Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCC	9696	broad.mit.edu	37	1	17285209	17285209	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17285209G>A	uc001azt.2	+	26	4065	c.3996G>A	c.(3994-3996)CTG>CTA	p.L1332L	CROCC_uc001azu.2_Silent_p.L635L	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	1332	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		AGAGGCTGCTGAAGGGCGAGG	0.711													3	2	---	---	---	---	PASS
ALDH4A1	8659	broad.mit.edu	37	1	19204081	19204081	+	Silent	SNP	G	A	A	rs150927009		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19204081G>A	uc001bbb.2	-	10	1242	c.966C>T	c.(964-966)TTC>TTT	p.F322F	ALDH4A1_uc010ocu.1_Silent_p.F262F|ALDH4A1_uc001bbc.2_Silent_p.F322F	NM_170726	NP_733844	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4A1 isoform a precursor	322					proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	NADH(DB00157)	AGCGGTGCACGAAGTGGAAGT	0.657													11	23	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19484358	19484358	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19484358G>C	uc001bbi.2	-	40	5715	c.5711C>G	c.(5710-5712)TCT>TGT	p.S1904C	UBR4_uc001bbl.1_5'Flank|UBR4_uc001bbm.1_Missense_Mutation_p.S1115C	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1904					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CCCATGGGGAGAGGAGAGCAC	0.542													28	81	---	---	---	---	PASS
DLGAP3	58512	broad.mit.edu	37	1	35365805	35365805	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35365805G>A	uc001byc.2	-	2	1177	c.1177C>T	c.(1177-1179)CGG>TGG	p.R393W		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	393					cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				CTGCCGCTCCGCATCCTGCGG	0.632													34	66	---	---	---	---	PASS
RLF	6018	broad.mit.edu	37	1	40706021	40706021	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40706021C>T	uc001cfc.3	+	8	5678	c.5647C>T	c.(5647-5649)CGG>TGG	p.R1883W	RLF_uc001cfd.3_Missense_Mutation_p.R1574W	NM_012421	NP_036553	Q13129	RLF_HUMAN	rearranged L-myc fusion	1883					chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			ovary(2)|pancreas(1)	3	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TCATTATCTTCGGCCAGTGGT	0.388													28	57	---	---	---	---	PASS
WDR65	149465	broad.mit.edu	37	1	43665156	43665156	+	Silent	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43665156G>C	uc001cip.1	+	9	1645	c.1524G>C	c.(1522-1524)CTG>CTC	p.L508L	EBNA1BP2_uc001cio.2_Intron|WDR65_uc010ojz.1_Silent_p.L497L|WDR65_uc001ciq.1_Silent_p.L508L	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65	508										skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TCTCAAGCCTGAAAGGACACA	0.453													37	79	---	---	---	---	PASS
PRPF38A	84950	broad.mit.edu	37	1	52882338	52882338	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52882338G>C	uc001ctv.3	+	10	1118	c.915G>C	c.(913-915)AAG>AAC	p.K305N	PRPF38A_uc001ctw.3_Missense_Mutation_p.R116T	NM_032864	NP_116253	Q8NAV1	PR38A_HUMAN	PRP38 pre-mRNA processing factor 38 (yeast)	305					mRNA processing|RNA splicing	spliceosomal complex					0						AGAGCCACAAGAAGAGCCGGA	0.313													8	41	---	---	---	---	PASS
PRPF38A	84950	broad.mit.edu	37	1	52882347	52882347	+	Silent	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52882347G>C	uc001ctv.3	+	10	1127	c.924G>C	c.(922-924)CGG>CGC	p.R308R	PRPF38A_uc001ctw.3_Missense_Mutation_p.G119A	NM_032864	NP_116253	Q8NAV1	PR38A_HUMAN	PRP38 pre-mRNA processing factor 38 (yeast)	308					mRNA processing|RNA splicing	spliceosomal complex					0						AGAAGAGCCGGAGAGGGAATG	0.348													9	41	---	---	---	---	PASS
BARHL2	343472	broad.mit.edu	37	1	91182267	91182267	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91182267G>A	uc001dns.2	-	1	528	c.486C>T	c.(484-486)ACC>ACT	p.T162T		NM_020063	NP_064447	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	162						nucleus	sequence-specific DNA binding			ovary(1)	1		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		AGGATACGCTGGTGCTGTAGG	0.592													6	7	---	---	---	---	PASS
BARHL2	343472	broad.mit.edu	37	1	91182268	91182268	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91182268G>A	uc001dns.2	-	1	527	c.485C>T	c.(484-486)ACC>ATC	p.T162I		NM_020063	NP_064447	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	162						nucleus	sequence-specific DNA binding			ovary(1)	1		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		GGATACGCTGGTGCTGTAGGG	0.592													5	7	---	---	---	---	PASS
CCDC76	54482	broad.mit.edu	37	1	100608696	100608696	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100608696G>C	uc001dsv.2	+	8	692	c.673G>C	c.(673-675)GAT>CAT	p.D225H	CCDC76_uc010ouf.1_RNA|CCDC76_uc009wea.2_Missense_Mutation_p.D225H	NM_019083	NP_061956	Q9NUP7	TRM13_HUMAN	coiled-coil domain containing 76	225					tRNA processing		metal ion binding|methyltransferase activity			ovary(1)	1		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0814)|all cancers(265;0.133)|COAD - Colon adenocarcinoma(174;0.146)|Lung(183;0.194)		TGTGCAGGTGGATGGAAAACA	0.284													5	29	---	---	---	---	PASS
CA14	23632	broad.mit.edu	37	1	150237017	150237017	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150237017G>C	uc001etx.2	+	11	1281	c.972G>C	c.(970-972)AAG>AAC	p.K324N		NM_012113	NP_036245	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV precursor	324	Cytoplasmic (Potential).					integral to membrane	carbonate dehydratase activity|metal ion binding			ovary(1)	1	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAAACCGAAAGAGTGTGGTCT	0.463													10	25	---	---	---	---	PASS
CRTC2	200186	broad.mit.edu	37	1	153927568	153927568	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153927568C>G	uc010ped.1	-	2	298	c.228G>C	c.(226-228)CAG>CAC	p.Q76H	CRTC2_uc001fde.3_5'Flank|CRTC2_uc001fdf.3_5'Flank	NM_181715	NP_859066	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	76					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)	2	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAGAGCCAATCTGGTTAACAT	0.532													14	25	---	---	---	---	PASS
SELL	6402	broad.mit.edu	37	1	169677748	169677748	+	Silent	SNP	T	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169677748T>G	uc001ggk.2	-	3	480	c.282A>C	c.(280-282)ATA>ATC	p.I94I	C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_Silent_p.I47I|SELL_uc001ggl.1_Silent_p.I107I	NM_000655	NP_000646	P14151	LYAM1_HUMAN	selectin L precursor	94	C-type lectin.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding				0	all_hematologic(923;0.208)					ATATTCCTCCTATCTTCCGGA	0.453													11	29	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197326066	197326066	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197326066G>A	uc001gtz.2	+	5	1229	c.1094G>A	c.(1093-1095)CGC>CAC	p.R365H	CRB1_uc010poz.1_Missense_Mutation_p.R296H|CRB1_uc001gty.1_Missense_Mutation_p.R365H|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.R253H|CRB1_uc010ppb.1_Missense_Mutation_p.R365H|CRB1_uc010ppc.1_RNA	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	365	Extracellular (Potential).|EGF-like 9.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						CAATATGGACGCATCACTGGA	0.498													24	44	---	---	---	---	PASS
AVPR1B	553	broad.mit.edu	37	1	206230995	206230995	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206230995C>G	uc001hds.2	+	2	1286	c.1128C>G	c.(1126-1128)CAC>CAG	p.H376Q		NM_000707	NP_000698	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	376	Cytoplasmic (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity			ovary(2)|large_intestine(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	CGAGCCGCCACACCACGCTGC	0.706													6	11	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220269459	220269459	+	Nonsense_Mutation	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220269459C>A	uc001hmc.2	+	2	385	c.281C>A	c.(280-282)TCA>TAA	p.S94*		NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase	94					isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TGTGGATTTTCAGAACTTTAT	0.333													9	20	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220269471	220269471	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220269471C>T	uc001hmc.2	+	2	397	c.293C>T	c.(292-294)TCA>TTA	p.S98L		NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase	98					isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	GAACTTTATTCATGGCAAAGA	0.323													10	24	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235969198	235969198	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235969198C>G	uc001hxj.2	-	6	3413	c.3238G>C	c.(3238-3240)GCT>CCT	p.A1080P	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Missense_Mutation_p.A1080P	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	1080					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GCTTCAGTAGCTGAAACTTCT	0.413									Chediak-Higashi_syndrome				24	64	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235969573	235969573	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235969573C>G	uc001hxj.2	-	6	3038	c.2863G>C	c.(2863-2865)GAA>CAA	p.E955Q	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Missense_Mutation_p.E955Q	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	955					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGCATATGTTCAGGAGAAGGC	0.458									Chediak-Higashi_syndrome				35	90	---	---	---	---	PASS
ATP6V1E2	90423	broad.mit.edu	37	2	46739842	46739842	+	Silent	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46739842C>G	uc002ruy.2	-	2	1123	c.9G>C	c.(7-9)CTG>CTC	p.L3L	ATP6V1E2_uc002ruz.2_Silent_p.L3L	NM_080653	NP_542384	Q96A05	VATE2_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1	3					cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain	proton-transporting ATPase activity, rotational mechanism			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)			CGACATCACTCAGGGCCATGG	0.507													14	33	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55544890	55544890	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55544890C>T	uc002ryv.2	-	20	4251	c.3409G>A	c.(3409-3411)GAA>AAA	p.E1137K	CCDC88A_uc010yoz.1_Missense_Mutation_p.E1138K|CCDC88A_uc010ypa.1_Missense_Mutation_p.E1137K|CCDC88A_uc002ryu.2_Missense_Mutation_p.E420K|CCDC88A_uc002rys.2_Missense_Mutation_p.E123K|CCDC88A_uc002ryw.2_Missense_Mutation_p.E421K|CCDC88A_uc010fby.1_Missense_Mutation_p.E17K	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	1138	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						GATTCATTTTCATTTTCTAAG	0.378													33	70	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90108583	90108583	+	Intron	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90108583G>A	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		TTCCAGGTGAGAATATTTAGA	0.383													12	58	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136566629	136566629	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136566629G>A	uc002tuu.1	-	8	3299	c.3288C>T	c.(3286-3288)GCC>GCT	p.A1096A		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1096	3.|Extracellular (Potential).|4 X approximate repeats.			A -> T (in Ref. 1; CAA30801).	carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		CTTTGATGACGGCGTGGGCTA	0.557													9	68	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179394998	179394998	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179394998C>T	uc010zfg.1	-	307	98864	c.98640G>A	c.(98638-98640)CGG>CGA	p.R32880R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.R26575R|TTN_uc010zfi.1_Silent_p.R26508R|TTN_uc010zfj.1_Silent_p.R26383R|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33807							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCAGTTGGCCGGGGTTCTC	0.378													5	118	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179613392	179613392	+	Missense_Mutation	SNP	A	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179613392A>G	uc002unb.2	-	46	13959	c.13735T>C	c.(13735-13737)TTT>CTT	p.F4579L	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAGTGTGAAACTGCTTTAAG	0.333													43	108	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179641169	179641169	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179641169C>T	uc010zfg.1	-	28	5646	c.5422G>A	c.(5422-5424)GAG>AAG	p.E1808K	TTN_uc010zfh.1_Missense_Mutation_p.E1762K|TTN_uc010zfi.1_Missense_Mutation_p.E1762K|TTN_uc010zfj.1_Missense_Mutation_p.E1762K|TTN_uc002unb.2_Missense_Mutation_p.E1808K|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1808							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCCTCCCCTCAGGCAATTGG	0.408													51	93	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183826937	183826937	+	Nonsense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183826937G>A	uc002upc.2	-	18	2233	c.1831C>T	c.(1831-1833)CGA>TGA	p.R611*	NCKAP1_uc002upb.2_Nonsense_Mutation_p.R617*	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	611					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ATGAGATTTCGAGCTTGTTTG	0.368													16	39	---	---	---	---	PASS
INO80D	54891	broad.mit.edu	37	2	206911292	206911292	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206911292C>G	uc002vaz.3	-	5	1414	c.1009G>C	c.(1009-1011)GAG>CAG	p.E337Q		NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	337					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						GAGGCCTGCTCTGAGTCCTCT	0.413													21	41	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215823081	215823081	+	Nonsense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215823081G>A	uc002vew.2	-	41	6257	c.6037C>T	c.(6037-6039)CAA>TAA	p.Q2013*	ABCA12_uc002vev.2_Nonsense_Mutation_p.Q1695*|ABCA12_uc010zjn.1_Nonsense_Mutation_p.Q940*	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	2013					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GCTTTGGTTTGATGTTCCCTT	0.428													21	49	---	---	---	---	PASS
SERPINE2	5270	broad.mit.edu	37	2	224866375	224866375	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866375C>T	uc002vnu.2	-	2	486	c.243G>A	c.(241-243)ATG>ATA	p.M81I	SERPINE2_uc002vnt.2_Missense_Mutation_p.M81I|SERPINE2_uc010zlr.1_Missense_Mutation_p.M93I|SERPINE2_uc002vnv.2_Missense_Mutation_p.M81I	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2	81					negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CGCCGTATCTCATCACCATGG	0.557													16	44	---	---	---	---	PASS
AQP12B	653437	broad.mit.edu	37	2	241622114	241622114	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241622114G>A	uc010fzj.2	-	1	204	c.141C>T	c.(139-141)CTC>CTT	p.L47L	AQP12B_uc002vzt.2_Intron	NM_001102467	NP_001095937	A6NM10	AQ12B_HUMAN	aquaporin 12B	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane	transporter activity				0		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		AGCAGGCCCCGAGCTGCACCG	0.692													10	13	---	---	---	---	PASS
NUP210	23225	broad.mit.edu	37	3	13381804	13381804	+	Intron	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13381804G>A	uc003bxv.1	-							NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					AAGACCTGTTGAGAGACACAG	0.562													5	31	---	---	---	---	PASS
ALS2CL	259173	broad.mit.edu	37	3	46717778	46717778	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46717778C>G	uc003cqa.1	-	19	2333	c.2143G>C	c.(2143-2145)GAG>CAG	p.E715Q	ALS2CL_uc003cpx.1_Missense_Mutation_p.E62Q|ALS2CL_uc003cpy.1_RNA|ALS2CL_uc003cpz.1_Missense_Mutation_p.E230Q|ALS2CL_uc003cqb.1_Missense_Mutation_p.E715Q|ALS2CL_uc003cqc.1_RNA	NM_147129	NP_667340	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like isoform 1	715					endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)|central_nervous_system(2)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		TTCACCTCCTCCTGGGCCAGC	0.627													22	33	---	---	---	---	PASS
NBEAL2	23218	broad.mit.edu	37	3	47045571	47045571	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47045571C>T	uc003cqp.2	+	37	6065	c.5886C>T	c.(5884-5886)ATC>ATT	p.I1962I	NBEAL2_uc010hjm.1_Silent_p.I1339I|NBEAL2_uc010hjn.1_Silent_p.I358I|NBEAL2_uc010hjo.1_5'Flank	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1962							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCATAGGCATCGGCTATGATT	0.607													74	157	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119134599	119134599	+	Missense_Mutation	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119134599G>T	uc003ecj.3	+	12	4355	c.3823G>T	c.(3823-3825)GTG>TTG	p.V1275L		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	1275					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						GTCCTCACCAGTGGATGCCAC	0.537													18	22	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178921549	178921549	+	Missense_Mutation	SNP	T	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178921549T>G	uc003fjk.2	+	5	1188	c.1031T>G	c.(1030-1032)GTG>GGG	p.V344G		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	344					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.V344A(1)|p.V344G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GCAACCTACGTGAATGTAAAT	0.303		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			25	65	---	---	---	---	PASS
HGFAC	3083	broad.mit.edu	37	4	3444814	3444814	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3444814C>G	uc003ghc.2	+	3	339	c.336C>G	c.(334-336)TTC>TTG	p.F112L	HGFAC_uc010icw.2_Missense_Mutation_p.F112L	NM_001528	NP_001519	Q04756	HGFA_HUMAN	HGF activator preproprotein	112	Fibronectin type-II.				proteolysis	extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(2)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GGTTCCCCTTCCGCTACGGGG	0.716													15	16	---	---	---	---	PASS
RNF150	57484	broad.mit.edu	37	4	142053952	142053952	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142053952G>A	uc003iio.1	-	1	665	c.11C>T	c.(10-12)TCT>TTT	p.S4F	RNF150_uc010iok.1_Missense_Mutation_p.S4F|RNF150_uc003iip.1_Missense_Mutation_p.S4F	NM_020724	NP_065775	Q9ULK6	RN150_HUMAN	ring finger protein 150 precursor	4						integral to membrane	zinc ion binding			ovary(1)	1	all_hematologic(180;0.162)					TTGGATGAGAGACATTGCCAT	0.343													10	38	---	---	---	---	PASS
ZNF827	152485	broad.mit.edu	37	4	146791581	146791581	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146791581C>T	uc003ikn.2	-	5	1845	c.1797G>A	c.(1795-1797)GAG>GAA	p.E599E	ZNF827_uc003ikm.2_Silent_p.E599E|ZNF827_uc010iox.2_Silent_p.E249E	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	599					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					CTTCCTTAGGCTCCTCTTTCA	0.483													13	81	---	---	---	---	PASS
MFAP3L	9848	broad.mit.edu	37	4	170926743	170926743	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170926743C>T	uc003isp.3	-	2	464	c.286G>A	c.(286-288)GAG>AAG	p.E96K	MFAP3L_uc003isn.3_5'Flank	NM_021647	NP_067679	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like isoform	96	Extracellular (Potential).|Ig-like C2-type.					integral to membrane|plasma membrane				ovary(1)	1		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		CCTCCTCTCTCCTTCTCATCC	0.423													85	72	---	---	---	---	PASS
CEP72	55722	broad.mit.edu	37	5	634048	634048	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:634048C>G	uc003jbf.2	+	5	749	c.677C>G	c.(676-678)TCT>TGT	p.S226C	CEP72_uc011clz.1_Intron	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa	226					G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GAGGCCGACTCTCGTGGTTCC	0.617													23	52	---	---	---	---	PASS
CD180	4064	broad.mit.edu	37	5	66479484	66479484	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66479484G>A	uc003juy.2	-	3	1335	c.1187C>T	c.(1186-1188)TCC>TTC	p.S396F		NM_005582	NP_005573	Q99467	CD180_HUMAN	CD180 molecule precursor	396	Extracellular (Potential).				inflammatory response|innate immune response	integral to membrane|plasma membrane	receptor activity			ovary(1)	1		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		TTGCAAGTGGGACAGGTTTTT	0.458													42	100	---	---	---	---	PASS
MARVELD2	153562	broad.mit.edu	37	5	68737491	68737491	+	3'UTR	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68737491G>A	uc003jwq.2	+	7					MARVELD2_uc010ixf.2_3'UTR|MARVELD2_uc003jwr.1_Intron|MARVELD2_uc003jws.1_RNA	NM_001038603	NP_001033692	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2 isoform 1						sensory perception of sound	integral to membrane|tight junction					0		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		ACGCTTATTTGAAACCACttt	0.154													16	27	---	---	---	---	PASS
POLR3G	10622	broad.mit.edu	37	5	89802378	89802378	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89802378G>A	uc003kjq.2	+	7	672	c.472G>A	c.(472-474)GAT>AAT	p.D158N	POLR3G_uc011cuc.1_Missense_Mutation_p.D158N	NM_006467	NP_006458	O15318	RPC7_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	158	Glu-rich.				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA-directed RNA polymerase activity				0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;2.74e-31)|Epithelial(54;8.2e-26)|all cancers(79;3.86e-22)		tgaaaaatcagatgaggaaaa	0.144													24	37	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112175921	112175921	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112175921G>C	uc010jby.2	+	16	5010	c.4630G>C	c.(4630-4632)GAA>CAA	p.E1544Q	APC_uc011cvt.1_Missense_Mutation_p.E1526Q|APC_uc003kpz.3_Missense_Mutation_p.E1544Q|APC_uc003kpy.3_Missense_Mutation_p.E1544Q|APC_uc010jbz.2_Missense_Mutation_p.E1261Q|APC_uc010jca.2_Missense_Mutation_p.E844Q	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1544	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.E1544*(1)|p.K1192fs*3(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCAGCCTAAAGAATCAAATGA	0.348		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			22	50	---	---	---	---	PASS
GFRA3	2676	broad.mit.edu	37	5	137589024	137589024	+	Silent	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137589024G>C	uc003lcn.2	-	7	1205	c.1065C>G	c.(1063-1065)CTC>CTG	p.L355L	GFRA3_uc003lco.2_Silent_p.L324L	NM_001496	NP_001487	O60609	GFRA3_HUMAN	GDNF family receptor alpha 3 preproprotein	355					peripheral nervous system development	anchored to membrane|cytoplasm|extrinsic to membrane|intracellular membrane-bounded organelle	receptor binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CCTGGGAGAAGAGTTGGCTGT	0.572													5	8	---	---	---	---	PASS
HIST1H2BL	8340	broad.mit.edu	37	6	27775463	27775463	+	Silent	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27775463G>T	uc003njl.2	-	1	247	c.222C>A	c.(220-222)ATC>ATA	p.I74I	HIST1H3H_uc003njm.2_5'Flank	NM_003519	NP_003510	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	74					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CCTCGCTTGCGATGCGCTCGA	0.612													153	57	---	---	---	---	PASS
GNL1	2794	broad.mit.edu	37	6	30520380	30520380	+	Silent	SNP	A	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30520380A>C	uc003nqh.2	-	8	1991	c.963T>G	c.(961-963)GGT>GGG	p.G321G	GNL1_uc011dmi.1_Intron|GNL1_uc011dmj.1_Silent_p.G319G|GNL1_uc011dmk.1_Intron	NM_005275	NP_005266	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	321					response to DNA damage stimulus|signal transduction|T cell mediated immunity	extracellular space|intracellular	GTP binding|structural molecule activity			ovary(3)	3						CAGAGCCATTACCCCAGGTGG	0.592													6	79	---	---	---	---	PASS
SLC44A4	80736	broad.mit.edu	37	6	31831514	31831514	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31831514C>G	uc010jti.2	-	21	2089	c.2023G>C	c.(2023-2025)GAG>CAG	p.E675Q	NEU1_uc003nxq.3_5'Flank|NEU1_uc010jtg.2_5'Flank|NEU1_uc003nxr.3_5'Flank|NEU1_uc010jth.2_5'Flank|NEU1_uc003nxs.3_5'Flank	NM_025257	NP_079533	Q53GD3	CTL4_HUMAN	choline transporter-like protein 4	675	Cytoplasmic (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4					Choline(DB00122)	TTGTTCCGCTCCAGGTCTTCC	0.483													34	14	---	---	---	---	PASS
TAP2	6891	broad.mit.edu	37	6	32805917	32805917	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32805917G>A	uc003occ.2	-	1	125	c.94C>T	c.(94-96)CCT>TCT	p.P32S	TAP2_uc011dqf.1_Missense_Mutation_p.P32S|TAP2_uc003ocb.1_Missense_Mutation_p.P32S|TAP2_uc003ocd.2_Missense_Mutation_p.P32S	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	32	Cytoplasmic (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						AGCCCTTGAGGAAGCAAAGTC	0.642													12	64	---	---	---	---	PASS
CPNE5	57699	broad.mit.edu	37	6	36713162	36713162	+	Intron	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36713162C>T	uc003omr.1	-						CPNE5_uc003omp.1_Intron|CPNE5_uc010jwn.1_Intron|CPNE5_uc003omq.1_Intron	NM_020939	NP_065990	Q9HCH3	CPNE5_HUMAN	copine V											skin(1)	1						CAGCGGCACTCACCTGGCCAC	0.662													20	8	---	---	---	---	PASS
ECHDC1	55862	broad.mit.edu	37	6	127611068	127611068	+	Nonsense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127611068C>T	uc003qax.2	-	6	906	c.870G>A	c.(868-870)TGG>TGA	p.W290*	ECHDC1_uc003qaz.3_Nonsense_Mutation_p.W284*|ECHDC1_uc010key.2_Nonsense_Mutation_p.W209*|ECHDC1_uc003qay.3_3'UTR|ECHDC1_uc010kez.2_3'UTR|ECHDC1_uc010kex.2_RNA	NM_001139510	NP_001132982	Q9NTX5	ECHD1_HUMAN	enoyl Coenzyme A hydratase domain containing 1	290							catalytic activity				0				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		CAGGCCCACCCCAAACTGTTC	0.373													58	35	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161470014	161470014	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161470014C>T	uc003qtn.2	+	3	852	c.710C>T	c.(709-711)TCA>TTA	p.S237L	MAP3K4_uc010kkc.1_Missense_Mutation_p.S237L|MAP3K4_uc003qto.2_Missense_Mutation_p.S237L|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	237					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AAGCTTACCTCAGTCTCAAAG	0.433													15	4	---	---	---	---	PASS
HOXA4	3201	broad.mit.edu	37	7	27169068	27169068	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27169068C>T	uc003sym.3	-	2	786	c.739G>A	c.(739-741)GAG>AAG	p.E247K	HOXA3_uc003syk.2_5'Flank	NM_002141	NP_002132	Q00056	HXA4_HUMAN	homeobox A4	247	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						TGGGCGATCTCGATGCGGCGC	0.577													26	80	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31904683	31904683	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31904683G>A	uc003tcm.1	-	7	1092	c.623C>T	c.(622-624)GCA>GTA	p.A208V	PDE1C_uc003tcn.1_Missense_Mutation_p.A208V|PDE1C_uc003tco.1_Missense_Mutation_p.A268V|PDE1C_uc003tcr.2_Missense_Mutation_p.A208V|PDE1C_uc003tcs.2_Missense_Mutation_p.A208V	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	208	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TGAGACAAGTGCAGAAATGGG	0.443													21	38	---	---	---	---	PASS
VWC2	375567	broad.mit.edu	37	7	49842412	49842412	+	Missense_Mutation	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49842412C>A	uc003tot.1	+	3	1358	c.802C>A	c.(802-804)CAG>AAG	p.Q268K		NM_198570	NP_940972	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	268	VWFC 2.				negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space					0						CGAGCCTGATCAGTGCTGTCC	0.572													3	47	---	---	---	---	PASS
CD36	948	broad.mit.edu	37	7	80292452	80292452	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80292452C>T	uc003uhc.2	+	9	1260	c.576C>T	c.(574-576)TAC>TAT	p.Y192Y	CD36_uc003uhd.3_Silent_p.Y192Y|CD36_uc011kgv.1_Silent_p.Y116Y|CD36_uc003uhe.3_Silent_p.Y192Y|CD36_uc003uhf.3_Silent_p.Y192Y|CD36_uc003uhg.3_Silent_p.Y192Y|CD36_uc003uhh.3_Silent_p.Y192Y	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen	192	Extracellular (Potential).				cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						TGGTTCCGTACCCTGTTACTA	0.333													31	77	---	---	---	---	PASS
SLC25A40	55972	broad.mit.edu	37	7	87476435	87476435	+	Missense_Mutation	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87476435C>A	uc003uje.2	-	8	811	c.460G>T	c.(460-462)GGT>TGT	p.G154C		NM_018843	NP_061331	Q8TBP6	S2540_HUMAN	mitochondrial carrier family protein	154	Helical; Name=3; (Potential).|Solcar 2.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			haematopoietic_and_lymphoid_tissue(1)	1	Esophageal squamous(14;0.00202)					GTTACTGCACCAACTAATACA	0.303													4	181	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141705385	141705385	+	Missense_Mutation	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141705385C>A	uc003vwy.2	+	2	109	c.55C>A	c.(55-57)CTT>ATT	p.L19I		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	19	Helical; Signal-anchor for type II membrane protein; (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCTCAGTGTTCTTCTGCTTGT	0.343													7	18	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30703505	30703505	+	Missense_Mutation	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30703505C>A	uc003xil.2	-	1	3029	c.3029G>T	c.(3028-3030)AGA>ATA	p.R1010I		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1010										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TGTGTGAACTCTTCTATGAGC	0.333													4	147	---	---	---	---	PASS
CA2	760	broad.mit.edu	37	8	86377680	86377680	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86377680G>A	uc003ydk.2	+	2	394	c.214G>A	c.(214-216)GAC>AAC	p.D72N		NM_000067	NP_000058	P00918	CAH2_HUMAN	carbonic anhydrase II	72					one-carbon metabolic process	apical part of cell	carbonate dehydratase activity|zinc ion binding			central_nervous_system(1)	1					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)	GGAGTTTGATGACTCTCAGGA	0.463													12	27	---	---	---	---	PASS
GRINA	2907	broad.mit.edu	37	8	145066985	145066985	+	Silent	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145066985C>A	uc003zan.1	+	7	1258	c.1092C>A	c.(1090-1092)ACC>ACA	p.T364T	GRINA_uc003zao.1_Silent_p.T364T|GRINA_uc003zap.1_Silent_p.T364T	NM_001009184	NP_001009184	Q7Z429	GRINA_HUMAN	glutamate receptor, ionotropic, N-methyl	364	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACATCCTCACCATCATTGGCC	0.602													3	24	---	---	---	---	PASS
SPTAN1	6709	broad.mit.edu	37	9	131351132	131351132	+	Silent	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131351132C>G	uc004bvl.3	+	21	3029	c.2916C>G	c.(2914-2916)GTC>GTG	p.V972V	SPTAN1_uc011mbg.1_Silent_p.V972V|SPTAN1_uc011mbh.1_Silent_p.V984V|SPTAN1_uc004bvm.3_Silent_p.V972V|SPTAN1_uc004bvn.3_Silent_p.V972V	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	972	SH3.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						AGGAGCTGGTCTTGGCTCTCT	0.507													19	56	---	---	---	---	PASS
ASS1	445	broad.mit.edu	37	9	133370371	133370371	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133370371G>A	uc004bzm.2	+	14	1444	c.1088G>A	c.(1087-1089)CGG>CAG	p.R363Q	ASS1_uc004bzn.2_Missense_Mutation_p.R363Q|ASS1_uc010mza.2_Missense_Mutation_p.R439Q|ASS1_uc004bzo.2_Missense_Mutation_p.R344Q|ASS1_uc010mzb.2_Missense_Mutation_p.R401Q|ASS1_uc004bzp.2_Missense_Mutation_p.R363Q|ASS1_uc010mzc.2_Missense_Mutation_p.R363Q	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1	363			R -> G (in CTLN1).|R -> Q (in CTLN1).|R -> W (in CTLN1).|R -> L (in CTLN1).		arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	ATCCTCGGCCGGGAGTCCCCA	0.582													7	19	---	---	---	---	PASS
AKR1CL1	340811	broad.mit.edu	37	10	5203836	5203836	+	RNA	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5203836C>T	uc009xhz.2	-	3		c.444G>A				NR_027916				Homo sapiens cDNA FLJ16347 fis, clone TESTI2036288, moderately similar to PROSTAGLANDIN-F SYNTHASE 1 (EC 1.1.1.188).												0						GCAAATGGTACATGAATAATG	0.408													12	14	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29769544	29769544	+	Missense_Mutation	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29769544G>T	uc001iut.1	-	29	6052	c.5299C>A	c.(5299-5301)CTC>ATC	p.L1767I	LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Missense_Mutation_p.L681I|SVIL_uc001iuu.1_Missense_Mutation_p.L1341I|SVIL_uc009xlc.2_Missense_Mutation_p.L559I	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1767	Gelsolin-like 3.				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TGTTTGGGGAGCCTGCTATAG	0.547													5	50	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89717609	89717609	+	Splice_Site	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89717609G>A	uc001kfb.2	+	8	1666	c.635_splice	c.e8-1	p.N212_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(3)|p.Y27fs*1(2)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TAACCATGCAGATCCTCAGTT	0.383		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			43	19	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106976806	106976806	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106976806G>A	uc001kyi.1	+	19	2887	c.2660G>A	c.(2659-2661)GGG>GAG	p.G887E	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	887	PKD.|Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AAGAGTGCGGGGATCTTCCAG	0.527													23	43	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129913693	129913693	+	Missense_Mutation	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129913693G>T	uc001lke.2	-	7	1174	c.979C>A	c.(979-981)CAG>AAG	p.Q327K	MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	327					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTGGGAGTCTGAACAGACTCC	0.522													70	38	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134896365	134896365	+	Intron	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134896365G>A	uc001llw.2	+									Q86SQ6	GP123_HUMAN	RecName: Full=Probable G-protein coupled receptor 123;							integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CCTGTGCGGTGAGGCCTTCCA	0.667													5	3	---	---	---	---	PASS
SPTY2D1	144108	broad.mit.edu	37	11	18637159	18637159	+	Missense_Mutation	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18637159C>A	uc001moy.2	-	3	878	c.662G>T	c.(661-663)GGA>GTA	p.G221V	SPTY2D1_uc010rdi.1_Missense_Mutation_p.G221V	NM_194285	NP_919261	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1	221										breast(1)	1						AGGTAGTTTTCCATCTGTCTC	0.443													58	155	---	---	---	---	PASS
CAT	847	broad.mit.edu	37	11	34478296	34478296	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34478296G>A	uc001mvm.2	+	8	1071	c.988G>A	c.(988-990)GAA>AAA	p.E330K	CAT_uc009ykc.1_RNA	NM_001752	NP_001743	P04040	CATA_HUMAN	catalase	330					hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	TGCTGAGGTTGAACAGATAGC	0.478													23	45	---	---	---	---	PASS
CD44	960	broad.mit.edu	37	11	35231516	35231516	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35231516G>C	uc001mvu.2	+	13	1955	c.1521G>C	c.(1519-1521)CAG>CAC	p.Q507H	CD44_uc001mvv.2_Missense_Mutation_p.Q464H|CD44_uc001mvw.2_Missense_Mutation_p.Q258H|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Missense_Mutation_p.Q71H|CD44_uc010ret.1_RNA|CD44_uc010reu.1_Missense_Mutation_p.Q35H	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	507	Extracellular (Potential).|Stem.				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	AAACAGAGCAGAGTAATTCTC	0.383													40	80	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55110827	55110827	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55110827C>T	uc010rie.1	+	1	151	c.151C>T	c.(151-153)CCC>TCC	p.P51S		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	51	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						TATTGGCAGCCCCTCCTTGGG	0.408													4	108	---	---	---	---	PASS
LGALS12	85329	broad.mit.edu	37	11	63276260	63276260	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63276260G>A	uc001nxa.2	+	3	576	c.235G>A	c.(235-237)GAC>AAC	p.D79N	LGALS12_uc001nxb.2_Missense_Mutation_p.D79N|LGALS12_uc001nxc.2_Missense_Mutation_p.D80N|LGALS12_uc001nxd.2_Missense_Mutation_p.D18N|LGALS12_uc001nxe.2_Missense_Mutation_p.D18N|LGALS12_uc009yot.2_Missense_Mutation_p.D39N	NM_033101	NP_149092	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12 isoform	79	Galectin 1.				apoptosis|induction of apoptosis by intracellular signals	nucleus	lactose binding			ovary(2)	2						GTTTCAGGTGGACTTCCAGTG	0.587													8	43	---	---	---	---	PASS
SYT12	91683	broad.mit.edu	37	11	66802123	66802123	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66802123G>C	uc009yrl.2	+	3	272	c.42G>C	c.(40-42)AAG>AAC	p.K14N	SYT12_uc001oju.2_Missense_Mutation_p.K14N	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII	14	Vesicular (Potential).					cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						CAGTCATCAAGAGCCCCCCTG	0.587													13	35	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70118338	70118338	+	Silent	SNP	A	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70118338A>G	uc001opo.2	+	2	258	c.60A>G	c.(58-60)GGA>GGG	p.G20G	PPFIA1_uc001opn.1_Silent_p.G20G|PPFIA1_uc001opp.2_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	20	Poly-Gly.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GAGGAGGTGGAGGCCATGGTT	0.517													3	146	---	---	---	---	PASS
CXCR5	643	broad.mit.edu	37	11	118765349	118765349	+	Missense_Mutation	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118765349G>T	uc001pue.3	+	2	1206	c.1096G>T	c.(1096-1098)GCC>TCC	p.A366S	CXCR5_uc001puf.2_Missense_Mutation_p.A321S	NM_001716	NP_001707	P32302	CXCR5_HUMAN	Burkitt lymphoma receptor 1 isoform 1	366	Cytoplasmic (Potential).				B cell activation|cellular component movement	integral to plasma membrane	C-X-C chemokine receptor activity			breast(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		GTCAGAGAATGCCACCTCTCT	0.602													3	33	---	---	---	---	PASS
STT3A	3703	broad.mit.edu	37	11	125472272	125472272	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125472272G>A	uc001qcd.2	+	4	334	c.224G>A	c.(223-225)CGA>CAA	p.R75Q	STT3A_uc009zbm.2_Missense_Mutation_p.R75Q|STT3A_uc001qce.2_Missense_Mutation_p.R75Q|STT3A_uc010sbg.1_5'UTR	NM_152713	NP_689926	P46977	STT3A_HUMAN	integral membrane protein 1	75	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity				0	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		TTTGATGACCGAGCCTGGTAC	0.373													10	20	---	---	---	---	PASS
FGFR1OP2	26127	broad.mit.edu	37	12	27116335	27116335	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27116335G>A	uc001rhm.2	+	6	913	c.571G>A	c.(571-573)GAA>AAA	p.E191K	FGFR1OP2_uc001rhn.2_Missense_Mutation_p.E153K	NM_015633	NP_056448	Q9NVK5	FGOP2_HUMAN	FGFR1 oncogene partner 2	191	Potential.					cytoplasm					0	Colorectal(261;0.0847)					GAAAGCCATTGAAATTGACGA	0.378													17	28	---	---	---	---	PASS
ABCD2	225	broad.mit.edu	37	12	40013237	40013237	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40013237C>G	uc001rmb.2	-	1	607	c.181G>C	c.(181-183)GAG>CAG	p.E61Q		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	61	Interaction with PEX19.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						TCTGTGTTCTCTGCAGCAGGG	0.463													35	111	---	---	---	---	PASS
MSRB3	253827	broad.mit.edu	37	12	65847516	65847516	+	Missense_Mutation	SNP	T	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65847516T>C	uc001ssn.2	+	5	383	c.322T>C	c.(322-324)TCA>CCA	p.S108P	MSRB3_uc001ssm.2_Missense_Mutation_p.S101P|MSRB3_uc009zqp.2_Missense_Mutation_p.S101P	NM_198080	NP_932346	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3 isoform 1	108					protein repair	endoplasmic reticulum|mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		AGGTTGGCCTTCATTCCACGA	0.438													3	96	---	---	---	---	PASS
RPH3A	22895	broad.mit.edu	37	12	113314457	113314457	+	Silent	SNP	G	C	C	rs140784190	byFrequency	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113314457G>C	uc010syl.1	+	13	1319	c.957G>C	c.(955-957)CCG>CCC	p.P319P	RPH3A_uc001ttz.2_Silent_p.P319P|RPH3A_uc001tty.2_Silent_p.P315P|RPH3A_uc009zwe.1_Silent_p.P315P|RPH3A_uc010sym.1_Silent_p.P270P|RPH3A_uc001tua.2_Silent_p.P79P	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	319	Pro-rich.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AGGTGGCTCCGAGCGACCCTG	0.493													3	11	---	---	---	---	PASS
POU4F1	5457	broad.mit.edu	37	13	79175810	79175810	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79175810C>G	uc001vkv.2	-	2	1234	c.1000G>C	c.(1000-1002)GAG>CAG	p.E334Q	uc001vku.1_Intron	NM_006237	NP_006228	Q01851	PO4F1_HUMAN	POU domain, class 4, transcription factor 1	334	POU-specific.				axonogenesis|regulation of transcription from RNA polymerase II promoter|synapse assembly	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TCGGCCTCCTCGAGCCACGCC	0.632													8	11	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23857474	23857474	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23857474C>G	uc001wjv.2	-	30	4316	c.4249G>C	c.(4249-4251)GAG>CAG	p.E1417Q		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1417	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TTGGTCTTCTCCAGTGAGGAG	0.582													41	62	---	---	---	---	PASS
CLEC14A	161198	broad.mit.edu	37	14	38724396	38724396	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38724396C>G	uc001wum.1	-	1	1179	c.832G>C	c.(832-834)GAG>CAG	p.E278Q		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	278	Extracellular (Potential).|EGF-like.					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TTCCCCAGCTCGAAGCCCGTA	0.672													45	66	---	---	---	---	PASS
DAAM1	23002	broad.mit.edu	37	14	59792443	59792443	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59792443G>C	uc001xdz.1	+	9	1176	c.1051G>C	c.(1051-1053)GAA>CAA	p.E351Q	DAAM1_uc001xea.1_Missense_Mutation_p.E351Q|DAAM1_uc001xeb.1_Missense_Mutation_p.E351Q	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	351	GBD/FH3.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		CAAAAGATTTGAACTGGTACG	0.328													11	43	---	---	---	---	PASS
TCL1B	9623	broad.mit.edu	37	14	96152916	96152916	+	Missense_Mutation	SNP	C	T	T	rs75572239		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96152916C>T	uc001yez.2	+	1	154	c.112C>T	c.(112-114)CGG>TGG	p.R38W	TCL1B_uc001yew.2_Intron|TCL1B_uc001yex.2_Intron|TCL1B_uc010avj.2_Intron|TCL1B_uc001yfa.2_Missense_Mutation_p.R38W	NM_004918	NP_004909	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	38										ovary(1)	1		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		TGTGGTCGTGCGGTTCAATCC	0.657													14	31	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105404399	105404399	+	3'UTR	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105404399C>T	uc010axc.1	-	7					AHNAK2_uc001ypx.2_3'UTR	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2							nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGCCATACCTCTCAGCCTTCA	0.493													10	52	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105404558	105404558	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105404558C>G	uc010axc.1	-	7	17350	c.17230G>C	c.(17230-17232)GAG>CAG	p.E5744Q	AHNAK2_uc001ypx.2_Missense_Mutation_p.E5644Q	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5744						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCTTCCTTCTCTTCAGGGGAG	0.507													10	23	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105405143	105405143	+	Nonsense_Mutation	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105405143C>A	uc010axc.1	-	7	16765	c.16645G>T	c.(16645-16647)GAA>TAA	p.E5549*	AHNAK2_uc001ypx.2_Nonsense_Mutation_p.E5449*	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5549						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGAGCCTCTTCTGTGCCCTCC	0.493													23	48	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105405820	105405820	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105405820C>G	uc010axc.1	-	7	16088	c.15968G>C	c.(15967-15969)GGA>GCA	p.G5323A	AHNAK2_uc001ypx.2_Missense_Mutation_p.G5223A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5323						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ATCTATTTCTCCTGGAAGAAC	0.493													12	28	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105406022	105406022	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105406022C>T	uc010axc.1	-	7	15886	c.15766G>A	c.(15766-15768)GAA>AAA	p.E5256K	AHNAK2_uc001ypx.2_Missense_Mutation_p.E5156K	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5256						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGTCACTTCTGCATCTGCC	0.512													71	189	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106237582	106237582	+	RNA	SNP	C	T	T	rs2983776		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106237582C>T	uc010tyt.1	-	3611		c.57301G>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						GTAGGACAGCCGGGAAGGTGT	0.637													3	40	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26812728	26812728	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26812728C>T	uc001zaz.2	-	7	977	c.835G>A	c.(835-837)GGG>AGG	p.G279R	GABRB3_uc010uae.1_Missense_Mutation_p.G194R|GABRB3_uc001zba.2_Missense_Mutation_p.G279R|GABRB3_uc001zbb.2_Missense_Mutation_p.G335R	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	279	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TAGCACATACCGAGGGCAACT	0.373													4	24	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	27017880	27017880	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27017880C>T	uc001zaz.2	-	2	262	c.120G>A	c.(118-120)ACG>ACA	p.T40T	GABRB3_uc001zba.2_Silent_p.T40T|GABRB3_uc001zbb.2_Silent_p.T96T	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	40	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	GCTTGTCCACCGTCTCCTTCA	0.632													6	15	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28517458	28517458	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28517458G>A	uc001zbj.2	-	9	1092	c.986C>T	c.(985-987)TCC>TTC	p.S329F	HERC2_uc001zbl.1_Missense_Mutation_p.S24F	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	329					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCCCTGGGCGGAACGCTCATT	0.542													5	21	---	---	---	---	PASS
CHRNA3	1136	broad.mit.edu	37	15	78894271	78894271	+	Missense_Mutation	SNP	C	T	T	rs149559299	byFrequency	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78894271C>T	uc002bec.2	-	5	899	c.713G>A	c.(712-714)CGG>CAG	p.R238Q	CHRNA3_uc002bea.2_RNA|CHRNA3_uc002beb.2_Missense_Mutation_p.R238Q	NM_000743	NP_000734	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3	238	Extracellular (Potential).				activation of transmembrane receptor protein tyrosine kinase activity|behavioral response to nicotine|locomotory behavior|regulation of acetylcholine secretion|regulation of dendrite morphogenesis|regulation of excitatory postsynaptic membrane potential|regulation of smooth muscle contraction|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|dendrite|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic density|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(3)|ovary(1)	4						GGGCAGGCGCCGGATGTACAG	0.567													10	43	---	---	---	---	PASS
HOMER2	9455	broad.mit.edu	37	15	83533003	83533003	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83533003C>G	uc002bjg.2	-	4	489	c.303G>C	c.(301-303)GAG>GAC	p.E101D	HOMER2_uc002bjh.2_Missense_Mutation_p.E101D|HOMER2_uc002bjj.2_Missense_Mutation_p.E101D|HOMER2_uc002bji.2_Missense_Mutation_p.E101D	NM_199330	NP_955362	Q9NSB8	HOME2_HUMAN	homer 2 isoform 2	101	Potential.|WH1.				metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane					0						CCTGGAATTTCTCTGCAAACT	0.383													17	33	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3900914	3900914	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3900914G>A	uc002cvv.2	-	2	386	c.182C>T	c.(181-183)CCA>CTA	p.P61L	CREBBP_uc002cvw.2_Missense_Mutation_p.P61L	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	61					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGCAGCATCTGGAACAAGGTT	0.468			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				23	46	---	---	---	---	PASS
SPNS1	83985	broad.mit.edu	37	16	28986868	28986868	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28986868C>T	uc010vdi.1	+	3	437	c.297C>T	c.(295-297)CTC>CTT	p.L99L	uc010vct.1_Intron|SPNS1_uc002dry.2_Silent_p.L99L|SPNS1_uc002drx.2_Silent_p.L26L|SPNS1_uc002dsa.2_Silent_p.L99L|SPNS1_uc002drz.2_Silent_p.L99L|SPNS1_uc010byp.2_Intron|SPNS1_uc010byq.1_Silent_p.L26L	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	99	Helical; (Potential).				lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						GCTCTGGGCTCATCCAGACCG	0.582													15	36	---	---	---	---	PASS
MVP	9961	broad.mit.edu	37	16	29848216	29848216	+	Nonsense_Mutation	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29848216C>A	uc002dui.2	+	7	930	c.846C>A	c.(844-846)TGC>TGA	p.C282*	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MVP_uc010bzh.1_RNA|MVP_uc010vdz.1_RNA|MVP_uc002duj.2_Nonsense_Mutation_p.C282*|MVP_uc010vea.1_5'UTR	NM_005115	NP_005106	Q14764	MVP_HUMAN	major vault protein	282	MVP 6.				mRNA transport|protein transport|response to drug|transmembrane transport	cytoplasm|nuclear pore|ribonucleoprotein complex	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						ACAACTACTGCGTGATTCTCG	0.637													3	38	---	---	---	---	PASS
DDX19A	55308	broad.mit.edu	37	16	70365795	70365795	+	Intron	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70365795G>A	uc002eys.2	+						DDX19B_uc010vly.1_Intron|DDX19B_uc010vlv.1_Intron|DDX19B_uc010vlw.1_Intron|DDX19B_uc002eyo.2_Intron|DDX19B_uc002eyp.2_Intron|DDX19B_uc002eyq.2_Intron|DDX19B_uc002eyr.2_Intron|DDX19B_uc010vlx.1_Intron|uc002eyt.2_Intron	NM_007242	NP_009173	Q9NUU7	DD19A_HUMAN	DEAD (Asp-Glu-Ala-As) box polypeptide 19 isoform						mRNA transport|protein transport|transmembrane transport	cytoplasm|nuclear membrane|nuclear pore	ATP binding|ATP-dependent helicase activity|RNA binding				0		Ovarian(137;0.221)				GCGGTGAGCAGAGGACGTGTC	0.592											OREG0023914	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	32	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72828798	72828798	+	Nonsense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72828798G>A	uc002fck.2	-	9	8456	c.7783C>T	c.(7783-7785)CAG>TAG	p.Q2595*	ZFHX3_uc002fcl.2_Nonsense_Mutation_p.Q1681*	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	2595					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GCTGGAATCTGAGGTATGGCC	0.552													47	102	---	---	---	---	PASS
FOXC2	2303	broad.mit.edu	37	16	86602295	86602295	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86602295G>A	uc002fjq.2	+	1	1439	c.1354G>A	c.(1354-1356)GAG>AAG	p.E452K		NM_005251	NP_005242	Q99958	FOXC2_HUMAN	forkhead box C2	452					anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|embryonic viscerocranium morphogenesis|insulin receptor signaling pathway|lymphangiogenesis|metanephros development|negative regulation of transcription from RNA polymerase II promoter|neural crest cell fate commitment|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of cell adhesion mediated by integrin|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vascular wound healing|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding|transcription regulatory region DNA binding				0						CAACGTGCGGGAGATGTTCAA	0.637									Late-onset_Hereditary_Lymphedema				18	26	---	---	---	---	PASS
P2RX1	5023	broad.mit.edu	37	17	3806871	3806871	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3806871G>A	uc002fww.2	-	6	1020	c.579C>T	c.(577-579)ATC>ATT	p.I193I		NM_002558	NP_002549	P51575	P2RX1_HUMAN	purinergic receptor P2X1	193	Extracellular (Potential).				platelet activation	integral to plasma membrane	calcium channel activity|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity			ovary(1)|skin(1)	2				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		GTGGAAAGCTGATGCTGTTCT	0.617													21	41	---	---	---	---	PASS
EIF4A1	1973	broad.mit.edu	37	17	7477965	7477965	+	Silent	SNP	C	A	A	rs147090597	by1000genomes	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7477965C>A	uc002gho.1	+	11	1499	c.174C>A	c.(172-174)ATC>ATA	p.I58I	EIF4A1_uc002ghr.1_Silent_p.I58I|EIF4A1_uc002ghq.1_Silent_p.I58I|EIF4A1_uc002ghp.1_Silent_p.I58I|SNORA48_uc002ghs.1_5'Flank|SNORD10_uc002ght.2_5'Flank	NM_001416	NP_001407	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A	58	Q motif.				nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity			ovary(1)	1						CCTCTGCCATCCAGCAGCGAG	0.517													41	64	---	---	---	---	PASS
SHBG	6462	broad.mit.edu	37	17	7535070	7535070	+	Intron	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7535070G>T	uc002gie.2	+						SHBG_uc010cmo.2_Intron|SHBG_uc010cmp.2_Intron|SHBG_uc010cmq.2_Intron|SHBG_uc010cmr.2_Intron|SHBG_uc010cms.2_Intron|SHBG_uc010cmt.2_Intron|SHBG_uc010cmu.2_Intron|SHBG_uc010cmz.2_Intron|SHBG_uc010cmv.2_Intron|SHBG_uc010cmw.2_Intron|SHBG_uc010cmx.2_Intron|SHBG_uc010cmy.2_Intron|SHBG_uc002gid.3_Intron|SHBG_uc010cnd.2_Intron|SHBG_uc010cna.2_Intron|SHBG_uc010vue.1_Intron|SHBG_uc010vuf.1_Intron|SHBG_uc010cnb.2_Intron|SHBG_uc010cnc.2_Intron	NM_001040	NP_001031	P04278	SHBG_HUMAN	sex hormone-binding globulin isoform 1						hormone transport	extracellular region	androgen binding|protein homodimerization activity	p.0?(1)|p.?(1)			0		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Dromostanolone(DB00858)|Estradiol(DB00783)|Estrone(DB00655)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Mitotane(DB00648)|Norethindrone(DB00717)|Testosterone(DB00624)	CTCCGAGGTAGATTTCCTCGG	0.552													60	156	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7664250	7664250	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7664250G>A	uc002giu.1	+	17	2992	c.2978G>A	c.(2977-2979)CGC>CAC	p.R993H		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	993	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GACATTGCCCGGTGAGTGGTG	0.562													3	78	---	---	---	---	PASS
SCO1	6341	broad.mit.edu	37	17	10600752	10600752	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10600752G>C	uc002gmr.3	-	1	134	c.73C>G	c.(73-75)CGC>GGC	p.R25G	SCO1_uc002gms.3_Missense_Mutation_p.R25G|C17orf48_uc002gmt.2_5'Flank|C17orf48_uc002gmu.2_5'Flank|C17orf48_uc002gmv.2_5'Flank	NM_004589	NP_004580	O75880	SCO1_HUMAN	cytochrome oxidase deficient homolog 1	25					cellular copper ion homeostasis|copper ion transport|generation of precursor metabolites and energy|respiratory chain complex IV assembly	mitochondrial inner membrane	copper ion binding				0						TCGAGTCCGCGAGGCAAGAAG	0.667													7	16	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16001722	16001722	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16001722G>A	uc002gpo.2	-	21	3019	c.2779C>T	c.(2779-2781)CTG>TTG	p.L927L	NCOR1_uc002gpn.2_Silent_p.L943L|NCOR1_uc002gpp.1_Silent_p.L834L|NCOR1_uc002gpr.2_Silent_p.L834L	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	927					cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AGCTGTGGCAGATCCAGTGGA	0.403													20	30	---	---	---	---	PASS
PEX12	5193	broad.mit.edu	37	17	33904559	33904559	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33904559C>G	uc002hjp.2	-	2	794	c.178G>C	c.(178-180)GAT>CAT	p.D60H		NM_000286	NP_000277	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	60	Cytoplasmic (Potential).				protein import into peroxisome matrix	integral to peroxisomal membrane	protein C-terminus binding|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AAGATTTCATCAAACCACCTC	0.378													82	135	---	---	---	---	PASS
TMEM99	147184	broad.mit.edu	37	17	38990881	38990881	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38990881C>T	uc002hvj.1	+	3	420	c.113C>T	c.(112-114)TCA>TTA	p.S38L		NM_145274	NP_660317	Q8N816	TMM99_HUMAN	transmembrane protein 99 precursor	38						integral to membrane				skin(1)	1		Breast(137;0.000301)				GTTCCTCATTCAGCTGGTCAC	0.522													20	50	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8252485	8252485	+	Intron	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8252485G>T	uc002knn.3	+						PTPRM_uc010dkv.2_Splice_Site_p.V852_splice|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				CTTCTTAAAAGTGCCAATAAA	0.418													18	52	---	---	---	---	PASS
C18orf1	753	broad.mit.edu	37	18	13612692	13612692	+	Intron	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13612692G>A	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron|C18orf1_uc002kse.2_5'UTR|C18orf1_uc002ksf.2_5'UTR|C18orf1_uc002ksg.1_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		CCCACTTGCAGAGGACCTGAT	0.507													9	25	---	---	---	---	PASS
C18orf1	753	broad.mit.edu	37	18	13612736	13612736	+	Intron	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13612736G>A	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron|C18orf1_uc002kse.2_Silent_p.L11L|C18orf1_uc002ksf.2_Silent_p.L11L|C18orf1_uc002ksg.1_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		ACAGCACACTGAAGGAGGCTC	0.488													13	33	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44561020	44561020	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44561020G>A	uc002lcr.1	-	1	969	c.616C>T	c.(616-618)CTG>TTG	p.L206L	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	206					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GGACACAGCAGAGGCCCGCCC	0.682													13	17	---	---	---	---	PASS
PIGN	23556	broad.mit.edu	37	18	59739947	59739947	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59739947G>C	uc002lii.3	-	31	3079	c.2631C>G	c.(2629-2631)TTC>TTG	p.F877L	PIGN_uc002lij.3_Missense_Mutation_p.F877L	NM_176787	NP_789744	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	877	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)				CCTTGACCAAGAAGAAAAAAT	0.239													4	14	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63481756	63481756	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63481756G>A	uc002ljz.2	+	4	866	c.541G>A	c.(541-543)GAT>AAT	p.D181N	CDH7_uc002lka.2_Missense_Mutation_p.D181N|CDH7_uc002lkb.2_Missense_Mutation_p.D181N	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	181	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				GACGGATGCTGATGATCCTAC	0.433													32	58	---	---	---	---	PASS
C19orf6	91304	broad.mit.edu	37	19	1013310	1013310	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1013310G>C	uc002lqr.1	-	3	683	c.537C>G	c.(535-537)TTC>TTG	p.F179L	C19orf6_uc002lqq.1_5'Flank|C19orf6_uc002lqs.1_Missense_Mutation_p.F179L	NM_001033026	NP_001028198	Q4ZIN3	MBRL_HUMAN	membralin isoform 1	179						cytoplasm|integral to membrane				pancreas(2)|breast(1)	3		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.0252)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGCGGCTTGAACACCTTGG	0.637													21	50	---	---	---	---	PASS
DPP9	91039	broad.mit.edu	37	19	4702154	4702154	+	Silent	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4702154G>C	uc002mba.2	-	9	1155	c.897C>G	c.(895-897)CTC>CTG	p.L299L	DPP9_uc002mbb.2_Silent_p.L299L|DPP9_uc002mbc.2_Silent_p.L299L	NM_139159	NP_631898	Q86TI2	DPP9_HUMAN	dipeptidylpeptidase 9	270					proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		GCAGCGTCTTGAGGCCCTCTG	0.612													8	17	---	---	---	---	PASS
DPP9	91039	broad.mit.edu	37	19	4702155	4702155	+	Missense_Mutation	SNP	A	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4702155A>T	uc002mba.2	-	9	1154	c.896T>A	c.(895-897)CTC>CAC	p.L299H	DPP9_uc002mbb.2_Missense_Mutation_p.L299H|DPP9_uc002mbc.2_Missense_Mutation_p.L299H	NM_139159	NP_631898	Q86TI2	DPP9_HUMAN	dipeptidylpeptidase 9	270					proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		CAGCGTCTTGAGGCCCTCTGA	0.612													8	16	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7676636	7676636	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7676636C>T	uc002mgv.3	+	11	1358	c.1257C>T	c.(1255-1257)GTC>GTT	p.V419V	KIAA1543_uc002mgu.3_Silent_p.V446V|KIAA1543_uc002mgw.2_5'Flank	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	419					epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						ACGTGGATGTCGTCATGGGAG	0.726													4	10	---	---	---	---	PASS
MAST1	22983	broad.mit.edu	37	19	12981737	12981737	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12981737G>C	uc002mvm.2	+	23	3231	c.3103G>C	c.(3103-3105)GAG>CAG	p.E1035Q		NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	1035	PDZ.				cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						GGTGCATCCTGAGGTCGTGGA	0.637													22	68	---	---	---	---	PASS
MAST1	22983	broad.mit.edu	37	19	12981865	12981865	+	Missense_Mutation	SNP	G	C	C	rs35052801		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12981865G>C	uc002mvm.2	+	24	3270	c.3142G>C	c.(3142-3144)GCA>CCA	p.A1048P		NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	1048	PDZ.				cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						CAACAAGGTAGCAGTGACCAC	0.602													48	77	---	---	---	---	PASS
OR7A17	26333	broad.mit.edu	37	19	14991727	14991727	+	Silent	SNP	T	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14991727T>A	uc010xob.1	-	1	441	c.441A>T	c.(439-441)GCA>GCT	p.A147A		NM_030901	NP_112163	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A,	147	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					TCATCCAGGATGCCAGAACCA	0.502													33	76	---	---	---	---	PASS
UPF1	5976	broad.mit.edu	37	19	18967005	18967005	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18967005C>T	uc002nkg.2	+	13	2028	c.1753C>T	c.(1753-1755)CTG>TTG	p.L585L	UPF1_uc002nkf.2_Silent_p.L574L	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	585					cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CATGCCTGAGCTGCAGAAGCT	0.607													15	27	---	---	---	---	PASS
CAPN12	147968	broad.mit.edu	37	19	39234770	39234770	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39234770G>A	uc002ojd.1	-	1	345	c.36C>T	c.(34-36)CTC>CTT	p.L12L		NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12	12					proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CCTCATCCACGAGCTGGATGG	0.652													21	38	---	---	---	---	PASS
IRF2BP1	26145	broad.mit.edu	37	19	46388968	46388968	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46388968C>G	uc002pds.1	-	1	409	c.65G>C	c.(64-66)TGG>TCG	p.W22S		NM_015649	NP_056464	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein	22					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		CACCATGGCCCACGGCATCTT	0.706													7	8	---	---	---	---	PASS
IGFL2	147920	broad.mit.edu	37	19	46663962	46663962	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46663962C>T	uc010xxv.1	+	3	201	c.165C>T	c.(163-165)GAC>GAT	p.D55D	IGFL2_uc002peb.2_Silent_p.D66D	NM_001135113	NP_001128585	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2 isoform b	55						extracellular region	protein binding				0		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		GTTACAATGACGCCATCGTGT	0.592													59	169	---	---	---	---	PASS
CRX	1406	broad.mit.edu	37	19	48342779	48342779	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48342779C>T	uc002phq.3	+	4	659	c.455C>T	c.(454-456)TCC>TTC	p.S152F		NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein	152					organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		CCCTCAGGCTCCCCAACCACG	0.667													15	43	---	---	---	---	PASS
SIGLEC12	89858	broad.mit.edu	37	19	52000163	52000163	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52000163C>T	uc002pwx.1	-	7	1626	c.1570G>A	c.(1570-1572)GCA>ACA	p.A524T	SIGLEC12_uc002pww.1_Missense_Mutation_p.A406T|SIGLEC12_uc010eoy.1_Missense_Mutation_p.A251T	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like	524	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|skin(2)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		ACAGCGTTTGCGTCCTCCATG	0.577													4	66	---	---	---	---	PASS
ZSCAN22	342945	broad.mit.edu	37	19	58846567	58846567	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58846567G>C	uc002qsc.2	+	2	546	c.399G>C	c.(397-399)AAG>AAC	p.K133N	ZSCAN22_uc010yhz.1_Intron	NM_181846	NP_862829	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	133					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		TGCTGGACAAGAGAGGTAAAG	0.622													7	6	---	---	---	---	PASS
ANGPT4	51378	broad.mit.edu	37	20	865825	865825	+	Missense_Mutation	SNP	A	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:865825A>G	uc002wei.2	-	4	834	c.731T>C	c.(730-732)GTC>GCC	p.V244A	ANGPT4_uc010zpn.1_Missense_Mutation_p.V238A	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	244					anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						GTTGTGCCTGACACCGCGCAG	0.662													4	21	---	---	---	---	PASS
TGM3	7053	broad.mit.edu	37	20	2291781	2291781	+	Intron	SNP	A	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2291781A>G	uc002wfx.3	+							NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor						cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	GACAGGTAAAAGGGTCATAAG	0.498													3	164	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3678434	3678434	+	Intron	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3678434G>A	uc002wja.2	-						SIGLEC1_uc002wiz.3_Intron	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor						cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CCCATTCCCTGCCTGACTCAC	0.622													25	20	---	---	---	---	PASS
PYGB	5834	broad.mit.edu	37	20	25255328	25255328	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25255328C>G	uc002wup.2	+	5	738	c.629C>G	c.(628-630)ACC>AGC	p.T210S		NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase	210					glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)	GTGGAGCACACCCCCGACGGC	0.632													97	104	---	---	---	---	PASS
SPAG4	6676	broad.mit.edu	37	20	34205119	34205119	+	Silent	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34205119G>C	uc002xdb.1	+	2	483	c.366G>C	c.(364-366)CTG>CTC	p.L122L	SPAG4_uc010zvi.1_Silent_p.L45L	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	122					spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			CCCTGGATCTGAGGCAGGAGA	0.652													9	3	---	---	---	---	PASS
SPAG4	6676	broad.mit.edu	37	20	34205484	34205484	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34205484G>A	uc002xdb.1	+	3	569	c.452G>A	c.(451-453)GGA>GAA	p.G151E	SPAG4_uc010zvi.1_Missense_Mutation_p.G74E	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	151	Helical; (Potential).				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			TCCCTGGCAGGAGACGTGCTG	0.667													16	11	---	---	---	---	PASS
SPAG4	6676	broad.mit.edu	37	20	34206055	34206055	+	Intron	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34206055G>C	uc002xdb.1	+						SPAG4_uc010zvi.1_Intron	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4						spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			TGGAGAATGTGAGTTGGGGAG	0.582													50	38	---	---	---	---	PASS
SPAG4	6676	broad.mit.edu	37	20	34207117	34207117	+	Missense_Mutation	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34207117G>T	uc002xdb.1	+	9	911	c.794G>T	c.(793-795)GGA>GTA	p.G265V	SPAG4_uc010zvi.1_Missense_Mutation_p.G188V	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	265	SUN.				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			ACTGTTCCAGGAGCCTCCATC	0.502													83	71	---	---	---	---	PASS
SPAG4	6676	broad.mit.edu	37	20	34207230	34207230	+	Missense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34207230G>C	uc002xdb.1	+	9	1024	c.907G>C	c.(907-909)GAG>CAG	p.E303Q	SPAG4_uc010zvi.1_Missense_Mutation_p.E226Q	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	303	SUN.				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			GGTTATCCTGGAGGTGAGTCT	0.617													70	43	---	---	---	---	PASS
TGIF2	60436	broad.mit.edu	37	20	35207246	35207246	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35207246G>A	uc002xfn.2	+	2	242	c.69G>A	c.(67-69)GGG>GGA	p.G23G	C20orf24_uc002xfo.2_Silent_p.G23G	NM_021809	NP_068581	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	23	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)|skin(1)	2	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				AGCGCAGGGGGAACCTGCCCA	0.607													97	72	---	---	---	---	PASS
TGIF2	60436	broad.mit.edu	37	20	35207325	35207325	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35207325G>A	uc002xfn.2	+	2	321	c.148G>A	c.(148-150)GAG>AAG	p.E50K	C20orf24_uc002xfo.2_Missense_Mutation_p.E50K	NM_021809	NP_068581	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	50	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)|skin(1)	2	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				CTCAGAGCAGGAGAAGCTGAG	0.488													71	53	---	---	---	---	PASS
TGIF2	60436	broad.mit.edu	37	20	35207333	35207333	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35207333G>A	uc002xfn.2	+	2	329	c.156G>A	c.(154-156)CTG>CTA	p.L52L	C20orf24_uc002xfo.2_Silent_p.L52L	NM_021809	NP_068581	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	52	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)|skin(1)	2	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				AGGAGAAGCTGAGCCTTTCTG	0.468													64	51	---	---	---	---	PASS
SLC2A10	81031	broad.mit.edu	37	20	45353939	45353939	+	Silent	SNP	C	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45353939C>A	uc002xsl.2	+	2	361	c.264C>A	c.(262-264)GGC>GGA	p.G88G		NM_030777	NP_110404	O95528	GTR10_HUMAN	solute carrier family 2 member 10	88	Helical; Name=3; (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				TGCTGGCAGGCAGCCTGACCC	0.637													6	83	---	---	---	---	PASS
CTCFL	140690	broad.mit.edu	37	20	56098962	56098962	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56098962C>T	uc010gix.1	-	1	962	c.300G>A	c.(298-300)CTG>CTA	p.L100L	CTCFL_uc010giw.1_Silent_p.L100L|CTCFL_uc002xym.2_Silent_p.L100L|CTCFL_uc010giz.1_Intron|CTCFL_uc010giy.1_Intron|CTCFL_uc010gja.1_Silent_p.L100L|CTCFL_uc010gjb.1_Silent_p.L100L|CTCFL_uc010gjc.1_Silent_p.L100L|CTCFL_uc010gjd.1_Silent_p.L100L|CTCFL_uc010gje.2_Silent_p.L100L|CTCFL_uc010gjf.2_Intron|CTCFL_uc010gjg.2_Intron|CTCFL_uc010gjh.1_Silent_p.L100L|CTCFL_uc010gji.1_Intron|CTCFL_uc010gjj.1_Silent_p.L100L|CTCFL_uc010gjk.1_Silent_p.L100L|CTCFL_uc010gjl.1_Silent_p.L100L	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein	100					cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GCTGTATGCTCAGCAAGCTCA	0.607													24	106	---	---	---	---	PASS
CTCFL	140690	broad.mit.edu	37	20	56099150	56099150	+	Missense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56099150C>G	uc010gix.1	-	1	774	c.112G>C	c.(112-114)GAG>CAG	p.E38Q	CTCFL_uc010giw.1_Missense_Mutation_p.E38Q|CTCFL_uc002xym.2_Missense_Mutation_p.E38Q|CTCFL_uc010giz.1_Intron|CTCFL_uc010giy.1_Intron|CTCFL_uc010gja.1_Missense_Mutation_p.E38Q|CTCFL_uc010gjb.1_Missense_Mutation_p.E38Q|CTCFL_uc010gjc.1_Missense_Mutation_p.E38Q|CTCFL_uc010gjd.1_Missense_Mutation_p.E38Q|CTCFL_uc010gje.2_Missense_Mutation_p.E38Q|CTCFL_uc010gjf.2_Intron|CTCFL_uc010gjg.2_Intron|CTCFL_uc010gjh.1_Missense_Mutation_p.E38Q|CTCFL_uc010gji.1_Intron|CTCFL_uc010gjj.1_Missense_Mutation_p.E38Q|CTCFL_uc010gjk.1_Missense_Mutation_p.E38Q|CTCFL_uc010gjl.1_Missense_Mutation_p.E38Q	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein	38					cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			TGGTCTTTCTCTCTGCACACT	0.552													97	370	---	---	---	---	PASS
ITSN1	6453	broad.mit.edu	37	21	35183398	35183398	+	Silent	SNP	G	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35183398G>T	uc002yta.1	+	21	2707	c.2439G>T	c.(2437-2439)GTG>GTT	p.V813V	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Silent_p.V808V|ITSN1_uc010gmg.2_Silent_p.V771V|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Silent_p.V813V|ITSN1_uc010gmi.2_Silent_p.V776V|ITSN1_uc010gmj.2_Silent_p.V692V|ITSN1_uc002ysy.2_Silent_p.V808V|ITSN1_uc002ysx.2_Silent_p.V771V|ITSN1_uc002ytb.1_Silent_p.V808V|ITSN1_uc002ytc.1_Silent_p.V808V|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Silent_p.V776V|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Silent_p.V808V|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Silent_p.V747V|ITSN1_uc002ytf.1_RNA	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	813					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						CCGCTCCAGTGAAACCAGTGA	0.552													36	84	---	---	---	---	PASS
UMODL1	89766	broad.mit.edu	37	21	43524176	43524176	+	Missense_Mutation	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43524176C>T	uc002zaf.1	+	9	1498	c.1498C>T	c.(1498-1500)CGG>TGG	p.R500W	UMODL1_uc002zad.1_Missense_Mutation_p.R428W|UMODL1_uc002zae.1_Missense_Mutation_p.R428W|UMODL1_uc002zag.1_Missense_Mutation_p.R500W|UMODL1_uc010gow.1_Missense_Mutation_p.R292W|UMODL1_uc002zai.1_Missense_Mutation_p.R151W|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_Missense_Mutation_p.R151W|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Missense_Mutation_p.R245W|C21orf128_uc002zak.2_Intron	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	500	Extracellular (Potential).|SEA 1.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						CCAGATTGACCGGCAGGGGAC	0.607													20	39	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47786940	47786940	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47786940G>A	uc002zji.3	+	15	3158	c.3051G>A	c.(3049-3051)GAG>GAA	p.E1017E	PCNT_uc002zjj.2_Silent_p.E899E	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	1017	Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					AAGAGTTGGAGAAACTGAAGC	0.547													39	108	---	---	---	---	PASS
TUBA8	51807	broad.mit.edu	37	22	18609338	18609338	+	Nonsense_Mutation	SNP	C	G	G			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18609338C>G	uc002znv.1	+	4	666	c.593C>G	c.(592-594)TCA>TGA	p.S198*	TUBA8_uc002znr.2_Nonsense_Mutation_p.S132*|TUBA8_uc002znw.1_Nonsense_Mutation_p.S222*|TUBA8_uc002znx.1_Nonsense_Mutation_p.S45*	NM_018943	NP_061816	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	198					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0						CTGGAACATTCAGATTGTGCT	0.542													54	108	---	---	---	---	PASS
C22orf31	25770	broad.mit.edu	37	22	29456463	29456463	+	Silent	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29456463G>A	uc003aej.1	-	2	499	c.372C>T	c.(370-372)TTC>TTT	p.F124F		NM_015370	NP_056185	O95567	CV031_HUMAN	hypothetical protein LOC25770	124											0						TGGAACTGATGAAGTTTCTTT	0.522													26	70	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3229028	3229028	+	Nonsense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3229028G>A	uc004crg.3	-	7	7373	c.7216C>T	c.(7216-7218)CAG>TAG	p.Q2406*		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2406	Ig-like C2-type 8.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGGGCTTTCTGAATAAGGAGA	0.537													43	96	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47098458	47098458	+	Intron	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47098458C>T	uc004dhp.2	+						USP11_uc004dhq.2_5'Flank	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TGTTACCTGTCTGGGCCCCAG	0.498													9	13	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63412990	63412990	+	Silent	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63412990G>C	uc004dvo.2	-	2	450	c.177C>G	c.(175-177)CTC>CTG	p.L59L		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	59					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						TGCCACCAAAGAGTTTCATGG	0.522													28	113	---	---	---	---	PASS
TAF9B	51616	broad.mit.edu	37	X	77387268	77387268	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77387268G>A	uc004eda.2	-	7	666	c.595C>T	c.(595-597)CCT>TCT	p.P199S		NM_015975	NP_057059	Q9HBM6	TAF9B_HUMAN	transcription associated factor 9B	199					negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding				0						GTTGTTGCAGGAACTGTAAAC	0.373													77	107	---	---	---	---	PASS
PABPC5	140886	broad.mit.edu	37	X	90691095	90691095	+	Silent	SNP	C	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90691095C>T	uc004efg.2	+	2	959	c.519C>T	c.(517-519)CGC>CGT	p.R173R	PABPC5_uc004eff.1_Silent_p.R9R	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	173	RRM 2.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						TCAACAACCGCCAGGTGTATG	0.498													19	63	---	---	---	---	PASS
AMOT	154796	broad.mit.edu	37	X	112058755	112058755	+	Nonsense_Mutation	SNP	G	C	C			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112058755G>C	uc004epr.2	-	2	1223	c.1223C>G	c.(1222-1224)TCA>TGA	p.S408*	AMOT_uc004eps.2_5'UTR|AMOT_uc004ept.1_Nonsense_Mutation_p.S408*	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1	408					actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1						AGGCATAGCTGAATAGGCTTC	0.318													27	102	---	---	---	---	PASS
USP26	83844	broad.mit.edu	37	X	132161099	132161099	+	Missense_Mutation	SNP	G	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132161099G>A	uc010nrm.1	-	6	1620	c.1150C>T	c.(1150-1152)CAT>TAT	p.H384Y	USP26_uc011mvf.1_Missense_Mutation_p.H384Y	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	384					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					AAAAACTCATGAGCATCGTTC	0.358													42	136	---	---	---	---	PASS
C1orf163	65260	broad.mit.edu	37	1	53153917	53153917	+	Intron	DEL	T	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53153917delT	uc001cui.1	-							NM_023077	NP_075565	Q96BR5	SELR1_HUMAN	hypothetical protein LOC65260								binding				0						AGTCAGTGAAttttttttttt	0.239													9	4	---	---	---	---	
VPS72	6944	broad.mit.edu	37	1	151157066	151157067	+	Intron	INS	-	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151157066_151157067insT	uc001exe.1	-						VPS72_uc001exf.1_Intron	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1						chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			Atttttttttcttttttttttt	0.129													4	3	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153800932	153800939	+	Intron	DEL	ACACACAC	-	-	rs71677766		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800932_153800939delACACACAC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCTcacacatacacacacacacacacac	0.236													5	4	---	---	---	---	
ZNF512	84450	broad.mit.edu	37	2	27822283	27822284	+	Intron	INS	-	AC	AC	rs144936250	by1000genomes	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27822283_27822284insAC	uc002rla.2	+						ZNF512_uc010ylv.1_Intron|ZNF512_uc010ylw.1_Intron|ZNF512_uc002rlb.2_Intron|ZNF512_uc010ylx.1_Intron|ZNF512_uc002rlc.2_Intron|ZNF512_uc010yly.1_Intron|ZNF512_uc010ylz.1_Intron	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					CAGTTAATGAGAAGTTACACCA	0.351													4	2	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54155186	54155186	+	Intron	DEL	T	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54155186delT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TTCTCCAACCTTTTGTCACTG	0.274													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	173020727	173020728	+	IGR	INS	-	T	T	rs79150091	by1000genomes	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173020727_173020728insT								DLX2 (53249 upstream) : ITGA6 (271354 downstream)																							gcgcactcctctttttttttct	0.000													6	3	---	---	---	---	
RBM44	375316	broad.mit.edu	37	2	238730004	238730005	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238730004_238730005delAC	uc002vxi.3	+	7	2248_2249	c.2116_2117delAC	c.(2116-2118)ACAfs	p.T706fs		NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	705							nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GAAAAAAGAAACACATGTGTGA	0.233													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	53098198	53098199	+	IGR	INS	-	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53098198_53098199insT								SFMBT1 (18128 upstream) : RFT1 (24304 downstream)																							ATGAATGACAGTTTTTTTTTTT	0.337													4	3	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54872838	54872838	+	Intron	DEL	T	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54872838delT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		ATTTAAAAGGTTTTTTTTTTA	0.318													4	2	---	---	---	---	
CADPS	8618	broad.mit.edu	37	3	62477249	62477250	+	Intron	INS	-	AC	AC	rs28433147		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62477249_62477250insAC	uc003dll.2	-						CADPS_uc003dlk.1_Intron|CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		cacacacacacacacacacaca	0.238													6	4	---	---	---	---	
RPN1	6184	broad.mit.edu	37	3	128363638	128363639	+	Intron	INS	-	A	A	rs146448705	by1000genomes	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128363638_128363639insA	uc003ekr.1	-						RPN1_uc011bkq.1_Intron	NM_002950	NP_002941	P04843	RPN1_HUMAN	ribophorin I precursor						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.189)		ctcctctctacaaaaaaaaaaC	0.188			T	EVI1	AML								7	4	---	---	---	---	
ALG1L2	644974	broad.mit.edu	37	3	129814813	129814813	+	Intron	DEL	T	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129814813delT	uc011bld.1	+						ALG1L2_uc010hth.2_Intron	NM_001136152	NP_001129624	C9J202	AG1L2_HUMAN	asparagine-linked glycosylation 1-like 2						biosynthetic process		transferase activity, transferring glycosyl groups				0						CCTCGGGGGGTGTTGCCTCAC	0.617													4	2	---	---	---	---	
TMEM192	201931	broad.mit.edu	37	4	166023937	166023939	+	Intron	DEL	TTT	-	-	rs11363030		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166023937_166023939delTTT	uc003iqz.3	-							NM_001100389	NP_001093859	Q8IY95	TM192_HUMAN	transmembrane protein 192							Golgi apparatus|integral to membrane|late endosome|lysosomal membrane|nucleus				skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0926)		gtgtacgtacTTTTTTTTTTTTT	0.074													5	3	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183673226	183673227	+	Intron	INS	-	A	A	rs5864797		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183673226_183673227insA	uc003ivd.1	+						ODZ3_uc003ive.1_Intron	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		ttttatttattaaaaaaaaaaa	0.416													2	5	---	---	---	---	
FRG1	2483	broad.mit.edu	37	4	190881814	190881816	+	Intron	DEL	ATC	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190881814_190881816delATC	uc003izs.2	+							NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGCATAAGAAATCATCTCGAATG	0.325													6	3	---	---	---	---	
SLC22A5	6584	broad.mit.edu	37	5	131714344	131714345	+	Intron	INS	-	ATC	ATC	rs141106891	by1000genomes	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131714344_131714345insATC	uc003kww.3	+						SLC22A5_uc003kwx.3_Intron	NM_003060	NP_003051	O76082	S22A5_HUMAN	solute carrier family 22 member 5						positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity				0		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	AGAGCCAACAAATCTGACTCCG	0.416													5	6	---	---	---	---	
CANX	821	broad.mit.edu	37	5	179134357	179134357	+	Intron	DEL	G	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179134357delG	uc003mkk.2	+						CANX_uc011dgp.1_Intron|CANX_uc010jlb.1_Intron|CANX_uc003mkl.2_Intron|CANX_uc011dgq.1_Intron	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	aagccaaggcgggcagatcac	0.075													4	5	---	---	---	---	
MCCD1	401250	broad.mit.edu	37	6	31495806	31495812	+	5'Flank	DEL	AAAAAAA	-	-	rs147277013		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31495806_31495812delAAAAAAA	uc003ntp.1	+							NM_001011700	NP_001011700	P59942	MCCD1_HUMAN	mitochondrial coiled-coil domain 1 precursor							mitochondrion					0						actccgtctcaaaaaaaaaaaaaaaaa	0.203													4	2	---	---	---	---	
BRD2	6046	broad.mit.edu	37	6	32943057	32943058	+	Intron	DEL	GG	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32943057_32943058delGG	uc003ocn.3	+						BRD2_uc003oco.2_Intron|BRD2_uc003ocq.3_Intron|BRD2_uc003ocp.3_Intron|BRD2_uc010juh.2_Intron	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2						spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5						TTGATGCATAGGGGGGgtgtgt	0.337													6	3	---	---	---	---	
PEX1	5189	broad.mit.edu	37	7	92135419	92135420	+	Intron	INS	-	AAGACTTAAAATTTCT	AAGACTTAAAATTTCT	rs145764168	by1000genomes	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92135419_92135420insAAGACTTAAAATTTCT	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_Intron	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TTAGAAAGCCAAAGAAATTTTA	0.272													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142021522	142021523	+	Intron	DEL	CA	-	-	rs72430962		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142021522_142021523delCA	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		TTCTGCAACTCAGGGCTGGGGA	0.520													5	3	---	---	---	---	
SCARA3	51435	broad.mit.edu	37	8	27491791	27491791	+	Intron	DEL	G	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27491791delG	uc003xga.1	+						SCARA3_uc003xgb.1_Intron	NM_016240	NP_057324	Q6AZY7	SCAR3_HUMAN	scavenger receptor class A, member 3 isoform 1						response to oxidative stress|UV protection	collagen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	scavenger receptor activity			skin(2)|ovary(1)|breast(1)	4		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)		CCCAGGGCCTGGGGGGCGCCT	0.687													4	2	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGACCttttctttttttttt	0.139		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				18	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90748359	90748361	+	Intron	DEL	CGG	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90748359_90748361delCGG	uc011lti.1	-											SubName: Full=cDNA FLJ59639;																		GGCTTCATTCCGGCGGCACAGAA	0.591													8	5	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34964519	34964520	+	Intron	INS	-	T	T	rs112555249		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34964519_34964520insT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				AATACCCCAACTTTTTTTTTTT	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42400410	42400410	+	IGR	DEL	C	-	-	rs74186261		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42400410delC								None (None upstream) : LOC441666 (426905 downstream)																							aacgggatttcttcacataat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	43063100	43063101	+	IGR	INS	-	A	A	rs34202394		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43063100_43063101insA								ZNF37B (14820 upstream) : ZNF33B (6532 downstream)																							TTTGGAGCCAGAAAAAAAAAAA	0.218													4	2	---	---	---	---	
FAM22D	728130	broad.mit.edu	37	10	89118409	89118409	+	Intron	DEL	A	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89118409delA	uc001kes.2	+						FAM22D_uc009xte.1_Intron	NM_001009610	NP_001009610	Q5VT03	FA22D_HUMAN	hypothetical protein LOC728130												0						TGCCTGGGGGAATACACCGTG	0.532													4	2	---	---	---	---	
ABCC2	1244	broad.mit.edu	37	10	101579171	101579172	+	Intron	DEL	TG	-	-	rs5787360		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101579171_101579172delTG	uc001kqf.2	+							NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	TTCTGGGTTCTGTGTCTCTTTG	0.416													1	6	---	---	---	---	
DDX25	29118	broad.mit.edu	37	11	125778612	125778613	+	Intron	INS	-	ACTT	ACTT	rs144963134	by1000genomes	TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125778612_125778613insACTT	uc001qcz.3	+						DDX25_uc010sbk.1_Intron	NM_013264	NP_037396	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 25						mRNA export from nucleus|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|nucleus	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(1)	1	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		gctagcctcccacttactaact	0.059													4	4	---	---	---	---	
LARP4	113251	broad.mit.edu	37	12	50829549	50829550	+	Intron	INS	-	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50829549_50829550insT	uc001rwp.1	+						LARP4_uc001rwo.1_Intron|LARP4_uc001rwq.1_Intron|LARP4_uc001rwr.1_Intron|LARP4_uc001rws.1_Intron|LARP4_uc009zlr.1_5'Flank|LARP4_uc001rwm.2_Intron|LARP4_uc001rwn.2_Intron	NM_052879	NP_443111	Q71RC2	LARP4_HUMAN	c-Mpl binding protein isoform a								nucleotide binding|RNA binding			ovary(1)	1						CTCTCTCTTTGTTTTTTTTTTT	0.238													4	2	---	---	---	---	
ULK1	8408	broad.mit.edu	37	12	132403267	132403275	+	Intron	DEL	GGGTGTGTG	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132403267_132403275delGGGTGTGTG	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		TCTGGCTGGAGGGTgtgtggggtgtgtgg	0.316													4	2	---	---	---	---	
FRY	10129	broad.mit.edu	37	13	32808567	32808568	+	Intron	INS	-	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32808567_32808568insA	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ctcaaaaagagaaaaaaaaaaT	0.198													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	65748001	65748002	+	IGR	INS	-	TT	TT	rs1760975		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65748001_65748002insTT								MAX (178774 upstream) : LOC645431 (129311 downstream)																							TTCTTTCtttcttttttttttt	0.228													9	5	---	---	---	---	
DIO2	1734	broad.mit.edu	37	14	80669639	80669640	+	Intron	INS	-	A	A	rs72035234		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80669639_80669640insA	uc010tvq.1	-						DIO2_uc010tvp.1_Intron|DIO2_uc001xut.2_Intron|DIO2_uc010asx.2_Intron|DIO2_uc010tvr.1_Intron|DIO2_uc010asy.2_Intron	NM_000793	NP_000784	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II isoform a						hormone biosynthetic process|selenocysteine incorporation|thyroid hormone generation	integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|ubiquitin protein ligase binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0281)		CACCTGACGGTAaaaaaaaaaa	0.376													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20454213	20454214	+	IGR	INS	-	T	T	rs144687403		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20454213_20454214insT								None (None upstream) : GOLGA6L6 (282880 downstream)																							GACCCTCAAGCtttttttttct	0.267													5	3	---	---	---	---	
GANC	2595	broad.mit.edu	37	15	42579747	42579747	+	Intron	DEL	T	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42579747delT	uc001zpi.2	+						GANC_uc001zph.2_Intron|GANC_uc001zpj.1_Intron	NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C						carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		ACTGGGGAGCTTTTTTTTTTA	0.313													4	3	---	---	---	---	
FAM96A	84191	broad.mit.edu	37	15	64367853	64367853	+	Intron	DEL	T	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64367853delT	uc002amt.1	-						FAM96A_uc002amu.1_Intron|FAM96A_uc010uin.1_Intron	NM_032231	NP_115607	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A						chromosome segregation						0						ATCCTGtttcttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84784761	84784762	+	IGR	INS	-	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84784761_84784762insA								ADAMTSL3 (76170 upstream) : LOC388152 (82838 downstream)																							TTAATAATGGGAAAAATAGTGA	0.312													12	11	---	---	---	---	
CLEC18C	283971	broad.mit.edu	37	16	70066043	70066043	+	Intron	DEL	A	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70066043delA	uc002exy.2	+						PDXDC2_uc002eyb.2_Intron|PDXDC2_uc002eyc.2_Intron	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						AGCCAAGCCGAAAAAAAAAAA	0.289													4	3	---	---	---	---	
PFAS	5198	broad.mit.edu	37	17	8161537	8161537	+	Intron	DEL	C	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8161537delC	uc002gkr.2	+						PFAS_uc010vuv.1_Intron	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase						'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TGCCACCTTTCTCTGGATCCA	0.507													44	28	---	---	---	---	
CASC3	22794	broad.mit.edu	37	17	38296627	38296630	+	5'UTR	DEL	ACAC	-	-	rs146433128		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38296627_38296630delACAC	uc010cwt.1	+	1					CASC3_uc010cws.1_5'UTR|CASC3_uc002hue.2_5'UTR	NM_007359	NP_031385	O15234	CASC3_HUMAN	metastatic lymph node 51						mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding			ovary(1)	1						acacaccccaacacacacacacac	0.343													4	2	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	58888882	58888882	+	Intron	DEL	A	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58888882delA	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GTTCAGAGGTAAaaaaaaaaa	0.254													5	3	---	---	---	---	
SEC14L1	6397	broad.mit.edu	37	17	75190633	75190634	+	Intron	INS	-	A	A			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75190633_75190634insA	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron|SEC14L1_uc010wti.1_Intron	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						gaccctgtctcaaaaaaaaaaa	0.158													4	2	---	---	---	---	
ZNF560	147741	broad.mit.edu	37	19	9593130	9593133	+	Intron	DEL	GAAG	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9593130_9593133delGAAG	uc002mlp.1	-						ZNF560_uc010dwr.1_Intron	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						ggaagggggagaaggaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	56289695	56289695	+	IGR	DEL	C	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56289695delC								RFPL4A (15156 upstream) : NLRP11 (7075 downstream)																							TGCTGAACTACCGGTTCTTCT	0.443													4	6	---	---	---	---	
PRIC285	85441	broad.mit.edu	37	20	62190932	62190933	+	Intron	INS	-	T	T			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62190932_62190933insT	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			tcaggtgggaggagtcagggtc	0.000													6	9	---	---	---	---	
TFIP11	24144	broad.mit.edu	37	22	26894669	26894669	+	Intron	DEL	A	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26894669delA	uc003acr.2	-						TFIP11_uc003acs.2_Intron|TFIP11_uc003act.2_Intron	NM_012143	NP_036275	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11						biomineral tissue development	catalytic step 2 spliceosome|cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity				0						Caaaaaaattaaaaaaaaaaa	0.204													9	4	---	---	---	---	
SLC35E4	339665	broad.mit.edu	37	22	31050572	31050572	+	Intron	DEL	C	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31050572delC	uc003ait.2	+						DUSP18_uc003aiu.2_Intron	NM_001001479	NP_001001479	Q6ICL7	S35E4_HUMAN	solute carrier family 35, member E4							integral to membrane					0						CGGCTGGGGACCCGGAAGTGG	0.612													4	2	---	---	---	---	
SSX3	10214	broad.mit.edu	37	X	48217953	48217953	+	5'Flank	DEL	A	-	-			TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48217953delA	uc004djd.1	-						SSX3_uc004dje.2_5'Flank|SSX3_uc010nic.2_5'Flank	NM_021014	NP_066294	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						agcaagactgaaaaaaaaaaa	0.015													13	8	---	---	---	---	
AIFM1	9131	broad.mit.edu	37	X	129267606	129267606	+	Intron	DEL	T	-	-	rs66532248		TCGA-FU-A23K-01	TCGA-FU-A23K-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129267606delT	uc004evg.2	-						AIFM1_uc011mur.1_Intron|AIFM1_uc011mus.1_Intron|AIFM1_uc004evh.2_Intron|AIFM1_uc004evi.2_Intron|AIFM1_uc004evk.2_Intron	NM_004208	NP_004199	O95831	AIFM1_HUMAN	programmed cell death 8 isoform 1						activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(4)|central_nervous_system(1)	5						CCCATTTAAAttttttttttt	0.179													20	11	---	---	---	---	
