Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11184646	11184646	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11184646C>G	uc001asd.2	-	47	6692	c.6571G>C	c.(6571-6573)GAT>CAT	p.D2191H	MTOR_uc001asc.2_Missense_Mutation_p.D396H	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	2191	PI3K/PI4K.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						TGGCGCAGATCTTCATGGCCT	0.507													30	71	---	---	---	---	PASS
TRIM63	84676	broad.mit.edu	37	1	26385124	26385124	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26385124G>A	uc001bli.1	-							NM_032588	NP_115977	Q969Q1	TRI63_HUMAN	muscle specific ring finger protein 1							cytoplasm|microtubule|nucleus	ligase activity|signal transducer activity|titin binding|zinc ion binding			kidney(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGAGGACGGAAGTCTTGTG	0.483													7	139	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31478705	31478705	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31478705C>A	uc001bsi.1	-	5	828	c.715G>T	c.(715-717)GGA>TGA	p.G239*	PUM1_uc001bsg.1_Nonsense_Mutation_p.G51*|PUM1_uc001bsh.1_Nonsense_Mutation_p.G239*|PUM1_uc001bsj.1_Nonsense_Mutation_p.G239*|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Nonsense_Mutation_p.G275*|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	239					cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		CTTACAAATCCTCCTTTTCTT	0.398													4	112	---	---	---	---	PASS
SERINC2	347735	broad.mit.edu	37	1	31905823	31905823	+	Silent	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31905823C>A	uc010ogh.1	+	9	1236	c.1035C>A	c.(1033-1035)TCC>TCA	p.S345S	SERINC2_uc010ogg.1_Silent_p.S342S|SERINC2_uc001bst.2_Silent_p.S341S|SERINC2_uc001bsu.2_Silent_p.S286S|SERINC2_uc001bsv.2_Silent_p.S286S	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	341						integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		GTCTGCGCTCCTCAGACCACC	0.612													3	13	---	---	---	---	PASS
BSDC1	55108	broad.mit.edu	37	1	32843566	32843566	+	Intron	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32843566C>G	uc001bvh.3	-						BSDC1_uc010ohg.1_Intron|BSDC1_uc010ohh.1_Intron|BSDC1_uc010ohi.1_Intron|BSDC1_uc001bvg.3_Intron|BSDC1_uc001bvj.2_Intron|BSDC1_uc001bvi.2_Intron	NM_018045	NP_060515	Q9NW68	BSDC1_HUMAN	BSD domain containing 1 isoform b								protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTCAACGCCTCTTACCTTCCT	0.632													7	32	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43784988	43784988	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43784988G>A	uc001ciu.2	+	18	3084	c.3005G>A	c.(3004-3006)CGG>CAG	p.R1002Q	TIE1_uc010oke.1_Missense_Mutation_p.R957Q|TIE1_uc009vwq.2_Missense_Mutation_p.R958Q|TIE1_uc010okg.1_Missense_Mutation_p.R647Q	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	1002	Cytoplasmic (Potential).|Protein kinase.				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGCCTTTCTCGGGGAGAGGAG	0.572													37	102	---	---	---	---	PASS
PDE4B	5142	broad.mit.edu	37	1	66384436	66384436	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66384436G>C	uc001dcn.2	+	3	390	c.199G>C	c.(199-201)GAG>CAG	p.E67Q	PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Missense_Mutation_p.E67Q	NM_001037341	NP_001032418	Q07343	PDE4B_HUMAN	phosphodiesterase 4B isoform 1	67					signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)	AAGGACTCCTGAGGGAGATGG	0.502													31	104	---	---	---	---	PASS
PIGK	10026	broad.mit.edu	37	1	77685079	77685079	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77685079G>A	uc001dhk.2	-	1	54	c.9C>T	c.(7-9)GTC>GTT	p.V3V	PIGK_uc010orj.1_Silent_p.V3V|PIGK_uc009wbx.2_Silent_p.V3V|PIGK_uc001dhl.1_Silent_p.V3V	NM_005482	NP_005473	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	3				MAVT -> SLHEA (in Ref. 1).	attachment of GPI anchor to protein|C-terminal protein lipidation|protein thiol-disulfide exchange|proteolysis	GPI-anchor transamidase complex	cysteine-type endopeptidase activity|GPI-anchor transamidase activity|protein binding			ovary(2)|pancreas(1)	3						GGCTGTCGGTGACGGCCATGT	0.607													4	23	---	---	---	---	PASS
NTNG1	22854	broad.mit.edu	37	1	107937833	107937833	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107937833C>T	uc001dvh.3	+	4	1663	c.945C>T	c.(943-945)TGC>TGT	p.C315C	NTNG1_uc001dvf.3_Silent_p.C315C|NTNG1_uc010out.1_Silent_p.C315C|NTNG1_uc001dvc.3_Silent_p.C315C|NTNG1_uc001dvi.2_5'UTR|NTNG1_uc001dve.2_RNA|NTNG1_uc009wek.2_RNA|NTNG1_uc001dvg.2_RNA|NTNG1_uc009wem.2_5'UTR|NTNG1_uc001dvd.1_Silent_p.C315C	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	315	Laminin EGF-like 1.				axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		AATTGACATGCGAATGTGAGC	0.483													120	159	---	---	---	---	PASS
AMIGO1	57463	broad.mit.edu	37	1	110051392	110051392	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110051392G>T	uc001dxx.3	-	2	525	c.143C>A	c.(142-144)TCC>TAC	p.S48Y		NM_020703	NP_065754	Q86WK6	AMGO1_HUMAN	AMIGO protein precursor	48	LRRNT.|Extracellular (Potential).				axonal fasciculation|heterophilic cell-cell adhesion|homophilic cell adhesion|myelination|positive regulation of axonogenesis	axon|integral to membrane				ovary(1)|breast(1)	2		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		CTGCTGCTTGGAGCAGCTGAG	0.622													4	69	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144886257	144886257	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144886257G>A	uc001elw.3	-	23	3268	c.2977C>T	c.(2977-2979)CCG>TCG	p.P993S	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.P1059S|PDE4DIP_uc001elv.3_5'UTR	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	993					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCTCCCATCGGAGAAGGAGGG	0.488			T	PDGFRB	MPD								37	396	---	---	---	---	PASS
ACP6	51205	broad.mit.edu	37	1	147124355	147124355	+	Intron	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147124355G>C	uc001epr.2	-						ACP6_uc009wjj.1_3'UTR	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor						lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					TTGTGTGCCTGAAAGGGCCAC	0.493													30	83	---	---	---	---	PASS
C1orf56	54964	broad.mit.edu	37	1	151021205	151021205	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151021205C>T	uc001ewn.2	+	1	947	c.882C>T	c.(880-882)CTC>CTT	p.L294L		NM_017860	NP_060330	Q9BUN1	CA056_HUMAN	hypothetical protein LOC54964 precursor	294						extracellular region					0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCATCCACCTCAGAAGCAGTC	0.592											OREG0013793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	117	---	---	---	---	PASS
SPRR3	6707	broad.mit.edu	37	1	152975565	152975565	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152975565A>C	uc001fax.3	+	3	219	c.69A>C	c.(67-69)CAA>CAC	p.Q23H	SPRR3_uc001faz.3_Missense_Mutation_p.Q23H|SPRR3_uc001fay.2_Missense_Mutation_p.Q23H	NM_005416	NP_005407	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	23					keratinization|peptide cross-linking|wound healing	cytoplasm	protein binding|structural molecule activity			skin(1)	1	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGGTGAAACAACCCAGCCAGC	0.502													5	49	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155927552	155927552	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155927552C>A	uc001fmt.2	-	13	1785	c.1667G>T	c.(1666-1668)CGG>CTG	p.R556L	ARHGEF2_uc001fmr.2_Missense_Mutation_p.R528L|ARHGEF2_uc001fms.2_Missense_Mutation_p.R555L|ARHGEF2_uc001fmu.2_Missense_Mutation_p.R600L	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2	556	PH.				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCGGTCATCCCGGGATGCTGT	0.577													3	70	---	---	---	---	PASS
C1orf112	55732	broad.mit.edu	37	1	169771780	169771780	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169771780G>A	uc001ggp.2	+	5	395	c.85G>A	c.(85-87)GAC>AAC	p.D29N	C1orf112_uc001ggj.2_RNA|C1orf112_uc001ggo.2_Missense_Mutation_p.D29N|C1orf112_uc001ggq.2_Missense_Mutation_p.D29N|C1orf112_uc009wvt.2_5'UTR|C1orf112_uc010plu.1_5'UTR|C1orf112_uc009wvu.1_5'UTR|C1orf112_uc001ggr.2_5'UTR|C1orf112_uc010plv.1_5'Flank	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732	29											0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ATTATTCGATGACATGATGTA	0.323													22	79	---	---	---	---	PASS
ANGPTL1	9068	broad.mit.edu	37	1	178822038	178822038	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178822038G>C	uc001gma.2	-	5	1544	c.1068C>G	c.(1066-1068)ATC>ATG	p.I356M	RALGPS2_uc001gly.1_Intron|RALGPS2_uc001glz.2_Intron|RALGPS2_uc010pnb.1_Intron|ANGPTL1_uc001gmb.2_Missense_Mutation_p.I356M	NM_004673	NP_004664	O95841	ANGL1_HUMAN	angiopoietin-like 1 precursor	356	Fibrinogen C-terminal.					extracellular space	receptor binding				0						TAAGCATATAGATATTTTCCA	0.338													31	109	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203667305	203667305	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203667305G>C	uc001gzw.2	+	3	1098	c.214G>C	c.(214-216)GAT>CAT	p.D72H	ATP2B4_uc001gzv.2_Missense_Mutation_p.D72H|ATP2B4_uc009xaq.2_Missense_Mutation_p.D72H	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	72	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GAACCCTGCAGATCTGGAGAA	0.408													11	113	---	---	---	---	PASS
CNTN2	6900	broad.mit.edu	37	1	205027456	205027456	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205027456C>T	uc001hbr.2	+	4	632	c.363C>T	c.(361-363)GTC>GTT	p.V121V	CNTN2_uc001hbq.1_5'UTR|CNTN2_uc009xbi.2_5'UTR|CNTN2_uc001hbs.2_5'Flank	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	121	Ig-like C2-type 1.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCACCGTTGTCAGCAGGGAGG	0.632													4	37	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20189768	20189768	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20189768G>A	uc002rdi.2	-	1	117	c.9C>T	c.(7-9)TTC>TTT	p.F3F	WDR35_uc002rdj.2_Silent_p.F3F|WDR35_uc010ext.2_RNA	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	3										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTCAGGTAGAAGAACATCG	0.617													4	13	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21234642	21234642	+	Missense_Mutation	SNP	C	T	T	rs140783923		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21234642C>T	uc002red.2	-	26	5226	c.5098G>A	c.(5098-5100)GAT>AAT	p.D1700N		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1700					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GCTTTCCCATCCAGACTGAAT	0.478													37	119	---	---	---	---	PASS
IFT172	26160	broad.mit.edu	37	2	27669207	27669207	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27669207T>C	uc002rku.2	-	43	4726	c.4675A>G	c.(4675-4677)AGG>GGG	p.R1559G	IFT172_uc010ezb.2_RNA	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	1559					cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					ACAGAAAGCCTGGCAGCCACG	0.493													10	43	---	---	---	---	PASS
APLF	200558	broad.mit.edu	37	2	68804999	68804999	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68804999G>C	uc002sep.2	+	10	1554	c.1381G>C	c.(1381-1383)GAG>CAG	p.E461Q	APLF_uc002seq.1_RNA|APLF_uc002ser.1_Missense_Mutation_p.E192Q	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	461					double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						GCAACCCAATGAGTATGACCT	0.408													34	105	---	---	---	---	PASS
GFPT1	2673	broad.mit.edu	37	2	69554097	69554097	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69554097C>T	uc002sfh.2	-	18	2129	c.1950G>A	c.(1948-1950)GTG>GTA	p.V650V		NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate	668	SIS 2.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1						GTAAAGGGATCACGCTGAGAA	0.458													22	74	---	---	---	---	PASS
REG1A	5967	broad.mit.edu	37	2	79349971	79349971	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79349971G>A	uc002snz.2	+	5	429	c.326G>A	c.(325-327)CGC>CAC	p.R109H	REG1A_uc010ysd.1_Missense_Mutation_p.R109H	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor	109	C-type lectin.				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0						ATCTAGAACCGCCGCTGGCAC	0.547													40	102	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96970571	96970571	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96970571G>A	uc002svu.2	-	2	167	c.81C>T	c.(79-81)CTC>CTT	p.L27L		NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	27						catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						TCCGGTCAATGAGAGAACGGT	0.507													16	38	---	---	---	---	PASS
LONRF2	164832	broad.mit.edu	37	2	100906773	100906773	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100906773G>A	uc002tal.3	-	10	2507	c.1867C>T	c.(1867-1869)CGC>TGC	p.R623C	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	623	Lon.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						TCTCTGTGGCGGTGGCTTAGC	0.468													11	79	---	---	---	---	PASS
SAP130	79595	broad.mit.edu	37	2	128712902	128712902	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128712902C>T	uc002tpp.2	-	15	2185	c.2053G>A	c.(2053-2055)GAA>AAA	p.E685K	SAP130_uc002tpn.2_Missense_Mutation_p.E445K|SAP130_uc002tpo.2_Missense_Mutation_p.E465K|SAP130_uc010fmd.2_Missense_Mutation_p.E720K|SAP130_uc002tpq.1_Missense_Mutation_p.E693K	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	685					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ACGTGGATTTCAGACTTGGGT	0.438													16	49	---	---	---	---	PASS
HOXD9	3235	broad.mit.edu	37	2	176988751	176988751	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176988751G>C	uc010zex.1	+	2	991	c.907G>C	c.(907-909)GAA>CAA	p.E303Q		NM_014213	NP_055028	P28356	HXD9_HUMAN	homeobox D9	303	Homeobox.					nucleus	sequence-specific DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		GCTGGAGAAAGAATTCCTCTT	0.547													46	100	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179473514	179473514	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179473514C>G	uc010zfg.1	-	223	44744	c.44520G>C	c.(44518-44520)AAG>AAC	p.K14840N	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K8535N|TTN_uc010zfi.1_Missense_Mutation_p.K8468N|TTN_uc010zfj.1_Missense_Mutation_p.K8343N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15767							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTGTCTTTCTTTTCCAAAG	0.373													20	60	---	---	---	---	PASS
ZSWIM2	151112	broad.mit.edu	37	2	187693277	187693277	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187693277G>C	uc002upu.1	-	9	1376	c.1336C>G	c.(1336-1338)CAG>GAG	p.Q446E		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	446					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			AAATTACACTGAGGTATGCTA	0.308													26	83	---	---	---	---	PASS
ANKAR	150709	broad.mit.edu	37	2	190593499	190593499	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190593499G>A	uc002uqw.1	+	14	2932	c.2932G>A	c.(2932-2934)GAA>AAA	p.E978K	ANKAR_uc002uqu.2_RNA|ANKAR_uc002uqx.1_RNA|ANKAR_uc002uqy.1_Missense_Mutation_p.E145K	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1049						integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			TACGATTGCTGAAGGCACACT	0.373													31	88	---	---	---	---	PASS
CASP10	843	broad.mit.edu	37	2	202074061	202074061	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202074061C>T	uc002uxl.1	+	9	1609	c.1191C>T	c.(1189-1191)TTC>TTT	p.F397F	CASP10_uc002uxj.1_Silent_p.F397F|CASP10_uc002uxk.1_Silent_p.F354F|CASP10_uc010fta.1_Silent_p.F330F|CASP10_uc002uxm.1_Silent_p.F354F|CASP10_uc010ftb.1_RNA	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein	397					apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6						AACTCTTTTTCATCCAGGCCT	0.522													16	70	---	---	---	---	PASS
SLC11A1	6556	broad.mit.edu	37	2	219247828	219247828	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219247828G>A	uc002vhv.2	+						SLC11A1_uc010zkb.1_Intron|SLC11A1_uc010fvp.1_Intron|SLC11A1_uc010fvq.1_Intron|SLC11A1_uc010zkc.1_Intron|SLC11A1_uc002vhu.1_Intron|SLC11A1_uc002vhw.2_Intron	NM_000578	NP_000569	P49279	NRAM1_HUMAN	natural resistance-associated macrophage protein						activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity			ovary(3)|central_nervous_system(1)	4		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAAAACCGGTGGGATGCTGGA	0.483													7	23	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219321885	219321885	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219321885C>T	uc002vie.2	-	24	3097	c.2644_splice	c.e24-1	p.T882_splice	USP37_uc010fvs.1_Splice_Site_p.T882_splice|USP37_uc010zkf.1_Splice_Site_p.T882_splice|USP37_uc002vif.2_Splice_Site_p.T882_splice|USP37_uc002vig.2_Splice_Site_p.T788_splice	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		GATTTCCTGTCTGGAAAACAG	0.368													8	14	---	---	---	---	PASS
SGPP2	130367	broad.mit.edu	37	2	223423365	223423365	+	Silent	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223423365C>G	uc010zlo.1	+	5	948	c.948C>G	c.(946-948)CTC>CTG	p.L316L	SGPP2_uc010zlp.1_Silent_p.L188L	NM_152386	NP_689599	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphotase 2	316					sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		TCCCACCACTCACCACCTACA	0.468													27	61	---	---	---	---	PASS
PDCD6IP	10015	broad.mit.edu	37	3	33863539	33863539	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33863539G>A	uc003cfx.2	+	4	582	c.427G>A	c.(427-429)GAT>AAT	p.D143N	PDCD6IP_uc011axv.1_Missense_Mutation_p.D143N|PDCD6IP_uc003cfy.2_Missense_Mutation_p.D143N	NM_013374	NP_037506	Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	143	BRO1.				apoptosis|cell cycle|cell division|interspecies interaction between organisms|protein transport	cytosol|melanosome|microtubule organizing center	calcium-dependent protein binding			ovary(1)|skin(1)	2						CCTGGATAATGATGAAGGATT	0.363													19	22	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52437782	52437782	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52437782G>C	uc003ddx.2	-	13	1494	c.1379C>G	c.(1378-1380)TCA>TGA	p.S460*	BAP1_uc003ddw.2_RNA|BAP1_uc010hmg.2_RNA|BAP1_uc010hmh.2_Intron	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	460					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CAGAGGAATTGAGAGGTCCTT	0.587			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								19	34	---	---	---	---	PASS
PCNP	57092	broad.mit.edu	37	3	101311589	101311589	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101311589G>C	uc003dva.2	+	5	547	c.529G>C	c.(529-531)GAC>CAC	p.D177H	PCNP_uc003dvb.2_RNA|PCNP_uc003dvc.2_RNA|PCNP_uc003dvd.2_3'UTR	NM_020357	NP_065090	Q8WW12	PCNP_HUMAN	PEST proteolytic signal containing nuclear	177					cell cycle|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	nucleus	protein binding				0						CCATGACCAAGACAATTAAAT	0.378													24	96	---	---	---	---	PASS
ACAD11	84129	broad.mit.edu	37	3	132278760	132278760	+	Silent	SNP	T	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132278760T>G	uc003eov.3	-	19	2525	c.2145A>C	c.(2143-2145)CCA>CCC	p.P715P		NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase	715						peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						TGACAGCCCGTGGGGCAGCCA	0.443													8	37	---	---	---	---	PASS
CLDN18	51208	broad.mit.edu	37	3	137729133	137729133	+	Intron	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137729133C>T	uc003ero.1	+						CLDN18_uc003erp.1_Silent_p.I22I|CLDN18_uc010hue.1_Missense_Mutation_p.R18C	NM_001002026	NP_001002026	P56856	CLD18_HUMAN	claudin 18 isoform 2						calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity			upper_aerodigestive_tract(1)|ovary(1)	2						CCGGCTGCATCGCGGCCACCG	0.667													5	42	---	---	---	---	PASS
P2RY13	53829	broad.mit.edu	37	3	151046485	151046485	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151046485G>A	uc003eyv.2	-	2	380	c.359C>T	c.(358-360)TCG>TTG	p.S120L	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_176894	NP_795713	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	120	Helical; Name=3; (Potential).					integral to membrane|plasma membrane				ovary(3)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			AAATATCACCGAAGAAAAACG	0.443													24	95	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155571018	155571018	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155571018G>C	uc003fan.3	-	1	1150	c.769C>G	c.(769-771)CTT>GTT	p.L257V	SLC33A1_uc003fao.1_Missense_Mutation_p.L257V	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	257	Helical; (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTACCTGAAAGAGTAACGATT	0.383													10	64	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	A	A	rs121913273		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936082G>A	uc003fjk.2	+	10	1781	c.1624G>A	c.(1624-1626)GAA>AAA	p.E542K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TCCTCTCTCTGAAATCACTGA	0.333	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			15	67	---	---	---	---	PASS
RNF4	6047	broad.mit.edu	37	4	2514238	2514238	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2514238C>T	uc003gfb.2	+	6	624	c.288C>T	c.(286-288)GAC>GAT	p.D96D	RNF4_uc010icj.2_Intron|RNF4_uc003gfc.2_Silent_p.D96D	NM_002938	NP_002929	P78317	RNF4_HUMAN	ring finger protein 4	96					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination|regulation of kinetochore assembly|regulation of spindle assembly|response to arsenic-containing substance	cytoplasm|PML body	androgen receptor binding|DNA binding|nucleosome binding|sequence-specific DNA binding transcription factor activity|SUMO polymer binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(65;0.241)				TGAGCAGTGACGATGAGGAGT	0.542													4	15	---	---	---	---	PASS
DRD5	1816	broad.mit.edu	37	4	9784379	9784379	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9784379C>T	uc003gmb.3	+	1	1122	c.726C>T	c.(724-726)ATC>ATT	p.I242I		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	242	Helical; Name=5; (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	CCATCATGATCGTGACCTACA	0.602													26	38	---	---	---	---	PASS
APBB2	323	broad.mit.edu	37	4	40825700	40825700	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40825700C>G	uc003gvl.2	-	16	2520	c.1890G>C	c.(1888-1890)ATG>ATC	p.M630I	APBB2_uc010ifu.2_Missense_Mutation_p.M202I|APBB2_uc003gvm.2_Missense_Mutation_p.M608I|APBB2_uc003gvn.2_Missense_Mutation_p.M631I|APBB2_uc003gvk.2_Missense_Mutation_p.M82I	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,	630	PID 2.				cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						CAGCCACGTTCATGTTCACTG	0.418													26	74	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57244534	57244534	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57244534C>T	uc003hbn.2	-	4	601	c.448G>A	c.(448-450)GAG>AAG	p.E150K	AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_5'UTR|AASDH_uc003hbo.2_Missense_Mutation_p.E50K|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Missense_Mutation_p.E150K|AASDH_uc003hbp.2_Missense_Mutation_p.E150K	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	150					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				AAGTTCACCTCAGTATTTTTC	0.303													27	66	---	---	---	---	PASS
ATOH1	474	broad.mit.edu	37	4	94750668	94750668	+	Silent	SNP	A	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94750668A>G	uc003hta.1	+	1	591	c.591A>G	c.(589-591)AAA>AAG	p.K197K		NM_005172	NP_005163	Q92858	ATOH1_HUMAN	atonal homolog 1	197	Helix-loop-helix motif.				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		AGCTGTCCAAATATGAGACCC	0.597													11	42	---	---	---	---	PASS
HADH	3033	broad.mit.edu	37	4	108911144	108911144	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108911144C>T	uc003hyq.2	+	1	205	c.56C>T	c.(55-57)TCG>TTG	p.S19L	HADH_uc010ilx.2_Missense_Mutation_p.S19L|HADH_uc010ily.2_5'UTR	NM_005327	NP_005318	Q16836	HCDH_HUMAN	L-3-hydroxyacyl-Coenzyme A dehydrogenase	19					fatty acid beta-oxidation	mitochondrial matrix	3-hydroxyacyl-CoA dehydrogenase activity|NAD+ binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)	NADH(DB00157)	TCCACCGCCTCGGCCTCGGCC	0.677													6	9	---	---	---	---	PASS
INTU	27152	broad.mit.edu	37	4	128621157	128621157	+	Intron	SNP	T	A	A	rs75572799		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128621157T>A	uc003ifk.1	+						INTU_uc011cgq.1_Intron	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6											ovary(1)	1						TTTTTTTTTTTAACATAGATG	0.308													4	83	---	---	---	---	PASS
NAA15	80155	broad.mit.edu	37	4	140264026	140264026	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140264026C>A	uc003ihu.1	+	5	705	c.449C>A	c.(448-450)TCA>TAA	p.S150*		NM_057175	NP_476516	Q9BXJ9	NAA15_HUMAN	NMDA receptor regulated 1	150	TPR 3.				angiogenesis|cell differentiation|N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	protein binding			ovary(1)|skin(1)	2						CAGAGAGCATCATGGATTGGT	0.343													46	126	---	---	---	---	PASS
GLRB	2743	broad.mit.edu	37	4	158064954	158064954	+	Intron	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158064954G>C	uc003ipj.2	+							NM_000824	NP_000815	P48167	GLRB_HUMAN	glycine receptor, beta isoform A precursor						nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)	GTTTGCTTCTGAAAGGCTACT	0.483													4	32	---	---	---	---	PASS
SLC6A19	340024	broad.mit.edu	37	5	1216712	1216712	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1216712C>G	uc003jbw.3	+	7	983	c.927C>G	c.(925-927)ATC>ATG	p.I309M		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	309	Helical; Name=7; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TGTCCATCATCAACGGCTTCA	0.587													23	40	---	---	---	---	PASS
ITGA1	3672	broad.mit.edu	37	5	52206174	52206174	+	Silent	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52206174G>C	uc003jou.2	+	14	1834	c.1782G>C	c.(1780-1782)CCG>CCC	p.P594P	ITGA1_uc003jov.2_RNA|ITGA1_uc003jow.2_Silent_p.P125P	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor	594	Extracellular (Potential).|FG-GAP 6.				axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TAGGAGCTCCGCTGGAAGATG	0.428													26	58	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66456416	66456416	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66456416G>A	uc003jut.1	+	26	3282	c.3214G>A	c.(3214-3216)GAA>AAA	p.E1072K	MAST4_uc003juw.2_Missense_Mutation_p.E1000K	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	1264						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AGAAAGTCTCGAAAGGTTAGT	0.363													38	91	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115351427	115351427	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115351427C>T	uc003kro.2	+	18	2885	c.2721C>T	c.(2719-2721)GAC>GAT	p.D907D	AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	907	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						TCGCAAAAGACTTCTTAGTCA	0.418													20	57	---	---	---	---	PASS
GPR151	134391	broad.mit.edu	37	5	145895353	145895353	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145895353C>T	uc003lod.1	-	1	324	c.324G>A	c.(322-324)TGG>TGA	p.W108*		NM_194251	NP_919227	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	108	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCAGACAAACCAGCCTAGAT	0.507													4	126	---	---	---	---	PASS
PDGFRB	5159	broad.mit.edu	37	5	149515197	149515197	+	Silent	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149515197C>A	uc003lro.2	-	3	754	c.285G>T	c.(283-285)ACG>ACT	p.T95T	PDGFRB_uc010jhd.2_5'UTR|PDGFRB_uc011dcg.1_Silent_p.T95T	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	95	Extracellular (Potential).|Ig-like C2-type 1.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGTATTCTCCCGTGTCTAGCC	0.587			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								4	107	---	---	---	---	PASS
FBXW11	23291	broad.mit.edu	37	5	171299926	171299926	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171299926G>A	uc003mbm.1	-	9	1598	c.1227C>T	c.(1225-1227)CTC>CTT	p.L409L	FBXW11_uc011dey.1_Silent_p.L377L|FBXW11_uc003mbl.1_Silent_p.L396L|FBXW11_uc003mbn.1_Silent_p.L375L	NM_012300	NP_036432	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11 isoform	409	WD 5.				cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of circadian rhythm|positive regulation of proteolysis|positive regulation of transcription, DNA-dependent|protein dephosphorylation|protein destabilization|protein polyubiquitination|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	centrosome|cytosol|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)|breast(1)	2	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCCTGTACTGGAGACAGGCAA	0.453													19	82	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12125377	12125377	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12125377G>C	uc003nac.2	+	4	5528	c.5349G>C	c.(5347-5349)TTG>TTC	p.L1783F	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1783					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TAGAGGCTTTGAGTTCGAGAG	0.443													68	134	---	---	---	---	PASS
DEK	7913	broad.mit.edu	37	6	18236826	18236826	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18236826C>G	uc003ncr.1	-	9	1097	c.904G>C	c.(904-906)GAG>CAG	p.E302Q	DEK_uc011djf.1_Missense_Mutation_p.E268Q|DEK_uc011djg.1_RNA	NM_003472	NP_003463	P35659	DEK_HUMAN	DEK oncogene isoform 1	302	Asp/Glu-rich (acidic).				chromatin modification|regulation of transcription from RNA polymerase II promoter|signal transduction|transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|histone binding			kidney(1)	1	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			TCCTCAGACTCACTTTCTAAA	0.249			T	NUP214	AML								23	65	---	---	---	---	PASS
HIST1H2AE	3012	broad.mit.edu	37	6	26217416	26217416	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26217416C>G	uc003nha.1	+	1	269	c.214C>G	c.(214-216)CGC>GGC	p.R72G	HIST1H2BG_uc003ngz.2_5'Flank	NM_021052	NP_066390	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	72					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)|skin(1)	2		all_hematologic(11;0.196)				CAACGCGGCTCGCGACAATAA	0.602													12	49	---	---	---	---	PASS
GABBR1	2550	broad.mit.edu	37	6	29599339	29599339	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29599339G>C	uc003nmt.3	-	3	459	c.123C>G	c.(121-123)ATC>ATG	p.I41M	GABBR1_uc003nmu.3_Missense_Mutation_p.I41M|GABBR1_uc011dlr.1_Translation_Start_Site|GABBR1_uc011dls.1_Missense_Mutation_p.I41M	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1	41	Sushi 1.|Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	CCCGGTACCTGATGCCCCCTT	0.602													24	86	---	---	---	---	PASS
TRIM39	56658	broad.mit.edu	37	6	30297275	30297275	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30297275G>C	uc010jrz.2	+	3	493	c.181G>C	c.(181-183)GAG>CAG	p.E61Q	HCG18_uc003npx.2_5'Flank|HCG18_uc003npy.2_5'Flank|TRIM39_uc003npz.2_Missense_Mutation_p.E61Q|TRIM39_uc003nqb.2_Missense_Mutation_p.E61Q|TRIM39_uc003nqc.2_Missense_Mutation_p.E61Q|TRIM39_uc010jsa.1_Missense_Mutation_p.E61Q	NM_021253	NP_067076	Q9HCM9	TRI39_HUMAN	tripartite motif-containing 39 isoform 1	61	RING-type.				apoptosis	cytosol|mitochondrion	identical protein binding|zinc ion binding			ovary(3)	3						GGAGGACCTAGAGAGGGACTT	0.542													43	113	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56473779	56473779	+	Intron	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56473779C>A	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.V1346F	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCTGGAATAACCAGAGAGCCT	0.423													6	127	---	---	---	---	PASS
CNR1	1268	broad.mit.edu	37	6	88854027	88854027	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88854027C>G	uc011dzq.1	-	2	4530	c.967G>C	c.(967-969)GAG>CAG	p.E323Q	CNR1_uc010kbz.2_Missense_Mutation_p.E323Q|CNR1_uc011dzr.1_Missense_Mutation_p.E323Q|CNR1_uc011dzs.1_Missense_Mutation_p.E323Q|CNR1_uc003pmq.3_Missense_Mutation_p.E323Q|CNR1_uc011dzt.1_Missense_Mutation_p.E323Q|CNR1_uc010kca.2_Missense_Mutation_p.E290Q	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	323	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	TTCCCATCCTCAGACGTGTGG	0.552													4	75	---	---	---	---	PASS
FIG4	9896	broad.mit.edu	37	6	110107564	110107564	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110107564G>C	uc003ptt.2	+	18	2223	c.2008G>C	c.(2008-2010)GAG>CAG	p.E670Q	FIG4_uc011eau.1_Missense_Mutation_p.E393Q	NM_014845	NP_055660	Q92562	FIG4_HUMAN	Sac domain-containing inositol phosphatase 3	670					cell death	endosome membrane	protein binding			ovary(1)	1		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		ATATGAAGAAGAGATTGATAT	0.378													6	92	---	---	---	---	PASS
AHR	196	broad.mit.edu	37	7	17382648	17382648	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17382648C>T	uc011jxz.1	+	11	3120	c.2507C>T	c.(2506-2508)GCC>GTC	p.A836V	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	836				LNETYPAELNNINNTQTTTHLQPLHHPSEARPFPDLTSSGF L -> FK (in Ref. 1; BAA03857).	apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					CCGTCAGAAGCCAGACCTTTT	0.373													6	370	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31890315	31890315	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31890315G>C	uc003tcm.1	-	8	1260	c.791C>G	c.(790-792)TCA>TGA	p.S264*	PDE1C_uc003tcn.1_Nonsense_Mutation_p.S264*|PDE1C_uc003tco.1_Nonsense_Mutation_p.S324*|PDE1C_uc003tcr.2_Nonsense_Mutation_p.S264*|PDE1C_uc003tcs.2_Nonsense_Mutation_p.S264*	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	264	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			GATGGCAGCTGAGAAGATTAT	0.453													29	69	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55248974	55248974	+	Intron	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55248974C>G	uc003tqk.2	+						EGFR_uc010kzg.1_Intron|EGFR_uc011kco.1_Intron|uc003tqo.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	ACGTGCCTCTCCCTCCCTCCA	0.602		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			28	73	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55249069	55249069	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55249069C>G	uc003tqk.2	+	20	2613	c.2367C>G	c.(2365-2367)ATC>ATG	p.I789M	EGFR_uc010kzg.1_Missense_Mutation_p.I744M|EGFR_uc011kco.1_Missense_Mutation_p.I736M|uc003tqo.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	789	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.I789I(1)|p.I789_L792del(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCAGCTCATCACGCAGCTCA	0.607		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			22	66	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55249134	55249134	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55249134C>G	uc003tqk.2	+	20	2678	c.2432C>G	c.(2431-2433)TCC>TGC	p.S811C	EGFR_uc010kzg.1_Missense_Mutation_p.S766C|EGFR_uc011kco.1_Missense_Mutation_p.S758C|uc003tqo.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	811	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.S811F(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AATATTGGCTCCCAGTACCTG	0.572		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			13	56	---	---	---	---	PASS
SEMA3D	223117	broad.mit.edu	37	7	84751142	84751142	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84751142C>T	uc003uic.2	-	1	106	c.66G>A	c.(64-66)TTG>TTA	p.L22L	SEMA3D_uc010led.2_Silent_p.L22L|SEMA3D_uc010lee.1_Silent_p.L22L	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	22					cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						TTAGCATCATCAAAGCAGGAA	0.343													19	46	---	---	---	---	PASS
CPSF4	10898	broad.mit.edu	37	7	99051700	99051700	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99051700C>T	uc003uqj.2	+	7	825	c.682C>T	c.(682-684)CAA>TAA	p.Q228*	PTCD1_uc011kiw.1_Intron|CPSF4_uc003uqi.2_Nonsense_Mutation_p.Q203*|CPSF4_uc003uqk.2_Nonsense_Mutation_p.Q202*|CPSF4_uc011kix.1_Nonsense_Mutation_p.Q150*	NM_006693	NP_006684	O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4,	228					modification by virus of host mRNA processing|mRNA processing|viral infectious cycle	mRNA cleavage and polyadenylation specificity factor complex	RNA binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CATGCAGAGTCAAAACAGCAG	0.592													70	133	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101844749	101844749	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101844749C>T	uc003uyx.3	+	18	2210	c.2172C>T	c.(2170-2172)CTC>CTT	p.L724L	CUX1_uc003uys.3_Silent_p.L735L|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	724	Potential.				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						AGGCTGCCCTCGACCCTGCCT	0.652													49	111	---	---	---	---	PASS
EPHB6	2051	broad.mit.edu	37	7	142563735	142563735	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142563735G>C	uc011kst.1	+	9	1910	c.1123G>C	c.(1123-1125)GAG>CAG	p.E375Q	EPHB6_uc011ksu.1_Missense_Mutation_p.E375Q|EPHB6_uc003wbs.2_Missense_Mutation_p.E83Q|EPHB6_uc003wbt.2_5'UTR|EPHB6_uc003wbu.2_Missense_Mutation_p.E83Q|EPHB6_uc003wbv.2_5'Flank	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	375	Extracellular (Potential).|Fibronectin type-III 1.					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					GGCTCCCCAGGAGCTTTGGTT	0.562													4	21	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154379724	154379724	+	Intron	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154379724C>G	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Missense_Mutation_p.S331W|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TGTGAGGCATCGCATCTGCTC	0.612													19	56	---	---	---	---	PASS
CSGALNACT1	55790	broad.mit.edu	37	8	19363168	19363168	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19363168C>T	uc011kyn.1	-	4	1242	c.178G>A	c.(178-180)GTC>ATC	p.V60I	CSGALNACT1_uc011kyo.1_Missense_Mutation_p.V60I|CSGALNACT1_uc003wzg.2_RNA|CSGALNACT1_uc011kyp.1_Missense_Mutation_p.V59I|CSGALNACT1_uc003wzh.2_RNA	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate	60	Lumenal (Potential).|Potential.				anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)		TCCTGAAGGACGGCCTGGTAC	0.632													18	47	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	29013378	29013378	+	Intron	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29013378G>C	uc003xhh.3	-						KIF13B_uc003xhj.2_Intron|KIF13B_uc010lvf.1_Intron	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		ATGTTCCTAAGAAAAAACCAA	0.353													3	12	---	---	---	---	PASS
HGSNAT	138050	broad.mit.edu	37	8	43025773	43025773	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43025773C>T	uc003xpx.3	+	7	727	c.679C>T	c.(679-681)CAG>TAG	p.Q227*		NM_152419	NP_689632	Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	255	Cytoplasmic (Potential).				lysosomal transport|protein oligomerization	integral to membrane|lysosomal membrane	heparan-alpha-glucosaminide N-acetyltransferase activity				0	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TGGTGATGTTCAGCCAGCAAC	0.562													3	12	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73480393	73480393	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73480393C>T	uc003xzb.2	+	2	1012	c.424C>T	c.(424-426)CAT>TAT	p.H142Y		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	142	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			GGCCAGATATCATCAAAAAAA	0.448													56	86	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139629165	139629165	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139629165C>T	uc003yvd.2	-	54	4309	c.3862G>A	c.(3862-3864)GGT>AGT	p.G1288S	COL22A1_uc011ljo.1_Missense_Mutation_p.G568S	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1288	Pro-rich.|Gly-rich.|Collagen-like 12.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			ACCCGGGGACCGGGTGCACCA	0.587										HNSCC(7;0.00092)			25	74	---	---	---	---	PASS
NFKBIL2	4796	broad.mit.edu	37	8	145659414	145659414	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145659414G>T	uc011llg.1	-	21	3349	c.3334C>A	c.(3334-3336)CCC>ACC	p.P1112T	uc011llh.1_5'Flank	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	1112	LRR 2.				cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			AGGCCTTCGGGACCCAGGTGA	0.662													12	20	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14801858	14801858	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14801858C>G	uc003zlm.2	-	20	4076	c.3486G>C	c.(3484-3486)CAG>CAC	p.Q1162H	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1162	CSPG 8.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		GCTCTTTCATCTGACCCTCAC	0.468													41	113	---	---	---	---	PASS
OR13C3	138803	broad.mit.edu	37	9	107298226	107298226	+	Missense_Mutation	SNP	G	A	A	rs147645466	byFrequency	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107298226G>A	uc004bcb.1	-	1	869	c.869C>T	c.(868-870)GCG>GTG	p.A290V		NM_001001961	NP_001001961	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C,	290	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1						CTTCGGTTTCGCATACATAAA	0.438													63	138	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123298654	123298654	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123298654C>G	uc004bkf.2	-	7	839	c.658G>C	c.(658-660)GAC>CAC	p.D220H	CDK5RAP2_uc004bkg.2_Missense_Mutation_p.D220H|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.D220H|CDK5RAP2_uc004bki.2_Missense_Mutation_p.D19H	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	220					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						CCAGACCTGTCTTTCTCATCC	0.498													23	65	---	---	---	---	PASS
USP54	159195	broad.mit.edu	37	10	75258749	75258749	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75258749G>A	uc001juo.2	-	22	4710	c.4693C>T	c.(4693-4695)CAA>TAA	p.Q1565*	PPP3CB_uc001juf.2_5'Flank|PPP3CB_uc001jue.2_5'Flank|PPP3CB_uc001jug.2_5'Flank|PPP3CB_uc001jui.2_5'Flank|PPP3CB_uc001juh.2_5'Flank|USP54_uc010qkk.1_Nonsense_Mutation_p.Q700*|USP54_uc001juk.2_Nonsense_Mutation_p.Q653*|USP54_uc001jul.2_Nonsense_Mutation_p.Q606*|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1565					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					TAGGTTAGTTGAGGATTGCAC	0.547													77	109	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89685300	89685300	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89685300C>G	uc001kfb.2	+	4	1226	c.195C>G	c.(193-195)TAC>TAG	p.Y65*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	65	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(4)|p.R55fs*1(4)|p.Y65*(4)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.Y65C(1)|p.Y65N(1)|p.V54fs*29(1)|p.Y65D(1)|p.R55_L70>S(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAAACCATTACAAGATATACA	0.269		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			6	10	---	---	---	---	PASS
CYP2C9	1559	broad.mit.edu	37	10	96741048	96741048	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96741048G>C	uc001kka.3	+	7	1095	c.1070G>C	c.(1069-1071)AGA>ACA	p.R357T	CYP2C9_uc009xut.2_Missense_Mutation_p.R355T	NM_000771	NP_000762	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C,	357					exogenous drug catabolic process|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid metabolic process|urea metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|caffeine oxidase activity|drug binding|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(4)|ovary(2)	6		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Alosetron(DB00969)|Amiodarone(DB01118)|Antihemophilic Factor(DB00025)|Aprepitant(DB00673)|Bosentan(DB00559)|Carprofen(DB00821)|Carvedilol(DB01136)|Celecoxib(DB00482)|Clomipramine(DB01242)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Desogestrel(DB00304)|Diclofenac(DB00586)|Esomeprazole(DB00736)|Etodolac(DB00749)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Glibenclamide(DB01016)|Glimepiride(DB00222)|Glipizide(DB01067)|Guanfacine(DB01018)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Imipramine(DB00458)|Irbesartan(DB01029)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Losartan(DB00678)|Lumiracoxib(DB01283)|Marinol(DB00470)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mephenytoin(DB00532)|Metronidazole(DB00916)|Miconazole(DB01110)|Midazolam(DB00683)|Montelukast(DB00471)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Oxymorphone(DB01192)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pravastatin(DB00175)|Quinidine(DB00908)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Sertraline(DB01104)|Sildenafil(DB00203)|Sulfamethoxazole(DB01015)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tenoxicam(DB00469)|Terfenadine(DB00342)|Tolbutamide(DB01124)|Torasemide(DB00214)|Troleandomycin(DB01361)|Valdecoxib(DB00580)|Valsartan(DB00177)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)	GAGGTCCAGAGATACATTGAC	0.507													33	54	---	---	---	---	PASS
LCOR	84458	broad.mit.edu	37	10	98714983	98714983	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98714983C>T	uc001kms.1	+	8	1127	c.606C>T	c.(604-606)TTC>TTT	p.F202F	LCOR_uc001kmr.2_Silent_p.F202F|C10orf12_uc009xvg.1_Intron|LCOR_uc001kmt.1_Silent_p.F202F|LCOR_uc001kmu.1_Silent_p.F202F	NM_032440	NP_115816	Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	202						nucleus	DNA binding			ovary(3)	3		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		ATTACGAGTTCAACCTCAGCC	0.468													24	32	---	---	---	---	PASS
OR52N4	390072	broad.mit.edu	37	11	5776878	5776878	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5776878G>T	uc001mbu.2	+	1	956	c.908G>T	c.(907-909)CGA>CTA	p.R303L	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		AAACAGATACGAGACTGTGTC	0.423													27	71	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6649939	6649939	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6649939C>G	uc001mem.1	-	13	5694	c.5284G>C	c.(5284-5286)GAG>CAG	p.E1762Q		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	1762	Cadherin 17.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCTGGCCCTCAGGCACCTCC	0.572													23	50	---	---	---	---	PASS
OR10A3	26496	broad.mit.edu	37	11	7960477	7960477	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7960477G>C	uc010rbi.1	-	1	591	c.591C>G	c.(589-591)ATC>ATG	p.I197M		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	197	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGAAGGCATAGATTTCAAATA	0.413													21	90	---	---	---	---	PASS
BTBD10	84280	broad.mit.edu	37	11	13441050	13441050	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13441050C>G	uc001mkz.2	-	4	798	c.541G>C	c.(541-543)GAC>CAC	p.D181H	BTBD10_uc010rcl.1_Missense_Mutation_p.D189H|BTBD10_uc001mla.2_Missense_Mutation_p.D165H|BTBD10_uc009ygn.2_RNA|BTBD10_uc010rcm.1_Missense_Mutation_p.D133H|BTBD10_uc010rcn.1_Missense_Mutation_p.D150H|BTBD10_uc009ygo.2_Missense_Mutation_p.D133H	NM_032320	NP_115696	Q9BSF8	BTBDA_HUMAN	K+ channel tetramerization protein	181	BTB.					nucleus					0				Epithelial(150;0.0214)		ATGGATGGGTCTACAACAAAT	0.318													43	116	---	---	---	---	PASS
E2F8	79733	broad.mit.edu	37	11	19251015	19251015	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19251015C>G	uc001mpm.2	-	10	2401	c.1879G>C	c.(1879-1881)GAA>CAA	p.E627Q	E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Missense_Mutation_p.E627Q	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	627					cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						GAGACATTTTCAAGTCCTTTT	0.453													8	184	---	---	---	---	PASS
CCDC34	91057	broad.mit.edu	37	11	27384593	27384593	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27384593G>A	uc001mrh.1	-	1	203	c.149C>T	c.(148-150)TCG>TTG	p.S50L	CCDC34_uc001mri.1_Missense_Mutation_p.S50L	NM_030771	NP_110398	Q96HJ3	CCD34_HUMAN	coiled-coil domain containing 34 isoform 1	50											0						CGGCGACGGCGAGCGCACCAC	0.662													11	21	---	---	---	---	PASS
FBXO3	26273	broad.mit.edu	37	11	33763601	33763601	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33763601C>A	uc001muz.2	-	11	1297	c.1269G>T	c.(1267-1269)ATG>ATT	p.M423I	FBXO3_uc010rej.1_Missense_Mutation_p.M110I|FBXO3_uc001muy.2_Missense_Mutation_p.M310I|FBXO3_uc009ykb.2_RNA	NM_012175	NP_036307	Q9UK99	FBX3_HUMAN	F-box only protein 3 isoform 1	423	Asp/Glu-rich (highly acidic).				proteolysis	nucleus	ubiquitin-protein ligase activity			pancreas(1)	1		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		cctcttcttccATCTCTTCAT	0.284													3	15	---	---	---	---	PASS
OR8J1	219477	broad.mit.edu	37	11	56128642	56128642	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56128642C>A	uc010rjh.1	+	1	920	c.920C>A	c.(919-921)ACA>AAA	p.T307K		NM_001005205	NP_001005205	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J,	307	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					AGATTCATGACAAATCTGTGC	0.358													30	74	---	---	---	---	PASS
BRMS1	25855	broad.mit.edu	37	11	66109569	66109569	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66109569G>C	uc001ohp.1	-	2	284	c.137C>G	c.(136-138)TCC>TGC	p.S46C	BRMS1_uc001oho.1_Missense_Mutation_p.S46C|BRMS1_uc009yre.2_5'Flank	NM_015399	NP_056214	Q9HCU9	BRMS1_HUMAN	breast cancer metastasis suppressor 1 isoform 1	46					apoptosis|negative regulation of anti-apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of anoikis|positive regulation of protein deacetylation|transcription, DNA-dependent	cytoplasm|nucleus	NF-kappaB binding				0						GGGCTCACCGGAGCTCTCCTC	0.333													9	21	---	---	---	---	PASS
SPTBN2	6712	broad.mit.edu	37	11	66460084	66460084	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66460084C>T	uc001ojd.2	-	25	5185	c.5113G>A	c.(5113-5115)GAC>AAC	p.D1705N		NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1705	Spectrin 14.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						TGTTCCAGGTCATCCAGCTCG	0.677													5	20	---	---	---	---	PASS
IGHMBP2	3508	broad.mit.edu	37	11	68704244	68704244	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68704244G>A	uc001ook.1	+	13	2398	c.2296G>A	c.(2296-2298)GGG>AGG	p.G766R	IGHMBP2_uc001ool.1_Missense_Mutation_p.G390R|IGHMBP2_uc001oom.1_Missense_Mutation_p.G344R	NM_002180	NP_002171	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	766	R3H.|SS DNA-binding (By similarity).				cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CGAGGAGCACGGGCTGAGGCA	0.617													11	29	---	---	---	---	PASS
RNF214	257160	broad.mit.edu	37	11	117150913	117150913	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117150913G>A	uc001pqt.2	+	8	1128	c.1083G>A	c.(1081-1083)GAG>GAA	p.E361E	RNF214_uc001pqu.2_Silent_p.E361E|RNF214_uc010rxf.1_Silent_p.E206E	NM_207343	NP_997226	Q8ND24	RN214_HUMAN	ring finger protein 214	361	Potential.						zinc ion binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		GCCGGAAAGAGTTACTGGTAC	0.363													34	63	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20782869	20782869	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20782869C>G	uc001reh.1	+	6	1590	c.1568C>G	c.(1567-1569)TCA>TGA	p.S523*		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	523					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	TCACCTCTTTCATCGCCCTGC	0.448													37	97	---	---	---	---	PASS
KCNJ8	3764	broad.mit.edu	37	12	21919523	21919523	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21919523C>A	uc001rff.2	-	3	747	c.409G>T	c.(409-411)GTT>TTT	p.V137F		NM_004982	NP_004973	Q15842	IRK8_HUMAN	potassium inwardly-rectifying channel J8	137						voltage-gated potassium channel complex					0					Levosimendan(DB00922)	GTAACTTGAACTTCAATGGAG	0.408													16	44	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49427595	49427595	+	Silent	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49427595G>C	uc001rta.3	-	39	10893	c.10893C>G	c.(10891-10893)CTC>CTG	p.L3631L		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3631	Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCTGACCAGGGAGCTTGGTGA	0.527			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	15	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49427852	49427852	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49427852G>A	uc001rta.3	-	38	10738	c.10738C>T	c.(10738-10740)CAG>TAG	p.Q3580*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3580	Potential.|Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TCCCCCACCTGATCCAGTTGT	0.577			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			12	22	---	---	---	---	PASS
RACGAP1	29127	broad.mit.edu	37	12	50384052	50384052	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50384052C>T	uc001rvt.2	-	19	2208	c.1898G>A	c.(1897-1899)TGA>TAA	p.*633*	RACGAP1_uc009zlm.1_Silent_p.*633*|RACGAP1_uc001rvs.2_Silent_p.*633*|RACGAP1_uc001rvu.2_Silent_p.*633*	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	633					blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						GATGTGACTTCACTTGAGCAT	0.428													34	77	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52168059	52168059	+	Silent	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52168059C>A	uc001ryw.2	+	20	3910	c.3732C>A	c.(3730-3732)ATC>ATA	p.I1244I	SCN8A_uc010snl.1_Silent_p.I1109I|SCN8A_uc001rza.1_RNA	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1244	Helical; Name=S2 of repeat III; (Potential).|III.				axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	ATATCTTCATCCTGGAGATGT	0.488													52	126	---	---	---	---	PASS
DGKA	1606	broad.mit.edu	37	12	56347560	56347560	+	3'UTR	SNP	A	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56347560A>C	uc001sij.2	+	24					DGKA_uc001sik.2_3'UTR|DGKA_uc001sil.2_3'UTR|DGKA_uc001sim.2_3'UTR|DGKA_uc001sin.2_3'UTR|DGKA_uc009zof.2_3'UTR|DGKA_uc001sio.2_3'UTR	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	TAAGGGGGACACCCTTGGCCT	0.592													6	26	---	---	---	---	PASS
MBD6	114785	broad.mit.edu	37	12	57921757	57921757	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57921757C>G	uc001soj.1	+	9	2587	c.2363C>G	c.(2362-2364)TCA>TGA	p.S788*	MBD6_uc001sok.1_Nonsense_Mutation_p.S655*|MBD6_uc001sol.1_RNA	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	788	Pro-rich.					chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4						CCACCCCTCTCAGAGGCTTCT	0.582													15	53	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78444560	78444560	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78444560T>C	uc001syp.2	+	11	2322	c.2149T>C	c.(2149-2151)TTT>CTT	p.F717L	NAV3_uc001syo.2_Missense_Mutation_p.F717L|NAV3_uc010sub.1_Missense_Mutation_p.F217L	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	717						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GGAGACAACATTTGACAGCAC	0.478										HNSCC(70;0.22)			32	87	---	---	---	---	PASS
TMTC3	160418	broad.mit.edu	37	12	88566466	88566466	+	Silent	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88566466C>A	uc001tau.2	+	8	1363	c.1143C>A	c.(1141-1143)CCC>CCA	p.P381P	TMTC3_uc009zsm.2_RNA	NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	381	Helical; (Potential).					integral to membrane	binding			skin(1)	1						TATATGTTCCCAGCATGGGGT	0.368													4	129	---	---	---	---	PASS
NFYB	4801	broad.mit.edu	37	12	104522200	104522200	+	Splice_Site	SNP	A	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104522200A>T	uc001tkl.1	-	3	301	c.100_splice	c.e3+1	p.D34_splice	NFYB_uc001tkk.1_Splice_Site_p.D32_splice	NM_006166	NP_006157	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta							CCAAT-binding factor complex	repressing transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						TGGCTTGCTTACCATCATGAG	0.378													6	52	---	---	---	---	PASS
ATP2A2	488	broad.mit.edu	37	12	110778588	110778588	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110778588G>A	uc001tqk.3	+	14	2449	c.1886G>A	c.(1885-1887)GGC>GAC	p.G629D	ATP2A2_uc001tql.3_Missense_Mutation_p.G629D|ATP2A2_uc010sxy.1_Missense_Mutation_p.G602D	NM_170665	NP_733765	P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, slow twitch 2 isoform	629	Cytoplasmic (By similarity).				ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding			ovary(3)|skin(1)	4						GACAACAAGGGCACTGCTGTG	0.597													35	88	---	---	---	---	PASS
OAS1	4938	broad.mit.edu	37	12	113354322	113354322	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113354322G>C	uc001tud.2	+	4	769	c.663G>C	c.(661-663)AAG>AAC	p.K221N	OAS1_uc010syn.1_Missense_Mutation_p.K220N|OAS1_uc010syo.1_3'UTR|OAS1_uc001tub.2_Missense_Mutation_p.K221N|OAS1_uc001tuc.2_Missense_Mutation_p.K221N|OAS1_uc009zwf.2_Missense_Mutation_p.K220N	NM_016816	NP_058132	P00973	OAS1_HUMAN	2',5'-oligoadenylate synthetase 1 isoform 1	221					interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(2)	2						AGTGTAAGAAGAAGCTTGGGA	0.368													31	59	---	---	---	---	PASS
RBM19	9904	broad.mit.edu	37	12	114386651	114386651	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114386651G>A	uc009zwi.2	-	10	1407	c.1263C>T	c.(1261-1263)CTC>CTT	p.L421L	RBM19_uc001tvn.3_Silent_p.L421L|RBM19_uc001tvm.2_Silent_p.L421L	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	421	RRM 3.				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					ATTTGGAGAAGAGCTTCTCCA	0.607													14	59	---	---	---	---	PASS
FBXW8	26259	broad.mit.edu	37	12	117426609	117426609	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117426609G>A	uc001twg.1	+	7	1256	c.1174G>A	c.(1174-1176)GAC>AAC	p.D392N	FBXW8_uc001twf.1_Missense_Mutation_p.D326N|FBXW8_uc009zwp.1_RNA	NM_153348	NP_699179	Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8 isoform	392							protein binding			ovary(2)|pancreas(1)	3	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		CACATGTCTAGACGTCTCGGC	0.512													37	119	---	---	---	---	PASS
SFRS5	6430	broad.mit.edu	37	14	70234911	70234911	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70234911C>G	uc001xll.2	+	3	1489	c.38C>G	c.(37-39)CCA>CGA	p.P13R	SFRS5_uc001xlm.2_RNA|SFRS5_uc001xln.1_Missense_Mutation_p.P13R|SFRS5_uc001xlo.2_Missense_Mutation_p.P13R|SFRS5_uc001xlp.2_Missense_Mutation_p.P13R|SFRS5_uc001xlq.2_Missense_Mutation_p.P13R	NM_006925	NP_008856	Q13243	SRSF5_HUMAN	splicing factor, arginine/serine-rich 5	13	RRM 1.				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)		AGACTAAATCCAGCGGCCAGG	0.428													37	87	---	---	---	---	PASS
SPTLC2	9517	broad.mit.edu	37	14	77978688	77978688	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77978688C>T	uc001xub.2	-	12	1816	c.1628G>A	c.(1627-1629)CGG>CAG	p.R543Q		NM_004863	NP_004854	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base	543						integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			upper_aerodigestive_tract(1)|ovary(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	AGGTACCAACCGATGACGGGA	0.483													23	54	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92905670	92905670	+	Intron	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92905670C>G	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_5'Flank	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		TCTCCTCTCTCCTTTGCAGGC	0.567													36	102	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92905693	92905693	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92905693C>G	uc001yak.2	+	4	306	c.282C>G	c.(280-282)TTC>TTG	p.F94L	SLC24A4_uc001yai.2_Missense_Mutation_p.F47L|SLC24A4_uc010twm.1_Missense_Mutation_p.F111L|SLC24A4_uc001yaj.2_Missense_Mutation_p.F94L|SLC24A4_uc010auj.2_Missense_Mutation_p.F2L	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	111	Helical; (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		TGTATATGTTCTATGCCTTGG	0.552													46	153	---	---	---	---	PASS
DEGS2	123099	broad.mit.edu	37	14	100615443	100615443	+	Silent	SNP	G	A	A	rs145891510		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100615443G>A	uc001ygx.2	-	2	775	c.687C>T	c.(685-687)TTC>TTT	p.F229F		NM_206918	NP_996801	Q6QHC5	DEGS2_HUMAN	degenerative spermatocyte homolog 2, lipid	229	Helical; (Potential).				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	sphingosine hydroxylase activity				0		Melanoma(154;0.212)				GCTCGGCCACGAAGTGGCCCG	0.622													32	93	---	---	---	---	PASS
KIF26A	26153	broad.mit.edu	37	14	104639437	104639437	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104639437C>T	uc001yos.3	+	8	1544	c.1544C>T	c.(1543-1545)TCC>TTC	p.S515F		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	515	Kinesin-motor.				blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		ACCCGCTTCTCCGTCCGGGTC	0.701													3	8	---	---	---	---	PASS
RTF1	23168	broad.mit.edu	37	15	41768712	41768712	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41768712G>A	uc001zny.2	+	12	1563	c.1551G>A	c.(1549-1551)CTG>CTA	p.L517L		NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component	517					histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		CTCAGCTACTGAAGGAAAAGG	0.448													27	56	---	---	---	---	PASS
SLC28A2	9153	broad.mit.edu	37	15	45564994	45564994	+	Intron	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45564994G>C	uc001zva.2	+							NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		TGAGCACCAGGACCCCATTCC	0.502													16	37	---	---	---	---	PASS
NEDD4	4734	broad.mit.edu	37	15	56155208	56155208	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56155208G>C	uc002adj.2	-	5	2134	c.1834C>G	c.(1834-1836)CTA>GTA	p.L612V	NEDD4_uc002adl.2_Missense_Mutation_p.L193V|NEDD4_uc002adi.2_Missense_Mutation_p.L540V|NEDD4_uc010ugj.1_Missense_Mutation_p.L596V|NEDD4_uc010bfm.2_Missense_Mutation_p.L595V|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	612	WW 1.|Mediates interaction with TNIK (By similarity).				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		CCTGGAGGTAGAGGAGAAGGT	0.463													44	83	---	---	---	---	PASS
DAPK2	23604	broad.mit.edu	37	15	64204182	64204182	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64204182G>A	uc002amr.2	-	11	988	c.957C>T	c.(955-957)TTC>TTT	p.F319F	DAPK2_uc010uim.1_RNA	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2	319	Calmodulin-binding.			Missing: Loss of ca(2+)-calmodulin binding, increase in activity, loss of autophosphorylation.	apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		ACACGATGCTGAAGGAAAGCT	0.597													6	26	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79750330	79750330	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79750330C>T	uc002bew.1	+	2	1916	c.1841C>T	c.(1840-1842)TCG>TTG	p.S614L	KIAA1024_uc010unk.1_Missense_Mutation_p.S614L	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	614						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						GAATCCCTGTCGGGTGTCCGT	0.498													29	63	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90347826	90347826	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90347826C>T	uc002bop.3	-	5	1212	c.920G>A	c.(919-921)AGT>AAT	p.S307N		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	307	Extracellular.|Interaction with HCoV-229E.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	CGCAATGGCACTGGGCCGGGC	0.612													17	55	---	---	---	---	PASS
NUBP2	10101	broad.mit.edu	37	16	1838062	1838062	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1838062G>A	uc002cmw.3	+						NUBP2_uc002cmx.3_Intron|NUBP2_uc010brx.2_Intron	NM_012225	NP_036357	Q9Y5Y2	NUBP2_HUMAN	nucleotide binding protein 2 (MinD homolog, E.							microtubule organizing center|nucleus	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding|protein binding				0						GGTGAGTCCCGGGGGTTGCAG	0.652													10	20	---	---	---	---	PASS
TSC2	7249	broad.mit.edu	37	16	2137872	2137872	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2137872C>G	uc002con.2	+	39	5104	c.4998C>G	c.(4996-4998)TTC>TTG	p.F1666L	TSC2_uc010bsd.2_Missense_Mutation_p.F1643L|TSC2_uc002coo.2_Missense_Mutation_p.F1599L|TSC2_uc010uvv.1_Missense_Mutation_p.F1563L|TSC2_uc010uvw.1_Missense_Mutation_p.F1551L|TSC2_uc002cop.2_Missense_Mutation_p.F1422L|TSC2_uc002coq.2_Missense_Mutation_p.F441L|TSC2_uc002cor.2_Missense_Mutation_p.F367L	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	1666	Rap-GAP.				cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				AGGGCCAGTTCAACTTTGTCC	0.617			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				6	19	---	---	---	---	PASS
ZNF213	7760	broad.mit.edu	37	16	3188545	3188545	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3188545G>A	uc010uws.1	+						ZNF213_uc002cud.2_Intron|ZNF213_uc010btf.2_3'UTR|ZNF213_uc010bth.2_Intron|ZNF213_uc010uwt.1_Intron	NM_004220	NP_004211	O14771	ZN213_HUMAN	zinc finger protein 213						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCATAGCGGTGAGTAAGCCTC	0.677													4	19	---	---	---	---	PASS
NLRC3	197358	broad.mit.edu	37	16	3614207	3614207	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3614207G>T	uc010btn.2	-	5	1142	c.731C>A	c.(730-732)CCG>CAG	p.P244Q		NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	244	NACHT.				I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						GTGGTCCACCGGGATCTCCTT	0.607													3	26	---	---	---	---	PASS
USP7	7874	broad.mit.edu	37	16	9024213	9024213	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9024213C>A	uc002czl.2	-	2	320	c.121G>T	c.(121-123)GTG>TTG	p.V41L	USP7_uc010uyk.1_5'UTR|USP7_uc010uyj.1_5'UTR|USP7_uc002czk.2_Missense_Mutation_p.V25L|USP7_uc010uyl.1_RNA	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	41	Interaction with TSPYL5.				interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						CCATTGATCACAGGGTTCTGA	0.488													26	55	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15814153	15814153	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15814153G>A	uc002ddy.2	-	34	4915	c.4808C>T	c.(4807-4809)ACG>ATG	p.T1603M	MYH11_uc002ddv.2_Missense_Mutation_p.T1610M|MYH11_uc002ddw.2_Missense_Mutation_p.T1603M|MYH11_uc002ddx.2_Missense_Mutation_p.T1610M|MYH11_uc010bvg.2_Missense_Mutation_p.T1435M|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Missense_Mutation_p.T309M|NDE1_uc002ddz.1_5'Flank	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1603	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						TTCCAGTTCCGTCTCATACTC	0.592			T	CBFB	AML								11	27	---	---	---	---	PASS
CDR2	1039	broad.mit.edu	37	16	22359077	22359077	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22359077C>G	uc002dkn.2	-	5	882	c.574G>C	c.(574-576)GAA>CAA	p.E192Q		NM_001802	NP_001793	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2	192	Potential.					nucleus	protein binding			skin(1)	1				GBM - Glioblastoma multiforme(48;0.0188)		TTTTCCTCTTCATCAGGGCTT	0.453													47	116	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24788506	24788506	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24788506G>A	uc002dmm.2	+	5	530	c.416G>A	c.(415-417)CGA>CAA	p.R139Q	TNRC6A_uc010bxs.2_5'UTR	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	139					negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		GTACCTCCACGATTTCGCCAC	0.328													40	100	---	---	---	---	PASS
ZNF768	79724	broad.mit.edu	37	16	30536174	30536174	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30536174G>C	uc002dyk.3	-	2	1463	c.1287C>G	c.(1285-1287)TTC>TTG	p.F429L	ZNF768_uc010vex.1_Missense_Mutation_p.F398L|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Missense_Mutation_p.F398L	NM_024671	NP_078947	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	429	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding				0						CAGGGCACTTGAAGGGCTTCT	0.692													12	21	---	---	---	---	PASS
ARMC5	79798	broad.mit.edu	37	16	31475706	31475706	+	Intron	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31475706C>T	uc002ecc.2	+						ARMC5_uc010vfn.1_Intron|ARMC5_uc010vfo.1_Intron|ARMC5_uc002eca.3_Intron|ARMC5_uc010vfp.1_Intron|ARMC5_uc002ecb.2_Intron	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN	armadillo repeat containing 5 isoform a								binding			pancreas(1)	1						CCCTTTCTGCCCTCCGCAGGT	0.527													4	13	---	---	---	---	PASS
PDP2	57546	broad.mit.edu	37	16	66919167	66919167	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66919167C>T	uc002eqk.1	+	2	1142	c.980C>T	c.(979-981)TCA>TTA	p.S327L		NM_020786	NP_065837	Q9P2J9	PDP2_HUMAN	pyruvate dehydrogenase phosphatase isoenzyme 2	327					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		CACCCTGAGTCAGAGGACAGG	0.572													10	39	---	---	---	---	PASS
C17orf81	23587	broad.mit.edu	37	17	7155834	7155834	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7155834G>T	uc002gfg.1	+	2	120	c.13G>T	c.(13-15)GAG>TAG	p.E5*	DULLARD_uc002gfd.2_5'Flank|DULLARD_uc002gfe.2_5'Flank|DULLARD_uc002gff.2_5'Flank|DULLARD_uc002gfc.2_5'Flank|C17orf81_uc002gfj.2_Nonsense_Mutation_p.E5*|C17orf81_uc010cmb.2_Nonsense_Mutation_p.E5*|C17orf81_uc002gfh.1_Nonsense_Mutation_p.E5*|C17orf81_uc002gfi.1_Nonsense_Mutation_p.E5*|C17orf81_uc002gfk.1_Nonsense_Mutation_p.E5*|C17orf81_uc002gfl.1_Nonsense_Mutation_p.E5*	NM_203415	NP_981960	Q8TE02	DERP6_HUMAN	S-phase 2 protein isoform 4	5					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding				0						GACGCCATCAGAGGGCGCCAG	0.627													3	14	---	---	---	---	PASS
EVI2B	2124	broad.mit.edu	37	17	29631855	29631855	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29631855C>T	uc002hgk.2	-	2	928	c.773G>A	c.(772-774)AGA>AAA	p.R258K	NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2B_uc010csq.2_Missense_Mutation_p.R273K	NM_006495	NP_006486	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B precursor	258	Cytoplasmic (Potential).					cytoplasm|integral to plasma membrane				ovary(2)	2		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		TTCATTTTCTCTGATGTTATC	0.363													33	108	---	---	---	---	PASS
MLLT6	4302	broad.mit.edu	37	17	36877003	36877003	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36877003G>A	uc002hqi.3	+						MLLT6_uc002hqj.2_Silent_p.V250V|MLLT6_uc002hqk.3_Intron	NM_005937	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent	nucleus	protein binding|zinc ion binding			breast(3)|prostate(1)|lung(1)|skin(1)	6	Breast(7;4.43e-21)					CTTCTGAGGTGGGCGCTACGA	0.627			T	MLL	AL								12	23	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41244494	41244494	+	Silent	SNP	G	A	A	rs80357547		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41244494G>A	uc002icq.2	-	10	3286	c.3054C>T	c.(3052-3054)AAC>AAT	p.N1018N	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Silent_p.N947N|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Silent_p.N971N|BRCA1_uc002ict.2_Silent_p.N1018N|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Silent_p.N1018N|BRCA1_uc002ide.1_Silent_p.N849N|BRCA1_uc010cyy.1_Silent_p.N1018N|BRCA1_uc010whs.1_Silent_p.N1018N|BRCA1_uc010cyz.2_Silent_p.N971N|BRCA1_uc010cza.2_Silent_p.N992N|BRCA1_uc010wht.1_Silent_p.N722N	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1018					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TACTTGGAATGTTCTCATTTC	0.338			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			9	271	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62020421	62020421	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62020421C>T	uc002jds.1	-	23	4130	c.4053G>A	c.(4051-4053)ACG>ACA	p.T1351T		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1351	Helical; Name=S1 of repeat IV; (Potential).|IV.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	AGGCCTGCTTCGTCACGAGGT	0.562													30	112	---	---	---	---	PASS
TTYH2	94015	broad.mit.edu	37	17	72245514	72245514	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72245514G>A	uc002jkc.2	+	8	937	c.906G>A	c.(904-906)CAG>CAA	p.Q302Q	TTYH2_uc010wqw.1_Silent_p.Q281Q|TTYH2_uc002jkd.2_5'UTR	NM_032646	NP_116035	Q9BSA4	TTYH2_HUMAN	tweety 2 isoform 1	302	Extracellular (Potential).					chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4						ATTGCAGCCAGAGTGGAAGCA	0.592													33	108	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76501504	76501504	+	Silent	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76501504G>C	uc010wtu.1	-	5	879	c.702C>G	c.(700-702)CTC>CTG	p.L234L						full-length cDNA clone CS0DJ002YI14 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GGCTATCGAAGAGTTTGGACA	0.547													8	25	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13099491	13099491	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13099491C>T	uc010xac.1	+	37	6654	c.6574C>T	c.(6574-6576)CTT>TTT	p.L2192F	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.L1717F|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Missense_Mutation_p.L614F|CEP192_uc002krw.2_Missense_Mutation_p.L341F|CEP192_uc002krx.2_Missense_Mutation_p.L196F|CEP192_uc002kry.2_RNA	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	2192										ovary(4)|pancreas(1)	5						ACTACAAATTCTTGTGAGTCC	0.333													29	82	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18539802	18539802	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18539802C>G	uc002kte.2	-	29	4452	c.3511G>C	c.(3511-3513)GAT>CAT	p.D1171H		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1171	PH.|Auto-inhibitory.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					GCAACTTACTCTATGTCCAAT	0.279													17	26	---	---	---	---	PASS
SNRPD1	6632	broad.mit.edu	37	18	19192399	19192399	+	Silent	SNP	C	G	G	rs139445414		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19192399C>G	uc002ktj.1	+	1	140	c.9C>G	c.(7-9)CTC>CTG	p.L3L		NM_006938	NP_008869	P62314	SMD1_HUMAN	small nuclear ribonucleoprotein D1 polypeptide	3					ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding|RNA binding				0						GGATGAAGCTCGTGAGGTGAG	0.622											OREG0024889	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	85	255	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31323474	31323474	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31323474C>G	uc010dmg.1	+	12	3717	c.3662C>G	c.(3661-3663)TCT>TGT	p.S1221C	ASXL3_uc002kxq.2_Missense_Mutation_p.S928C	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1221	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TCATCTACCTCTTCTGAAAAT	0.378													23	66	---	---	---	---	PASS
C18orf21	83608	broad.mit.edu	37	18	33554887	33554887	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33554887T>G	uc002kzc.2	+	3	233	c.129T>G	c.(127-129)TGT>TGG	p.C43W	C18orf21_uc002kzd.2_5'UTR	NM_031446	NP_113634	Q32NC0	CR021_HUMAN	chromosome 18 open reading frame 21	43											0						AAGAAACGTGTCCATACTGTT	0.368													41	102	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1062282	1062282	+	Silent	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1062282G>C	uc002lqw.3	+	42	5913	c.5682G>C	c.(5680-5682)CTG>CTC	p.L1894L	ABCA7_uc002lqy.2_Silent_p.L347L|ABCA7_uc010dsc.2_RNA	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	1894	ABC transporter 2.				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGCGCGCCTGCGCGGTGTCC	0.672													33	139	---	---	---	---	PASS
DIRAS1	148252	broad.mit.edu	37	19	2717432	2717432	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2717432C>T	uc002lwf.3	-	2	531	c.373G>A	c.(373-375)GAG>AAG	p.E125K		NM_145173	NP_660156	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	125					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCTGCGTCTCATCGCACTTG	0.622													6	33	---	---	---	---	PASS
TJP3	27134	broad.mit.edu	37	19	3738664	3738664	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3738664G>A	uc010xhv.1	+						TJP3_uc010xhs.1_Intron|TJP3_uc010xht.1_Intron|TJP3_uc010xhu.1_Intron|TJP3_uc010xhw.1_Intron	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3							tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGGACAGTGAGTGCGCGTG	0.622													5	85	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5729880	5729880	+	Intron	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5729880C>T	uc002mda.2	+						TMEM146_uc010duj.1_Intron	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor							integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						TTGTTTATTTCAGGAAACAAG	0.308													24	95	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9068371	9068371	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9068371C>G	uc002mkp.2	-	3	19279	c.19075G>C	c.(19075-19077)GAG>CAG	p.E6359Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6361	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AAAGTTGTCTCAGACTCAATC	0.453													13	38	---	---	---	---	PASS
ZNF791	163049	broad.mit.edu	37	19	12740056	12740056	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12740056G>C	uc002mua.2	+	4	1875	c.1713G>C	c.(1711-1713)ATG>ATC	p.M571I	ZNF791_uc010xml.1_Missense_Mutation_p.M539I|ZNF791_uc010dyu.1_Missense_Mutation_p.M462I|ZNF791_uc010xmm.1_Missense_Mutation_p.M462I	NM_153358	NP_699189	Q3KP31	ZN791_HUMAN	zinc finger protein 791	571	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						AAAAACATATGAGAATGCACA	0.338													38	64	---	---	---	---	PASS
CC2D1A	54862	broad.mit.edu	37	19	14040433	14040433	+	Silent	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14040433G>A	uc002mxo.2	+	26	2969	c.2670G>A	c.(2668-2670)CAG>CAA	p.Q890Q	CC2D1A_uc002mxp.2_Silent_p.Q889Q|CC2D1A_uc010dzh.2_Silent_p.Q459Q	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	890					positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			GCCAGTGGCAGAGGGCACAGC	0.667													4	4	---	---	---	---	PASS
CC2D1A	54862	broad.mit.edu	37	19	14041055	14041055	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14041055G>A	uc002mxo.2	+	28	3087	c.2788G>A	c.(2788-2790)GAT>AAT	p.D930N	CC2D1A_uc002mxp.2_Missense_Mutation_p.D929N|CC2D1A_uc010dzh.2_Missense_Mutation_p.D499N	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	930					positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			TCCCCCACAGGATGCTGCAAA	0.642													26	93	---	---	---	---	PASS
CHERP	10523	broad.mit.edu	37	19	16640543	16640543	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16640543C>G	uc002nei.1	-	8	1119	c.1045G>C	c.(1045-1047)GCT>CCT	p.A349P	MED26_uc002nee.2_Intron	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum	349					cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						TTGACTTCAGCCTCCATCTGC	0.562													4	1	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17038888	17038888	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17038888C>T	uc002nfb.2	-	25	3474	c.3442G>A	c.(3442-3444)GAG>AAG	p.E1148K		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1101						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						GTGAAGGCCTCGCTGTAGCTC	0.632													4	74	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22585688	22585688	+	Splice_Site	SNP	T	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22585688T>A	uc002nqt.2	-	3	280	c.158_splice	c.e3-1	p.G53_splice		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CAGCAATACCTGTTTTATTAC	0.373													22	83	---	---	---	---	PASS
CLIP3	25999	broad.mit.edu	37	19	36508769	36508769	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36508769C>T	uc010eeq.1	-	9	1590	c.1308G>A	c.(1306-1308)GGG>GGA	p.G436G	uc002ocy.2_Intron|CLIP3_uc002ocz.1_Silent_p.G436G	NM_015526	NP_056341	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	436	CAP-Gly 2.				chaperone-mediated protein transport|fat cell differentiation|membrane biogenesis|negative regulation of microtubule polymerization|peptidyl-L-cysteine S-palmitoylation|positive regulation of apoptosis|positive regulation of endocytosis|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose transport|positive regulation of protein phosphorylation	early endosome membrane|Golgi stack|membrane raft|microsome|plasma membrane|recycling endosome membrane|trans-Golgi network membrane	ganglioside binding|microtubule binding			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AGTCTGTCTTCCCGTAGAAGC	0.627													38	62	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38609965	38609965	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38609965A>C	uc002ohk.2	+	9	2820	c.2311A>C	c.(2311-2313)AAA>CAA	p.K771Q		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	771	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GACCCGATCCAAAGACGCTCC	0.488													9	68	---	---	---	---	PASS
LGALS4	3960	broad.mit.edu	37	19	39292800	39292800	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39292800G>A	uc002ojg.2	-							NM_006149	NP_006140	P56470	LEG4_HUMAN	galectin-4						cell adhesion	cytosol|plasma membrane	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			TAGCAAAGCTGGGGACAGAGA	0.388													17	36	---	---	---	---	PASS
MARK4	57787	broad.mit.edu	37	19	45801453	45801453	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45801453G>A	uc002pbb.1	+						MARK4_uc002pba.1_Missense_Mutation_p.A644T			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;						microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGTTTCGGGCGCCTCTCTGCC	0.567													21	47	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47422099	47422099	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47422099C>T	uc010ekv.2	+	1	167	c.167C>T	c.(166-168)TCC>TTC	p.S56F		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	56					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		GACCATACCTCCGTCCTCAGC	0.542													22	77	---	---	---	---	PASS
C5AR1	728	broad.mit.edu	37	19	47823477	47823477	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47823477G>A	uc002pgj.1	+	2	492	c.443G>A	c.(442-444)CGA>CAA	p.R148Q		NM_001736	NP_001727	P21730	C5AR_HUMAN	complement component 5 receptor 1	148	Cytoplasmic (Potential).				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		CAGAACTTCCGAGGGGCTGGC	0.612													27	54	---	---	---	---	PASS
SYNGR4	23546	broad.mit.edu	37	19	48869139	48869139	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48869139G>A	uc002piz.2	+	2	285	c.40G>A	c.(40-42)GAA>AAA	p.E14K	TMEM143_uc002piw.1_5'Flank|TMEM143_uc002pix.1_5'Flank|TMEM143_uc002piy.1_5'Flank|TMEM143_uc010xzn.1_5'Flank|TMEM143_uc010elw.1_5'Flank|TMEM143_uc010xzo.1_5'Flank|TMEM143_uc010xzp.1_5'Flank|TMEM143_uc010xzq.1_5'Flank	NM_012451	NP_036583	O95473	SNG4_HUMAN	synaptogyrin 4	14						integral to membrane					0		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		GGCCAACAGCGAAGCCGTGCA	0.647													15	56	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53384853	53384853	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53384853G>A	uc002qag.2	-	4	717	c.526C>T	c.(526-528)CTT>TTT	p.L176F	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.L122F|ZNF320_uc002qai.2_Missense_Mutation_p.L176F	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	176	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		TGTATTTCAAGATGTGATTTG	0.353													16	76	---	---	---	---	PASS
ZNF347	84671	broad.mit.edu	37	19	53644386	53644386	+	Silent	SNP	T	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53644386T>A	uc002qbb.1	-	5	1764	c.1695A>T	c.(1693-1695)GGA>GGT	p.G565G	ZNF347_uc010eql.1_Silent_p.G566G|ZNF347_uc002qbc.1_Silent_p.G566G	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN	zinc finger protein 347	565					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0179)		AAGGTTTTTCTCCAGTATGGA	0.408													5	268	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54782885	54782885	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54782885A>C	uc002qfb.2	-	6	1003	c.737T>G	c.(736-738)GTC>GGC	p.V246G	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.V246G|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.V246G|LILRB2_uc010yet.1_Missense_Mutation_p.V130G|LILRB2_uc010yeu.1_Intron	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	246	Extracellular (Potential).|Ig-like C2-type 3.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GACATCAGAGACACACTGGAG	0.602													3	99	---	---	---	---	PASS
EPS8L1	54869	broad.mit.edu	37	19	55594890	55594890	+	Intron	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55594890G>A	uc002qis.3	+						EPS8L1_uc010ess.1_Silent_p.V435V|EPS8L1_uc010est.1_Intron|EPS8L1_uc010yfr.1_Intron|EPS8L1_uc010esu.1_Intron|EPS8L1_uc002qiu.2_Intron|EPS8L1_uc002qiv.2_Silent_p.V99V|EPS8L1_uc002qiw.2_Silent_p.V200V	NM_133180	NP_573441	Q8TE68	ES8L1_HUMAN	epidermal growth factor receptor pathway							cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GCCGGCAGGTGACCCAAGCGA	0.697													5	9	---	---	---	---	PASS
ZNF551	90233	broad.mit.edu	37	19	58198820	58198820	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58198820T>G	uc002qpw.3	+	3	1352	c.1129T>G	c.(1129-1131)TGC>GGC	p.C377G	ZNF551_uc002qpv.3_Missense_Mutation_p.C320G|ZNF776_uc002qpx.2_Intron	NM_138347	NP_612356	Q7Z340	ZN551_HUMAN	zinc finger protein 551	393	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCCTTATCAGTGCTGTGAGTG	0.443													3	144	---	---	---	---	PASS
C19orf18	147685	broad.mit.edu	37	19	58472918	58472918	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58472918G>A	uc002qqv.2	-	5	477	c.373C>T	c.(373-375)CGA>TGA	p.R125*		NM_152474	NP_689687	Q8NEA5	CS018_HUMAN	hypothetical protein LOC147685 precursor	125	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)		TGTGCCAGTCGACTGGAGAAT	0.433													36	99	---	---	---	---	PASS
DDRGK1	65992	broad.mit.edu	37	20	3175951	3175951	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3175951C>T	uc002wic.2	-	5	581	c.559G>A	c.(559-561)GAG>AAG	p.E187K	DDRGK1_uc010gaw.2_RNA|DDRGK1_uc010gax.1_Missense_Mutation_p.E187K	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1 precursor	187						endoplasmic reticulum	protein binding				0						AGGTACTCCTCATGCTCCCGC	0.622													15	73	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	41101176	41101176	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41101176C>T	uc002xkg.2	-	8	1364	c.1180G>A	c.(1180-1182)GAA>AAA	p.E394K	PTPRT_uc010ggj.2_Missense_Mutation_p.E394K	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	394	Extracellular (Potential).|Fibronectin type-III 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCTACGATTTCCACGTTCTGT	0.562													15	42	---	---	---	---	PASS
CSTB	1476	broad.mit.edu	37	21	45194154	45194154	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45194154C>T	uc002zdr.2	-	3	335	c.226G>A	c.(226-228)GAA>AAA	p.E76K		NM_000100	NP_000091	P04080	CYTB_HUMAN	cystatin B	76						cytoplasm|nucleolus	cysteine-type endopeptidase inhibitor activity|protease binding				0				STAD - Stomach adenocarcinoma(101;0.168)		GGCTTGTTTTCATGAGGGAGA	0.522													27	95	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21188890	21188890	+	Silent	SNP	T	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21188890T>C	uc002zsz.3	-	3	384	c.153A>G	c.(151-153)AAA>AAG	p.K51K	PI4KA_uc010gsq.1_Silent_p.K109K	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	51					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CCCAATACACTTTTGGAAGAC	0.303													71	143	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42610503	42610503	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42610503G>C	uc003bcj.1	-	1	943	c.809C>G	c.(808-810)TCT>TGT	p.S270C	TCF20_uc003bck.1_Missense_Mutation_p.S270C|TCF20_uc003bnt.2_Missense_Mutation_p.S270C	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	270					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						TTCATACTGAGATCCAGCATT	0.388													51	160	---	---	---	---	PASS
TTLL12	23170	broad.mit.edu	37	22	43565515	43565515	+	Silent	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43565515C>T	uc003bdq.2	-	12	1667	c.1635G>A	c.(1633-1635)ACG>ACA	p.T545T	TTLL12_uc003bdp.2_Missense_Mutation_p.R138Q|TTLL12_uc003bdr.1_Silent_p.T545T	NM_015140	NP_055955	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	545	TTL.				protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)				CCTGGACGTCCGTCCAGGGAA	0.617													4	20	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46722476	46722476	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46722476C>G	uc011aqy.1	+	9	1861	c.1649C>G	c.(1648-1650)CCC>CGC	p.P550R	GTSE1_uc011aqz.1_Missense_Mutation_p.P397R|GTSE1_uc003bhl.1_Missense_Mutation_p.P175R|GTSE1_uc003bhm.1_Missense_Mutation_p.P175R|GTSE1_uc003bhn.2_5'Flank	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	531					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		AAAACGATGCCCAGGGCCGTG	0.617													14	43	---	---	---	---	PASS
GRAMD4	23151	broad.mit.edu	37	22	47064702	47064702	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47064702C>G	uc003bhx.2	+	12	1020	c.981C>G	c.(979-981)TTC>TTG	p.F327L	GRAMD4_uc010had.2_Missense_Mutation_p.F266L	NM_015124	NP_055939	Q6IC98	GRAM4_HUMAN	death-inducing-protein	327					apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CCAGCTTGTTCATGTGGGTCC	0.478													22	65	---	---	---	---	PASS
MAPK11	5600	broad.mit.edu	37	22	50704989	50704989	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50704989G>A	uc003bkr.2	-	8	720	c.662C>T	c.(661-663)GCC>GTC	p.A221V	MAPK11_uc010hax.2_Missense_Mutation_p.A43V|MAPK11_uc011ars.1_RNA|MAPK11_uc010hay.1_RNA|MAPK11_uc011art.1_3'UTR|MAPK11_uc010haz.2_3'UTR	NM_002751	NP_002742	Q15759	MK11_HUMAN	mitogen-activated protein kinase 11	221	Protein kinase.		A -> V (in a lung neuroendocrine carcinoma sample; somatic mutation).		activation of MAPK activity|innate immune response|mRNA metabolic process|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding	p.A221V(1)		lung(1)|breast(1)	2		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGGGAAGAGGGCCTTGCCCTG	0.657													12	44	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11682476	11682476	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11682476G>A	uc004cup.1	-	1	1346	c.473C>T	c.(472-474)TCA>TTA	p.S158L	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.S158L	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	158					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						TCCCCCGGATGAACAGAGGAT	0.662													8	21	---	---	---	---	PASS
SCML2	10389	broad.mit.edu	37	X	18283732	18283732	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18283732C>G	uc004cyl.2	-	8	1078	c.921G>C	c.(919-921)AGG>AGC	p.R307S	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.R307S|SCML2_uc011miz.1_Missense_Mutation_p.R241S|SCML2_uc010nfc.2_Missense_Mutation_p.R43S	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	307					anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					GACCTTTTTTCCTTGGTGTGA	0.363													69	224	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148721	34148721	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148721C>T	uc004ddg.2	-	1	1708	c.1675G>A	c.(1675-1677)GAG>AAG	p.E559K		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	559										ovary(4)|central_nervous_system(1)	5						TTGGGAGGCTCCGGGTGGAGA	0.572													23	62	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41077746	41077746	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41077746G>A	uc004dfb.2	+	37	6964	c.6331G>A	c.(6331-6333)GAA>AAA	p.E2111K	USP9X_uc004dfc.2_Missense_Mutation_p.E2111K	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	2111					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						CCCTAGTGCAGAAGTGAGGGG	0.443													76	190	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44833908	44833908	+	Intron	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44833908C>T	uc004dge.3	+						KDM6A_uc010nhk.2_Intron|KDM6A_uc011mkz.1_Intron|KDM6A_uc011mla.1_Intron|KDM6A_uc011mlb.1_Intron|KDM6A_uc011mlc.1_Intron	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide						histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						ATTTTCCTTTCAGCATTATCT	0.378			D|N|F|S		renal|oesophageal SCC|MM								6	143	---	---	---	---	PASS
ZNF673	55634	broad.mit.edu	37	X	46332435	46332435	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46332435G>C	uc004dgn.3	+	6	803	c.504G>C	c.(502-504)AAG>AAC	p.K168N	ZNF673_uc004dgp.3_3'UTR|ZNF673_uc010nhl.2_3'UTR|ZNF673_uc004dgm.3_Missense_Mutation_p.K163N	NM_001129898	NP_001123370	Q5JUW0	ZN673_HUMAN	zinc finger family member 673 isoform 1	168					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0						AGCTATGTAAGAAAGAAAGAT	0.333													15	31	---	---	---	---	PASS
PPP1R3F	89801	broad.mit.edu	37	X	49143337	49143337	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49143337G>A	uc004dnh.1	+	4	2201	c.2185G>A	c.(2185-2187)GAA>AAA	p.E729K	PPP1R3F_uc011mnd.1_Missense_Mutation_p.E400K|PPP1R3F_uc004dni.2_Missense_Mutation_p.E383K|PPP1R3F_uc004dnj.1_Missense_Mutation_p.E383K	NM_033215	NP_149992	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory (inhibitor)	729	Extracellular (Potential).					integral to membrane				ovary(2)|skin(1)	3	Ovarian(276;0.236)					CTCCCAGGATGAAAAGGATGC	0.602													12	37	---	---	---	---	PASS
PJA1	64219	broad.mit.edu	37	X	68382141	68382141	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68382141C>A	uc004dxh.2	-	2	1227	c.941G>T	c.(940-942)AGT>ATT	p.S314I	PJA1_uc011mpi.1_Missense_Mutation_p.S32I|PJA1_uc004dxg.2_Missense_Mutation_p.S126I|PJA1_uc004dxi.2_Missense_Mutation_p.S259I	NM_145119	NP_660095	Q8NG27	PJA1_HUMAN	praja 1 isoform a	314							zinc ion binding				0						GGGATAGCCACTTGAACTCTC	0.567													3	49	---	---	---	---	PASS
ZCCHC5	203430	broad.mit.edu	37	X	77913926	77913926	+	5'UTR	SNP	G	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77913926G>A	uc004edc.1	-	2						NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5								nucleic acid binding|zinc ion binding			ovary(1)	1						ATCTTTTGAGGAAATGGGTAT	0.453													10	15	---	---	---	---	PASS
GLA	2717	broad.mit.edu	37	X	100658843	100658843	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100658843C>G	uc004ehl.1	-	2	435	c.325G>C	c.(325-327)GAC>CAC	p.D109H	GLA_uc011mrj.1_Missense_Mutation_p.D109H	NM_000169	NP_000160	P06280	AGAL_HUMAN	alpha-galactosidase A precursor	109					glycoside catabolic process|glycosphingolipid catabolic process|glycosylceramide catabolic process|negative regulation of nitric oxide biosynthetic process|negative regulation of nitric-oxide synthase activity|oligosaccharide metabolic process	extracellular region|Golgi apparatus|lysosome	cation binding|protein homodimerization activity|raffinose alpha-galactosidase activity|receptor binding				0					Agalsidase beta(DB00103)	CGCTGAGGGTCTGCCTGAAGT	0.463													56	141	---	---	---	---	PASS
ARHGAP36	158763	broad.mit.edu	37	X	130218322	130218322	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130218322C>T	uc004evz.2	+	5	1034	c.689C>T	c.(688-690)CCG>CTG	p.P230L	ARHGAP36_uc004ewa.2_Missense_Mutation_p.P218L|ARHGAP36_uc004ewb.2_Missense_Mutation_p.P199L|ARHGAP36_uc004ewc.2_Missense_Mutation_p.P94L	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor	230	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						AGTCTCAATCCGATTGCGAAA	0.468													23	50	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151900161	151900161	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151900161C>T	uc010ntp.2	-	3	994	c.640G>A	c.(640-642)GAC>AAC	p.D214N	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Missense_Mutation_p.D214N	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	214	MAGE.									skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GGGGCACAGTCGCCCTCTTTT	0.582													60	181	---	---	---	---	PASS
AADACL4	343066	broad.mit.edu	37	1	12708365	12708366	+	Intron	INS	-	TCCT	TCCT	rs34475360		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12708365_12708366insTCCT	uc001auf.2	+							NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4							integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		TGGACCTCAGAtccttccttcc	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	67992275	67992276	+	IGR	INS	-	AG	AG			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67992275_67992276insAG								SERBP1 (96152 upstream) : GADD45A (158607 downstream)																							aaagaaagaaagaaagaaagaa	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	94871899	94871900	+	IGR	INS	-	G	G			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94871899_94871900insG								ARHGAP29 (131275 upstream) : ABCD3 (12033 downstream)																							TTGTTTTGTTTTTTTTTTTTTT	0.193													3	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144220693	144220694	+	Intron	INS	-	C	C			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144220693_144220694insC	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|uc010oxz.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						CTTTTTCTTTTTAAACAGTTCC	0.366													11	5	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151214277	151214277	+	Intron	DEL	A	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151214277delA	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron|PIP5K1A_uc010pcv.1_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			actccatctcaaaaaaaaaaa	0.184													6	3	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CATGTGTGGAGTTTTATAACTC	0.589													6	3	---	---	---	---	
TFDP2	7029	broad.mit.edu	37	3	141697191	141697192	+	Intron	DEL	AC	-	-	rs147134052	by1000genomes	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141697191_141697192delAC	uc003eun.3	-						TFDP2_uc003euk.3_Intron|TFDP2_uc010hur.2_Intron|TFDP2_uc003eul.3_Intron|TFDP2_uc011bnf.1_Intron|TFDP2_uc011bng.1_Intron|TFDP2_uc003eum.3_Intron	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization						cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						cgcctaaaaaacaaaaaaaaaG	0.158													10	6	---	---	---	---	
RUFY3	22902	broad.mit.edu	37	4	71588132	71588132	+	5'UTR	DEL	T	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71588132delT	uc003hfq.2	+	1					RUFY3_uc003hfp.3_Intron|RUFY3_uc011cax.1_5'UTR|RUFY3_uc003hfr.2_5'UTR	NM_014961	NP_055776	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 2						negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			GTATTTTTCCTTTTTTTTTTT	0.323													4	3	---	---	---	---	
NDST3	9348	broad.mit.edu	37	4	119163440	119163441	+	Intron	INS	-	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119163440_119163441insA	uc003ibx.2	+							NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						ATTAACCACGGAAAAAAAAAAC	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154050582	154050583	+	IGR	DEL	AT	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154050582_154050583delAT								FHDC1 (149734 upstream) : TRIM2 (23687 downstream)																							caccaccaccataccactacca	0.000													4	3	---	---	---	---	
UFSP2	55325	broad.mit.edu	37	4	186347090	186347091	+	5'UTR	INS	-	GC	GC			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186347090_186347091insGC	uc003ixo.2	-	1					UFSP2_uc003ixq.2_5'UTR|UFSP2_uc003ixp.2_RNA|uc003ixr.2_RNA	NM_018359	NP_060829	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2							endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		GCCCTGAAGTGGTGTCACCGCA	0.688													4	2	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70820367	70820368	+	Intron	INS	-	AAT	AAT	rs146090263	by1000genomes	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70820367_70820368insAAT	uc003kbp.1	+						BDP1_uc003kbo.2_Intron|BDP1_uc003kbq.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AGTGTAACAACGAGAGAAATCT	0.327													5	3	---	---	---	---	
C6orf106	64771	broad.mit.edu	37	6	34614822	34614823	+	Intron	INS	-	ACA	ACA	rs145923035	by1000genomes	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34614822_34614823insACA	uc003ojr.2	-						C6orf106_uc003ojs.2_Intron	NM_024294	NP_077270	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106 isoform a											skin(2)|ovary(1)	3						AGTTCCTCAAGACAAGTATTTC	0.450													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	2434621	2434622	+	IGR	DEL	AA	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2434621_2434622delAA								EIF3B (14246 upstream) : CHST12 (8601 downstream)																							tttttaagacaagagtctcctt	0.203													4	3	---	---	---	---	
C7orf59	389541	broad.mit.edu	37	7	99750774	99750774	+	Intron	DEL	A	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99750774delA	uc003utq.2	+							NM_001008395	NP_001008396	Q0VGL1	CG059_HUMAN	hypothetical protein LOC389541												0						ctcaaaaaagaaaaaaaaaaa	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131438392	131438392	+	IGR	DEL	T	-	-	rs144638874		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131438392delT								PODXL (197016 upstream) : PLXNA4 (369700 downstream)																							GCAAGCTTTCTTTTTTTTTTT	0.174													4	2	---	---	---	---	
DEFB105A	245908	broad.mit.edu	37	8	7681124	7681124	+	Intron	DEL	A	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7681124delA	uc011kwr.1	-						DEFB106A_uc003wru.1_5'Flank	NM_152250	NP_689463	Q8NG35	D105A_HUMAN	defensin, beta 105A precursor						defense response to bacterium	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		AACAAATTACAAAAAAAAAAA	0.378													5	3	---	---	---	---	
EBF2	64641	broad.mit.edu	37	8	25716167	25716168	+	Intron	DEL	CT	-	-	rs142028277		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25716167_25716168delCT	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		CCATCTTTAGCttttttttttt	0.287													4	2	---	---	---	---	
ZNF704	619279	broad.mit.edu	37	8	81742988	81742988	+	Intron	DEL	C	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81742988delC	uc003yby.1	-							NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704							intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			GTGtttctttctttttttttt	0.119													4	3	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121823372	121823372	+	Intron	DEL	C	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823372delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGCCACCCTTCCCCCCCCCCC	0.622													5	3	---	---	---	---	
C9orf11	54586	broad.mit.edu	37	9	27285130	27285131	+	Intron	DEL	CC	-	-	rs67807368		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27285130_27285131delCC	uc003zql.2	-						NCRNA00032_uc010mjd.1_5'Flank|C9orf11_uc011lnq.1_Intron	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1							acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		CTTTTCTTTTCCtttttttttt	0.129													4	2	---	---	---	---	
FRMPD1	22844	broad.mit.edu	37	9	37736882	37736883	+	Intron	DEL	GC	-	-	rs151329428		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37736882_37736883delGC	uc004aag.1	+						FRMPD1_uc004aah.1_Intron|FRMPD1_uc011lqm.1_Intron|FRMPD1_uc011lqn.1_Intron	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		gtgtatgtgtgCGCACACACAC	0.376													5	3	---	---	---	---	
TMEM2	23670	broad.mit.edu	37	9	74319306	74319306	+	Intron	DEL	A	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74319306delA	uc011lsa.1	-						TMEM2_uc011lrz.1_Intron|TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GACCACAGAGAAAAAAAAAGC	0.348													4	3	---	---	---	---	
TXN	7295	broad.mit.edu	37	9	113007320	113007322	+	Intron	DEL	GAA	-	-	rs144802558		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113007320_113007322delGAA	uc004bep.1	-						TXN_uc004beq.1_Intron	NM_003329	NP_003320	P10599	THIO_HUMAN	thioredoxin						cell proliferation|cell-cell signaling|cellular component movement|electron transport chain|glycerol ether metabolic process|nucleobase, nucleoside and nucleotide interconversion|positive regulation of DNA binding|regulation of protein import into nucleus, translocation|response to radiation|signal transduction|transcription, DNA-dependent|transport	cytosol|extracellular region|nucleoplasm	electron carrier activity|protein binding|protein disulfide oxidoreductase activity				0				OV - Ovarian serous cystadenocarcinoma(323;7.36e-07)		TATTCTCAATGAAGAAGTTTTAT	0.345													4	2	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113192403	113192404	+	Intron	INS	-	GT	GT	rs35386381	by1000genomes	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113192403_113192404insGT	uc010mtz.2	-						SVEP1_uc010mty.2_5'Flank	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ttttttttttGGTGTGTGTGTG	0.322													8	5	---	---	---	---	
SPTAN1	6709	broad.mit.edu	37	9	131347294	131347294	+	Intron	DEL	C	-	-	rs11382658		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131347294delC	uc004bvl.3	+						SPTAN1_uc011mbg.1_Intron|SPTAN1_uc011mbh.1_Intron|SPTAN1_uc004bvm.3_Intron|SPTAN1_uc004bvn.3_Intron	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1						actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						gcctgaatttctttttttttt	0.045													5	3	---	---	---	---	
LCN10	414332	broad.mit.edu	37	9	139635199	139635200	+	Intron	INS	-	TCCTGGG	TCCTGGG	rs145287279	by1000genomes	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139635199_139635200insTCCTGGG	uc010nbq.2	-						LCN10_uc004civ.2_Intron|LCN10_uc011med.1_Intron|LCN10_uc011mee.1_Intron|LCN10_uc011mef.1_Intron|LCN10_uc004ciw.2_Intron			Q6JVE6	LCN10_HUMAN	SubName: Full=LCN10 protein;						transport	extracellular region	binding			large_intestine(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		cccgcctcacctcctgcccggc	0.257													7	4	---	---	---	---	
FRMPD2	143162	broad.mit.edu	37	10	49382781	49382781	+	Intron	DEL	A	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49382781delA	uc001jgi.2	-						FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron|FRMPD2L1_uc001jgf.2_Intron|FRMPD2_uc001jgg.2_Intron|FRMPD2_uc001jgk.2_Intron	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		AATGGAAGAGAAAAAAAAAAC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													6	3	---	---	---	---	
NUCB2	4925	broad.mit.edu	37	11	17333790	17333790	+	Intron	DEL	T	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17333790delT	uc001mmw.2	+						NUCB2_uc009ygz.2_Intron	NM_005013	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2 precursor							cytosol|ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|plasma membrane	calcium ion binding|DNA binding				0						tttgtttttgttttttttttg	0.095													6	3	---	---	---	---	
DIP2B	57609	broad.mit.edu	37	12	51122130	51122130	+	Intron	DEL	A	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51122130delA	uc001rwv.2	+						DIP2B_uc009zlt.2_Intron	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						aactccatctaaaaaaaaaaa	0.124													5	3	---	---	---	---	
USP15	9958	broad.mit.edu	37	12	62715521	62715521	+	Intron	DEL	T	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62715521delT	uc001src.1	+						USP15_uc001srb.1_Intron|USP15_uc001sra.2_Intron	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15						protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ATCTCTTGTCTTTCCTTGCTG	0.338													5	5	---	---	---	---	
C12orf42	374470	broad.mit.edu	37	12	103696458	103696459	+	Intron	INS	-	A	A	rs76499737		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103696458_103696459insA	uc001tjt.2	-						C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Intron|C12orf42_uc001tju.2_Intron	NM_198521	NP_940923	Q96LP6	CL042_HUMAN	hypothetical protein LOC374470											ovary(1)|central_nervous_system(1)	2						AGAGGGGAAAGAAAAAAAAAAA	0.465													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110868215	110868216	+	IGR	DEL	GT	-	-	rs113592903		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110868215_110868216delGT								ANAPC7 (26680 upstream) : ARPC3 (4491 downstream)																							CAgtgtgtgcgtgtgtgtgtgt	0.342													4	2	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33752061	33752062	+	Intron	INS	-	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33752061_33752062insA	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		aggaaggaaggaaggaaggaag	0.000													4	2	---	---	---	---	
DGKH	160851	broad.mit.edu	37	13	42748077	42748078	+	Intron	INS	-	TG	TG	rs143667194	by1000genomes	TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42748077_42748078insTG	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron|DGKH_uc010tfi.1_Intron|DGKH_uc010tfj.1_Intron|DGKH_uc001uyn.1_Intron|DGKH_uc001uyo.1_Intron|DGKH_uc001uyp.2_Intron	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TAGTTCATGAAtgtgtgtgtgt	0.193													9	5	---	---	---	---	
CCNF	899	broad.mit.edu	37	16	2487904	2487905	+	Intron	INS	-	A	A			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2487904_2487905insA	uc002cqd.1	+						CCNF_uc002cqe.1_Intron	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F						cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				tgtttccctttaaaaaaaaaaa	0.252													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29096435	29096435	+	Intron	DEL	T	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29096435delT	uc010vct.1	-						RRN3P2_uc010vdm.1_Intron|RRN3P2_uc002dsf.3_Intron|RRN3P2_uc002dsg.3_Intron|RRN3P2_uc010vdn.1_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GAAAAATAACTTTTTTTATAG	0.279													4	2	---	---	---	---	
CLEC18A	348174	broad.mit.edu	37	16	69988604	69988605	+	Intron	INS	-	T	T			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69988604_69988605insT	uc010vlo.1	+						CLEC18C_uc002exy.2_Intron|CLEC18A_uc002exz.2_Intron|CLEC18A_uc002eya.2_Intron|CLEC18A_uc010vlp.1_Intron	NM_001136214	NP_001129686	A5D8T8	CL18A_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						TTTAGttttacttttttttttt	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74419886	74419887	+	Intron	DEL	TC	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74419886_74419887delTC	uc010vmt.1	+											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GGTtttcctttctctctttttt	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25754047	25754047	+	Intron	DEL	T	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25754047delT	uc002gzg.2	+											Homo sapiens similar to ubiquitin specific protease 6, mRNA (cDNA clone IMAGE:5168266), with apparent retained intron.																		GACGCTGTTCTTttttttttt	0.274													4	2	---	---	---	---	
UBTF	7343	broad.mit.edu	37	17	42284469	42284469	+	3'UTR	DEL	T	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42284469delT	uc002igb.2	-	20					UBTF_uc002igc.2_3'UTR|UBTF_uc010czs.2_3'UTR|UBTF_uc002igd.2_3'UTR|UBTF_uc010czt.2_3'UTR	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCCCACCGTATTTTTTTTTTT	0.562													6	3	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025826	64025829	+	Intron	DEL	AAAC	-	-	rs67867456		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025826_64025829delAAAC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gtctctaaataaacaaacaaacaa	0.123													5	3	---	---	---	---	
ACAA2	10449	broad.mit.edu	37	18	47318807	47318812	+	Intron	DEL	TTAATA	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47318807_47318812delTTAATA	uc002ldw.3	-						ACAA2_uc002ldx.3_Intron	NM_006111	NP_006102	P42765	THIM_HUMAN	acetyl-coenzyme A acyltransferase 2						anti-apoptosis|cholesterol biosynthetic process		acetyl-CoA C-acyltransferase activity|protein binding			ovary(1)	1						ACAGTCTACTTTAATATTGAGTCTTT	0.146													8	4	---	---	---	---	
CALR3	125972	broad.mit.edu	37	19	16590240	16590241	+	Intron	INS	-	A	A	rs150170208		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16590240_16590241insA	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0						accaaaaatacaaaaaaaaaaa	0.000													4	5	---	---	---	---	
MEGF8	1954	broad.mit.edu	37	19	42858270	42858271	+	Intron	INS	-	TT	TT	rs36065839		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42858270_42858271insTT	uc002otl.3	+						MEGF8_uc002otm.3_Intron	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8							integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				TAGTATTGCTGTTTTTTTTTTT	0.520													4	2	---	---	---	---	
TGM6	343641	broad.mit.edu	37	20	2374941	2374944	+	Intron	DEL	AAAC	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2374941_2374944delAAAC	uc002wfy.1	+						TGM6_uc010gal.1_Intron	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6						cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	ccctgtctcaaaacaaacaaacaa	0.181													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074811	62074813	+	Intron	DEL	CAC	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074811_62074813delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccatcaccatcaccaccatcacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	19649028	19649031	+	IGR	DEL	CCTC	-	-			TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19649028_19649031delCCTC								LOC150185 (94666 upstream) : SEPT5 (52956 downstream)																							CCATtttcttcctccctcccttcc	0.265													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151841	20151842	+	IGR	INS	-	CAC	CAC	rs10627070		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151841_20151842insCAC								ZDHHC8 (16312 upstream) : LOC150197 (42013 downstream)																							accaccaccatcaccaccacca	0.025													4	2	---	---	---	---	
OPHN1	4983	broad.mit.edu	37	X	67331931	67331932	+	Intron	DEL	AG	-	-	rs59924749		TCGA-C5-A1BM-01	TCGA-C5-A1BM-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67331931_67331932delAG	uc004dww.3	-						OPHN1_uc011mpg.1_Intron	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1						axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						acacacacacagagagagattc	0.074													10	6	---	---	---	---	
