Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16913608	16913608	+	Missense_Mutation	SNP	T	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16913608T>C	uc009vos.1	-	11	1603	c.715A>G	c.(715-717)ACT>GCT	p.T239A	NBPF1_uc009vot.1_5'UTR|NBPF1_uc001ayz.1_5'UTR|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	239	NBPF 1.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ACAACCAGAGTTGAGTTGACT	0.448													4	307	---	---	---	---	PASS
AHDC1	27245	broad.mit.edu	37	1	27875174	27875174	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27875174C>T	uc009vsy.2	-	6	4422	c.3453G>A	c.(3451-3453)CAG>CAA	p.Q1151Q	AHDC1_uc009vsz.1_Silent_p.Q1151Q	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1151							DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCTTCACCTTCTGCGGTGTGT	0.582													19	115	---	---	---	---	PASS
ZBTB8A	653121	broad.mit.edu	37	1	33065750	33065750	+	Silent	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33065750G>A	uc001bvn.2	+	5	1541	c.1056G>A	c.(1054-1056)GGG>GGA	p.G352G	ZBTB8A_uc001bvk.2_RNA|ZBTB8A_uc001bvm.2_Intron	NM_001040441	NP_001035531	Q96BR9	ZBT8A_HUMAN	zinc finger and BTB domain containing 8A	352					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATCTAACAGGGCAAGTGGTAC	0.428													3	57	---	---	---	---	PASS
IPO13	9670	broad.mit.edu	37	1	44433064	44433064	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44433064C>T	uc001ckx.2	+	19	3486	c.2691C>T	c.(2689-2691)TTC>TTT	p.F897F	IPO13_uc001cky.2_Silent_p.F115F	NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	897					protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				AGCACTGCTTCAGCCTCCTGA	0.612													16	119	---	---	---	---	PASS
ATP5F1	515	broad.mit.edu	37	1	112002183	112002183	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112002183G>A	uc001ebc.2	+	6	1039	c.618G>A	c.(616-618)ATG>ATA	p.M206I	ATP5F1_uc009wgf.1_Missense_Mutation_p.M353I|ATP5F1_uc001ebd.3_RNA	NM_001688	NP_001679	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial F0	206					ATP catabolic process|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transporting ATP synthase activity, rotational mechanism|protein binding				0		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGCAGAACATGATGCGTCGAA	0.423													15	64	---	---	---	---	PASS
DENND2C	163259	broad.mit.edu	37	1	115142027	115142027	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115142027C>T	uc001efd.1	-	16	2853	c.2151G>A	c.(2149-2151)CCG>CCA	p.P717P	DENND2C_uc001eez.2_Intron|DENND2C_uc001efc.1_Silent_p.P660P	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	717	DENN.									skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCAGGTGAACGGATACAGTG	0.463													22	41	---	---	---	---	PASS
S100A1	6271	broad.mit.edu	37	1	153604234	153604234	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153604234G>A	uc001fck.1	+	3	315	c.202G>A	c.(202-204)GGG>AGG	p.G68R	C1orf77_uc001fcm.1_5'Flank|C1orf77_uc001fcn.1_5'Flank|S100A13_uc001fcj.2_Intron|S100A1_uc001fcl.1_RNA|C1orf77_uc009woi.1_5'Flank|C1orf77_uc009woj.1_5'Flank	NM_006271	NP_006262	P23297	S10A1_HUMAN	S100 calcium binding protein A1	68	2; high affinity.|EF-hand 2.				intracellular signal transduction|regulation of heart contraction	nucleus|protein complex|sarcoplasmic reticulum	ATPase binding|calcium ion binding|protein homodimerization activity|S100 alpha binding|S100 beta binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	GAATGGAGACGGGGAGGTGGA	0.542													186	249	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156907208	156907208	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156907208G>A	uc001fqo.2	-	38	5193	c.4153C>T	c.(4153-4155)CAG>TAG	p.Q1385*	ARHGEF11_uc010phu.1_Nonsense_Mutation_p.Q801*|ARHGEF11_uc001fqn.2_Nonsense_Mutation_p.Q1425*|MIR765_hsa-mir-765|MI0005116_5'Flank	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1385					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGTCAGGCTGAGGGGGGCTC	0.622													16	100	---	---	---	---	PASS
ADCY10	55811	broad.mit.edu	37	1	167791359	167791359	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167791359C>G	uc001ger.2	-	30	4487	c.4189G>C	c.(4189-4191)GAA>CAA	p.E1397Q	ADCY10_uc009wvj.2_RNA|ADCY10_uc009wvk.2_Missense_Mutation_p.E1305Q|ADCY10_uc010plj.1_Missense_Mutation_p.E1244Q	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	1397					intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						AAACATTCTTCAAATGTTCTA	0.398													13	93	---	---	---	---	PASS
FAM129A	116496	broad.mit.edu	37	1	184764870	184764870	+	Silent	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184764870G>C	uc001gra.2	-	14	2222	c.2028C>G	c.(2026-2028)CTC>CTG	p.L676L	FAM129A_uc001grb.1_Intron	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2	676					negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						ATGTGCCCGGGAGTCCTGCTG	0.577													9	109	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197072159	197072159	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197072159C>T	uc001gtu.2	-	18	6479	c.6222G>A	c.(6220-6222)CAG>CAA	p.Q2074Q	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	2074	IQ 15.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						GATACCATCTCTGAATTATAA	0.323													7	210	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203693066	203693066	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203693066C>G	uc001gzw.2	+	19	3966	c.3082C>G	c.(3082-3084)CAG>GAG	p.Q1028E	ATP2B4_uc001gzv.2_Missense_Mutation_p.Q1028E|ATP2B4_uc009xaq.2_Missense_Mutation_p.Q1028E|ATP2B4_uc001gzx.2_Missense_Mutation_p.Q59E|ATP2B4_uc009xar.2_Intron	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	1028	Helical; (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGCCTGTCTCAGTGGCTGTG	0.522													10	77	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848679	215848679	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848679G>A	uc001hku.1	-	63	12961	c.12574C>T	c.(12574-12576)CGC>TGC	p.R4192C		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4192	Extracellular (Potential).|Fibronectin type-III 27.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAGCATCTGCGAATCACTTCA	0.438										HNSCC(13;0.011)			16	127	---	---	---	---	PASS
DQX1	165545	broad.mit.edu	37	2	74751187	74751187	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74751187C>T	uc010yrw.1	-	4	844	c.679G>A	c.(679-681)GAG>AAG	p.E227K	DQX1_uc002smc.2_5'Flank	NM_133637	NP_598376	Q8TE96	DQX1_HUMAN	DEAQ box polypeptide 1 (RNA-dependent ATPase)	227						nucleus	ATP binding|helicase activity|nucleic acid binding			ovary(2)	2						TCACCAGGCTCTCTGGGTATA	0.562													27	84	---	---	---	---	PASS
ATOH8	84913	broad.mit.edu	37	2	85982063	85982063	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85982063G>C	uc002sqn.2	+	1	1155	c.751G>C	c.(751-753)GAG>CAG	p.E251Q	ATOH8_uc002sqm.3_Missense_Mutation_p.E251Q	NM_032827	NP_116216	Q96SQ7	ATOH8_HUMAN	atonal homolog 8	251	Helix-loop-helix motif.				cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						CGCAGCCTTCGAGGCGCTCAG	0.716													5	30	---	---	---	---	PASS
POLR1A	25885	broad.mit.edu	37	2	86259429	86259429	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86259429G>C	uc002sqs.2	-	29	4617	c.4238C>G	c.(4237-4239)TCT>TGT	p.S1413C	POLR1A_uc010ytb.1_Missense_Mutation_p.S779C	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	1413					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						TTTGGCATCAGAGGCATCGGC	0.597													15	87	---	---	---	---	PASS
CASP8	841	broad.mit.edu	37	2	202136259	202136259	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202136259C>G	uc002uxr.1	+	4	535	c.326C>G	c.(325-327)TCA>TGA	p.S109*	CASP8_uc010ftc.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxo.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxp.1_Nonsense_Mutation_p.S141*|CASP8_uc002uxq.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxs.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxt.1_Nonsense_Mutation_p.S168*|CASP8_uc002uxu.1_RNA|CASP8_uc010ftd.1_Nonsense_Mutation_p.S6*|CASP8_uc002uxv.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxw.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxy.1_Nonsense_Mutation_p.S109*|CASP8_uc002uxx.1_Nonsense_Mutation_p.S109*|CASP8_uc010ftf.2_Nonsense_Mutation_p.S109*|CASP8_uc010fte.1_Nonsense_Mutation_p.S6*	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor	109	DED 2.				activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						TATCAGATTTCAGAAGAAGTG	0.398										HNSCC(4;0.00038)			9	42	---	---	---	---	PASS
CASP8	841	broad.mit.edu	37	2	202149710	202149710	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202149710G>A	uc002uxr.1	+	9	1183	c.974G>A	c.(973-975)GGC>GAC	p.G325D	CASP8_uc002uxp.1_Missense_Mutation_p.G342D|CASP8_uc002uxq.1_Missense_Mutation_p.G310D|CASP8_uc002uxt.1_Missense_Mutation_p.G384D|CASP8_uc002uxu.1_RNA|CASP8_uc002uxw.1_Missense_Mutation_p.G310D|CASP8_uc002uxy.1_Intron|CASP8_uc002uxx.1_Intron|CASP8_uc010ftf.2_Missense_Mutation_p.G241D	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor	325					activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						ATCATCTATGGCACTGATGGA	0.458										HNSCC(4;0.00038)			6	124	---	---	---	---	PASS
WNT10A	80326	broad.mit.edu	37	2	219754750	219754750	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219754750G>A	uc002vjd.1	+	3	884	c.421G>A	c.(421-423)GTG>ATG	p.V141M		NM_025216	NP_079492	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family,	141					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|female gonad development|hair follicle morphogenesis|odontogenesis|regulation of odontogenesis of dentine-containing tooth|sebaceous gland development|skin development|tongue development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			lung(1)|skin(1)	2		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCAGCTGGCGTGGTGCACGC	0.532													21	34	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49694757	49694757	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49694757G>A	uc003cxe.3	+	5	7882	c.7768G>A	c.(7768-7770)GAG>AAG	p.E2590K		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	2590					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GACAGACGATGAGGATGGGGA	0.637													4	43	---	---	---	---	PASS
RAD54L2	23132	broad.mit.edu	37	3	51697389	51697389	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51697389G>A	uc011bdt.1	+	22	4482	c.4357G>A	c.(4357-4359)GAT>AAT	p.D1453N	RAD54L2_uc003dbh.2_Missense_Mutation_p.D1042N|RAD54L2_uc011bdu.1_Missense_Mutation_p.D1147N|RAD54L2_uc003dbj.2_Missense_Mutation_p.D779N	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2	1453						nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CAGCTCCAATGATGATGAGGA	0.577													9	54	---	---	---	---	PASS
OR5H6	79295	broad.mit.edu	37	3	97983721	97983721	+	Missense_Mutation	SNP	T	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97983721T>A	uc003dsi.1	+	1	593	c.593T>A	c.(592-594)ATC>AAC	p.I198N		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	198	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						TGTGACATTATCCCATTGTTA	0.318													4	77	---	---	---	---	PASS
LNP1	348801	broad.mit.edu	37	3	100170714	100170714	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100170714G>C	uc003dtx.3	+	3	1588	c.308G>C	c.(307-309)AGA>ACA	p.R103T	LNP1_uc003dty.3_RNA|LNP1_uc011bhb.1_RNA	NM_001085451	NP_001078920	A1A4G5	LNP1_HUMAN	leukemia NUP98 fusion partner 1	103											0						TCAAAAGGAAGATCCCATTCC	0.438													9	83	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121414091	121414091	+	Missense_Mutation	SNP	T	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121414091T>G	uc003eei.3	-	13	5390	c.5264A>C	c.(5263-5265)GAG>GCG	p.E1755A	GOLGB1_uc010hrc.2_Missense_Mutation_p.E1760A|GOLGB1_uc003eej.3_Missense_Mutation_p.E1721A|GOLGB1_uc011bjm.1_Missense_Mutation_p.E1641A|GOLGB1_uc010hrd.1_Missense_Mutation_p.E1719A	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1755	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		ATCTTGAACCTCTTCACTTAG	0.388													92	162	---	---	---	---	PASS
NMD3	51068	broad.mit.edu	37	3	160951234	160951234	+	Silent	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160951234G>A	uc003feb.1	+	5	443	c.324G>A	c.(322-324)AAG>AAA	p.K108K	NMD3_uc003fec.2_Silent_p.K108K|NMD3_uc003fed.1_Silent_p.K108K|NMD3_uc010hwh.2_5'Flank	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog	108					protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			CTCATTCTAAGAGACTTAAAG	0.373													9	109	---	---	---	---	PASS
C3orf70	285382	broad.mit.edu	37	3	184800822	184800822	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184800822C>T	uc003fpd.2	-	2	917	c.726G>A	c.(724-726)GTG>GTA	p.V242V		NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382	242											0						TCGTTTCAATCACTTCCAGGT	0.527													23	402	---	---	---	---	PASS
APBB2	323	broad.mit.edu	37	4	41016312	41016312	+	Silent	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41016312G>C	uc003gvl.2	-	6	753	c.123C>G	c.(121-123)CTC>CTG	p.L41L	APBB2_uc003gvm.2_Silent_p.L41L|APBB2_uc003gvn.2_Silent_p.L41L|APBB2_uc011byt.1_Silent_p.L24L	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,	41					cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						GGGAGGATCGGAGGTTAAGGG	0.473													21	51	---	---	---	---	PASS
GUF1	60558	broad.mit.edu	37	4	44691410	44691410	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44691410C>T	uc003gww.3	+	10	1393	c.1186C>T	c.(1186-1188)CTG>TTG	p.L396L	GUF1_uc010ifz.1_RNA	NM_021927	NP_068746	Q8N442	GUF1_HUMAN	GUF1 GTPase homolog	396					translation	mitochondrial inner membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)	1						TAGCCTTGCTCTGGGTGCTGG	0.378													46	37	---	---	---	---	PASS
HSD17B4	3295	broad.mit.edu	37	5	118810106	118810106	+	Silent	SNP	A	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118810106A>G	uc003ksj.2	+	4	354	c.231A>G	c.(229-231)GAA>GAG	p.E77E	HSD17B4_uc011cwg.1_Silent_p.E53E|HSD17B4_uc011cwh.1_Silent_p.E59E|HSD17B4_uc011cwi.1_Silent_p.E102E|HSD17B4_uc003ksk.3_5'UTR|HSD17B4_uc011cwj.1_5'Flank|HSD17B4_uc010jcn.1_5'Flank	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	77	(3R)-hydroxyacyl-CoA dehydrogenase.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	ATTCAGTGGAAGAAGGAGAGA	0.423													3	125	---	---	---	---	PASS
PCDHA13	56136	broad.mit.edu	37	5	140262124	140262124	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140262124G>A	uc003lif.2	+	1	271	c.271G>A	c.(271-273)GAC>AAC	p.D91N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.D91N|PCDHA13_uc003lid.2_Missense_Mutation_p.D91N	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	91	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTCGGATCGACCGCGAGGA	0.592													99	163	---	---	---	---	PASS
EHMT2	10919	broad.mit.edu	37	6	31848018	31848018	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31848018C>A	uc003nxz.1	-	28	3486	c.3476G>T	c.(3475-3477)TGG>TTG	p.W1159L	EHMT2_uc003nxv.1_Missense_Mutation_p.W198L|EHMT2_uc003nxw.1_Missense_Mutation_p.W198L|EHMT2_uc003nxx.1_Missense_Mutation_p.W357L|EHMT2_uc003nxy.1_Missense_Mutation_p.W957L|EHMT2_uc011don.1_Missense_Mutation_p.W1182L|EHMT2_uc003nya.1_Missense_Mutation_p.W1125L|SLC44A4_uc010jti.2_5'Flank|SLC44A4_uc011dol.1_5'Flank|SLC44A4_uc011dom.1_5'Flank	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	1159	SET.				DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						TTTGATGTCCCAGAAGCGGTC	0.577													4	48	---	---	---	---	PASS
GPR126	57211	broad.mit.edu	37	6	142737195	142737195	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142737195G>T	uc010khc.2	+	20	3343	c.2932G>T	c.(2932-2934)GGC>TGC	p.G978C	GPR126_uc010khd.2_Missense_Mutation_p.G950C|GPR126_uc010khe.2_Missense_Mutation_p.G978C|GPR126_uc010khf.2_Missense_Mutation_p.G950C	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1	978	Helical; Name=4; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CTGCATCATTGGCTGGGGTAA	0.333													9	57	---	---	---	---	PASS
LRP11	84918	broad.mit.edu	37	6	150157417	150157417	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150157417C>G	uc003qng.2	-	5	1380	c.1056G>C	c.(1054-1056)AAG>AAC	p.K352N	LRP11_uc003qnh.1_Missense_Mutation_p.K352N	NM_032832	NP_116221	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein	352	Extracellular (Potential).					integral to membrane	receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GGGTTACCATCTTGCGGTCCA	0.498													18	66	---	---	---	---	PASS
TNRC18	84629	broad.mit.edu	37	7	5401610	5401610	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5401610G>A	uc003soi.3	-	13	4799	c.4450C>T	c.(4450-4452)CGG>TGG	p.R1484W		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1484	Potential.						DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		AGCCGCATCCGGAAGTCCAGC	0.617													11	29	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	92027863	92027863	+	Missense_Mutation	SNP	A	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92027863A>G	uc003ulw.2	+	20	3246	c.2870A>G	c.(2869-2871)GAC>GGC	p.D957G	ANKIB1_uc010lew.1_Missense_Mutation_p.D226G	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	957							protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGTGATCCTGACTCAGCTGGC	0.493													16	128	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94174866	94174866	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94174866C>T	uc003uni.3	+	12	1713	c.1486C>T	c.(1486-1488)CGT>TGT	p.R496C	CASD1_uc003unj.3_Missense_Mutation_p.R496C	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	496	Helical; (Potential).					integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GGTTTTATTTCGTCTCAATTT	0.358													5	119	---	---	---	---	PASS
MCM7	4176	broad.mit.edu	37	7	99696993	99696993	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99696993C>A	uc003usw.1	-	4	820	c.310G>T	c.(310-312)GAG>TAG	p.E104*	MCM7_uc003usv.1_5'UTR|MCM7_uc003usx.1_5'UTR|AP4M1_uc011kjg.1_5'Flank|AP4M1_uc010lgl.1_5'Flank|AP4M1_uc003utb.3_5'Flank|AP4M1_uc003utc.3_5'Flank|AP4M1_uc010lgm.2_5'Flank|AP4M1_uc003utd.2_5'Flank|AP4M1_uc011kjh.1_5'Flank|AP4M1_uc003ute.3_5'Flank|AP4M1_uc003utf.3_5'Flank	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	104					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	AGCCGATGCTCAATGTAAACG	0.478													19	99	---	---	---	---	PASS
GAL3ST4	79690	broad.mit.edu	37	7	99757888	99757888	+	Missense_Mutation	SNP	C	T	T	rs140660995		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99757888C>T	uc003utt.2	-	3	2141	c.1124G>A	c.(1123-1125)CGC>CAC	p.R375H	C7orf43_uc011kjj.1_5'Flank|C7orf43_uc003utr.2_5'Flank|C7orf43_uc003uts.2_5'Flank|GAL3ST4_uc003utu.2_Missense_Mutation_p.R375H|GAL3ST4_uc010lgq.2_Missense_Mutation_p.R313H	NM_024637	NP_078913	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	375	Lumenal (Potential).				cell-cell signaling|oligosaccharide metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane|membrane fraction	3'-phosphoadenosine 5'-phosphosulfate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity			ovary(3)	3	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCAGAGACTGCGGTTGAAGTG	0.627													5	165	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100676739	100676739	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100676739C>G	uc003uxp.1	+	3	2095	c.2042C>G	c.(2041-2043)TCA>TGA	p.S681*	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	681	Extracellular (Potential).|9.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ATGCCAACCTCAACTTATACT	0.483													71	376	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103193976	103193976	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103193976C>T	uc003vca.2	-	40	6164	c.6004G>A	c.(6004-6006)GAA>AAA	p.E2002K	RELN_uc010liz.2_Missense_Mutation_p.E2002K	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2002					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCACCAACTTCATTTGAAACA	0.363													12	60	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106508952	106508952	+	Missense_Mutation	SNP	G	C	C	rs147267699		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508952G>C	uc003vdv.3	+	2	1031	c.946G>C	c.(946-948)GAC>CAC	p.D316H	PIK3CG_uc003vdu.2_Missense_Mutation_p.D316H|PIK3CG_uc003vdw.2_Missense_Mutation_p.D316H	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	316					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CCCGGCCCTAGACGAGGTGAG	0.587													12	65	---	---	---	---	PASS
TAS2R16	50833	broad.mit.edu	37	7	122634943	122634943	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122634943C>T	uc003vkl.1	-	1	812	c.746G>A	c.(745-747)GGT>GAT	p.G249D		NM_016945	NP_058641	Q9NYV7	T2R16_HUMAN	taste receptor T2R16	249	Helical; Name=6; (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste	endoplasmic reticulum|external side of plasma membrane|trans-Golgi network	bitter taste receptor activity|protein binding			ovary(1)|skin(1)	2						AAATAGAGTACCTATAATGGT	0.428													21	131	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127255484	127255484	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127255484G>A	uc010lld.1	-	1	297	c.91C>T	c.(91-93)CGG>TGG	p.R31W	PAX4_uc003vmf.2_5'UTR|PAX4_uc003vmg.1_Missense_Mutation_p.R31W|PAX4_uc003vmh.2_5'UTR	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	39	Paired.		R -> Q.		cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TCACAGGGCCGCATTCCACTG	0.582													4	123	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	148963515	148963515	+	RNA	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148963515C>T	uc003wfr.3	+	2		c.277C>T								Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																		ACCTCTACTCCACGGAAATCA	0.602													3	33	---	---	---	---	PASS
VDAC3	7419	broad.mit.edu	37	8	42256271	42256271	+	Silent	SNP	A	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42256271A>G	uc011lct.1	+	5	302	c.159A>G	c.(157-159)AAA>AAG	p.K53K	VDAC3_uc010lxk.2_Silent_p.K53K|VDAC3_uc003xpc.2_Silent_p.K54K	NM_005662	NP_005653	Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3 isoform b	53					adenine transport	mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity			upper_aerodigestive_tract(1)	1	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	ATACAGGGAAAGCATCAGGCA	0.353													24	62	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61765871	61765871	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61765871C>T	uc003xue.2	+	31	7064	c.6587C>T	c.(6586-6588)ACC>ATC	p.T2196I		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2196	Glu-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GAAGAAGAAACCGATGGCAGC	0.537													9	26	---	---	---	---	PASS
DERL1	79139	broad.mit.edu	37	8	124042857	124042857	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124042857G>A	uc003ypl.2	-	2	539	c.253C>T	c.(253-255)CGA>TGA	p.R85*	DERL1_uc003ypm.2_Nonsense_Mutation_p.R85*|DERL1_uc011lif.1_Intron|DERL1_uc003ypn.2_Nonsense_Mutation_p.R85*	NM_024295	NP_077271	Q9BUN8	DERL1_HUMAN	Der1-like domain family, member 1 isoform a	85	Cytoplasmic (Potential).				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|intracellular transport of viral proteins in host cell|retrograde protein transport, ER to cytosol	integral to endoplasmic reticulum membrane	MHC class I protein binding|receptor activity				0	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GTTTCAAGTCGCGTAGAATAC	0.373													38	44	---	---	---	---	PASS
ZNF367	195828	broad.mit.edu	37	9	99160438	99160438	+	Intron	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99160438C>T	uc004awf.2	-						ZNF367_uc004awg.2_Intron	NM_153695	NP_710162	Q7RTV3	ZN367_HUMAN	zinc finger protein 367						regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0167)				AAAATTTGCTCAACTTACCTG	0.294													25	129	---	---	---	---	PASS
SDCCAG3	10807	broad.mit.edu	37	9	139302311	139302311	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139302311C>T	uc004chi.2	-	4	574	c.369G>A	c.(367-369)TCG>TCA	p.S123S	SDCCAG3_uc004chj.2_Silent_p.S100S|SDCCAG3_uc004chk.2_Silent_p.S50S|PMPCA_uc011mdy.1_5'Flank|PMPCA_uc010nbk.2_5'Flank|PMPCA_uc004chl.2_5'Flank|PMPCA_uc010nbl.2_5'Flank|PMPCA_uc011mdz.1_5'Flank	NM_001039707	NP_001034796	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	123						cytoplasm					0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		GATCCTCTTTCGAGAGGCCGA	0.483													22	135	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140669695	140669695	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140669695C>G	uc011mfc.1	+	11	1819	c.1782C>G	c.(1780-1782)TTC>TTG	p.F594L	EHMT1_uc004coa.2_Missense_Mutation_p.F594L|EHMT1_uc004cob.1_Missense_Mutation_p.F563L	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	594					DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GTGGCTACTTCTGCACAGCGG	0.632													3	25	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1103266	1103266	+	Silent	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1103266G>A	uc001lsx.1	+	49	15129	c.15102G>A	c.(15100-15102)TCG>TCA	p.S5034S		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	5034						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	AGCTCATCTCGTCCGTCTCCA	0.597													5	87	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1214870	1214870	+	Intron	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1214870C>T	uc009ycr.1	+						uc001lsz.2_RNA	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGCTGCCATCACTACCAGTG	0.692													5	16	---	---	---	---	PASS
PHF21A	51317	broad.mit.edu	37	11	45975137	45975137	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45975137C>T	uc001ncc.3	-	10	1657	c.1033G>A	c.(1033-1035)GAG>AAG	p.E345K	PHF21A_uc001ncb.3_Missense_Mutation_p.E346K|PHF21A_uc009ykx.2_Missense_Mutation_p.E346K|PHF21A_uc001nce.2_Missense_Mutation_p.E346K|PHF21A_uc001nca.1_Missense_Mutation_p.E81K	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN	BRAF35/HDAC2 complex isoform a	345					blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						GTGCGGCTCTCTGTTTGTTTC	0.418													6	59	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78412896	78412896	+	Silent	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78412896G>A	uc001ozl.3	-	28	5225	c.4762C>T	c.(4762-4764)CTG>TTG	p.L1588L	ODZ4_uc009yvb.1_Silent_p.L172L	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1588	Extracellular (Potential).|YD 1.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						GTATCAAACAGATAGAGCTCC	0.507													56	88	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92086050	92086050	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92086050C>T	uc001pdj.3	+	1	789	c.772C>T	c.(772-774)CGC>TGC	p.R258C		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	258	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCACATTGAGCGCATAAATGA	0.428										TCGA Ovarian(4;0.039)			14	143	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92088452	92088452	+	Silent	SNP	T	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92088452T>C	uc001pdj.3	+	1	3191	c.3174T>C	c.(3172-3174)ATT>ATC	p.I1058I		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1058	Cadherin 10.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTCACGCATTGGAACAAGCG	0.498										TCGA Ovarian(4;0.039)			16	46	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52139775	52139775	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52139775G>C	uc001ryw.2	+	13	2265	c.2087G>C	c.(2086-2088)AGA>ACA	p.R696T	SCN8A_uc010snl.1_Missense_Mutation_p.R561T|SCN8A_uc001ryx.1_Missense_Mutation_p.R572T|SCN8A_uc001ryz.1_Missense_Mutation_p.R572T|SCN8A_uc001ryy.2_Missense_Mutation_p.R561T	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	696					axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	CGGAAGGACAGAATCAACAGT	0.393													25	56	---	---	---	---	PASS
KRT6C	286887	broad.mit.edu	37	12	52864987	52864987	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52864987C>A	uc001sal.3	-	5	1054	c.1006G>T	c.(1006-1008)GAG>TAG	p.E336*		NM_173086	NP_775109	P48668	K2C6C_HUMAN	keratin 6C	336	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0828)		GCCTTGACCTCAGCGATGATG	0.587													4	277	---	---	---	---	PASS
STAT6	6778	broad.mit.edu	37	12	57496707	57496707	+	Intron	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57496707G>A	uc009zpe.2	-						STAT6_uc009zpf.2_Intron|STAT6_uc001sna.2_Intron|STAT6_uc010srb.1_Intron|STAT6_uc010src.1_Intron|STAT6_uc010srd.1_Intron|STAT6_uc009zpg.2_Intron	NM_003153	NP_003144	P42226	STAT6_HUMAN	signal transducer and activator of transcription						regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4						GACAGGGCCTGAAGAGGGTGA	0.338													9	49	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62895398	62895398	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62895398G>A	uc001sre.2	+	7	1100	c.709G>A	c.(709-711)GGC>AGC	p.G237S	MON2_uc009zqj.2_Missense_Mutation_p.G237S|MON2_uc010ssl.1_Missense_Mutation_p.G165S|MON2_uc010ssm.1_Missense_Mutation_p.G237S|MON2_uc010ssn.1_Missense_Mutation_p.G237S|MON2_uc001srf.2_5'UTR|MON2_uc001srd.1_Missense_Mutation_p.G129S	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	237					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTGGCTAGTGGGCATGACAGA	0.388													30	50	---	---	---	---	PASS
MGAT4C	25834	broad.mit.edu	37	12	86373207	86373207	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86373207C>A	uc001tai.3	-	8	2547	c.1297G>T	c.(1297-1299)GGA>TGA	p.G433*	MGAT4C_uc001tal.3_Nonsense_Mutation_p.G433*|MGAT4C_uc001taj.3_Nonsense_Mutation_p.G433*|MGAT4C_uc001tak.3_Nonsense_Mutation_p.G433*|MGAT4C_uc010sum.1_Nonsense_Mutation_p.G457*|MGAT4C_uc001tah.3_Nonsense_Mutation_p.G433*	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	433	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						TTGAATTCTCCTAGTCTTAAG	0.343													16	83	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99640543	99640543	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99640543G>T	uc001tge.1	-	13	2273	c.1856C>A	c.(1855-1857)CCT>CAT	p.P619H	ANKS1B_uc001tgf.1_Missense_Mutation_p.P199H|ANKS1B_uc001tgk.2_Translation_Start_Site|ANKS1B_uc009ztt.1_Missense_Mutation_p.P585H	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	619						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TGGATTTTCAGGGGACTCACA	0.468													4	222	---	---	---	---	PASS
TXNRD1	7296	broad.mit.edu	37	12	104725378	104725378	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104725378G>C	uc010swk.1	+	14	1631	c.1609G>C	c.(1609-1611)GAG>CAG	p.E537Q	TXNRD1_uc010swl.1_Missense_Mutation_p.E387Q|TXNRD1_uc010swm.1_Missense_Mutation_p.E439Q|TXNRD1_uc010swn.1_Missense_Mutation_p.E387Q|TXNRD1_uc010swo.1_Missense_Mutation_p.E387Q|TXNRD1_uc010swp.1_Missense_Mutation_p.E349Q|TXNRD1_uc010swq.1_Missense_Mutation_p.E437Q|TXNRD1_uc001tku.2_RNA|TXNRD1_uc009zun.2_Missense_Mutation_p.E453Q	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3	537					cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						TGGCCTTTCTGAGGAGAAAGC	0.338													3	30	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124270380	124270380	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124270380C>T	uc001uft.3	+	9	1160	c.1135C>T	c.(1135-1137)CGA>TGA	p.R379*		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	379	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GATCATCTCCCGACACTACAA	0.567													22	102	---	---	---	---	PASS
TMEM132B	114795	broad.mit.edu	37	12	126128683	126128683	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126128683C>T	uc001uhe.1	+	6	1492	c.1484C>T	c.(1483-1485)ACG>ATG	p.T495M	TMEM132B_uc001uhf.1_Missense_Mutation_p.T7M	NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	495	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAAGTGGACACGATTGTGAAC	0.507													14	66	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20637063	20637063	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20637063G>C	uc001umr.2	+	19	3287	c.2989G>C	c.(2989-2991)GAT>CAT	p.D997H	ZMYM2_uc001ums.2_Missense_Mutation_p.D997H|ZMYM2_uc001umt.2_Missense_Mutation_p.D997H|ZMYM2_uc001umv.2_Missense_Mutation_p.D377H|ZMYM2_uc001umw.2_Missense_Mutation_p.D450H	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	997					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CAGCATGCCTGATGTACCATA	0.363													3	11	---	---	---	---	PASS
SOS2	6655	broad.mit.edu	37	14	50597312	50597312	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50597312C>G	uc001wxs.3	-	20	3342	c.3244G>C	c.(3244-3246)GCA>CCA	p.A1082P	SOS2_uc010ans.2_5'UTR|SOS2_uc010tql.1_Missense_Mutation_p.A1049P	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2	1082					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					GAGGTTGGTGCTGACACTGTT	0.428													13	115	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95670454	95670454	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95670454C>G	uc001yef.2	-	9	1348	c.1232G>C	c.(1231-1233)AGA>ACA	p.R411T		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	411						integral to membrane	actin binding				0				Epithelial(152;0.193)		GTTCTCCTTTCTGGATGATAA	0.493													20	98	---	---	---	---	PASS
C14orf73	91828	broad.mit.edu	37	14	103566829	103566829	+	Silent	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103566829G>C	uc001ymk.2	+	1	349	c.273G>C	c.(271-273)CTG>CTC	p.L91L		NM_001077594	NP_001071062	Q17RC7	EX3L4_HUMAN	hypothetical protein LOC91828	91											0		Melanoma(154;0.155)	Epithelial(46;0.221)			GGCAAGCCCTGAATGACGGCC	0.662													4	26	---	---	---	---	PASS
TUBGCP5	114791	broad.mit.edu	37	15	22833552	22833552	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22833552C>T	uc001yur.3	+	1	158	c.28C>T	c.(28-30)CGG>TGG	p.R10W	TUBGCP5_uc001yuq.2_Missense_Mutation_p.R10W	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	10					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		ACCGTGGAGTCGGTTGGACGC	0.697													4	5	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41859705	41859705	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41859705G>C	uc001zof.1	+	7	1155	c.931G>C	c.(931-933)GAC>CAC	p.D311H		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	311	Fibronectin type-III 1.|Extracellular (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TCCCTATGCTGACTGGGTGCC	0.642													29	135	---	---	---	---	PASS
TGM7	116179	broad.mit.edu	37	15	43571969	43571969	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43571969C>T	uc001zrf.1	-	10	1537	c.1532G>A	c.(1531-1533)CGT>CAT	p.R511H		NM_052955	NP_443187	Q96PF1	TGM7_HUMAN	transglutaminase 7	511					peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)	2		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	CCTCTGGATACGCAGCAGCAG	0.657													7	88	---	---	---	---	PASS
SPG11	80208	broad.mit.edu	37	15	44941174	44941174	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44941174G>C	uc001ztx.2	-	7	1523	c.1492C>G	c.(1492-1494)CAA>GAA	p.Q498E	SPG11_uc010ueh.1_Missense_Mutation_p.Q498E|SPG11_uc010uei.1_Missense_Mutation_p.Q498E|SPG11_uc001zua.1_Missense_Mutation_p.Q498E	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	498	Extracellular (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AACTCTTCTTGAGTCAAACCA	0.363													15	62	---	---	---	---	PASS
HEXA	3073	broad.mit.edu	37	15	72638962	72638962	+	Silent	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72638962G>A	uc002aun.3	-	11	1443	c.1236C>T	c.(1234-1236)TTC>TTT	p.F412F	uc002aug.2_RNA|CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Silent_p.F423F|HEXA_uc002auo.3_Silent_p.F275F|HEXA_uc010bix.2_Silent_p.F412F|HEXA_uc010biy.2_Silent_p.F275F|HEXA_uc010uko.1_Silent_p.F238F|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	412					cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						GAAGGGCCCGGAAGCCGGCCT	0.498													210	200	---	---	---	---	PASS
CHRNA5	1138	broad.mit.edu	37	15	78882360	78882360	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78882360G>C	uc002bdy.2	+	5	789	c.627G>C	c.(625-627)AAG>AAC	p.K209N	CHRNA5_uc002bdz.2_Intron	NM_000745	NP_000736	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5	209	Extracellular (Potential).				behavioral response to nicotine	cell junction|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3						ATGTAGACAAGAGAGATTTTT	0.403													19	136	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9858383	9858383	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9858383C>T	uc002czo.3	-	13	3566	c.3018G>A	c.(3016-3018)GCG>GCA	p.A1006A	GRIN2A_uc010uym.1_Silent_p.A1006A|GRIN2A_uc010uyn.1_Silent_p.A849A|GRIN2A_uc002czr.3_Silent_p.A1006A	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1006	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GTCTAGAGTTCGCTTTGGATT	0.507													33	89	---	---	---	---	PASS
SEPHS2	22928	broad.mit.edu	37	16	30456484	30456484	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30456484C>T	uc010ves.1	-	2	741	c.565G>A	c.(565-567)GAA>AAA	p.E189K	SEPHS2_uc002dyh.1_Missense_Mutation_p.E132K|SEPHS2_uc010vet.1_Missense_Mutation_p.E71K	NM_012248	NP_036380	Q99611	SPS2_HUMAN	selenophosphate synthetase 2	189					selenocysteine biosynthetic process		ATP binding|selenide, water dikinase activity			breast(2)	2						GTTACCTTTTCGCGTTCCTCC	0.542													26	85	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57075481	57075481	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57075481C>G	uc002ekk.1	+	18	3249	c.3024C>G	c.(3022-3024)CAC>CAG	p.H1008Q	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Missense_Mutation_p.H757Q|NLRC5_uc002ekl.2_Missense_Mutation_p.H813Q|NLRC5_uc002ekm.2_Missense_Mutation_p.H813Q|NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekp.1_5'UTR|NLRC5_uc002ekq.1_5'Flank	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	1008	LRR 9.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				GTCACCTCCACCTCGAGTGAG	0.517													21	27	---	---	---	---	PASS
COQ9	57017	broad.mit.edu	37	16	57490503	57490503	+	Silent	SNP	C	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57490503C>A	uc002elq.2	+	4	482	c.466C>A	c.(466-468)CGG>AGG	p.R156R	COQ9_uc010vhn.1_Silent_p.R156R|COQ9_uc010vho.1_Silent_p.R156R|COQ9_uc010vhp.1_Silent_p.R156R|COQ9_uc002elr.2_Silent_p.R156R|COQ9_uc002els.2_5'Flank	NM_020312	NP_064708	O75208	COQ9_HUMAN	coenzyme Q9 homolog precursor	156					ubiquinone biosynthetic process	mitochondrion				breast(1)	1						GTGCAATACCCGGCTCACACG	0.542													3	98	---	---	---	---	PASS
CCDC135	84229	broad.mit.edu	37	16	57760115	57760115	+	Missense_Mutation	SNP	C	T	T	rs143054335		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57760115C>T	uc002emi.2	+	13	1983	c.1894C>T	c.(1894-1896)CGC>TGC	p.R632C	CCDC135_uc002emj.2_Missense_Mutation_p.R632C|CCDC135_uc002emk.2_Missense_Mutation_p.R567C	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	632						cytoplasm				central_nervous_system(1)	1						GGCCTCCAAGCGCGAGTTCCT	0.662													12	58	---	---	---	---	PASS
C16orf70	80262	broad.mit.edu	37	16	67168377	67168377	+	Intron	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67168377G>A	uc002erc.2	+						C16orf70_uc002erd.2_Intron|C16orf70_uc002ere.1_3'UTR	NM_025187	NP_079463	Q9BSU1	CP070_HUMAN	lin-10											ovary(2)	2		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		GCAGGTCAGTGACTGGCTTTG	0.423													75	108	---	---	---	---	PASS
WDR59	79726	broad.mit.edu	37	16	74999681	74999681	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74999681C>G	uc002fdh.1	-	2	196	c.94G>C	c.(94-96)GTG>CTG	p.V32L	WDR59_uc002fdi.2_Missense_Mutation_p.V32L|WDR59_uc002fdj.2_Missense_Mutation_p.V32L	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	32										ovary(1)|breast(1)	2						CCAGAAAGCACTGCATGCTGC	0.498													15	95	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37604118	37604118	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37604118C>T	uc002hrv.3	-	2	277	c.65G>A	c.(64-66)CGG>CAG	p.R22Q	MED1_uc010wee.1_5'UTR|MED1_uc002hru.2_Missense_Mutation_p.R22Q	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	22	Interaction with ESR1.|Interaction with the Mediator complex and THRA.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TGCATGGAGCCGTTCCAGGAG	0.393										HNSCC(31;0.082)			15	95	---	---	---	---	PASS
MAP3K14	9020	broad.mit.edu	37	17	43351847	43351847	+	Silent	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43351847G>A	uc002iiw.1	-	8	1513	c.1404C>T	c.(1402-1404)TTC>TTT	p.F468F	MAP3K14_uc002iiu.1_5'Flank|MAP3K14_uc010daj.1_RNA|MAP3K14_uc002iiv.1_Silent_p.F52F	NM_003954	NP_003945	Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase	468	Interaction with ZFP91.|Protein kinase.				cellular response to mechanical stimulus|I-kappaB kinase/NF-kappaB cascade|immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade|T cell costimulation	cytosol	ATP binding|MAP kinase kinase kinase activity|NF-kappaB-inducing kinase activity|protein binding			central_nervous_system(3)|breast(2)|lung(1)|ovary(1)|stomach(1)	8						GCAGCTCCATGAAGATGTTGA	0.537													6	28	---	---	---	---	PASS
PRPSAP1	5635	broad.mit.edu	37	17	74328519	74328519	+	Intron	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74328519G>A	uc010wta.1	-						PRPSAP1_uc010wtb.1_Intron	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						TCACATCTCTGAAACAGTCAA	0.443													16	77	---	---	---	---	PASS
CDH2	1000	broad.mit.edu	37	18	25570188	25570188	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25570188C>T	uc002kwg.2	-	10	1930	c.1471G>A	c.(1471-1473)GTA>ATA	p.V491I	CDH2_uc010xbn.1_Missense_Mutation_p.V460I	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	491	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						TTTTCATTTACGTCAATAACT	0.468													30	66	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55020123	55020123	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55020123G>A	uc002lgn.2	+	1	403	c.46G>A	c.(46-48)GTC>ATC	p.V16I		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	16	Helical; Signal-anchor for type II membrane protein; (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GCTGGGGCTGGTCATGCTCAG	0.602													8	50	---	---	---	---	PASS
KDM4B	23030	broad.mit.edu	37	19	5135504	5135504	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5135504C>G	uc002mbq.3	+	15	2466	c.2240C>G	c.(2239-2241)TCC>TGC	p.S747C	KDM4B_uc010xim.1_Missense_Mutation_p.S781C|KDM4B_uc002mbr.3_Missense_Mutation_p.S505C	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	747	PHD-type 1.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						CCTGCCAACTCCTACATCGGC	0.642													5	24	---	---	---	---	PASS
LRRC8E	80131	broad.mit.edu	37	19	7964377	7964377	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7964377G>T	uc002mir.2	+	3	1071	c.970G>T	c.(970-972)GGA>TGA	p.G324*		NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member	324	Helical; (Potential).					integral to membrane				lung(1)|pancreas(1)	2						GTGCATCTACGGACTTACCTG	0.582													3	109	---	---	---	---	PASS
OR7G1	125962	broad.mit.edu	37	19	9225923	9225923	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9225923C>T	uc002mks.1	-	1	517	c.517G>A	c.(517-519)GAA>AAA	p.E173K		NM_001005192	NP_001005192	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G,	173	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						AAAGGGATTTCAACGTTTTTG	0.443													15	70	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36330131	36330131	+	Intron	SNP	C	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36330131C>A	uc002oby.2	-						NPHS1_uc010eem.1_Intron	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor						cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCAAGCCTCCCTTCCCACCTG	0.398													15	146	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39219695	39219695	+	Silent	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39219695G>A	uc002oja.1	+	20	2537	c.2478G>A	c.(2476-2478)GTG>GTA	p.V826V	ACTN4_uc002ojb.1_Silent_p.V148V	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	826	EF-hand 2.|2 (Potential).				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCGGCCTTGTGACCTTCCAAG	0.597													26	120	---	---	---	---	PASS
SHANK1	50944	broad.mit.edu	37	19	51169762	51169762	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51169762C>G	uc002psx.1	-	22	5474	c.5455G>C	c.(5455-5457)GAG>CAG	p.E1819Q	SHANK1_uc002psw.1_Missense_Mutation_p.E1203Q	NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1819					cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ACTTCTGGCTCTACAGCCACC	0.726													2	11	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51359632	51359632	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51359632C>T	uc002pts.1	+	2	224	c.183C>T	c.(181-183)CTC>CTT	p.L61L	KLK3_uc002ptp.1_Silent_p.L61L|KLK3_uc010ycj.1_Silent_p.L61L|KLK3_uc002ptr.1_Silent_p.L61L|KLK3_uc010eof.1_RNA	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3	61	Peptidase S1.				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		AGTGGGTCCTCACAGCTGCCC	0.622													14	133	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51361307	51361307	+	Missense_Mutation	SNP	C	G	G	rs146422657	byFrequency	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51361307C>G	uc002pts.1	+	3	270	c.229C>G	c.(229-231)CGG>GGG	p.R77G	KLK3_uc010ycj.1_Missense_Mutation_p.R77G|KLK3_uc002ptr.1_Intron|KLK3_uc010eof.1_RNA	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3	77	Peptidase S1.				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		CTTGCTGGGTCGGCACAGCCT	0.542													5	50	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33356297	33356297	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33356297C>A	uc002xav.2	-	6	3055	c.484G>T	c.(484-486)GAG>TAG	p.E162*	NCOA6_uc002xaw.2_Nonsense_Mutation_p.E162*|NCOA6_uc010gew.1_Nonsense_Mutation_p.E162*	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	162	TBP/GTF2A-binding region.|NCOA1-binding region.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						AATCCCGCCTCCATCCTAACT	0.448													44	80	---	---	---	---	PASS
SLC32A1	140679	broad.mit.edu	37	20	37356217	37356217	+	Silent	SNP	C	T	T	rs143574180		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37356217C>T	uc002xjc.2	+	2	776	c.513C>T	c.(511-513)TAC>TAT	p.Y171Y		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	171	Lumenal, vesicle (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGTGCCTGTACGAGGAGAATG	0.652													15	58	---	---	---	---	PASS
ZNF512B	57473	broad.mit.edu	37	20	62592657	62592657	+	Intron	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62592657C>T	uc002yhl.1	-							NM_020713	NP_065764	Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGATGGCCCTCGCACCTCTGC	0.642													9	48	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10942949	10942949	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10942949C>T	uc002yip.1	-	12	1006	c.638G>A	c.(637-639)AGA>AAA	p.R213K	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.R195K|TPTE_uc002yir.1_Missense_Mutation_p.R175K|TPTE_uc010gkv.1_Missense_Mutation_p.R75K	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	213					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTCAAGTTGTCTTTTTTGATG	0.323													6	50	---	---	---	---	PASS
THAP7	80764	broad.mit.edu	37	22	21354220	21354220	+	Silent	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21354220C>T	uc002ztr.1	-	5	909	c.879G>A	c.(877-879)CTG>CTA	p.L293L	THAP7_uc002zts.1_Silent_p.L293L|FLJ39582_uc002ztt.1_5'Flank|FLJ39582_uc002ztu.1_5'Flank|FLJ39582_uc002ztv.2_5'Flank	NM_001008695	NP_001008695	Q9BT49	THAP7_HUMAN	THAP domain containing 7 isoform 2	293					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck	C2H2 zinc finger domain binding|DNA binding|metal ion binding|protein N-terminus binding				0	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CATGCTCCTTCAGAGTCTGGC	0.657													6	56	---	---	---	---	PASS
SGSM3	27352	broad.mit.edu	37	22	40803462	40803462	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40803462G>A	uc003ayu.1	+	13	1623	c.1414G>A	c.(1414-1416)GAG>AAG	p.E472K	SGSM3_uc011aos.1_Missense_Mutation_p.E405K|SGSM3_uc011aot.1_Missense_Mutation_p.E409K|SGSM3_uc010gyd.1_Missense_Mutation_p.E543K	NM_015705	NP_056520	Q96HU1	SGSM3_HUMAN	small G protein signaling modulator 3	472					cell cycle arrest|Rap protein signal transduction	cytoplasm	Rab GTPase activator activity|Rab GTPase binding			ovary(2)	2						GCGGGACCACGAGAACTACGT	0.632													3	34	---	---	---	---	PASS
PPPDE2	27351	broad.mit.edu	37	22	41999352	41999352	+	Silent	SNP	A	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41999352A>G	uc003ban.1	-	5	397	c.324T>C	c.(322-324)TGT>TGC	p.C108C	PPPDE2_uc011apb.1_RNA	NM_015704	NP_056519	Q6ICB0	PPDE2_HUMAN	PPPDE peptidase domain containing 2	108	PPPDE peptidase.										0						TGAAGGTGTTACAATTGTGTT	0.463													32	135	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46790036	46790036	+	Intron	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46790036C>T	uc003bhw.1	-						CELSR1_uc011arc.1_Intron	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGCGGGGCCTCACCTTGCATT	0.582													9	87	---	---	---	---	PASS
RPGR	6103	broad.mit.edu	37	X	38146175	38146175	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38146175C>G	uc004ded.1	-	15	2245	c.2077G>C	c.(2077-2079)GAG>CAG	p.E693Q	RPGR_uc004deb.2_Intron|RPGR_uc004dea.2_Intron|RPGR_uc004dec.2_Intron	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator isoform C	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						agttccttctctccctctcct	0.095													11	51	---	---	---	---	PASS
WAS	7454	broad.mit.edu	37	X	48547408	48547408	+	Silent	SNP	C	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48547408C>A	uc004dkm.3	+	10	1348	c.1291C>A	c.(1291-1293)CGG>AGG	p.R431R		NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein	431	WH2.				blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				TGGTGGGGGTCGGGGAGCGCT	0.587			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				7	16	---	---	---	---	PASS
IQSEC2	23096	broad.mit.edu	37	X	53278057	53278057	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53278057C>G	uc004dsd.2	-	6	2506	c.2305G>C	c.(2305-2307)GAG>CAG	p.E769Q	IQSEC2_uc004dsc.2_Missense_Mutation_p.E564Q	NM_001111125	NP_001104595	Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2 isoform1	759	SEC7.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3						ATACCCTTCTCTGGCTTCCTG	0.532													9	20	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54324625	54324625	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54324625C>T	uc004dtd.1	-	7	1820	c.1381G>A	c.(1381-1383)GAA>AAA	p.E461K	WNK3_uc004dtc.1_Missense_Mutation_p.E461K	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	461					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						TATGCTACTTCCTCAGGTGTA	0.343													16	45	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76855932	76855932	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76855932G>A	uc004ecp.3	-	23	5900	c.5668C>T	c.(5668-5670)CAG>TAG	p.Q1890*	ATRX_uc004ecq.3_Nonsense_Mutation_p.Q1852*|ATRX_uc004eco.3_Nonsense_Mutation_p.Q1675*	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1890					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TAGTCTAGCTGCAAACACCAA	0.363			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						5	314	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51822189	51822189	+	3'UTR	DEL	A	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51822189delA	uc001csq.1	-	25					EPS15_uc009vyz.1_3'UTR|EPS15_uc001csp.3_3'UTR	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway						cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						CTTTTATAAGAAAAAAAAAAA	0.348			T	MLL	ALL								4	2	---	---	---	---	
TNN	63923	broad.mit.edu	37	1	175049103	175049104	+	Intron	INS	-	GT	GT	rs142891850	by1000genomes	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175049103_175049104insGT	uc001gkl.1	+						TNN_uc010pmx.1_Intron	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCtgtgtgtgagtgtgtgtgtg	0.248													3	3	---	---	---	---	
NEK7	140609	broad.mit.edu	37	1	198247384	198247385	+	Intron	INS	-	TCT	TCT	rs146890152	by1000genomes	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198247384_198247385insTCT	uc001gun.3	+							NM_133494	NP_598001	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7							cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4						ATGTAAATTAATCTGCTTGACT	0.267													5	5	---	---	---	---	
ATAD2B	54454	broad.mit.edu	37	2	24110911	24110912	+	Intron	INS	-	A	A	rs145193037	by1000genomes	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24110911_24110912insA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc010exx.1_Intron	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGACAGAAAAGAAAAAAAAAAT	0.282													3	4	---	---	---	---	
DPYSL5	56896	broad.mit.edu	37	2	27170942	27170943	+	3'UTR	DEL	CA	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27170942_27170943delCA	uc002rhu.3	+	13					DPYSL5_uc002rhv.3_3'UTR	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCTGCCACcacacacacaca	0.470													4	2	---	---	---	---	
MYO7B	4648	broad.mit.edu	37	2	128325237	128325238	+	Intron	INS	-	ATTC	ATTC	rs111424295		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128325237_128325238insATTC	uc002top.2	+							NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CCACCTGGGGGattcattcatt	0.297													4	2	---	---	---	---	
SSFA2	6744	broad.mit.edu	37	2	182763989	182763990	+	Intron	INS	-	TTTTG	TTTTG			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182763989_182763990insTTTTG	uc002uoi.2	+						SSFA2_uc002uoh.2_Intron|SSFA2_uc002uoj.2_Intron|SSFA2_uc002uok.2_Intron|SSFA2_uc010zfo.1_Intron|SSFA2_uc002uol.2_Intron	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1							cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TGATAGGAGCTttttgttttgt	0.282													4	2	---	---	---	---	
STK17B	9262	broad.mit.edu	37	2	197028246	197028246	+	Intron	DEL	A	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197028246delA	uc002utk.2	-						STK17B_uc010fsh.2_Intron	NM_004226	NP_004217	O94768	ST17B_HUMAN	serine/threonine kinase 17B						apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)			AAATACAACTAAAAAAAAAAA	0.308													11	5	---	---	---	---	
NCL	4691	broad.mit.edu	37	2	232325997	232325998	+	Intron	INS	-	A	A	rs34075637		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232325997_232325998insA	uc002vru.2	-						SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		caaaaaaatttaaaaaaaaaaa	0.119													4	2	---	---	---	---	
IRAK2	3656	broad.mit.edu	37	3	10283670	10283671	+	Intron	INS	-	A	A	rs73028497		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10283670_10283671insA	uc003bve.1	+							NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2						activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						aaaaaaaaaagaaaaaaAAAAA	0.144													6	6	---	---	---	---	
ARHGAP31	57514	broad.mit.edu	37	3	119128712	119128712	+	Intron	DEL	T	-	-	rs149651758		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119128712delT	uc003ecj.3	+							NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TGAAAAAAAATTTTTTTTTGA	0.378													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	134383510	134383511	+	IGR	DEL	TT	-	-	rs10563578		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134383510_134383511delTT								KY (13032 upstream) : EPHB1 (130749 downstream)																							CTTTAAGCAGTTTtgtgtgtgt	0.267													2	5	---	---	---	---	
CLRN1OS	116933	broad.mit.edu	37	3	150757691	150757692	+	Intron	DEL	GT	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150757691_150757692delGT	uc011bny.1	+						CLRN1OS_uc003eyl.2_Intron					Homo sapiens usher critical region protein (UCRP) pseudogene mRNA, complete sequence.												0						CCATCTTTCAgtgtgtgtgtgt	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	156329917	156329918	+	IGR	INS	-	TCCTTCCT	TCCTTCCT	rs11275550		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156329917_156329918insTCCTTCCT								SSR3 (56982 upstream) : LOC100287227 (61046 downstream)																							ttctgtattaAtccttccttcc	0.025													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165967473	165967473	+	IGR	DEL	A	-	-	rs150476538		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165967473delA								TRIM60 (4577 upstream) : TMEM192 (29758 downstream)																							ACTTACAGCCAAAAAAAAAAa	0.224													7	4	---	---	---	---	
TRIML2	205860	broad.mit.edu	37	4	189028108	189028108	+	5'Flank	DEL	A	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189028108delA	uc003izl.2	-						TRIML2_uc011cle.1_5'Flank|TRIML2_uc011clf.1_Intron	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2								ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TTTCTCTATTAAAAAAGCCAC	0.323													4	2	---	---	---	---	
BTF3	689	broad.mit.edu	37	5	72800863	72800864	+	Intron	INS	-	T	T	rs71615786		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72800863_72800864insT	uc003kcr.1	+						BTF3_uc003kcq.1_Intron|BTF3_uc003kcs.1_Intron|BTF3_uc003kct.1_Intron	NM_001037637	NP_001032726	P20290	BTF3_HUMAN	basic transcription factor 3 isoform A						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding				0		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		ATTTTTTTCACTTTTTTTTTTT	0.356													5	3	---	---	---	---	
WDR41	55255	broad.mit.edu	37	5	76745819	76745819	+	Intron	DEL	A	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76745819delA	uc003kff.1	-						WDR41_uc011csy.1_Intron|WDR41_uc011csz.1_Intron|WDR41_uc011cta.1_Intron|WDR41_uc011ctb.1_Intron	NM_018268	NP_060738	Q9HAD4	WDR41_HUMAN	WD repeat domain 41												0		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)		ACCCATCTCCAAAAAAAAGCC	0.313													4	2	---	---	---	---	
ARMC2	84071	broad.mit.edu	37	6	109285993	109285993	+	Intron	DEL	A	-	-	rs77214837		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109285993delA	uc003pss.3	+						ARMC2_uc011eao.1_Intron	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2								binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		actctgtctcaaaaaaaaaaa	0.114													5	3	---	---	---	---	
ENPP3	5169	broad.mit.edu	37	6	132014471	132014471	+	Intron	DEL	G	-	-	rs3841511		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132014471delG	uc003qcu.3	+						ENPP3_uc010kfq.2_Intron|ENPP3_uc003qcv.2_Intron	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		CTAATAACTAGGGGGATCTGA	0.239													4	4	---	---	---	---	
SYNJ2	8871	broad.mit.edu	37	6	158502667	158502668	+	Intron	DEL	TC	-	-	rs149018292	by1000genomes	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158502667_158502668delTC	uc003qqx.1	+						SYNJ2_uc003qqw.1_Intron|SYNJ2_uc003qqy.1_Intron|SYNJ2_uc003qqz.1_Intron|SYNJ2_uc003qra.1_Intron	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		tttttttttttctctgagacaa	0.188													3	3	---	---	---	---	
WDR27	253769	broad.mit.edu	37	6	170065759	170065760	+	Intron	INS	-	A	A	rs139046605	by1000genomes	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170065759_170065760insA	uc003qwx.2	-						WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron|WDR27_uc003qwz.1_5'Flank|WDR27_uc011egw.1_Intron|WDR27_uc003qxa.1_5'Flank			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		TTACTTACAGTATTTCTGTTAG	0.317													6	5	---	---	---	---	
ZMIZ2	83637	broad.mit.edu	37	7	44798683	44798684	+	Intron	INS	-	AA	AA	rs71563954		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44798683_44798684insAA	uc003tlr.2	+						ZMIZ2_uc003tlq.2_Intron|ZMIZ2_uc003tls.2_Intron|ZMIZ2_uc003tlt.2_5'Flank|ZMIZ2_uc010kyj.2_5'Flank	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						tgtctcaaattaaaaaaaaaaa	0.198													9	4	---	---	---	---	
RABGEF1	27342	broad.mit.edu	37	7	66098581	66098581	+	Intron	DEL	T	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66098581delT	uc003tvf.2	+						KCTD7_uc003tvd.3_Intron|KCTD7_uc003tve.2_Intron	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1						endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						AAGAGATCAATTTTTTTTTTT	0.333													4	2	---	---	---	---	
SSPO	23145	broad.mit.edu	37	7	149503917	149503920	+	Splice_Site	DEL	GATA	-	-	rs72359812		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149503917_149503920delGATA	uc010lpk.2	+	60	8745	c.8745_splice	c.e60+1	p.G2915_splice		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGGCCCCGGGATAGATAGAGTGT	0.652													7	6	---	---	---	---	
ASPH	444	broad.mit.edu	37	8	62538942	62538943	+	Intron	INS	-	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62538942_62538943insT	uc003xuj.2	-						ASPH_uc011leg.1_Intron|ASPH_uc003xuo.2_Intron|ASPH_uc011leh.1_Intron|ASPH_uc003xul.2_Intron|ASPH_uc011lei.1_Intron|ASPH_uc011lej.1_Intron|ASPH_uc003xun.2_Intron|ASPH_uc011lek.1_Intron|ASPH_uc003xum.2_Intron	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	CAACAAAGTAATTTTTTTTTTT	0.356													5	3	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100819906	100819907	+	Intron	DEL	TG	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100819906_100819907delTG	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGGgtgtgtttgtgtgtgtgtg	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69067802	69067805	+	Intron	DEL	TATT	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69067802_69067805delTATT	uc004afe.1	+						uc010mnq.1_Intron					Homo sapiens cDNA, FLJ18209.																		AATCTTACGATATTTATTTATCAC	0.206													8	4	---	---	---	---	
BEST1	7439	broad.mit.edu	37	11	61725444	61725445	+	Intron	INS	-	CAAACAAA	CAAACAAA	rs149120080	by1000genomes	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61725444_61725445insCAAACAAA	uc001nss.2	+						BEST1_uc010rlp.1_Intron|BEST1_uc001nsq.2_Intron|BEST1_uc010rlq.1_Intron|BEST1_uc010rlr.1_Intron|BEST1_uc010rls.1_Intron|BEST1_uc001nsr.2_Intron|BEST1_uc009ynt.2_Intron|BEST1_uc010rlt.1_Intron|BEST1_uc001nst.2_Intron|BEST1_uc010rlu.1_Intron|BEST1_uc010rlv.1_Intron	NM_004183	NP_004174	O76090	BEST1_HUMAN	bestrophin 1 isoform 1						response to stimulus|transepithelial chloride transport|visual perception	basolateral plasma membrane|chloride channel complex|cytosol|membrane fraction	chloride channel activity			central_nervous_system(1)	1						agactctgtctcaaacaaacaa	0.188													6	3	---	---	---	---	
ARHGDIB	397	broad.mit.edu	37	12	15095806	15095807	+	Intron	INS	-	T	T			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15095806_15095807insT	uc001rcq.1	-						ARHGDIB_uc001rcp.1_Intron	NM_001175	NP_001166	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta						actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity				0						CCTGAGGCATCttttttttttt	0.198													4	2	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54744018	54744018	+	Intron	DEL	C	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54744018delC	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						TTTTTTTTTTCTTTTATACCA	0.443													6	3	---	---	---	---	
ANKRD13A	88455	broad.mit.edu	37	12	110463770	110463770	+	Intron	DEL	T	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110463770delT	uc001tpx.2	+						ANKRD13A_uc009zvl.1_Intron|ANKRD13A_uc010sxw.1_Intron|ANKRD13A_uc001tpy.2_Intron|ANKRD13A_uc001tpz.2_5'Flank	NM_033121	NP_149112	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13												0						TCTCTCTCTCttttttttttt	0.204													5	5	---	---	---	---	
ZNF605	100289635	broad.mit.edu	37	12	133501828	133501829	+	3'UTR	DEL	TT	-	-	rs138670099		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133501828_133501829delTT	uc001ulh.2	-	5					ZNF605_uc001uli.2_3'UTR|ZNF605_uc001ulj.2_3'UTR	NM_183238	NP_899061	Q86T29	ZN605_HUMAN	zinc finger protein 605 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00227)|all_epithelial(31;0.142)		OV - Ovarian serous cystadenocarcinoma(86;9.24e-09)|Epithelial(86;2.11e-07)|all cancers(50;5.27e-06)		TTAGTGACTCTTGACTCCTCAA	0.376													5	4	---	---	---	---	
C14orf159	80017	broad.mit.edu	37	14	91592748	91592749	+	Intron	INS	-	TTCTT	TTCTT	rs151189640	by1000genomes	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91592748_91592749insTTCTT	uc001xzb.2	+						C14orf159_uc010atu.1_Intron|C14orf159_uc010atv.1_Intron|C14orf159_uc001xyy.2_Intron|C14orf159_uc001xyx.2_Intron|C14orf159_uc001xyw.2_Intron|C14orf159_uc001xzc.2_Intron|C14orf159_uc001xza.2_Intron|C14orf159_uc001xyv.2_Intron|C14orf159_uc001xyz.2_Intron|C14orf159_uc010twj.1_Intron|C14orf159_uc001xze.2_Intron|SNORA11B_uc010atw.2_5'Flank	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN	hypothetical protein LOC80017 isoform a							mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		atgtctgtgccttcttataaTT	0.238													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78675656	78675656	+	IGR	DEL	T	-	-	rs112849950		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78675656delT								CRABP1 (35084 upstream) : IREB2 (54862 downstream)																							ATAAGGAGAAttttttttttt	0.209													3	3	---	---	---	---	
IDH2	3418	broad.mit.edu	37	15	90631012	90631012	+	Intron	DEL	T	-	-	rs74743859		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90631012delT	uc002box.2	-						IDH2_uc010uqb.1_Intron|IDH2_uc010uqc.1_Intron|IDH2_uc010bnu.2_Intron	NM_002168	NP_002159	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+),						2-oxoglutarate metabolic process|glyoxylate cycle|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding			haematopoietic_and_lymphoid_tissue(621)|central_nervous_system(80)|bone(7)|skin(3)	711	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			AAACACCGCCTTTTTTTTTTT	0.403			M		GBM								4	2	---	---	---	---	
SNF8	11267	broad.mit.edu	37	17	47013393	47013394	+	Intron	INS	-	T	T	rs80064953		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47013393_47013394insT	uc002ioj.2	-						SNF8_uc002iok.2_Intron	NM_007241	NP_009172	Q96H20	SNF8_HUMAN	EAP30 subunit of ELL complex						cellular membrane organization|endosome transport|protein transport|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytosol|late endosome membrane|transcription factor complex	transcription factor binding				0						TTTGTTTTTTGTTTTTTTTTTT	0.183													8	7	---	---	---	---	
MBTD1	54799	broad.mit.edu	37	17	49270644	49270644	+	Intron	DEL	T	-	-	rs66924763		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49270644delT	uc002itr.3	-						MBTD1_uc002itp.3_Intron|MBTD1_uc002itq.3_Intron	NM_017643	NP_060113	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			AAAGAAAATATTTATATTGTT	0.244													5	3	---	---	---	---	
MIR21	406991	broad.mit.edu	37	17	57918537	57918542	+	5'Flank	DEL	TTTGTT	-	-			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57918537_57918542delTTTGTT	hsa-mir-21|MI0000077	+						TMEM49_uc002ixv.2_RNA																	0						GTTTTTTTGGtttgtttttgtttttg	0.374													25	13	---	---	---	---	
GAA	2548	broad.mit.edu	37	17	78084941	78084941	+	Intron	DEL	C	-	-	rs12945868	by1000genomes	TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78084941delC	uc002jxo.2	+						GAA_uc002jxp.2_Intron|GAA_uc002jxq.2_Intron	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein						cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	GGGAAAGGGGCGGGGGGGGGA	0.632													3	4	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153065	7153066	+	Intron	DEL	CA	-	-	rs113402674		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153065_7153066delCA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	cacacccccccacacacacaca	0.054													4	3	---	---	---	---	
RAB22A	57403	broad.mit.edu	37	20	56934551	56934552	+	Intron	INS	-	TT	TT	rs5842222		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56934551_56934552insTT	uc002xyz.2	+							NM_020673	NP_065724	Q9UL26	RB22A_HUMAN	RAS-related protein RAB-22A						endocytosis|endosome organization|protein transport|small GTPase mediated signal transduction	early endosome|endosome membrane|plasma membrane	GTP binding|GTPase activity|protein binding				0	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)			gtttattaaaCTTTTTTTTTTT	0.168													4	3	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36690135	36690136	+	Splice_Site	INS	-	A	A			TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36690135_36690136insA	uc003apg.2	-	28	4068	c.3837_splice	c.e28+1	p.Q1279_splice		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GCGGAGGCCTCACCTGCAGCTT	0.639			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				42	36	---	---	---	---	
SEPT6	23157	broad.mit.edu	37	X	118768990	118768991	+	Intron	DEL	AG	-	-	rs58483699		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118768990_118768991delAG	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron|SEPT6_uc011mtv.1_Intron|SEPT6_uc011mtw.1_Intron	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						aaaaaaaaaaagaaagaaaaGA	0.198													4	2	---	---	---	---	
PDZD4	57595	broad.mit.edu	37	X	153068677	153068679	+	3'UTR	DEL	GAG	-	-	rs72151348		TCGA-DS-A0VL-01	TCGA-DS-A0VL-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153068677_153068679delGAG	uc004fiz.1	-	8					PDZD4_uc004fiy.1_3'UTR|PDZD4_uc004fix.2_3'UTR|PDZD4_uc004fja.1_3'UTR|PDZD4_uc011mze.1_3'UTR	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4							cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACACCCAGACGAGGAGATGTGTG	0.458													2	5	---	---	---	---	
