	1					Glycine(DB00145)	AAATCTTCCATCATCTGAGGG	0.572													4	48	---	---	---	---	PASS
KIF4A	24137	broad.mit.edu	37	X	69626750	69626750	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69626750C>A	uc004dyg.2	+	28	3207	c.3080C>A	c.(3079-3081)CCT>CAT	p.P1027H	KIF4A_uc010nkw.2_Missense_Mutation_p.P1027H	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	1027	Globular.|Interaction with PRC1.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						TAGCCAAAACCTTCTCGTGTT	0.308													4	53	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70348264	70348264	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70348264T>C	uc004dyy.2	+	23	3527	c.3328T>C	c.(3328-3330)TTC>CTC	p.F1110L	MED12_uc011mpq.1_Missense_Mutation_p.F1110L|MED12_uc004dyz.2_Missense_Mutation_p.F1110L|MED12_uc004dza.2_Missense_Mutation_p.F957L|MED12_uc010nla.2_5'Flank	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1110					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					CACTTGTGGTTTCAACGATCT	0.547													38	165	---	---	---	---	PASS
ARMCX2	9823	broad.mit.edu	37	X	100911645	100911645	+	Silent	SNP	G	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100911645G>T	uc004eid.2	-	3	1285	c.930C>A	c.(928-930)GGC>GGA	p.G310G	ARMCX2_uc004eie.3_Silent_p.G310G|ARMCX2_uc004eif.3_Silent_p.G310G|ARMCX2_uc004eig.3_Silent_p.G310G|ARMCX2_uc010nnt.2_Silent_p.G310G	NM_177949	NP_808818	Q7L311	ARMX2_HUMAN	ALEX2 protein	310						integral to membrane	binding			ovary(6)	6						CAGGACGGAAGCCCATCCCCA	0.597													23	135	---	---	---	---	PASS
H2BFWT	158983	broad.mit.edu	37	X	103268225	103268225	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103268225C>T	uc004elr.2	-	1	32	c.8G>A	c.(7-9)CGT>CAT	p.R3H		NM_001002916	NP_001002916	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	3					nucleosome assembly	nuclear membrane|nucleosome	DNA binding			ovary(1)	1						CACTTCGGTACGCAGCATGGC	0.607													9	18	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118974646	118974646	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118974646A>C	uc004erz.1	-	8	886	c.809T>G	c.(808-810)GTA>GGA	p.V270G	UPF3B_uc004esa.1_Intron	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	270	Sufficient for association with EJC core.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						AAACCTGTGTACCTGAAGACA	0.383													4	85	---	---	---	---	PASS
FAM127B	26071	broad.mit.edu	37	X	134185818	134185818	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134185818C>A	uc004eyf.2	-	1	404	c.321G>T	c.(319-321)TGG>TGT	p.W107C	FAM127B_uc004eyg.3_Intron	NM_001078172	NP_001071640	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B	107											0	Acute lymphoblastic leukemia(192;0.000127)					CGTCCTCCTCCCATCCAAAGA	0.642													4	53	---	---	---	---	PASS
BRS3	680	broad.mit.edu	37	X	135570306	135570306	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135570306G>C	uc004ezv.1	+	1	182	c.33G>C	c.(31-33)CAG>CAC	p.Q11H		NM_001727	NP_001718	P32247	BRS3_HUMAN	bombesin-like receptor 3	11	Extracellular (Potential).				adult feeding behavior|glucose metabolic process|regulation of blood pressure	integral to membrane|plasma membrane	bombesin receptor activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					CACCTAATCAGACTTTAATTT	0.398													12	70	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138728984	138728984	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138728984A>G	uc011mwn.1	-	3	365	c.359T>C	c.(358-360)ATA>ACA	p.I120T	MCF2_uc004faw.2_Missense_Mutation_p.I35T|MCF2_uc011mwo.1_Missense_Mutation_p.I35T			P10911	MCF2_HUMAN	SubName: Full=MCF.2 cell line derived transforming sequence;	Error:Variant_position_missing_in_P10911_after_alignment					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					TACTTTTGCTATTACTTCCTC	0.328													7	19	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140969327	140969327	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140969327C>A	uc011mwp.1	+	4	654	c.654C>A	c.(652-654)TAC>TAA	p.Y218*		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	218	MAGE 1.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TCAACACATACACGGGCTACT	0.438													40	211	---	---	---	---	PASS
SDF4	51150	broad.mit.edu	37	1	1158442	1158443	+	Intron	DEL	CA	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1158442_1158443delCA	uc001adh.3	-						SDF4_uc001adg.2_5'Flank|SDF4_uc001adi.3_Intron|SDF4_uc009vjv.2_Intron|SDF4_uc009vjw.2_Intron|SDF4_uc001adj.1_3'UTR	NM_016176	NP_057260	Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4 isoform 2						cerebellum development|fat cell differentiation|response to ethanol|UV protection|zymogen granule exocytosis	bleb|Golgi lumen|late endosome|soluble fraction	calcium ion binding|calcium ion binding|identical protein binding|protein binding			upper_aerodigestive_tract(1)|large_intestine(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		acacaacatgcacacacgtact	0.000													4	2	---	---	---	---	
TNFRSF9	3604	broad.mit.edu	37	1	7980709	7980709	+	3'UTR	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7980709delA	uc001aot.2	-	8						NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,						induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		agaccctgtcaaaaaaaaaaa	0.184													8	4	---	---	---	---	
LZIC	84328	broad.mit.edu	37	1	9992160	9992164	+	Intron	DEL	GGGGG	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9992160_9992164delGGGGG	uc001aqm.2	-						LZIC_uc001aqn.2_Intron|LZIC_uc001aqo.2_Intron|LZIC_uc009vmr.2_Intron|LZIC_uc010oah.1_Intron	NM_032368	NP_115744	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing								beta-catenin binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		tgggaggcgtggggggggggggggg	0.102													3	4	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39770237	39770238	+	Intron	INS	-	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39770237_39770238insT	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc009vvq.1_Intron|MACF1_uc001cdb.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			tcttttctttcttttttttttt	0.158													9	5	---	---	---	---	
LPGAT1	9926	broad.mit.edu	37	1	211960832	211960833	+	Intron	DEL	AA	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211960832_211960833delAA	uc001hiu.2	-						LPGAT1_uc001hiv.2_Intron	NM_014873	NP_055688	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		tctgtctctcaaaaaaaaaaaa	0.139													10	5	---	---	---	---	
PLD5	200150	broad.mit.edu	37	1	242383609	242383613	+	Intron	DEL	AAAAG	-	-	rs113967982		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242383609_242383613delAAAAG	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			aaagaaaactaaaagaaaagaaaag	0.268													4	2	---	---	---	---	
TP53I3	9540	broad.mit.edu	37	2	24307260	24307261	+	Intron	INS	-	CAGGG	CAGGG	rs149489510	by1000genomes	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24307260_24307261insCAGGG	uc002rey.1	-						LOC375190_uc002rew.2_Intron|TP53I3_uc002rex.1_5'Flank|TP53I3_uc002rez.1_5'UTR|TP53I3_uc010ykk.1_5'UTR	NM_147184	NP_671713	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3						induction of apoptosis by oxidative stress|NADP metabolic process		NADPH binding|NADPH:quinone reductase activity|protein homodimerization activity|quinone binding|zinc ion binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					gcaggacaggacagggcagggc	0.411											OREG0014492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	6	---	---	---	---	
CDK15	65061	broad.mit.edu	37	2	202698423	202698425	+	Intron	DEL	TCT	-	-	rs66588345		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202698423_202698425delTCT	uc002uyt.2	+						CDK15_uc010ftm.2_Intron|CDK15_uc002uys.2_Intron|CDK15_uc010ftn.1_Intron|CDK15_uc010fto.1_Intron	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	AATGTAAAAAtcttcttcttctt	0.310													8	7	---	---	---	---	
C2orf67	151050	broad.mit.edu	37	2	211018091	211018091	+	Intron	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211018091delA	uc002vds.2	-						C2orf67_uc002vdt.2_Intron|C2orf67_uc002vdw.2_Intron|C2orf67_uc002vdy.1_3'UTR|C2orf67_uc002vdv.2_Intron|C2orf67_uc002vdx.1_Intron	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		aataaaaattaaaaaaaaaaa	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233282753	233282753	+	IGR	DEL	T	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233282753delT								ALPPL2 (7331 upstream) : ALPI (38080 downstream)																							GGGGGGGGGGTGATCTTCTGC	0.577													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	26990561	26990561	+	IGR	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26990561delA								LRRC3B (238298 upstream) : NEK10 (161834 downstream)																							ggaagggaggaagggaggaag	0.065													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	87543497	87543498	+	IGR	DEL	AG	-	-	rs146116458		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87543497_87543498delAG								POU1F1 (217760 upstream) : HTR1F (488228 downstream)																							aaagagaaaaagaaagaagaag	0.000													4	3	---	---	---	---	
XRN1	54464	broad.mit.edu	37	3	142135859	142135860	+	Intron	DEL	AA	-	-	rs11291353		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142135859_142135860delAA	uc003eus.2	-						XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron|XRN1_uc003euv.1_Intron	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						caacagagtgaaaaaaaaaaaa	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182178994	182178995	+	IGR	INS	-	T	T			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182178994_182178995insT								SOX2OT (719991 upstream) : ATP11B (332296 downstream)																							ttactctacacttttttttttt	0.000													4	2	---	---	---	---	
ABCC5	10057	broad.mit.edu	37	3	183696103	183696103	+	Intron	DEL	T	-	-	rs67116575		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183696103delT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATATGTGGTATTttttttttg	0.219													5	5	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79371639	79371640	+	Intron	INS	-	T	T	rs138438777	by1000genomes	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79371639_79371640insT	uc003hlb.2	+							NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ttgttttcttattttttttttc	0.277													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	130824979	130824979	+	Intron	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130824979delA	uc003igw.1	+											Homo sapiens cDNA clone IMAGE:5170949, partial cds.																		TGGTACTCACAATATCGCTTT	0.468													4	2	---	---	---	---	
ATG12	9140	broad.mit.edu	37	5	115173167	115173167	+	Intron	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115173167delA	uc003krh.2	-						ATG12_uc003kri.2_Intron|ATG12_uc003krj.2_Intron	NM_004707	NP_004698	O94817	ATG12_HUMAN	APG12 autophagy 12-like						autophagic vacuole assembly|negative regulation of type I interferon production	pre-autophagosomal structure membrane	protein binding				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;7.59e-08)|Epithelial(69;7.05e-07)|all cancers(49;3.11e-05)		agactgtctcaaaaaaaaaaa	0.129													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123556070	123556070	+	IGR	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123556070delA								CSNK1G3 (603608 upstream) : ZNF608 (416540 downstream)																							TTAACTATACAAAAAAAAAAA	0.363													4	3	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137290194	137290195	+	Intron	INS	-	AC	AC	rs151026681	by1000genomes	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137290194_137290195insAC	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						catacacacatacacacacaca	0.228													3	4	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154287016	154287017	+	Intron	INS	-	GAAAAAAAA	GAAAAAAAA	rs145860358	by1000genomes	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154287016_154287017insGAAAAAAAA	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAATAAAGCTTAACAAAAAAAA	0.356													4	2	---	---	---	---	
MTHFD1L	25902	broad.mit.edu	37	6	151330671	151330671	+	Intron	DEL	A	-	-	rs71780971		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151330671delA	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		caccatctccaaaaaaaaaaG	0.254													3	4	---	---	---	---	
CRYGN	155051	broad.mit.edu	37	7	151133532	151133533	+	Intron	INS	-	A	A			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151133532_151133533insA	uc003wke.2	-						CRYGN_uc003wkf.2_Intron|CRYGN_uc003wkg.2_Intron|CRYGN_uc010lqd.1_5'Flank	NM_144727	NP_653328	Q8WXF5	CRGN_HUMAN	gammaN-crystallin												0			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CACCCCCACCCCACACACTTCA	0.490													4	2	---	---	---	---	
NEK6	10783	broad.mit.edu	37	9	127088493	127088493	+	Intron	DEL	G	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127088493delG	uc004bog.2	+						NEK6_uc004bof.2_Intron|NEK6_uc004boh.2_Intron|NEK6_uc010mwj.2_Intron|NEK6_uc010mwk.2_Intron|NEK6_uc004boi.2_Intron	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2						apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3						CCCCCCCCCCGCCCCTGCCAG	0.632													4	2	---	---	---	---	
NCS1	23413	broad.mit.edu	37	9	132985259	132985259	+	Intron	DEL	C	-	-	rs68053432		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985259delC	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101	P62166	NCS1_HUMAN	frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0						AAGAGGGGGGCGGCCCTCATC	0.657													3	3	---	---	---	---	
NOTCH1	4851	broad.mit.edu	37	9	139417461	139417462	+	Frame_Shift_Ins	INS	-	GG	GG	rs146350322	by1000genomes	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139417461_139417462insGG	uc004chz.2	-	4	582_583	c.582_583insCC	c.(580-585)ACCTGCfs	p.T194fs		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	194_195	Extracellular (Potential).|EGF-like 5; calcium-binding (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TCGTTGTGGCAGGTGCCTCCGT	0.698			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			4	2	---	---	---	---	
ITIH5	80760	broad.mit.edu	37	10	7628109	7628110	+	Intron	DEL	CG	-	-	rs3841465		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7628109_7628110delCG	uc001ijq.2	-						ITIH5_uc001ijp.2_Intron|ITIH5_uc001ijr.1_Intron	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						AAACCGCCCCCGCCCCCCAGGA	0.475													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	13199671	13199672	+	IGR	INS	-	G	G	rs113702003		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13199671_13199672insG								OPTN (19395 upstream) : MCM10 (3909 downstream)																							tttttttttttttttttttttg	0.183													5	4	---	---	---	---	
SLC17A6	57084	broad.mit.edu	37	11	22396073	22396074	+	Intron	DEL	AA	-	-	rs5790258		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22396073_22396074delAA	uc001mqk.2	+							NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent						sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						ATTACGTGGCAAAAAAAAAAAA	0.312													4	4	---	---	---	---	
DHCR7	1717	broad.mit.edu	37	11	71146249	71146260	+	3'UTR	DEL	AGCAAGGAACAG	-	-	rs72112762		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71146249_71146260delAGCAAGGAACAG	uc001oqk.2	-	9					DHCR7_uc001oql.2_3'UTR	NM_001163817	NP_001157289	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase						cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|nuclear outer membrane	7-dehydrocholesterol reductase activity|protein binding			ovary(1)|liver(1)	2					NADH(DB00157)	TGAAGGCAAAAGCAAGGAACAGAGCGTGATTA	0.443									Smith-Lemli-Opitz_syndrome				5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31269805	31269806	+	Intron	INS	-	AAG	AAG	rs10650892		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31269805_31269806insAAG	uc010sjy.1	-						uc001rjy.2_Intron|uc001rjz.2_Intron					RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CAATATTCCTCAAACTTCTCTT	0.307													4	2	---	---	---	---	
GXYLT1	283464	broad.mit.edu	37	12	42481468	42481468	+	3'UTR	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42481468delA	uc001rms.3	-	8					GXYLT1_uc001rmt.3_3'UTR	NM_173601	NP_775872	Q4G148	GXLT1_HUMAN	glycosyltransferase 8 domain containing 3						O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0						CTTCTTTAGGAAAAAAAAAAT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76082490	76082491	+	IGR	INS	-	T	T	rs141632958		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76082490_76082491insT								KRR1 (177072 upstream) : PHLDA1 (336737 downstream)																							cattctTTTTCTTTTTTTTTTT	0.218													4	2	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119560094	119560097	+	Intron	DEL	AGGC	-	-	rs72486757	by1000genomes	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119560094_119560097delAGGC	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						gaaggcaggaaggcaggaaggaag	0.196													4	3	---	---	---	---	
COL4A1	1282	broad.mit.edu	37	13	110821801	110821804	+	Intron	DEL	AAGA	-	-	rs3832902		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110821801_110821804delAAGA	uc001vqw.3	-						COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein						angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GGTTACTGGCAAGAAAGAAAGAAA	0.230													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20148686	20148725	+	IGR	DEL	ATTTTGTCCGCCGCCGCCGCGGCTTTCTACCCGCCGCGGC	-	-	rs71114078		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20148686_20148725delATTTTGTCCGCCGCCGCCGCGGCTTTCTACCCGCCGCGGC								None (None upstream) : GOLGA6L6 (588369 downstream)																							CATCTCCACTATTTTGTCCGCCGCCGCCGCGGCTTTCTACCCGCCGCGGCATTTTGCCCC	0.592													4	2	---	---	---	---	
FMN1	342184	broad.mit.edu	37	15	33191986	33191987	+	Intron	INS	-	A	A	rs112769345		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33191986_33191987insA	uc001zhf.3	-							NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		AGTCTAACGTGAAAAAAAAAAA	0.327													7	6	---	---	---	---	
DMXL2	23312	broad.mit.edu	37	15	51745609	51745610	+	Intron	DEL	TG	-	-	rs76051381		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51745609_51745610delTG	uc002abf.2	-						DMXL2_uc002abd.2_Intron|DMXL2_uc010ufy.1_Intron|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		AAAAACACTCTGAAATAAGAAT	0.248													8	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76079338	76079339	+	5'Flank	INS	-	A	A	rs77222978		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76079338_76079339insA	uc002bbb.1	-						uc002bbc.1_5'Flank					DQ577530																		GTCAAGAAATTAAAAAAAAAAA	0.391													5	3	---	---	---	---	
USP7	7874	broad.mit.edu	37	16	8994680	8994680	+	Intron	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8994680delA	uc002czl.2	-						USP7_uc010uyk.1_Intron|USP7_uc002czj.2_Intron|USP7_uc010uyj.1_Intron|USP7_uc002czk.2_Intron	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7						interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						TACAACAGGTAAAAAAAAAAA	0.318													5	3	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74394379	74394380	+	Intron	INS	-	A	A	rs142790741	by1000genomes	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394379_74394380insA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						TAGTCATCCTTAAACAAAATTC	0.327													5	6	---	---	---	---	
FLJ36000	284124	broad.mit.edu	37	17	21906797	21906806	+	Intron	DEL	TGTGTGTGTG	-	-	rs74187557		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21906797_21906806delTGTGTGTGTG	uc002gza.2	+							NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						TCTTTCCCTCtgtgtgtgtgtgtgtgtgtg	0.400													4	2	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59465981	59465981	+	Intron	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59465981delA	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Frame_Shift_Del_p.K884fs|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron|BCAS3_uc002izd.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TTCAAAAGGGAAAAAAAAAGG	0.443													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025820	64025821	+	Intron	INS	-	TAAA	TAAA	rs144628903	by1000genomes	TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025820_64025821insTAAA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gaccctgtctctaaataaacaa	0.114													5	9	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13411132	13411132	+	Intron	DEL	T	-	-	rs138629534		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13411132delT	uc010dze.2	-						CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc010xne.1_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	acaggtgggattttttttttc	0.030													2	6	---	---	---	---	
ARMC6	93436	broad.mit.edu	37	19	19162185	19162186	+	Intron	DEL	TG	-	-	rs72199956		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19162185_19162186delTG	uc002nld.2	+						ARMC6_uc002nlc.2_Intron|ARMC6_uc010xql.1_Intron|ARMC6_uc002nle.2_Intron|ARMC6_uc010xqm.1_Intron	NM_033415	NP_219483	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6								protein binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			TCTCTCTCTCtgtgtgtgtgtg	0.233													3	3	---	---	---	---	
TULP2	7288	broad.mit.edu	37	19	49384468	49384468	+	Intron	DEL	C	-	-	rs68173909		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49384468delC	uc002pkz.2	-							NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2						visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		ttttttttttctttttttttt	0.199													7	10	---	---	---	---	
DDX27	55661	broad.mit.edu	37	20	47840110	47840110	+	Intron	DEL	T	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47840110delT	uc002xuh.2	+							NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CCTTTCTTTCTTTTTTTTTTT	0.224													6	3	---	---	---	---	
LSM14B	149986	broad.mit.edu	37	20	60705077	60705077	+	Intron	DEL	T	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60705077delT	uc010gjy.1	+						LSM14B_uc010gjx.1_Intron|LSM14B_uc002ybv.2_Intron|LSM14B_uc010gjz.1_Intron|LSM14B_uc010zzz.1_Intron	NM_144703	NP_653304	Q9BX40	LS14B_HUMAN	LSM14 homolog B						multicellular organismal development|regulation of translation	ribonucleoprotein complex					0	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			TCCTGGGCtattttttttttt	0.507													9	4	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45839640	45839641	+	Intron	INS	-	GTG	GTG	rs140387137		TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45839640_45839641insGTG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron|uc011afe.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						tgatgatggcagtggtggtggt	0.000													3	3	---	---	---	---	
WDR13	64743	broad.mit.edu	37	X	48462533	48462533	+	Intron	DEL	A	-	-			TCGA-C5-A1M7-01	TCGA-C5-A1M7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48462533delA	uc004dkh.1	+						WDR13_uc004dki.1_Intron|WDR13_uc004dkj.1_Intron|WDR13_uc004dkk.1_Intron|WDR13_uc004dkl.3_Intron	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13 protein							cytoplasm|nucleus				ovary(2)	2						tctcaaaaacaaaaaaaaaaa	0.249													6	3	---	---	---	---	
