Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ISG15	9636	broad.mit.edu	37	1	949726	949726	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:949726C>G	uc001acj.3	+	2	473	c.366C>G	c.(364-366)TTC>TTG	p.F122L		NM_005101	NP_005092	P05161	ISG15_HUMAN	ISG15 ubiquitin-like modifier precursor	122	Ubiquitin-like 2.				cell-cell signaling|interspecies interaction between organisms|ISG15-protein conjugation|negative regulation of type I interferon production|response to virus|type I interferon-mediated signaling pathway	cytosol|extracellular space	protein binding				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.05e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.54e-23)|Colorectal(212;5.37e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00238)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		ACGACCTGTTCTGGCTGACCT	0.662													3	48	---	---	---	---	PASS
NBPF3	84224	broad.mit.edu	37	1	21807446	21807446	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21807446G>T	uc001ber.2	+	12	1755	c.1405G>T	c.(1405-1407)GAA>TAA	p.E469*	NBPF3_uc001bes.2_Nonsense_Mutation_p.E413*|NBPF3_uc009vqb.2_Nonsense_Mutation_p.E457*|NBPF3_uc010odm.1_Nonsense_Mutation_p.E399*	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	469	Poly-Glu.|NBPF 4.					cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCAAGAAGAGGAAGAAGACCA	0.468													23	138	---	---	---	---	PASS
TAF12	6883	broad.mit.edu	37	1	28930062	28930062	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28930062T>C	uc001bqw.2	-	5	568	c.475A>G	c.(475-477)ACC>GCC	p.T159A	TAF12_uc001bqx.2_Missense_Mutation_p.T159A|TAF12_uc001bqy.2_Missense_Mutation_p.T159A	NM_005644	NP_005635	Q16514	TAF12_HUMAN	TAF12 RNA polymerase II, TATA box binding	159					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	PCAF complex|STAGA complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Renal(390;0.00121)|Breast(348;0.00502)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)		Colorectal(126;3.21e-08)|COAD - Colon adenocarcinoma(152;1.74e-06)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(1967;0.0109)|BRCA - Breast invasive adenocarcinoma(304;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		TATTTCTTGGTTGTTTTCCGG	0.423													7	122	---	---	---	---	PASS
CDC20	991	broad.mit.edu	37	1	43827899	43827899	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43827899G>C	uc001cix.2	+	10	1338	c.1237G>C	c.(1237-1239)GAG>CAG	p.E413Q	CDC20_uc001ciy.2_Missense_Mutation_p.E413Q	NM_001255	NP_001246	Q12834	CDC20_HUMAN	cell division cycle 20	413	WD 6.				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	cytosol|nucleoplasm|spindle	enzyme binding|protein C-terminus binding				0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCATTACAAGGAGCTCATCTC	0.368													18	42	---	---	---	---	PASS
CDC20	991	broad.mit.edu	37	1	43827910	43827910	+	Silent	SNP	A	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43827910A>C	uc001cix.2	+	10	1349	c.1248A>C	c.(1246-1248)TCA>TCC	p.S416S	CDC20_uc001ciy.2_Silent_p.S416S	NM_001255	NP_001246	Q12834	CDC20_HUMAN	cell division cycle 20	416	WD 6.				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	cytosol|nucleoplasm|spindle	enzyme binding|protein C-terminus binding				0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGCTCATCTCAGGCCATGGCT	0.338													17	44	---	---	---	---	PASS
TMEM53	79639	broad.mit.edu	37	1	45120220	45120220	+	3'UTR	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45120220G>C	uc001cmc.2	-	3					TMEM53_uc001cmb.1_Intron|TMEM53_uc001cmd.2_3'UTR|TMEM53_uc009vxh.1_3'UTR|TMEM53_uc010ola.1_3'UTR	NM_024587	NP_078863	Q6P2H8	TMM53_HUMAN	transmembrane protein 53							integral to membrane				ovary(2)	2	Acute lymphoblastic leukemia(166;0.155)					AGGTGAGATGGAGCAATGGCC	0.547													30	53	---	---	---	---	PASS
LRRC41	10489	broad.mit.edu	37	1	46746151	46746151	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46746151G>A	uc001cpn.2	-	6	1882	c.1838C>T	c.(1837-1839)TCG>TTG	p.S613L	LRRC41_uc010omb.1_Missense_Mutation_p.S613L	NM_006369	NP_006360	Q15345	LRC41_HUMAN	MUF1 protein	613	LRR 4.									ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(166;0.155)					CAGAGAACCCGAGGCCTTCAG	0.567													57	90	---	---	---	---	PASS
HOOK1	51361	broad.mit.edu	37	1	60312834	60312834	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60312834G>A	uc009wad.2	+	11	1008	c.906G>A	c.(904-906)CTG>CTA	p.L302L	HOOK1_uc001czo.2_Silent_p.L302L|HOOK1_uc001czp.2_RNA|HOOK1_uc010oor.1_Silent_p.L260L	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	302	Potential.|Sufficient for interaction with microtubules.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					CAAGAGCCCTGAAAGATGAAA	0.328													12	163	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93649015	93649015	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93649015G>A	uc001dpq.2	+	2	619	c.451G>A	c.(451-453)GAA>AAA	p.E151K	TMED5_uc001dpn.2_5'Flank|TMED5_uc001dpo.2_5'Flank|TMED5_uc001dpp.2_5'Flank	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	33										ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GAAGATAACAGAATGGAGTTT	0.338													43	56	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93711674	93711674	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93711674G>T	uc001dpq.2	+	22	3516	c.3348G>T	c.(3346-3348)ATG>ATT	p.M1116I	CCDC18_uc009wdl.1_Missense_Mutation_p.M633I	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	997	Potential.									ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AATGCAAGATGGAGATTGAAG	0.353													11	136	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154306711	154306711	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154306711G>A	uc001fey.1	+	9	964	c.775G>A	c.(775-777)GAG>AAG	p.E259K	ATP8B2_uc001few.2_Missense_Mutation_p.E240K|ATP8B2_uc001fex.2_Missense_Mutation_p.E273K	NM_001005855	NP_001005855	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform b	259	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GCGAAACACCGAGTGGTGCTT	0.532													15	415	---	---	---	---	PASS
UFC1	51506	broad.mit.edu	37	1	161128205	161128205	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161128205G>A	uc001fyd.3	+	6	681	c.427G>A	c.(427-429)GGT>AGT	p.G143S	USP21_uc010pkc.1_5'Flank|USP21_uc010pkd.1_5'Flank|USP21_uc010pke.1_5'Flank|USP21_uc010pkf.1_5'Flank	NM_016406	NP_057490	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1	143					protein ufmylation		protein binding|UFM1 conjugating enzyme activity				0	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ATTGCAGCTGGGTCCATGGCT	0.478													52	84	---	---	---	---	PASS
DHX9	1660	broad.mit.edu	37	1	182843982	182843982	+	Intron	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182843982C>G	uc001gpr.2	+						DHX9_uc001gps.2_Intron	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9						CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						TGGATTGTCCCTGGCAGAATA	0.333													52	225	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067662	190067662	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067662C>T	uc001gse.1	-	8	2019	c.1787G>A	c.(1786-1788)TGG>TAG	p.W596*	FAM5C_uc010pot.1_Nonsense_Mutation_p.W494*	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	596						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					AGTCCGCTCCCAGTCTGGAAA	0.478													182	228	---	---	---	---	PASS
LAMB3	3914	broad.mit.edu	37	1	209789963	209789963	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209789963C>G	uc001hhg.2	-	21	3625	c.3235G>C	c.(3235-3237)GAG>CAG	p.E1079Q	LAMB3_uc009xco.2_Missense_Mutation_p.E1079Q|LAMB3_uc001hhh.2_Missense_Mutation_p.E1079Q	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	1079	Domain I.|Potential.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TTTATTCTCTCAAATCCCTGA	0.468													14	57	---	---	---	---	PASS
LAMB3	3914	broad.mit.edu	37	1	209791342	209791342	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209791342C>T	uc001hhg.2	-	19	3351	c.2961G>A	c.(2959-2961)CTG>CTA	p.L987L	LAMB3_uc009xco.2_Silent_p.L987L|LAMB3_uc001hhh.2_Silent_p.L987L	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	987	Domain I.|Potential.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TCCCCTGCCGCAGGTTCCCAA	0.602													15	56	---	---	---	---	PASS
LIN9	286826	broad.mit.edu	37	1	226426770	226426770	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226426770C>A	uc001hqa.2	-	12	1505	c.1195G>T	c.(1195-1197)GAA>TAA	p.E399*	LIN9_uc001hqb.2_Nonsense_Mutation_p.E364*|LIN9_uc001hqc.2_Nonsense_Mutation_p.E331*|LIN9_uc009xel.1_Nonsense_Mutation_p.E364*	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN	lin-9 homolog	383	Potential.				cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		CGCTGAAATTCAATGCTGATG	0.353													23	177	---	---	---	---	PASS
PRSS38	339501	broad.mit.edu	37	1	228003831	228003831	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228003831C>T	uc001hrh.2	+	2	189	c.189C>T	c.(187-189)GGC>GGT	p.G63G		NM_183062	NP_898885	A1L453	PRS38_HUMAN	marapsin 2 precursor	63	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)|pancreas(1)	2						TCCTGGGCGGCGTCCCTGCGC	0.617													12	92	---	---	---	---	PASS
GALNT2	2590	broad.mit.edu	37	1	230398692	230398692	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230398692G>A	uc010pwa.1	+	13	1326	c.1254G>A	c.(1252-1254)AGG>AGA	p.R418R	GALNT2_uc010pvy.1_Silent_p.R380R|GALNT2_uc010pvz.1_RNA|GALNT2_uc001htu.2_Silent_p.R30R	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	418	Lumenal (Potential).				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				TGGAGCTTAGGAAGAAACTCA	0.393													45	169	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233372617	233372617	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233372617G>A	uc001hvl.2	-	9	2567	c.2332C>T	c.(2332-2334)CGC>TGC	p.R778C	PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA|PCNXL2_uc001hvq.1_Missense_Mutation_p.R77C	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	778						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				TGGGTCCTGCGAGCCACCATC	0.527													52	211	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237789071	237789071	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237789071G>C	uc001hyl.1	+	40	6253	c.6133G>C	c.(6133-6135)GAA>CAA	p.E2045Q		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2045	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAGCAAGCAGAAAAACCAGT	0.443													21	71	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15307388	15307388	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15307388C>T	uc002rcc.1	-	52	6926	c.6900G>A	c.(6898-6900)CTG>CTA	p.L2300L	NBAS_uc002rcb.1_Silent_p.L140L|NBAS_uc010exl.1_Silent_p.L1372L|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	2300										ovary(2)|liver(1)|skin(1)	4						CACACTTCACCAGCAGCTTGG	0.537													12	27	---	---	---	---	PASS
EIF2B4	8890	broad.mit.edu	37	2	27589807	27589807	+	Intron	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27589807G>C	uc002rkb.2	-						EIF2B4_uc002rjz.2_Intron|EIF2B4_uc002rka.2_Intron|EIF2B4_uc002rkc.2_Intron|EIF2B4_uc002rkd.2_Intron|EIF2B4_uc002rke.2_Intron|EIF2B4_uc002rkf.1_3'UTR	NM_001034116	NP_001029288	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B,						myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGATGAGCTAGAGTGAATGAA	0.498													55	204	---	---	---	---	PASS
HK2	3099	broad.mit.edu	37	2	75116397	75116397	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75116397C>T	uc002snd.2	+	17	4327	c.2401C>T	c.(2401-2403)CGA>TGA	p.R801*		NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2	801	Catalytic.				apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						GCTGCAAGTCCGAGCCATCCT	0.607													14	27	---	---	---	---	PASS
RPIA	22934	broad.mit.edu	37	2	88991297	88991297	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88991297C>T	uc002ste.2	+	1	122	c.81C>T	c.(79-81)TCC>TCT	p.S27S		NM_144563	NP_653164	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A	27					pentose-phosphate shunt, non-oxidative branch	cytosol	ribose-5-phosphate isomerase activity			ovary(1)	1		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				gcgcggcctccggcggAGGAG	0.567													4	9	---	---	---	---	PASS
DFNB59	494513	broad.mit.edu	37	2	179325902	179325902	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179325902G>A	uc002umi.3	+	7	1316	c.960G>A	c.(958-960)GAG>GAA	p.E320E	DFNB59_uc002umj.3_Silent_p.E320E	NM_001042702	NP_001036167	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	320					sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			TCAAAAGGGAGACAGTTTATG	0.408													7	223	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179412236	179412236	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179412236G>T	uc010zfg.1	-	288	86637	c.86413C>A	c.(86413-86415)CTC>ATC	p.L28805I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.L22500I|TTN_uc010zfi.1_Missense_Mutation_p.L22433I|TTN_uc010zfj.1_Missense_Mutation_p.L22308I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29732							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTTTGTGAGATGAGTGACT	0.388													7	19	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179458767	179458767	+	Silent	SNP	A	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179458767A>G	uc010zfg.1	-	246	50873	c.50649T>C	c.(50647-50649)CGT>CGC	p.R16883R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.R10578R|TTN_uc010zfi.1_Silent_p.R10511R|TTN_uc010zfj.1_Silent_p.R10386R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17810							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGAATCTGAACGTTTGGCCT	0.413													62	110	---	---	---	---	PASS
AQP12A	375318	broad.mit.edu	37	2	241631397	241631397	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241631397C>T	uc002vzu.2	+	1	136	c.67C>T	c.(67-69)CGG>TGG	p.R23W	AQP12A_uc002vzv.2_Intron	NM_198998	NP_945349	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	23						integral to membrane	transporter activity				0		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GGCGGCCAGGCGGGCCTCCAA	0.687													13	20	---	---	---	---	PASS
LHFPL4	375323	broad.mit.edu	37	3	9594298	9594298	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9594298G>A	uc003bry.2	-	2	352	c.66C>T	c.(64-66)ATC>ATT	p.I22I		NM_198560	NP_940962	Q7Z7J7	LHPL4_HUMAN	lipoma HMGIC fusion partner-like 4	22	Helical; (Potential).					integral to membrane				ovary(2)|skin(1)	3	Medulloblastoma(99;0.227)					ACAGCACGCCGATGGCCCGCG	0.542													10	16	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38592173	38592173	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38592173C>T	uc003cio.2	-	28	5884	c.5690G>A	c.(5689-5691)CGG>CAG	p.R1897Q	SCN5A_uc003cin.2_Missense_Mutation_p.R1896Q|SCN5A_uc003cil.3_Missense_Mutation_p.R1897Q|SCN5A_uc010hhi.2_Missense_Mutation_p.R1879Q|SCN5A_uc010hhk.2_Missense_Mutation_p.R1864Q|SCN5A_uc011ayr.1_Missense_Mutation_p.R1843Q	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1897					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GTGCTTGCGCCGGAGTGTGGT	0.582													28	59	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38618222	38618222	+	Silent	SNP	G	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38618222G>T	uc003cio.2	-	19	3635	c.3441C>A	c.(3439-3441)ACC>ACA	p.T1147T	SCN5A_uc003cin.2_Silent_p.T1146T|SCN5A_uc003cil.3_Silent_p.T1147T|SCN5A_uc010hhi.2_Silent_p.T1147T|SCN5A_uc010hhk.2_Silent_p.T1146T|SCN5A_uc011ayr.1_Silent_p.T1093T|SCN5A_uc010hhj.1_Silent_p.T757T	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1147					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GGAGCTCAGCGGTGTTGGTCA	0.622													3	19	---	---	---	---	PASS
CCR9	10803	broad.mit.edu	37	3	45942736	45942736	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45942736G>A	uc003coz.1	+	3	613	c.456G>A	c.(454-456)ATG>ATA	p.M152I	LZTFL1_uc003coy.1_Intron|LZTFL1_uc011bak.1_Intron|CCR9_uc010hiv.1_Missense_Mutation_p.M140I|CCR9_uc003cpa.1_Missense_Mutation_p.M140I	NM_031200	NP_112477	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9 isoform A	152	Cytoplasmic (Potential).				cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane				ovary(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		CCCAGGCCATGAGAGCACATA	0.473													24	43	---	---	---	---	PASS
SMARCC1	6599	broad.mit.edu	37	3	47703996	47703996	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47703996C>G	uc003crq.2	-	20	2104	c.1986G>C	c.(1984-1986)TTG>TTC	p.L662F	SMARCC1_uc011bbc.1_RNA|SMARCC1_uc011bbd.1_Missense_Mutation_p.L553F	NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated	662	SANT.				chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		TGGGAAGTCTCAAAAAGTGGA	0.473													27	41	---	---	---	---	PASS
TRPC1	7220	broad.mit.edu	37	3	142443466	142443466	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142443466C>T	uc003evc.2	+	1	201	c.65C>T	c.(64-66)TCT>TTT	p.S22F	TRPC1_uc003evb.2_Missense_Mutation_p.S22F	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	22	Cytoplasmic (Potential).				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						ctgccttcctctccatcctct	0.517													4	30	---	---	---	---	PASS
TRPC1	7220	broad.mit.edu	37	3	142443468	142443468	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142443468C>T	uc003evc.2	+	1	203	c.67C>T	c.(67-69)CCA>TCA	p.P23S	TRPC1_uc003evb.2_Missense_Mutation_p.P23S	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	23	Cytoplasmic (Potential).				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						gccttcctctccatcctcttc	0.512													4	30	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128259	147128259	+	Silent	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128259C>G	uc003ewe.2	+	1	1079	c.360C>G	c.(358-360)CTC>CTG	p.L120L		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	120					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						AGCACAGCCTCTTTGCTGCAT	0.706													5	24	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179593161	179593161	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179593161C>T	uc003fki.1	-	6	740	c.610G>A	c.(610-612)GGA>AGA	p.G204R	PEX5L_uc011bqd.1_Missense_Mutation_p.G161R|PEX5L_uc011bqe.1_Missense_Mutation_p.G12R|PEX5L_uc011bqf.1_Missense_Mutation_p.G96R|PEX5L_uc003fkj.1_Missense_Mutation_p.G169R|PEX5L_uc010hxd.1_Missense_Mutation_p.G202R|PEX5L_uc011bqg.1_Missense_Mutation_p.G180R|PEX5L_uc011bqh.1_Missense_Mutation_p.G145R	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	204					protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCTTTTGATCCAGTTCTAGAT	0.378													229	94	---	---	---	---	PASS
LIPH	200879	broad.mit.edu	37	3	185252685	185252685	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185252685C>T	uc003fpm.2	-	2	395	c.285G>A	c.(283-285)TTG>TTA	p.L95L	LIPH_uc010hyh.2_Silent_p.L95L	NM_139248	NP_640341	Q8WWY8	LIPH_HUMAN	lipase, member H precursor	95					lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CAACAGAGAGCAAACCCTTTA	0.433													44	291	---	---	---	---	PASS
TP63	8626	broad.mit.edu	37	3	189608648	189608648	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189608648C>T	uc003fry.2	+	13	1812	c.1723C>T	c.(1723-1725)CAG>TAG	p.Q575*	TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron|TP63_uc003fsc.2_Nonsense_Mutation_p.Q481*|TP63_uc003fsd.2_Intron|TP63_uc010hzd.1_Nonsense_Mutation_p.Q396*	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	575	SAM.				anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CACCATCTATCAGATTGAGCA	0.443									Hay-Wells_syndrome	HNSCC(45;0.13)			37	140	---	---	---	---	PASS
UBXN7	26043	broad.mit.edu	37	3	196089280	196089280	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196089280G>A	uc003fwm.3	-	9	1188	c.1113C>T	c.(1111-1113)GTC>GTT	p.V371V	UBXN7_uc003fwn.3_Silent_p.V223V|UBXN7_uc010iae.2_Silent_p.V209V	NM_015562	NP_056377	O94888	UBXN7_HUMAN	UBX domain containing 7	371							protein binding			ovary(2)|pancreas(1)	3						GATCAGTTCTGACTGGTGGCT	0.493													20	316	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71509395	71509395	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71509395C>T	uc011caw.1	+	9	2533	c.2252C>T	c.(2251-2253)GCC>GTC	p.A751V		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	751					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			GTTAATAATGCCGCTGGACCA	0.458													3	58	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155161923	155161923	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155161923C>G	uc003inw.2	-	23	5760	c.5760G>C	c.(5758-5760)TTG>TTC	p.L1920F		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1920	Cadherin 17.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AAGCTGAATTCAAATCCACAT	0.393													21	40	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66084492	66084492	+	Intron	SNP	C	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66084492C>A	uc003jur.3	+						MAST4_uc010iwz.2_Intron	NM_198828	NP_942123	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCTTTAACTCCAACAGGGAGG	0.592													3	41	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150925842	150925842	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150925842G>C	uc003lue.3	-	9	4859	c.4846C>G	c.(4846-4848)CAA>GAA	p.Q1616E	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1616	Extracellular (Potential).|Cadherin 14.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCAAGCTTTTGAGCTAGAGTA	0.473													17	26	---	---	---	---	PASS
C5orf54	63920	broad.mit.edu	37	5	159821108	159821108	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159821108T>C	uc003lye.1	-	2	1854	c.1390A>G	c.(1390-1392)ATT>GTT	p.I464V	C5orf54_uc003lyf.1_Missense_Mutation_p.I464V	NM_022090	NP_071373	Q8IZ13	CE054_HUMAN	transposon-derived Buster3 transposase-like	464										pancreas(1)	1						agatctccaatggaaaaatat	0.000													53	84	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25777127	25777127	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25777127C>T	uc003nfe.2	+	10	1327	c.1208C>T	c.(1207-1209)TCT>TTT	p.S403F	SLC17A4_uc011djx.1_Missense_Mutation_p.S173F|SLC17A4_uc003nff.1_Missense_Mutation_p.S192F|SLC17A4_uc003nfg.2_Missense_Mutation_p.S340F|SLC17A4_uc010jqa.2_Intron	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),	403	Helical; (Potential).				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						GTGCTGTCTTCTGCCATCAGC	0.532													6	115	---	---	---	---	PASS
BTN2A2	10385	broad.mit.edu	37	6	26392863	26392863	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26392863C>T	uc003nhq.2	+	8	1326	c.1240C>T	c.(1240-1242)CAG>TAG	p.Q414*	BTN2A2_uc011dkg.1_3'UTR|BTN2A2_uc003nhr.2_Nonsense_Mutation_p.Q298*|BTN2A2_uc011dkh.1_Nonsense_Mutation_p.Q204*|BTN2A2_uc003nhs.2_Intron|BTN2A2_uc003nht.2_Nonsense_Mutation_p.Q414*|BTN2A2_uc011dki.1_3'UTR	NM_006995	NP_008926	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2 isoform a	414	B30.2/SPRY.|Cytoplasmic (Potential).				negative regulation of activated T cell proliferation|negative regulation of cellular metabolic process|negative regulation of cytokine secretion	integral to membrane					0						GCTGATTCCTCAGAATGGCTT	0.557													6	51	---	---	---	---	PASS
OR10C1	442194	broad.mit.edu	37	6	29408150	29408150	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29408150G>A	uc011dlp.1	+	1	358	c.358G>A	c.(358-360)GAC>AAC	p.D120N	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	120	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CATGGCCTATGACCGCTATGC	0.627													4	57	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75884903	75884903	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75884903C>A	uc003phs.2	-	13	2727	c.2561G>T	c.(2560-2562)GGT>GTT	p.G854V	COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	854	Fibronectin type-III 5.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TTGAGTTTCACCCCCTGCCAC	0.483													48	133	---	---	---	---	PASS
C6orf192	116843	broad.mit.edu	37	6	133100529	133100529	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133100529C>T	uc003qdw.1	-	7	825	c.673G>A	c.(673-675)GAA>AAA	p.E225K	C6orf192_uc010kgd.1_RNA|C6orf192_uc011eco.1_Missense_Mutation_p.E99K	NM_052831	NP_439896	Q6NT16	CF192_HUMAN	hypothetical protein LOC116843	225	Cytoplasmic (Potential).				transmembrane transport	integral to membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;0.00303)|GBM - Glioblastoma multiforme(226;0.0265)		AATGAGTGTTCACCTGGATCA	0.368													29	65	---	---	---	---	PASS
ECT2L	345930	broad.mit.edu	37	6	139203908	139203908	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139203908C>A	uc003qif.1	+	14	2031	c.1928C>A	c.(1927-1929)GCT>GAT	p.A643D	ECT2L_uc011edq.1_Missense_Mutation_p.A574D	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2	643	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						TGGGGCCCAGCTCACTGTGTG	0.403													23	48	---	---	---	---	PASS
LRP11	84918	broad.mit.edu	37	6	150158587	150158587	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150158587G>A	uc003qng.2	-	4	1250	c.926C>T	c.(925-927)ACT>ATT	p.T309I	LRP11_uc003qnh.1_Missense_Mutation_p.T309I	NM_032832	NP_116221	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein	309	Extracellular (Potential).|LDL-receptor class A.					integral to membrane	receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCGTGAGCAAGTGTGCAAACA	0.502													20	26	---	---	---	---	PASS
PARK2	5071	broad.mit.edu	37	6	161969941	161969941	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161969941G>A	uc003qtx.3	-	9	1162	c.1028C>T	c.(1027-1029)CCG>CTG	p.P343L	PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Missense_Mutation_p.P152L|PARK2_uc003qtw.3_Missense_Mutation_p.P152L|PARK2_uc003qty.3_Missense_Mutation_p.P315L|PARK2_uc003qtz.3_Missense_Mutation_p.P194L|PARK2_uc010kke.1_Missense_Mutation_p.P362L|PARK2_uc011egf.1_Missense_Mutation_p.P17L	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	343	IBR-type.				aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		GTCAGGCTCCGGCAGCAGCCC	0.637													34	45	---	---	---	---	PASS
CDK13	8621	broad.mit.edu	37	7	40118338	40118338	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40118338G>A	uc003thh.3	+	11	3199	c.2917G>A	c.(2917-2919)GAC>AAC	p.D973N	CDK13_uc003thi.3_Missense_Mutation_p.D973N|CDK13_uc003thj.2_Missense_Mutation_p.D24N	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	973	Protein kinase.				alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						AGCTGCGCTAGACTTATTTGA	0.408													39	27	---	---	---	---	PASS
SBDS	51119	broad.mit.edu	37	7	66460333	66460333	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66460333C>T	uc003tvm.1	-	1	256	c.72G>A	c.(70-72)GGG>GGA	p.G24G	TYW1_uc003tvn.2_5'Flank|TYW1_uc010lai.2_5'Flank	NM_016038	NP_057122	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome protein	24					bone marrow development|bone mineralization|leukocyte chemotaxis|mature ribosome assembly|mitotic spindle stabilization|positive regulation of translation|ribosomal large subunit biogenesis|rRNA processing	cytoplasm|nucleolus|nucleoplasm|spindle pole	microtubule binding|ribosome binding|rRNA binding			ovary(1)	1						CGAAGCGCTTCCCGGCACGCT	0.637			Gene Conversion			AML|MDS			Shwachman-Diamond_syndrome				14	37	---	---	---	---	PASS
SPDYE5	442590	broad.mit.edu	37	7	75124543	75124543	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75124543G>A	uc011kfy.1	+	1	245	c.109G>A	c.(109-111)GAA>AAA	p.E37K		NM_001099435	NP_001092905	A6NIY4	SPDE5_HUMAN	speedy homolog E5	37											0						GTGGTCAGATGAATCTGCGGA	0.587													4	47	---	---	---	---	PASS
ASB4	51666	broad.mit.edu	37	7	95157220	95157220	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95157220G>A	uc011kij.1	+	3	583	c.583G>A	c.(583-585)GTG>ATG	p.V195M	ASB4_uc003unx.2_Missense_Mutation_p.V195M	NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4	195	ANK 4.				intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			GGCCTTCTACGTGGAACACGG	0.597											OREG0018172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	40	---	---	---	---	PASS
SPDYE3	441272	broad.mit.edu	37	7	99909547	99909547	+	5'Flank	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99909547C>T	uc003uug.1	+							NM_001004351	NP_001004351	A6NKU9	SPDE3_HUMAN	speedy homolog E3												0						CGGCGAGTGTCGCTCGTGCTC	0.577													15	34	---	---	---	---	PASS
BHLHE22	27319	broad.mit.edu	37	8	65494180	65494180	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65494180G>A	uc003xvi.2	+	1	1367	c.833G>A	c.(832-834)CGA>CAA	p.R278Q	LOC401463_uc003xvh.2_Intron	NM_152414	NP_689627	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix domain containing, class	278	Helix-loop-helix motif.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						CCCTCGGTGCGAAAGCTCTCC	0.647													8	16	---	---	---	---	PASS
OPLAH	26873	broad.mit.edu	37	8	145106962	145106962	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145106962C>T	uc003zar.3	-	25	3561	c.3479G>A	c.(3478-3480)CGC>CAC	p.R1160H		NM_017570	NP_060040	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	1160							5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding				0	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		L-Glutamic Acid(DB00142)	CTCGAAGCGGCGCAGGATGAC	0.751													4	6	---	---	---	---	PASS
IFNA1	3439	broad.mit.edu	37	9	21440588	21440588	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21440588G>A	uc003zpd.1	+	1	149	c.82G>A	c.(82-84)GAG>AAG	p.E28K		NM_024013	NP_076918	P01562	IFNA1_HUMAN	interferon, alpha 1 precursor	28					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(2)	2				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		TGATCTCCCTGAGACCCACAG	0.517													5	72	---	---	---	---	PASS
CKS2	1164	broad.mit.edu	37	9	91926203	91926203	+	5'UTR	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91926203G>A	uc004aqh.2	+	1					hsa-mir-3153|MI0014180_5'Flank	NM_001827	NP_001818	P33552	CKS2_HUMAN	CDC28 protein kinase 2						cell division|cell proliferation|phosphatidylinositol-mediated signaling|regulation of cyclin-dependent protein kinase activity|spindle organization		cyclin-dependent protein kinase regulator activity				0						CAGCGCGCCAGCAGGATGGCC	0.597													4	20	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139399461	139399461	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139399461C>T	uc004chz.2	-	26	4682	c.4682G>A	c.(4681-4683)TGT>TAT	p.C1561Y	NOTCH1_uc004cia.1_Missense_Mutation_p.C791Y	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1561	Extracellular (Potential).|LNR 3.				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		ATGCTCCGCACAGTCCAGCCC	0.677			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			4	2	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7423844	7423844	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7423844G>C	uc009xio.1	-	2	108	c.17C>G	c.(16-18)TCA>TGA	p.S6*	SFMBT2_uc001ijn.1_Nonsense_Mutation_p.S6*|SFMBT2_uc010qay.1_Nonsense_Mutation_p.S6*|SFMBT2_uc001ijo.1_Nonsense_Mutation_p.S6*	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	6					regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						ATTGGAAGCTGACAAAGTGCT	0.403													7	47	---	---	---	---	PASS
SEC61A2	55176	broad.mit.edu	37	10	12203080	12203080	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12203080C>G	uc001ile.2	+	10	1274	c.1127C>G	c.(1126-1128)TCT>TGT	p.S376C	SEC61A2_uc010qbq.1_Missense_Mutation_p.S354C|SEC61A2_uc001ilf.3_RNA|SEC61A2_uc001ilh.3_RNA|SEC61A2_uc001ilg.3_Missense_Mutation_p.S376C	NM_018144	NP_060614	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform a	376	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				GCATTCTTCTCTAAGACATGG	0.363													40	68	---	---	---	---	PASS
UCMA	221044	broad.mit.edu	37	10	13275614	13275614	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13275614G>A	uc001imd.2	-	3	217	c.144C>T	c.(142-144)TTC>TTT	p.F48F		NM_145314	NP_660357	Q8WVF2	UCMA_HUMAN	upper zone of growth plate and cartilage matrix	48						proteinaceous extracellular matrix					0						ATTCCTGCATGAAAATCTTCT	0.592													22	72	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105197798	105197798	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105197798A>G	uc001kwy.1	+	26	3959	c.3872A>G	c.(3871-3873)AAC>AGC	p.N1291S		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	1291	S1 motif 11.				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ACTGCAGACAACGTATTGACT	0.468													15	202	---	---	---	---	PASS
PRLHR	2834	broad.mit.edu	37	10	120353959	120353959	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120353959G>A	uc001ldp.1	-	2	937	c.798C>T	c.(796-798)GCC>GCT	p.A266A		NM_004248	NP_004239	P49683	PRLHR_HUMAN	G protein-coupled receptor 10	266	Cytoplasmic (Potential).				female pregnancy	integral to plasma membrane	neuropeptide Y receptor activity				0		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		GGTCCCAGTCGGCCTGGCTCT	0.672													5	6	---	---	---	---	PASS
OR51I1	390063	broad.mit.edu	37	11	5461827	5461827	+	Silent	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5461827G>C	uc010qze.1	-	1	918	c.918C>G	c.(916-918)CTC>CTG	p.L306L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	306	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAAGAACTTGAGAATCCCTT	0.453													5	112	---	---	---	---	PASS
PRR5L	79899	broad.mit.edu	37	11	36484190	36484190	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36484190C>T	uc001mwo.3	+	9	1400	c.1011C>T	c.(1009-1011)TCC>TCT	p.S337S	PRR5L_uc001mwp.2_Silent_p.S337S|PRR5L_uc009ykk.2_Silent_p.S209S|PRR5L_uc010rfc.1_3'UTR	NM_001160167	NP_001153639	Q6MZQ0	PRR5L_HUMAN	protor-2 isoform a	337										ovary(1)	1						GGCAGTGCTCCAGTGAGCCCA	0.667													13	19	---	---	---	---	PASS
GPR137	56834	broad.mit.edu	37	11	64055225	64055225	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64055225C>T	uc001nzg.1	+	4	748	c.440C>T	c.(439-441)TCG>TTG	p.S147L	GPR137_uc009ypj.1_Missense_Mutation_p.S153L|GPR137_uc010rni.1_Missense_Mutation_p.S205L|GPR137_uc001nze.1_Missense_Mutation_p.S147L|GPR137_uc001nzf.2_Missense_Mutation_p.S147L|GPR137_uc001nzh.1_Missense_Mutation_p.S147L|GPR137_uc001nzi.2_Missense_Mutation_p.S147L|GPR137_uc010rnj.1_Missense_Mutation_p.S147L	NM_020155	NP_064540	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	147	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1						GTGGGGGCCTCGCTGCTCTTT	0.682													6	37	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103049938	103049938	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103049938C>G	uc001pho.2	+	39	6467	c.6323C>G	c.(6322-6324)TCT>TGT	p.S2108C	DYNC2H1_uc001phn.1_Missense_Mutation_p.S2108C|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2108	AAA 2 (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GCCACAATATCTAGAATGGGA	0.333													25	13	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9265042	9265042	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9265042T>C	uc001qvk.1	-	3	474	c.361A>G	c.(361-363)ATG>GTG	p.M121V	A2M_uc009zgk.1_Intron	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	121					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	TTCTTAACCATCACTGTGGTC	0.453													48	20	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12303967	12303967	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12303967T>G	uc001rah.3	-	13	2939	c.2797A>C	c.(2797-2799)ACG>CCG	p.T933P	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.T933P	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	933	Extracellular (Potential).|Beta-propeller 4.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				AGGAAAGTCGTAGGAGCTTAA	0.353													17	72	---	---	---	---	PASS
CCDC91	55297	broad.mit.edu	37	12	28605543	28605543	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28605543C>T	uc001riq.2	+	10	1073	c.1057C>T	c.(1057-1059)CAG>TAG	p.Q353*	CCDC91_uc001rio.2_Nonsense_Mutation_p.Q323*|CCDC91_uc009zjk.2_RNA|CCDC91_uc001rip.1_Nonsense_Mutation_p.Q353*|CCDC91_uc001rir.2_Nonsense_Mutation_p.Q191*|CCDC91_uc009zjl.2_Nonsense_Mutation_p.Q155*	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner	353	Potential.|Homodimerization.				protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					AAAAGTATCTCAGGAAATTCA	0.279													25	121	---	---	---	---	PASS
PLEKHA9	51054	broad.mit.edu	37	12	45568077	45568077	+	Silent	SNP	A	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45568077A>T	uc001rom.1	-	3	609	c.72T>A	c.(70-72)ACT>ACA	p.T24T	PLEKHA9_uc009zke.2_Silent_p.T24T	NM_015899	NP_056983			pleckstrin homology domain containing, family A												0	Lung SC(27;0.192)|Renal(347;0.236)			GBM - Glioblastoma multiforme(48;0.173)		TGGACACACCAGTTGTGGTCA	0.398													95	275	---	---	---	---	PASS
HDAC7	51564	broad.mit.edu	37	12	48189022	48189022	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48189022G>A	uc010slo.1	-	11	1424	c.1229C>T	c.(1228-1230)CCG>CTG	p.P410L	HDAC7_uc001rqe.2_5'Flank|HDAC7_uc001rqj.3_Missense_Mutation_p.P373L|HDAC7_uc001rqk.3_Missense_Mutation_p.P393L	NM_015401	NP_056216	Q8WUI4	HDAC7_HUMAN	histone deacetylase 7 isoform a	371	Poly-Pro.|Transcription repression 2 (By similarity).				negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)		CATGGGGCCCGGCGGTGGGGG	0.637													102	57	---	---	---	---	PASS
MCRS1	10445	broad.mit.edu	37	12	49954075	49954075	+	Intron	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49954075C>T	uc001ruk.1	-						MCRS1_uc001rui.1_Intron|MCRS1_uc001ruj.1_Intron|MCRS1_uc001rul.1_Intron|MCRS1_uc009zlj.1_Intron|MCRS1_uc001rum.1_Intron	NM_006337	NP_006328	Q96EZ8	MCRS1_HUMAN	microspherule protein 1 isoform 1						DNA recombination|DNA repair|protein modification process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|MLL1 complex|nucleolus	protein binding			large_intestine(1)	1						TCCAGCCACTCACTTGAGCTT	0.592													17	364	---	---	---	---	PASS
DNAJC14	85406	broad.mit.edu	37	12	56222390	56222390	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56222390C>A	uc001shx.1	-	2	257	c.53G>T	c.(52-54)GGT>GTT	p.G18V	DNAJC14_uc001shu.1_Missense_Mutation_p.G18V|DNAJC14_uc009zob.1_Missense_Mutation_p.G18V|DNAJC14_uc001shy.1_Missense_Mutation_p.G18V	NM_032364	NP_115740	Q6Y2X3	DJC14_HUMAN	dopamine receptor interacting protein	18					protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding			ovary(3)|large_intestine(1)	4						GGAGGCACCACCACTGTGGTG	0.587													28	69	---	---	---	---	PASS
ANKRD52	283373	broad.mit.edu	37	12	56638887	56638887	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56638887A>G	uc001skm.3	-	22	2582	c.2492T>C	c.(2491-2493)GTG>GCG	p.V831A		NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	831	ANK 24.						protein binding			ovary(2)	2						AGGGACTTACACTGCACAGTG	0.532													40	124	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72021721	72021721	+	Intron	SNP	A	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72021721A>T	uc001swo.2	-							NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2						RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						AAAGCTATTTAAAAAAAAAGT	0.323													21	67	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116675500	116675500	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116675500G>A	uc001tvw.2	-	2	138	c.83C>T	c.(82-84)ACG>ATG	p.T28M		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	28					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TTTGATTCCCGTGAGTTCAGC	0.403													48	67	---	---	---	---	PASS
USPL1	10208	broad.mit.edu	37	13	31205523	31205523	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31205523G>A	uc001utc.2	+	4	1212	c.780G>A	c.(778-780)TCG>TCA	p.S260S	USPL1_uc001utb.2_Silent_p.S79S|USPL1_uc001utd.2_Intron|USPL1_uc001ute.1_5'Flank	NM_005800	NP_005791	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	260					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			pancreas(2)|skin(1)	3		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		GACTGTGCTCGAAGGAGGAAT	0.408													45	89	---	---	---	---	PASS
UTP14C	9724	broad.mit.edu	37	13	52605014	52605014	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52605014C>T	uc001vgb.2	+	2	2609	c.2074C>T	c.(2074-2076)CGG>TGG	p.R692W	UTP14C_uc001vgc.2_RNA	NM_021645	NP_067677	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	692					cell differentiation|meiosis|multicellular organismal development|rRNA processing|spermatogenesis	nucleolus|small-subunit processome				ovary(3)|large_intestine(1)|breast(1)	5		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		TACCCACCATCGGCAATTTGA	0.478													8	187	---	---	---	---	PASS
RASA3	22821	broad.mit.edu	37	13	114762093	114762093	+	Silent	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114762093G>C	uc001vui.2	-	21	2186	c.2055C>G	c.(2053-2055)GTC>GTG	p.V685V	RASA3_uc010tkk.1_Silent_p.V653V|RASA3_uc001vuj.2_Silent_p.V302V	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	685	Btk-type.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ACGGGTGGTAGACGGTGAGGC	0.637													8	12	---	---	---	---	PASS
RNASE6	6039	broad.mit.edu	37	14	21250155	21250155	+	Silent	SNP	C	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21250155C>A	uc001vye.3	+	2	590	c.297C>A	c.(295-297)GTC>GTA	p.V99V		NM_005615	NP_005606	Q93091	RNAS6_HUMAN	ribonuclease, RNase A family, k6 precursor	99					defense response|RNA catabolic process	extracellular region	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00406)		Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)		CAAAGCCTGTCAACATGACTG	0.502													51	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22111569	22111569	+	Missense_Mutation	SNP	C	T	T	rs1063358		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22111569C>T	uc001wbk.3	+	2	173	c.140C>T	c.(139-141)ACG>ATG	p.T47M						SubName: Full=Putative uncharacterized protein ENSP00000374930;																		ATGACAGCTACGGAAGGTGCC	0.507													32	52	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23890167	23890167	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23890167C>A	uc001wjx.2	-	26	3442	c.3336G>T	c.(3334-3336)CAG>CAT	p.Q1112H	MIR208B_hsa-mir-208b|MI0005570_5'Flank	NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1112	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CAGACCTCACCTGAAGCTCCT	0.562													3	39	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47314992	47314992	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47314992G>A	uc001wwj.3	-	16	2955	c.2759C>T	c.(2758-2760)GCA>GTA	p.A920V	MDGA2_uc001wwh.3_Missense_Mutation_p.A122V|MDGA2_uc001wwi.3_Missense_Mutation_p.A691V	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	920	MAM.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						GTCTTGTTTTGCACATTCTCC	0.308													23	30	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47351300	47351300	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47351300G>A	uc001wwj.3	-	11	2352	c.2156C>T	c.(2155-2157)CCT>CTT	p.P719L	MDGA2_uc001wwh.3_5'UTR|MDGA2_uc001wwi.3_Missense_Mutation_p.P490L|MDGA2_uc010ani.2_Missense_Mutation_p.P279L	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	719					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TTTGGTGAGAGGAGTCAGTCG	0.299													19	20	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64491095	64491095	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64491095C>T	uc001xgm.2	+	39	5988	c.5758C>T	c.(5758-5760)CAG>TAG	p.Q1920*	SYNE2_uc001xgl.2_Nonsense_Mutation_p.Q1920*	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1920	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCTCGTGGGTCAGGAATTCGA	0.448													20	38	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65259917	65259917	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65259917G>C	uc001xht.2	-	13	2518	c.2464C>G	c.(2464-2466)CGG>GGG	p.R822G	SPTB_uc001xhr.2_Missense_Mutation_p.R822G|SPTB_uc001xhs.2_Missense_Mutation_p.R822G|SPTB_uc001xhu.2_Missense_Mutation_p.R822G	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	822	Spectrin 6.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCCTGCAGCCGATGGGTCACA	0.657													3	49	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78205216	78205216	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78205216C>G	uc001xuf.2	-	5	465	c.438G>C	c.(436-438)AAG>AAC	p.K146N	SNW1_uc010tvm.1_Missense_Mutation_p.K71N|SNW1_uc010asu.2_5'UTR|SNW1_uc010tvn.1_Missense_Mutation_p.K146N	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein	146					negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CTACTCTTGTCTTTTCTGTTA	0.398													5	173	---	---	---	---	PASS
CDC42BPB	9578	broad.mit.edu	37	14	103406262	103406262	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103406262G>A	uc001ymi.1	-	33	4846	c.4614C>T	c.(4612-4614)GAC>GAT	p.D1538D		NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	1538					actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TGTCGGAGGTGTCCGGCACGT	0.627													24	57	---	---	---	---	PASS
RHOV	171177	broad.mit.edu	37	15	41165905	41165905	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41165905C>G	uc001znd.2	-	2	394	c.244G>C	c.(244-246)GAG>CAG	p.E82Q		NM_133639	NP_598378	Q96L33	RHOV_HUMAN	ras homolog gene family, member V	82					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome membrane|plasma membrane	GTP binding|metal ion binding				0		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.58e-05)|COAD - Colon adenocarcinoma(120;0.149)|BRCA - Breast invasive adenocarcinoma(123;0.163)		TCCCAGAGCTCAATGCGCACC	0.662													27	63	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62283886	62283886	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62283886G>T	uc002agz.2	-	17	1543	c.1469C>A	c.(1468-1470)TCA>TAA	p.S490*	VPS13C_uc002aha.2_Nonsense_Mutation_p.S447*|VPS13C_uc002ahb.1_Nonsense_Mutation_p.S490*|VPS13C_uc002ahc.1_Nonsense_Mutation_p.S447*	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	490					protein localization					ovary(2)	2						AGGAATCAATGATTCTTCGTC	0.343													77	130	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86228062	86228062	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86228062C>T	uc002blv.1	+	16	5417	c.5247C>T	c.(5245-5247)TTC>TTT	p.F1749F	AKAP13_uc002blt.1_Silent_p.F1731F|AKAP13_uc002blu.1_Silent_p.F1753F|AKAP13_uc010bnf.1_Silent_p.F371F|AKAP13_uc002blw.1_Silent_p.F216F|AKAP13_uc002blx.1_5'UTR|AKAP13_uc010bne.1_Silent_p.F402F	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1749					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						GTCGTACATTCAGCTACATCA	0.408													56	89	---	---	---	---	PASS
FAM65A	79567	broad.mit.edu	37	16	67574374	67574374	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67574374C>T	uc010vjp.1	+	9	801	c.705C>T	c.(703-705)TTC>TTT	p.F235F	FAM65A_uc010cei.1_Silent_p.F57F|FAM65A_uc002eth.2_Silent_p.F215F|FAM65A_uc010cej.2_Silent_p.F218F|FAM65A_uc002eti.1_Silent_p.F178F|FAM65A_uc010vjq.1_Silent_p.F229F|FAM65A_uc002etj.1_Silent_p.F214F|FAM65A_uc002etk.2_Silent_p.F214F	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	219						cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TGGCTGGCTTCGCCAGGCTGT	0.592													15	24	---	---	---	---	PASS
PLCG2	5336	broad.mit.edu	37	16	81927367	81927367	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81927367G>A	uc002fgt.2	+	12	1192	c.1040G>A	c.(1039-1041)CGC>CAC	p.R347H	PLCG2_uc010chg.1_Missense_Mutation_p.R347H	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	347	PI-PLC X-box.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						GCTTACATCCGCTGCCTGCGC	0.587													18	40	---	---	---	---	PASS
ZNF594	84622	broad.mit.edu	37	17	5087112	5087112	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5087112C>G	uc010cla.1	-	2	596	c.440G>C	c.(439-441)AGA>ACA	p.R147T		NM_032530	NP_115919	Q96JF6	ZN594_HUMAN	zinc finger protein 594	147	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3						TGTATGAATTCTCTGATGTAT	0.308													8	114	---	---	---	---	PASS
MYH10	4628	broad.mit.edu	37	17	8404231	8404231	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8404231C>G	uc002gll.2	-	27	3660	c.3564G>C	c.(3562-3564)AAG>AAC	p.K1188N	MYH10_uc002glm.2_Missense_Mutation_p.K1219N|MYH10_uc010cnx.2_Missense_Mutation_p.K1197N	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle	1188	Potential.				actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						CTTCATGGTTCTTAGTTTCCT	0.483													11	175	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10314183	10314183	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10314183C>G	uc002gmm.2	-	15	1593	c.1498G>C	c.(1498-1500)GAG>CAG	p.E500Q	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	500	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TCCTCCTGCTCTAGCACAAAC	0.468									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				13	171	---	---	---	---	PASS
LRRC37B	114659	broad.mit.edu	37	17	30377011	30377011	+	Intron	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30377011C>T	uc002hgu.2	+						LRRC37B_uc010wbx.1_Intron|LRRC37B_uc010csu.2_Intron	NM_052888	NP_443120	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B precursor							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				ttttttttttcttttttttAG	0.274													5	48	---	---	---	---	PASS
HSF5	124535	broad.mit.edu	37	17	56540518	56540518	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56540518C>T	uc002iwi.1	-	4	1291	c.1167G>A	c.(1165-1167)GAG>GAA	p.E389E		NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	389						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCTTTACCATCTCCAATTTAG	0.428													38	69	---	---	---	---	PASS
MFSD11	79157	broad.mit.edu	37	17	74771185	74771185	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74771185C>T	uc002jta.2	+	12	1954	c.981C>T	c.(979-981)CTC>CTT	p.L327L	MFSD11_uc002jtb.2_Silent_p.L327L|MFSD11_uc010dha.2_Silent_p.L275L|MFSD11_uc002jtc.2_Silent_p.L327L|MFSD11_uc002jtd.3_Silent_p.L327L|MFSD11_uc010dhb.2_Silent_p.L275L|MFSD11_uc002jte.2_Silent_p.L327L	NM_024311	NP_077287	O43934	MFS11_HUMAN	major facilitator superfamily domain containing	327	Helical; (Potential).					integral to membrane				ovary(1)	1						TAATATTTCTCAACATGCCTG	0.458													49	117	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77082434	77082434	+	3'UTR	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77082434G>A	uc002jwv.2	+	14					ENGASE_uc002jww.2_3'UTR	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase							cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						CTGCATGAGCGGATGCTAAGG	0.647													3	30	---	---	---	---	PASS
TBXA2R	6915	broad.mit.edu	37	19	3595827	3595827	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3595827G>A	uc002lyg.1	-	3	1105	c.891C>T	c.(889-891)GCC>GCT	p.A297A	TBXA2R_uc002lye.1_Missense_Mutation_p.H168Y	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	297	Helical; Name=7; (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	GGTTCCAGGTGGCCACGCGCA	0.677													4	0	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9061666	9061666	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9061666G>C	uc002mkp.2	-	3	25984	c.25780C>G	c.(25780-25782)CTC>GTC	p.L8594V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8596	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCAAGGGTGAGAAGTGCAGTC	0.488													23	111	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10468442	10468442	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10468442C>T	uc002moc.3	-	17	2842	c.2464G>A	c.(2464-2466)GAG>AAG	p.E822K	TYK2_uc010dxe.2_Missense_Mutation_p.E637K|TYK2_uc002mod.2_Missense_Mutation_p.E822K	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	822	Protein kinase 1.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			AGACATACCTCGGAGGGACTG	0.617													4	17	---	---	---	---	PASS
S1PR5	53637	broad.mit.edu	37	19	10625529	10625529	+	Silent	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10625529C>T	uc002mot.1	-	2	216	c.159G>A	c.(157-159)GAG>GAA	p.E53E	S1PR5_uc002mou.1_Silent_p.E53E	NM_030760	NP_110387	Q9H228	S1PR5_HUMAN	endothelial differentiation, sphingolipid	53	Helical; Name=1; (By similarity).					integral to membrane|plasma membrane	lysosphingolipid and lysophosphatidic acid receptor activity			central_nervous_system(1)|pancreas(1)	2						CGGCTAGATTCTCTAGCACGA	0.682													3	20	---	---	---	---	PASS
ZNF491	126069	broad.mit.edu	37	19	11917006	11917006	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11917006C>T	uc002mso.1	+	3	523	c.238C>T	c.(238-240)CGT>TGT	p.R80C		NM_152356	NP_689569	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	80					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ACATAAACAACGTAGGAAAGC	0.383													116	34	---	---	---	---	PASS
ZNF440	126070	broad.mit.edu	37	19	11943292	11943292	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11943292G>C	uc002msp.1	+	4	1457	c.1301G>C	c.(1300-1302)AGA>ACA	p.R434T		NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	434	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAAGCCTTCAGATATGTGAAT	0.418													11	137	---	---	---	---	PASS
ZNF440	126070	broad.mit.edu	37	19	11943610	11943610	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11943610G>C	uc002msp.1	+	4	1775	c.1619G>C	c.(1618-1620)AGA>ACA	p.R540T		NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	540					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACCCTGAAGAGAAACCCTATG	0.488													10	123	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17056395	17056395	+	Silent	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17056395G>A	uc002nfb.2	-	22	2930	c.2898C>T	c.(2896-2898)ATC>ATT	p.I966I		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	919						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						GATCCACCCCGATGGGGACCC	0.592													5	139	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56704223	56704223	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56704223C>T	uc010ygh.1	-	1	199	c.199G>A	c.(199-201)GAG>AAG	p.E67K		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	67	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TGGCACAGCTCAGTGAGTTTC	0.557													19	35	---	---	---	---	PASS
ZSCAN5A	79149	broad.mit.edu	37	19	56733683	56733683	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56733683C>G	uc002qmq.2	-	5	918	c.752G>C	c.(751-753)AGA>ACA	p.R251T	ZSCAN5A_uc010ygi.1_Missense_Mutation_p.R134T|ZSCAN5A_uc002qmr.2_Missense_Mutation_p.R251T|ZSCAN5A_uc002qms.1_Missense_Mutation_p.R250T	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	251					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						CTCCTTTGCTCTCACCAGATC	0.483													50	122	---	---	---	---	PASS
R3HDML	140902	broad.mit.edu	37	20	42972010	42972010	+	Intron	SNP	T	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42972010T>A	uc002xls.1	+							NM_178491	NP_848586	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like precursor							extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			GTCCCCCGCCTCCCCAGGTAC	0.413													13	36	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61527728	61527728	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61527728C>G	uc002ydr.1	-	8	2335	c.2071G>C	c.(2071-2073)GAC>CAC	p.D691H	DIDO1_uc002yds.1_Missense_Mutation_p.D691H|DIDO1_uc002ydt.1_Missense_Mutation_p.D691H|DIDO1_uc002ydu.1_Missense_Mutation_p.D691H	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	691	TFIIS central.				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					ATGATTAAGTCATCGCTGTCA	0.358													29	48	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	30909691	30909691	+	Missense_Mutation	SNP	C	T	T	rs151335244	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30909691C>T	uc011acs.1	-	17	3087	c.2623G>A	c.(2623-2625)GCT>ACT	p.A875T	GRIK1_uc002ynn.2_Missense_Mutation_p.A860T|GRIK1_uc011act.1_Missense_Mutation_p.A736T	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	Error:Variant_position_missing_in_P39086_after_alignment					central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	TCCATGATAGCGTTGAAAGAG	0.398													17	27	---	---	---	---	PASS
IL10RB	3588	broad.mit.edu	37	21	34648988	34648988	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34648988G>C	uc002yrk.1	+	3	360	c.261G>C	c.(259-261)TTG>TTC	p.L87F	IL10RB_uc002yrh.1_Missense_Mutation_p.L157F|IL10RB_uc002yri.1_Missense_Mutation_p.L40F|IL10RB_uc002yrl.1_Missense_Mutation_p.L89F	NM_000628	NP_000619	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta precursor	87	Extracellular (Potential).				immune response|inflammatory response	interleukin-28 receptor complex	protein binding|receptor activity				0						ACCACACCTTGAGAGTCAGGG	0.393													10	206	---	---	---	---	PASS
DGCR2	9993	broad.mit.edu	37	22	19036055	19036055	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19036055C>T	uc002zoq.1	-	7	1152	c.904G>A	c.(904-906)GAG>AAG	p.E302K	DGCR2_uc002zor.1_Missense_Mutation_p.E78K|DGCR2_uc011agr.1_Missense_Mutation_p.E258K|DGCR11_uc002zos.2_5'Flank	NM_005137	NP_005128	P98153	IDD_HUMAN	integral membrane protein DGCR2 precursor	302	Extracellular (Potential).|VWFC.				cell adhesion|organ morphogenesis	integral to membrane	receptor activity|sugar binding			large_intestine(1)	1	Colorectal(54;0.0993)					ATCTCAGGCTCCCCTCCATGG	0.572													126	189	---	---	---	---	PASS
NAGA	4668	broad.mit.edu	37	22	42461877	42461877	+	Silent	SNP	G	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42461877G>T	uc003bbx.2	-	7	761	c.624C>A	c.(622-624)ATC>ATA	p.I208I	NAGA_uc003bby.2_Silent_p.I208I|NAGA_uc003bbw.3_Silent_p.I208I	NM_000262	NP_000253	P17050	NAGAB_HUMAN	alpha-N-acetylgalactosaminidase precursor	208					glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity			central_nervous_system(1)	1						AGAGGTTGCAGATGTCCGCCA	0.572													4	38	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31893493	31893493	+	Intron	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31893493G>A	uc004dda.1	-						DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngn.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTGGAAACCTGAAAGGAAAAT	0.303													15	35	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32509432	32509432	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32509432C>T	uc004dda.1	-	20	2828	c.2584G>A	c.(2584-2586)GAG>AAG	p.E862K	DMD_uc004dcz.2_Missense_Mutation_p.E739K|DMD_uc004dcy.1_Missense_Mutation_p.E858K|DMD_uc004ddb.1_Missense_Mutation_p.E854K|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	862	Spectrin 5.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCTGTTGGCTCTGATGGGGTG	0.378													47	154	---	---	---	---	PASS
ERCC6L	54821	broad.mit.edu	37	X	71427938	71427938	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71427938G>A	uc004eaq.1	-	2	776	c.679C>T	c.(679-681)CTC>TTC	p.L227F	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Missense_Mutation_p.L104F	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	227	Helicase ATP-binding.				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)					GCTTCATCGAGGATGACATAG	0.413													65	192	---	---	---	---	PASS
CENPI	2491	broad.mit.edu	37	X	100387418	100387418	+	Silent	SNP	C	G	G			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100387418C>G	uc004egx.2	+	14	1713	c.1443C>G	c.(1441-1443)CTC>CTG	p.L481L	CENPI_uc011mrg.1_Silent_p.L481L|CENPI_uc004egy.2_Silent_p.L481L	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	481					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1						TAGCGCAGCTCTTCTTTACAT	0.323													12	222	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107802363	107802363	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107802363C>T	uc004enz.1	+	3	413	c.211C>T	c.(211-213)CCG>TCG	p.P71S	COL4A5_uc011mso.1_Missense_Mutation_p.P71S	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	71	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						AGAAGGGCCTCCGGGGCCTCG	0.473									Alport_syndrome_with_Diffuse_Leiomyomatosis				19	207	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122745309	122745309	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122745309C>T	uc004etu.2	-	37	4768	c.4736G>A	c.(4735-4737)GGA>GAA	p.G1579E	THOC2_uc004etv.3_5'Flank|THOC2_uc010nqt.1_RNA|THOC2_uc004etw.1_Missense_Mutation_p.G400E	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1579	Lys-rich.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						CTCTTCCTTTCCTCCTGAACT	0.353													34	162	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123838977	123838977	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123838977A>T	uc004euj.2	-	5	965	c.901T>A	c.(901-903)TCC>ACC	p.S301T	ODZ1_uc011muj.1_Missense_Mutation_p.S301T|ODZ1_uc010nqy.2_Missense_Mutation_p.S301T	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	301	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GCAGGTCGGGAAAAGGTGCTT	0.527													61	272	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129155081	129155081	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129155081C>T	uc004evb.1	+	5	3677	c.3563C>T	c.(3562-3564)CCG>CTG	p.P1188L	BCORL1_uc010nrd.1_Missense_Mutation_p.P1090L	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	1188					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						CCGACAAAGCCGGAGTCCCAG	0.632													10	21	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153582588	153582588	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153582588C>T	uc004fkk.2	-	34	5737	c.5488G>A	c.(5488-5490)GTG>ATG	p.V1830M	FLNA_uc004fki.2_5'Flank|FLNA_uc011mzn.1_Missense_Mutation_p.V21M|FLNA_uc010nuu.1_Missense_Mutation_p.V1822M	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1830	Filamin 16.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCATACCGCACGGTCACGGTG	0.652													14	45	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						CTGTTTTTTTTGTTTGTTTGTT	0.317													4	2	---	---	---	---	
KIAA0467	23334	broad.mit.edu	37	1	43912108	43912109	+	Intron	DEL	CA	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43912108_43912109delCA	uc001cjk.1	+						KIAA0467_uc001cjl.1_Intron	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GAGCTGCGGGCACAGTCAGTGC	0.554													30	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	113433615	113433616	+	IGR	INS	-	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113433615_113433616insT								FAM19A3 (163761 upstream) : SLC16A1 (20856 downstream)																							ttattcacttattttttttttt	0.208													9	4	---	---	---	---	
LOC728989	728989	broad.mit.edu	37	1	146495480	146495481	+	Intron	INS	-	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146495480_146495481insA	uc001epd.2	-							NR_024442				SubName: Full=cDNA FLJ59595, highly similar to Homo sapiens phosphodiesterase 4D interacting protein, transcript variant 1, mRNA;												0						TGCAAAGCATGAAAAAAAACAA	0.436													4	2	---	---	---	---	
DENND4B	9909	broad.mit.edu	37	1	153912718	153912722	+	Frame_Shift_Del	DEL	TTCTT	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153912718_153912722delTTCTT	uc001fdd.1	-	11	1914_1918	c.1513_1517delAAGAA	c.(1513-1518)AAGAAGfs	p.K505fs		NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	505_506										ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGAGAGGAGCTTCTTTTCCTCAGTC	0.585													33	19	---	---	---	---	
ARHGEF11	9826	broad.mit.edu	37	1	157014370	157014371	+	5'UTR	INS	-	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157014370_157014371insA	uc001fqo.2	-	1					ARHGEF11_uc001fqn.2_5'UTR	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					aaagaaaaaagaaaaaaaaagg	0.342													4	3	---	---	---	---	
ARID4B	51742	broad.mit.edu	37	1	235465579	235465580	+	Intron	INS	-	AGGGAGGG	AGGGAGGG	rs139132686	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235465579_235465580insAGGGAGGG	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			gggaagtgtaaagggagggagg	0.020													4	2	---	---	---	---	
B3GALNT2	148789	broad.mit.edu	37	1	235652776	235652776	+	Intron	DEL	T	-	-	rs11299116		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235652776delT	uc001hxc.2	-						B3GALNT2_uc001hxd.1_Intron	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2						protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			GCATGAGTCCTTTATTGCAAT	0.338													4	4	---	---	---	---	
TMEM17	200728	broad.mit.edu	37	2	62728113	62728113	+	3'UTR	DEL	A	-	-	rs75662659		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62728113delA	uc002sbt.2	-	4					TMEM17_uc002sbu.2_3'UTR|TMEM17_uc002sbv.1_3'UTR	NM_198276	NP_938017	Q86X19	TMM17_HUMAN	transmembrane protein 17							integral to membrane					0	Lung NSC(7;0.0274)|all_lung(7;0.0568)		LUSC - Lung squamous cell carcinoma(7;1.31e-05)|Epithelial(17;0.169)			CAACAACATCAAAAAAAATTA	0.358													1	5	---	---	---	---	
TMEM182	130827	broad.mit.edu	37	2	103378582	103378582	+	5'UTR	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103378582delT	uc010fjb.2	+	1					TMEM182_uc002tcc.3_Intron|TMEM182_uc002tcd.3_Intron	NM_144632	NP_653233	Q6ZP80	TM182_HUMAN	transmembrane protein 182 precursor							integral to membrane					0						aatattattcttttttttttt	0.343													3	3	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107049257	107049257	+	Intron	DEL	G	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107049257delG	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						aaaaaaaaaaGACCAAAATGT	0.234													4	2	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	138000234	138000234	+	Intron	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138000234delT	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGTGAGCACCTTTTTTTTTTT	0.393													6	3	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	159992513	159992514	+	Intron	INS	-	TGTG	TGTG	rs13011527		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992513_159992514insTGTG	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc002uah.1_5'Flank	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						TACTGAAATTTtgtgtgtgtgt	0.371													4	2	---	---	---	---	
OGG1	4968	broad.mit.edu	37	3	9799704	9799705	+	Intron	DEL	AC	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9799704_9799705delAC	uc003bsm.2	+						OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bst.2_Intron|CAMK1_uc003bsu.2_Intron|CAMK1_uc003bss.2_Intron|uc003bsv.1_5'Flank	NM_016821	NP_058214	O15527	OGG1_HUMAN	8-oxoguanine DNA-glycosylase 1 isoform 2a						depurination|nucleotide-excision repair|regulation of protein import into nucleus, translocation|regulation of transcription, DNA-dependent|response to oxidative stress|response to radiation	mitochondrion|nuclear matrix|nuclear speck	damaged DNA binding|endonuclease activity|oxidized purine base lesion DNA N-glycosylase activity|protein binding				0	Medulloblastoma(99;0.227)					Ttatatatttacacacacacac	0.173								BER_DNA_glycosylases					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	88752126	88752141	+	IGR	DEL	TTCCTTCCTTCCTTCC	-	-	rs66786643	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88752126_88752141delTTCCTTCCTTCCTTCC								C3orf38 (545013 upstream) : EPHA3 (404533 downstream)																							ccttccttctttccttccttccttccttccttcctt	0.102													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196395222	196395223	+	IGR	DEL	AG	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196395222_196395223delAG								LRRC33 (6350 upstream) : C3orf34 (37926 downstream)																							agaaagagaaagagagagagag	0.064													5	4	---	---	---	---	
COL25A1	84570	broad.mit.edu	37	4	109774176	109774176	+	Intron	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109774176delT	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzd.2_Intron|COL25A1_uc003hzf.2_Intron	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TTTGAATATGTTTGGCTAGTC	0.289													19	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6571881	6571884	+	IGR	DEL	GAAG	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6571881_6571884delGAAG								UBE2QL1 (79176 upstream) : LOC255167 (10403 downstream)																							agggaggagagaaggaaggaagga	0.000													4	5	---	---	---	---	
MTRR	4552	broad.mit.edu	37	5	7885676	7885676	+	Intron	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7885676delT	uc003jed.2	+						MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CAATTGTGTGTTTTTTTTTTT	0.254													4	3	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121787399	121787400	+	Intron	INS	-	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121787399_121787400insA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GAATCCCCAGGAAAAAAAAAAA	0.376													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122973171	122973176	+	IGR	DEL	AAAAAA	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122973171_122973176delAAAAAA								CSNK1G3 (20709 upstream) : ZNF608 (999434 downstream)																							ATTGGATGTCaaaaaaaaaaaaaaaa	0.243													4	2	---	---	---	---	
UNC5CL	222643	broad.mit.edu	37	6	41028896	41028898	+	Intron	DEL	TTT	-	-	rs35586672		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41028896_41028898delTTT	uc010jxe.1	-						APOBEC2_uc003opl.2_Intron|APOBEC2_uc010jxf.2_Intron	NM_173561	NP_775832	Q8IV45	UN5CL_HUMAN	unc-5 homolog C-like						signal transduction	cytoplasm|integral to membrane				ovary(2)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					TTTTTAATGCttttttttttttt	0.379													4	2	---	---	---	---	
KIAA0240	23506	broad.mit.edu	37	6	42790382	42790382	+	Intron	DEL	A	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42790382delA	uc003osn.1	+						KIAA0240_uc003osm.1_Intron|KIAA0240_uc011duw.1_Intron|KIAA0240_uc003oso.1_Intron|KIAA0240_uc003osp.1_Intron	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			AAACAAGATTAAAAAAAAAAA	0.234													4	2	---	---	---	---	
ELOVL4	6785	broad.mit.edu	37	6	80631176	80631177	+	Intron	INS	-	AA	AA	rs35137040		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80631176_80631177insAA	uc003pja.3	-						ELOVL4_uc011dyt.1_Intron	NM_022726	NP_073563	Q9GZR5	ELOV4_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups			ovary(1)|skin(1)	2		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	gactccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
IGF2R	3482	broad.mit.edu	37	6	160483802	160483802	+	Intron	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160483802delT	uc003qta.2	+							NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		TTCCTTGAGCTTTTTTTTTTA	0.428													4	2	---	---	---	---	
KIAA1324L	222223	broad.mit.edu	37	7	86536849	86536850	+	Intron	INS	-	A	A	rs72283133		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86536849_86536850insA	uc011kha.1	-						KIAA1324L_uc003uif.1_Intron|KIAA1324L_uc011kgz.1_Intron|KIAA1324L_uc003uie.2_Intron	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					ACATTCCCTACAAAAAAAAAAA	0.322													4	2	---	---	---	---	
GATA3	2625	broad.mit.edu	37	10	8106259	8106265	+	Intron	DEL	TCTTTTC	-	-	rs60280763		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8106259_8106265delTCTTTTC	uc001ika.2	+						GATA3_uc001ijz.2_Intron	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2						aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						tttctttctttcttttcttcttcttct	0.329			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	94985788	94985789	+	IGR	INS	-	T	T	rs140557797	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94985788_94985789insT								CYP26A1 (148147 upstream) : MYOF (80398 downstream)																							cccagagggagtgttacagtgc	0.000													4	2	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097212	135097213	+	Intron	INS	-	CGCCCTGCCTCGCCCCT	CGCCCTGCCTCGCCCCT	rs147704556	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097212_135097213insCGCCCTGCCTCGCCCCT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		cctctcccgcacgccctgcctc	0.089													5	3	---	---	---	---	
CCDC77	84318	broad.mit.edu	37	12	518391	518392	+	Intron	INS	-	A	A			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:518391_518392insA	uc001qig.2	+						CCDC77_uc009zdk.2_Intron|CCDC77_uc010sdp.1_Intron|CCDC77_uc010sdq.1_Intron	NM_032358	NP_115734	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77 isoform a							centrosome				ovary(1)	1	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			aaaaaaaaaagaaaaaaaaaaC	0.144													9	4	---	---	---	---	
VWF	7450	broad.mit.edu	37	12	6062680	6062682	+	In_Frame_Del	DEL	TCC	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6062680_6062682delTCC	uc001qnn.1	-	48	8216_8218	c.7966_7968delGGA	c.(7966-7968)GGAdel	p.G2656del	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	2656					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TCATGATCTGTCCTCCTCTTAGC	0.463													60	90	---	---	---	---	
GPRC5A	9052	broad.mit.edu	37	12	13065680	13065680	+	3'UTR	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13065680delT	uc001rba.2	+	4					uc001rbb.3_5'Flank	NM_003979	NP_003970	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, family C, group 5,							cytoplasmic vesicle membrane|Golgi apparatus|integral to plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	CGCTGTAGTATTTTTTTTTTT	0.398													4	2	---	---	---	---	
PTPRR	5801	broad.mit.edu	37	12	71066812	71066813	+	Intron	DEL	AA	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71066812_71066813delAA	uc001swi.1	-						PTPRR_uc001swh.1_Intron|PTPRR_uc009zrs.2_Intron|PTPRR_uc010stq.1_Intron|PTPRR_uc010str.1_Intron	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R						in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GGGCCaaagcaaaaaaaaaaaa	0.391													4	2	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78592505	78592505	+	Intron	DEL	G	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78592505delG	uc001syp.2	+						NAV3_uc001syo.2_Intron|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GTTTTGTGTTGGGGGGGGCAG	0.398										HNSCC(70;0.22)			27	24	---	---	---	---	
TMPO	7112	broad.mit.edu	37	12	98914085	98914088	+	Intron	DEL	TTCT	-	-	rs113936216		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98914085_98914088delTTCT	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						ccttccttccttcTGTGTGTGTGA	0.039													4	2	---	---	---	---	
NDFIP2	54602	broad.mit.edu	37	13	80122251	80122252	+	Intron	INS	-	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80122251_80122252insT	uc001vlf.2	+						NDFIP2_uc010tib.1_Intron|NDFIP2_uc001vlg.2_Intron	NM_019080	NP_061953	Q9NV92	NFIP2_HUMAN	Nedd4 family interacting protein 2 isoform 1						negative regulation of gene expression|negative regulation of protein transport|negative regulation of transporter activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein ubiquitination	endoplasmic reticulum|Golgi membrane|integral to membrane|mitochondrion|multivesicular body membrane|perinuclear region of cytoplasm	signal transducer activity|WW domain binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)		AAATACTCCAATTTTTTTTTTG	0.287													4	2	---	---	---	---	
SEL1L	6400	broad.mit.edu	37	14	81943647	81943648	+	Intron	INS	-	TGTGTG	TGTGTG	rs140905448	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81943647_81943648insTGTGTG	uc010tvv.1	-							NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor						Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		ACGTTTTGCAAtgtgtgtgtgt	0.257													6	3	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66257236	66257237	+	Intron	INS	-	A	A	rs138144863	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66257236_66257237insA	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						CGCCCATTCCCAGCTCATACCT	0.673													4	5	---	---	---	---	
IL16	3603	broad.mit.edu	37	15	81561643	81561643	+	Intron	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81561643delT	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						TTAGTGAGCCTTTTGGCTGCT	0.507													4	2	---	---	---	---	
KIAA0556	23247	broad.mit.edu	37	16	27629732	27629732	+	Intron	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27629732delT	uc002dow.2	+							NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						CACTGCTCTGTTTCTTCATTT	0.502													31	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60214848	60214855	+	IGR	DEL	TTCCGTCT	-	-	rs71979129		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60214848_60214855delTTCCGTCT								None (None upstream) : None (None downstream)																							ccttccttccttccgtctgtctgtctgt	0.000													4	2	---	---	---	---	
SF3B3	23450	broad.mit.edu	37	16	70602096	70602097	+	Intron	INS	-	GT	GT			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70602096_70602097insGT	uc002ezf.2	+							NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				TTCTGCTGACCCTACGTATGTC	0.401													41	20	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16623497	16623498	+	Intron	INS	-	T	T			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16623497_16623498insT	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						AAAAGGAATTGTTTTTTTTTTT	0.248													5	3	---	---	---	---	
ULK2	9706	broad.mit.edu	37	17	19684555	19684555	+	Intron	DEL	C	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19684555delC	uc002gwm.3	-						ULK2_uc002gwn.2_Intron	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2						signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TCtttcttttctttttttttt	0.159													4	2	---	---	---	---	
ITGA3	3675	broad.mit.edu	37	17	48157869	48157870	+	Intron	INS	-	GA	GA	rs2018134	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48157869_48157870insGA	uc010dbl.2	+						ITGA3_uc010dbm.2_Intron	NM_002204	NP_002195	P26006	ITA3_HUMAN	integrin alpha 3 isoform a precursor						blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|leukocyte migration	cell surface|integrin complex	protein binding|receptor activity			ovary(2)|pancreas(1)	3						tgtgtgtgtgtgatttgcgtgt	0.282													5	3	---	---	---	---	
CDH2	1000	broad.mit.edu	37	18	25585623	25585623	+	Intron	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25585623delT	uc002kwg.2	-						CDH2_uc010xbn.1_Intron	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein						adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						ATAAGAAGGATTTTTTTTTTG	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	72057053	72057054	+	IGR	INS	-	T	T	rs79986462		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72057053_72057054insT								CYB5A (97832 upstream) : FAM69C (45910 downstream)																							ttattttattattatttttttt	0.158													6	4	---	---	---	---	
THOP1	7064	broad.mit.edu	37	19	2807339	2807339	+	Intron	DEL	C	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2807339delC	uc002lwj.2	+						THOP1_uc010xgz.1_Intron|THOP1_uc002lwk.2_5'Flank	NM_003249	NP_003240	P52888	THOP1_HUMAN	thimet oligopeptidase 1						proteolysis	cytoplasm	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCTCCCTTCCAAATGGGGA	0.726													4	2	---	---	---	---	
PSG6	5675	broad.mit.edu	37	19	43556931	43556931	+	Intron	DEL	A	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43556931delA	uc002ovi.2	-						PSG10_uc002ouv.1_Intron|PSG6_uc010xwk.1_Intron			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				GCTGTCATGGAAAAAAAAAGA	0.323													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	22713371	22713371	+	IGR	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22713371delT								FOXA2 (147270 upstream) : SSTR4 (302686 downstream)																							tctaagttagtttTTTTTTGA	0.219													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41306344	41306344	+	Intron	DEL	C	-	-	rs2425514	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41306344delC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AACAAACAAACAAAAAAAACC	0.408													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62737123	62737125	+	IGR	DEL	CGT	-	-	rs116947278	by1000genomes	TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62737123_62737125delCGT								OPRL1 (5132 upstream) : NPBWR2 (59 downstream)																							tgatgatgggcgtgatgatgatg	0.212													4	2	---	---	---	---	
SNRPD3	6634	broad.mit.edu	37	22	24967719	24967719	+	Intron	DEL	A	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24967719delA	uc003aam.1	+						SNRPD3_uc011aju.1_Intron	NM_004175	NP_004166	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein polypeptide D3						histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	enzyme binding|histone pre-mRNA DCP binding			ovary(1)	1						ctcaaaaaataaaaaaaaaaa	0.259													4	2	---	---	---	---	
C22orf23	84645	broad.mit.edu	37	22	38347219	38347219	+	Intron	DEL	A	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38347219delA	uc003auj.1	-						C22orf23_uc003auk.1_Intron|POLR2F_uc010gxi.2_5'Flank|POLR2F_uc003aul.2_5'Flank|POLR2F_uc003aum.2_5'Flank	NM_032561	NP_115950	Q9BZE7	EVG1_HUMAN	hypothetical protein LOC84645												0	Melanoma(58;0.045)					actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CA5BP	340591	broad.mit.edu	37	X	15707112	15707112	+	Intron	DEL	A	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15707112delA	uc011mir.1	+							NR_026551				RecName: Full=Putative carbonic anhydrase 5B-like protein; AltName: Full=CA-VB-like protein;												0						ATTGGAATTTAAAAAAAaatt	0.189													4	2	---	---	---	---	
NR0B1	190	broad.mit.edu	37	X	30328948	30328948	+	5'Flank	DEL	T	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30328948delT	uc004dcf.3	-							NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1						adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	ccttccttcctttccttcctt	0.060													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	53063295	53063298	+	IGR	DEL	GAGG	-	-			TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53063295_53063298delGAGG								FAM156A (125712 upstream) : GPR173 (15208 downstream)																							gggagggagcgagggagggaggga	0.000													4	2	---	---	---	---	
ZNF185	7739	broad.mit.edu	37	X	152100447	152100457	+	Intron	DEL	CCCACTGTTCC	-	-	rs66958885		TCGA-C5-A1MF-01	TCGA-C5-A1MF-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152100447_152100457delCCCACTGTTCC	uc010ntv.1	+						ZNF185_uc011myg.1_Intron|ZNF185_uc011myh.1_Intron|ZNF185_uc011myi.1_Intron|ZNF185_uc011myj.1_Intron|ZNF185_uc011myk.1_Intron|ZNF185_uc004fgw.3_Intron|ZNF185_uc004fgu.2_Intron|ZNF185_uc004fgv.2_Intron	NM_007150	NP_009081	O15231	ZN185_HUMAN	zinc finger protein 185							cytoplasm|cytoskeleton|focal adhesion	zinc ion binding			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					aggtcctgttcccactgttcccccagtacct	0.327													4	2	---	---	---	---	
