Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTHFR	4524	broad.mit.edu	37	1	11854118	11854118	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11854118G>A	uc001atc.1	-	9	1560	c.1376C>T	c.(1375-1377)CCC>CTC	p.P459L	MTHFR_uc001atb.1_Missense_Mutation_p.P482L	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase	459					blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)	AGCCGCCAGGGGCTCATCGTT	0.647													45	65	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27106648	27106648	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27106648G>A	uc001bmv.1	+	20	6632	c.6259G>A	c.(6259-6261)GGA>AGA	p.G2087R	ARID1A_uc001bmu.1_Missense_Mutation_p.G1870R|ARID1A_uc001bmx.1_Missense_Mutation_p.G933R|ARID1A_uc009vsm.1_Missense_Mutation_p.G415R|ARID1A_uc009vsn.1_Missense_Mutation_p.G329R	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	2087	LXXLL.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGTCCTGGACGGACTCCTACA	0.592			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								43	87	---	---	---	---	PASS
ZSCAN20	7579	broad.mit.edu	37	1	33945298	33945298	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33945298G>T	uc001bxj.3	+	2	576	c.409G>T	c.(409-411)GGA>TGA	p.G137*	ZSCAN20_uc001bxk.2_Nonsense_Mutation_p.G137*|ZSCAN20_uc009vui.2_Nonsense_Mutation_p.G137*	NM_145238	NP_660281	P17040	ZSC20_HUMAN	zinc finger protein 31	137					viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CAGGACTGCAGGACAGTCGGT	0.557													3	9	---	---	---	---	PASS
RPAP2	79871	broad.mit.edu	37	1	92798963	92798963	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92798963C>G	uc001dot.2	+	9	1580	c.1471C>G	c.(1471-1473)CCA>GCA	p.P491A	RPAP2_uc009wdh.2_RNA	NM_024813	NP_079089	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	491						integral to membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		TTCCACCTTTCCACTGATAGA	0.333													45	73	---	---	---	---	PASS
CD244	51744	broad.mit.edu	37	1	160811119	160811119	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160811119T>C	uc009wtq.2	-	3	729	c.551A>G	c.(550-552)TAC>TGC	p.Y184C	CD244_uc001fxa.2_Missense_Mutation_p.Y179C|CD244_uc009wtp.2_RNA|CD244_uc009wtr.2_Intron|CD244_uc010pjt.1_RNA	NM_016382	NP_057466	Q9BZW8	CD244_HUMAN	CD244 natural killer cell receptor 2B4	184	Extracellular (Potential).|Ig-like 2.				blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CTCGTCCAGGTAGGTGAGGTT	0.522													65	123	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232626797	232626797	+	Silent	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232626797C>T	uc001hvg.2	-	3	1787	c.1629G>A	c.(1627-1629)CTG>CTA	p.L543L		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	543					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TTGCTCCTCTCAGTGTTGTAA	0.428													25	20	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201507422	201507422	+	Silent	SNP	A	C	C			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201507422A>C	uc002uvx.2	+	25	2846	c.2745A>C	c.(2743-2745)CCA>CCC	p.P915P	AOX1_uc010zhf.1_Silent_p.P471P|AOX1_uc010fsu.2_Silent_p.P281P	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	915					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CCAACCTTCCATCCAACACAG	0.498													19	61	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216272840	216272840	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216272840G>A	uc002vfa.2	-	17	2775	c.2509C>T	c.(2509-2511)CCC>TCC	p.P837S	FN1_uc002vfb.2_Missense_Mutation_p.P837S|FN1_uc002vfc.2_Missense_Mutation_p.P837S|FN1_uc002vfd.2_Missense_Mutation_p.P837S|FN1_uc002vfe.2_Missense_Mutation_p.P837S|FN1_uc002vff.2_Missense_Mutation_p.P837S|FN1_uc002vfg.2_Missense_Mutation_p.P837S|FN1_uc002vfh.2_Missense_Mutation_p.P837S|FN1_uc002vfi.2_Missense_Mutation_p.P837S|FN1_uc002vfj.2_Missense_Mutation_p.P837S	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	837	Fibronectin type-III 3.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCTGTGATGGGAGCCTGGGGT	0.527													75	42	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216272872	216272872	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216272872G>C	uc002vfa.2	-	17	2743	c.2477C>G	c.(2476-2478)TCA>TGA	p.S826*	FN1_uc002vfb.2_Nonsense_Mutation_p.S826*|FN1_uc002vfc.2_Nonsense_Mutation_p.S826*|FN1_uc002vfd.2_Nonsense_Mutation_p.S826*|FN1_uc002vfe.2_Nonsense_Mutation_p.S826*|FN1_uc002vff.2_Nonsense_Mutation_p.S826*|FN1_uc002vfg.2_Nonsense_Mutation_p.S826*|FN1_uc002vfh.2_Nonsense_Mutation_p.S826*|FN1_uc002vfi.2_Nonsense_Mutation_p.S826*|FN1_uc002vfj.2_Nonsense_Mutation_p.S826*	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	826	Fibronectin type-III 3.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AACAACAATTGAGGTGTCATC	0.522													73	55	---	---	---	---	PASS
CBLB	868	broad.mit.edu	37	3	105464807	105464807	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105464807C>T	uc003dwc.2	-	6	1121	c.799G>A	c.(799-801)GAT>AAT	p.D267N	CBLB_uc011bhi.1_Missense_Mutation_p.D289N|CBLB_uc003dwd.1_Missense_Mutation_p.D267N|CBLB_uc003dwe.1_Missense_Mutation_p.D267N|CBLB_uc011bhj.1_RNA	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	267	Cbl-PTB.|SH2-like.				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						TTAACTTCATCATATGTGAGA	0.343			Mis S		AML								92	145	---	---	---	---	PASS
C3orf15	89876	broad.mit.edu	37	3	119462963	119462963	+	Missense_Mutation	SNP	C	T	T	rs139653997		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119462963C>T	uc003ede.3	+	14	1899	c.1822C>T	c.(1822-1824)CGG>TGG	p.R608W	C3orf15_uc010hqz.2_Missense_Mutation_p.R546W|C3orf15_uc011bjd.1_Missense_Mutation_p.R482W|C3orf15_uc011bje.1_Missense_Mutation_p.R588W	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	444						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		GCGCCAGCGGCGGGTACGAGA	0.587													39	54	---	---	---	---	PASS
GK5	256356	broad.mit.edu	37	3	141900366	141900366	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141900366C>T	uc003euq.1	-	11	1116	c.985G>A	c.(985-987)GTA>ATA	p.V329I	GK5_uc003eup.1_Missense_Mutation_p.V50I|GK5_uc010hus.1_RNA	NM_001039547	NP_001034636	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)	329					glycerol metabolic process		ATP binding|glycerol kinase activity				0						GCTAAGCATACGACTTCTTGC	0.383													49	68	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13600774	13600774	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13600774T>C	uc003gmz.1	-	10	7867	c.7750A>G	c.(7750-7752)ATG>GTG	p.M2584V	BOD1L_uc010idr.1_Missense_Mutation_p.M1921V	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	2584							DNA binding			ovary(5)|breast(1)	6						GGAGGGATCATTGTGTGGGAA	0.438													32	58	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96762017	96762017	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96762017A>T	uc003htr.3	+	1	779	c.716A>T	c.(715-717)GAT>GTT	p.D239V		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	239					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	GCCAGCCCTGATTACTACAAG	0.423													43	61	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121774626	121774626	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121774626G>A	uc003idn.2	-	3	497	c.247C>T	c.(247-249)CGC>TGC	p.R83C	PRDM5_uc003ido.2_Missense_Mutation_p.R83C|PRDM5_uc010ine.2_Missense_Mutation_p.R83C|PRDM5_uc010inf.2_Missense_Mutation_p.R83C|PRDM5_uc003idp.1_Missense_Mutation_p.R83C	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	83	SET.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						TGAACGAAGCGAAGCCAGTTG	0.468													127	427	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153245393	153245393	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153245393C>T	uc003ims.2	-	11	1947	c.1798G>A	c.(1798-1800)GAT>AAT	p.D600N	FBXW7_uc011cii.1_Missense_Mutation_p.D600N|FBXW7_uc003imt.2_Missense_Mutation_p.D600N|FBXW7_uc011cih.1_Missense_Mutation_p.D424N|FBXW7_uc003imq.2_Missense_Mutation_p.D520N|FBXW7_uc003imr.2_Missense_Mutation_p.D482N	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	600	WD 6.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ACTGTAGAATCTGCATTCCCA	0.388			Mis|N|D|F		colorectal|endometrial|T-ALL								41	13	---	---	---	---	PASS
WDR70	55100	broad.mit.edu	37	5	37479924	37479924	+	Intron	SNP	C	G	G			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37479924C>G	uc003jkv.2	+						WDR70_uc010iva.1_Intron	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70											ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTTTCCTTTTCTTTTCGTACA	0.338													102	95	---	---	---	---	PASS
OPRM1	4988	broad.mit.edu	37	6	154567919	154567919	+	Nonstop_Mutation	SNP	G	C	C			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154567919G>C	uc003qpt.1	+	4	1494	c.1257G>C	c.(1255-1257)TAG>TAC	p.*419Y	IPCEF1_uc003qpw.2_Intron|IPCEF1_uc003qpx.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_001008503	NP_001008503	P35372	OPRM_HUMAN	opioid receptor, mu 1 isoform MOR-1O	419					behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)	TGAAGAGGTAGATAATGTATT	0.428													29	36	---	---	---	---	PASS
PAPOLB	56903	broad.mit.edu	37	7	4901303	4901303	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4901303G>A	uc003snk.2	-	1	323	c.139C>T	c.(139-141)CTC>TTC	p.L47F	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	46					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		AAGGGCCTGAGGGTTTCTATT	0.542													6	21	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94052321	94052321	+	Missense_Mutation	SNP	G	A	A	rs147655324		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94052321G>A	uc003ung.1	+	40	2927	c.2456G>A	c.(2455-2457)CGT>CAT	p.R819H	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	819			Missing (in OI2A).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GAAGGGCTTCGTGGTCCTCGT	0.562										HNSCC(75;0.22)			55	144	---	---	---	---	PASS
EZH2	2146	broad.mit.edu	37	7	148515119	148515119	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148515119G>A	uc003wfd.1	-	10	1241	c.1075C>T	c.(1075-1077)CCC>TCC	p.P359S	EZH2_uc011kug.1_Missense_Mutation_p.P350S|EZH2_uc003wfb.1_Missense_Mutation_p.P364S|EZH2_uc003wfc.1_Missense_Mutation_p.P320S|EZH2_uc011kuh.1_Missense_Mutation_p.P350S|EZH2_uc011kui.1_Missense_Mutation_p.P359S|EZH2_uc011kuj.1_RNA	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	359					negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CTGTTATTGGGAAGCCGTCCT	0.547			Mis		DLBCL								40	86	---	---	---	---	PASS
ZNF777	27153	broad.mit.edu	37	7	149129368	149129368	+	Silent	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149129368C>T	uc003wfv.2	-	6	2158	c.1995G>A	c.(1993-1995)ACG>ACA	p.T665T		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	665	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			ACTCGGGGCACGTGTAGGGCC	0.612													78	78	---	---	---	---	PASS
CYP7B1	9420	broad.mit.edu	37	8	65509397	65509397	+	Silent	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65509397C>T	uc003xvj.2	-	6	1527	c.1323G>A	c.(1321-1323)CCG>CCA	p.P441P		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,	441					bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				CAGTTCCAAACGGCATTAGGT	0.333													25	76	---	---	---	---	PASS
SPAG1	6674	broad.mit.edu	37	8	101174635	101174635	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101174635C>A	uc003yjh.1	+	2	213	c.127C>A	c.(127-129)CTT>ATT	p.L43I	SPAG1_uc003yjg.1_Missense_Mutation_p.L43I|SPAG1_uc003yji.1_Missense_Mutation_p.L43I	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1	43					single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		GGAAAAAATTCTTTGCGTGCT	0.299													20	37	---	---	---	---	PASS
KANK1	23189	broad.mit.edu	37	9	731209	731209	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:731209G>A	uc003zgl.1	+	9	3597	c.2948G>A	c.(2947-2949)GGT>GAT	p.G983D	KANK1_uc003zgm.2_3'UTR|KANK1_uc003zgn.1_Missense_Mutation_p.G983D|KANK1_uc003zgs.1_Missense_Mutation_p.G825D|KANK1_uc010mgx.1_5'Flank|KANK1_uc010mgy.1_5'Flank	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a	983					negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		AAGAAAGATGGTAACAAAGAT	0.378													16	34	---	---	---	---	PASS
PTAR1	375743	broad.mit.edu	37	9	72365756	72365756	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72365756G>C	uc004ahj.3	-	2	219	c.197C>G	c.(196-198)CCA>CGA	p.P66R	PTAR1_uc004ahi.2_Intron	NM_001099666	NP_001093136	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat	66					protein prenylation		protein prenyltransferase activity			central_nervous_system(1)	1						GTGGACATATGGTAAAAGGAA	0.428													8	23	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79465412	79465412	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79465412G>A	uc010mpk.2	-	3	435	c.311C>T	c.(310-312)TCG>TTG	p.S104L	PRUNE2_uc004akn.2_Missense_Mutation_p.S104L	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	104					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						AAGTGTTATCGATAACTTCCC	0.423													73	52	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68280427	68280427	+	Silent	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68280427G>A	uc009xpn.1	-	11	1602	c.1479C>T	c.(1477-1479)CTC>CTT	p.L493L	CTNNA3_uc001jmw.2_Silent_p.L493L|CTNNA3_uc001jmx.3_Silent_p.L493L	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	493					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						CGGCTTCAGTGAGGACATGTA	0.368													127	75	---	---	---	---	PASS
SLC22A8	9376	broad.mit.edu	37	11	62762218	62762218	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62762218C>T	uc001nwo.2	-	8	1148	c.1012G>A	c.(1012-1014)GGT>AGT	p.G338S	SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_Missense_Mutation_p.G338S|SLC22A8_uc009yom.2_Missense_Mutation_p.G215S|SLC22A8_uc010rmm.1_Missense_Mutation_p.G247S|SLC22A8_uc009yon.2_Missense_Mutation_p.G338S	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8	338	Helical; (Potential).				response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						TAGGCAAAACCGGTAGCAAAC	0.488													28	41	---	---	---	---	PASS
THY1	7070	broad.mit.edu	37	11	119290224	119290224	+	Missense_Mutation	SNP	A	C	C	rs147718110		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119290224A>C	uc001pwq.2	-	3	414	c.380T>G	c.(379-381)CTG>CGG	p.L127R	uc001pwo.2_Intron|uc001pwp.1_Intron|THY1_uc001pwr.2_Missense_Mutation_p.L127R|THY1_uc001pws.2_RNA	NM_006288	NP_006279	P04216	THY1_HUMAN	Thy-1 cell surface antigen preproprotein	127					angiogenesis|cell-cell adhesion|cytoskeleton organization|focal adhesion assembly|negative regulation of axonogenesis|negative regulation of cell migration|negative regulation of protein kinase activity|negative regulation of T cell receptor signaling pathway|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell activation|retinal cone cell development|T cell receptor signaling pathway	endoplasmic reticulum|growth cone|integral to plasma membrane|membrane raft	GPI anchor binding|integrin binding|Rho GTPase activator activity				0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		ACACTTGACCAGTTTGTCTGC	0.602													32	29	---	---	---	---	PASS
TAS2R19	259294	broad.mit.edu	37	12	11174585	11174585	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11174585G>C	uc010shj.1	-	1	586	c.586C>G	c.(586-588)CTG>GTG	p.L196V	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176888	NP_795369	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	196	Helical; Name=5; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1						ATTAACAGCAGAAAACATATT	0.403													99	83	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12337018	12337018	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12337018C>G	uc001rah.3	-	5	1014	c.872G>C	c.(871-873)GGG>GCG	p.G291A	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.G291A	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	291	Extracellular (Potential).|EGF-like 1.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				GGAACAACCCCCATTGTCAAT	0.388													31	64	---	---	---	---	PASS
EIF4B	1975	broad.mit.edu	37	12	53421858	53421858	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53421858G>A	uc001sbh.3	+	8	1071	c.865G>A	c.(865-867)GAT>AAT	p.D289N	EIF4B_uc010snu.1_Missense_Mutation_p.D289N|EIF4B_uc010snv.1_Missense_Mutation_p.D250N|EIF4B_uc001sbi.2_Missense_Mutation_p.D41N	NM_001417	NP_001408	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	289	Arg-rich.|Asp-rich.				insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2						TCGCAGGGATGATGACTACAG	0.502													27	67	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70681587	70681587	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70681587G>A	uc001vip.2	-	1	1039	c.245C>T	c.(244-246)CCG>CTG	p.P82L	KLHL1_uc010thm.1_Missense_Mutation_p.P82L|ATXN8OS_uc010aej.1_RNA	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	82	Ser-rich.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ggaagaggacggggaggacga	0.453													35	51	---	---	---	---	PASS
PSEN1	5663	broad.mit.edu	37	14	73637568	73637568	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73637568T>C	uc001xnr.2	+	4	435	c.151T>C	c.(151-153)TCT>CCT	p.S51P	PSEN1_uc001xnv.2_Missense_Mutation_p.S47P|PSEN1_uc010ark.2_Missense_Mutation_p.S47P|PSEN1_uc001xnt.1_RNA|PSEN1_uc001xnu.2_RNA|PSEN1_uc001xnq.3_Missense_Mutation_p.S51P	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467	51	Cytoplasmic (Potential).				amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TGAGCCATTATCTAATGGACG	0.478													17	28	---	---	---	---	PASS
CYFIP1	23191	broad.mit.edu	37	15	22990062	22990062	+	Silent	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22990062G>A	uc001yus.2	+	24	2786	c.2682G>A	c.(2680-2682)TTG>TTA	p.L894L	CYFIP1_uc001yut.2_Silent_p.L894L|CYFIP1_uc010aya.1_Silent_p.L922L|CYFIP1_uc001yuu.2_Silent_p.L463L|CYFIP1_uc001yuv.2_Silent_p.L88L	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform	894					axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TCCAGGCTTTGAACTTGGCCT	0.547													27	93	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48056038	48056038	+	Intron	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48056038G>A	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GCTTCTATCCGTTGGGCAGGC	0.458													90	97	---	---	---	---	PASS
KIAA1370	56204	broad.mit.edu	37	15	52901518	52901518	+	Silent	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52901518C>T	uc002acg.3	-	6	1746	c.1593G>A	c.(1591-1593)TTG>TTA	p.L531L	KIAA1370_uc002ach.3_RNA|KIAA1370_uc010bfg.1_Silent_p.L443L|KIAA1370_uc010ugf.1_Silent_p.L538L	NM_019600	NP_062546	Q32MH5	K1370_HUMAN	hypothetical protein LOC56204	531											0				all cancers(107;0.0803)		TATTTTTCTTCAACAAATTTT	0.378													74	51	---	---	---	---	PASS
MCTP2	55784	broad.mit.edu	37	15	94899542	94899542	+	Intron	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94899542C>T	uc002btj.2	+						MCTP2_uc010urg.1_Intron|MCTP2_uc002bti.2_Intron|MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btk.3_Intron|MCTP2_uc002btl.2_Intron	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TAAGTTCCATCTTTTCCATAA	0.333													17	40	---	---	---	---	PASS
PITPNM3	83394	broad.mit.edu	37	17	6387600	6387600	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6387600C>T	uc002gdd.3	-	5	438	c.287G>A	c.(286-288)CGG>CAG	p.R96Q	PITPNM3_uc010cln.2_Missense_Mutation_p.R60Q|PITPNM3_uc002gdc.3_5'Flank	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1	96					phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CAAGGAAACCCGGTACAGTTC	0.597													49	96	---	---	---	---	PASS
NEURL4	84461	broad.mit.edu	37	17	7230490	7230490	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7230490G>A	uc002gga.1	-	3	794	c.787C>T	c.(787-789)CAT>TAT	p.H263Y	NEURL4_uc002ggb.1_Missense_Mutation_p.H263Y|NEURL4_uc002ggc.1_5'Flank	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1	263							protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						TCACCATTATGCGACTCAAGG	0.632													12	15	---	---	---	---	PASS
CCL23	6368	broad.mit.edu	37	17	34340828	34340828	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34340828C>G	uc002hkt.1	-	3	278	c.207G>C	c.(205-207)GAG>GAC	p.E69D	CCL23_uc002hks.1_Missense_Mutation_p.E86D	NM_145898	NP_665905	P55773	CCL23_HUMAN	small inducible cytokine A23 isoform CKbeta8	69					cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|negative regulation of cell proliferation	extracellular space	chemokine activity|heparin binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	Treprostinil(DB00374)	CAAAGTAACTCTCCAGGAGTG	0.522													38	31	---	---	---	---	PASS
CCL23	6368	broad.mit.edu	37	17	34340871	34340871	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34340871C>T	uc002hkt.1	-	3	235	c.164G>A	c.(163-165)TGC>TAC	p.C55Y	CCL23_uc002hks.1_Missense_Mutation_p.C72Y	NM_145898	NP_665905	P55773	CCL23_HUMAN	small inducible cytokine A23 isoform CKbeta8	55					cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|negative regulation of cell proliferation	extracellular space	chemokine activity|heparin binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	Treprostinil(DB00374)	GTAGGAGATGCAGCAGTCAGC	0.537													38	39	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75186917	75186917	+	Silent	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75186917G>A	uc002jto.2	+	4	363	c.96G>A	c.(94-96)TTG>TTA	p.L32L	SEC14L1_uc010dhc.2_Silent_p.L32L|SEC14L1_uc010wth.1_Silent_p.L32L|SEC14L1_uc002jtm.2_Silent_p.L32L|SEC14L1_uc010wti.1_5'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	32	PRELI/MSF1.				transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						CATGTCCTTTGATTCCGATGT	0.458													60	110	---	---	---	---	PASS
SMAD4	4089	broad.mit.edu	37	18	48575080	48575080	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48575080C>T	uc010xdp.1	+	3	812	c.274C>T	c.(274-276)CAT>TAT	p.H92Y	SMAD4_uc010xdo.1_RNA	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	92	MH1.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(4)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		AGGATTTCCTCATGTGATCTA	0.264									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				39	13	---	---	---	---	PASS
OLFM2	93145	broad.mit.edu	37	19	9965242	9965242	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9965242C>T	uc002mmp.2	-	6	1013	c.985G>A	c.(985-987)GAG>AAG	p.E329K	OLFM2_uc002mmo.2_Missense_Mutation_p.E251K	NM_058164	NP_477512	O95897	NOE2_HUMAN	olfactomedin 2 precursor	329	Olfactomedin-like.					extracellular region				large_intestine(1)|skin(1)	2						AGCCCGCTCTCGTCCACCATG	0.652													25	38	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30935510	30935510	+	Silent	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935510C>T	uc002nsu.1	+	2	1179	c.1041C>T	c.(1039-1041)TGC>TGT	p.C347C	ZNF536_uc010edd.1_Silent_p.C347C	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	347	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AGTTCCGCTGCGAGGTGTGCG	0.652													48	78	---	---	---	---	PASS
CDC42EP1	11135	broad.mit.edu	37	22	37964251	37964251	+	Silent	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37964251C>T	uc003asz.3	+	3	1003	c.600C>T	c.(598-600)CTC>CTT	p.L200L		NM_152243	NP_689449	Q00587	BORG5_HUMAN	CDC42 effector protein 1	200					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|endomembrane system|Golgi apparatus|plasma membrane	protein binding				0	Melanoma(58;0.0574)					GCCTGGACCTCGACCTTGGGC	0.667													57	56	---	---	---	---	PASS
TMEM47	83604	broad.mit.edu	37	X	34657409	34657409	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34657409G>A	uc004ddh.2	-	2	581	c.322C>T	c.(322-324)CGA>TGA	p.R108*	TMEM47_uc010ngs.2_RNA	NM_031442	NP_113630	Q9BQJ4	TMM47_HUMAN	transmembrane protein 47	108						integral to membrane				lung(1)	1						AAACGCCTTCGAGATCCCACG	0.448													7	16	---	---	---	---	PASS
ZC3H12B	340554	broad.mit.edu	37	X	64717050	64717050	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64717050A>G	uc010nko.2	+	2	623	c.614A>G	c.(613-615)CAA>CGA	p.Q205R		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	205							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						AGAGGAATACAACTTGCTGTG	0.388													30	23	---	---	---	---	PASS
MAMLD1	10046	broad.mit.edu	37	X	149638349	149638349	+	Silent	SNP	C	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149638349C>T	uc004fee.1	+	3	580	c.504C>T	c.(502-504)AGC>AGT	p.S168S	MAMLD1_uc011mxt.1_Silent_p.S130S|MAMLD1_uc011mxu.1_Silent_p.S143S|MAMLD1_uc011mxv.1_Silent_p.S143S|MAMLD1_uc011mxw.1_Silent_p.S95S	NM_005491	NP_005482	Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	168					male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					AAATCAACAGCGTGCCGGCTG	0.478													10	106	---	---	---	---	PASS
PAX7	5081	broad.mit.edu	37	1	19071367	19071367	+	Frame_Shift_Del	DEL	G	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19071367delG	uc010oct.1	+	9	2060	c.1462delG	c.(1462-1464)GGGfs	p.G488fs		NM_001135254	NP_001128726	P23759	PAX7_HUMAN	paired box 7 isoform 3	Error:Variant_position_missing_in_P23759_after_alignment					anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CATGAAGCTCGGGGAGCACTC	0.567			T	FOXO1A	alveolar rhabdomyosarcoma								4	2	---	---	---	---	
RNF19B	127544	broad.mit.edu	37	1	33416744	33416745	+	Intron	INS	-	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33416744_33416745insT	uc010oho.1	-						RNF19B_uc001bwm.3_Intron|RNF19B_uc010ohp.1_Intron	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B isoform a							integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				agccTTTTTCATTTTTTTTCTT	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	94871896	94871896	+	IGR	DEL	G	-	-	rs12091363		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94871896delG								ARHGAP29 (131272 upstream) : ABCD3 (12037 downstream)																							aTTTTGTTTTGTTTTTTTTTT	0.184													2	7	---	---	---	---	
PBX1	5087	broad.mit.edu	37	1	164719382	164719383	+	Intron	INS	-	GT	GT			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164719382_164719383insGT	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						GGGGCTAGTTGgtgtgtgtgtg	0.193			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								4	2	---	---	---	---	
SPAST	6683	broad.mit.edu	37	2	32340026	32340027	+	Intron	INS	-	T	T	rs67016851		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32340026_32340027insT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ATAAAGTTAAAttttttttttt	0.114													16	8	---	---	---	---	
SRBD1	55133	broad.mit.edu	37	2	45645816	45645816	+	Intron	DEL	A	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45645816delA	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AAGGGAGTTTaaaaaaaaaaa	0.199													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	128824753	128824754	+	IGR	INS	-	A	A	rs113610724		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128824753_128824754insA								SAP130 (39120 upstream) : UGGT1 (24000 downstream)																							agactccatctaaaaaaaaaaa	0.173													4	2	---	---	---	---	
ITGA6	3655	broad.mit.edu	37	2	173368989	173368990	+	3'UTR	INS	-	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173368989_173368990insA	uc002uhp.1	+	25					ITGA6_uc010zdy.1_3'UTR|ITGA6_uc002uho.1_3'UTR|ITGA6_uc010fqm.1_3'UTR	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a						blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AGCGGGGGCCTAAAAAAAAAAA	0.376													5	3	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225668718	225668719	+	Intron	DEL	TG	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225668718_225668719delTG	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AATAGAAATAtgtgtgtgtgtg	0.282													8	4	---	---	---	---	
IQSEC1	9922	broad.mit.edu	37	3	13065983	13065986	+	Intron	DEL	ATCT	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13065983_13065986delATCT	uc011auw.1	-							NM_001134382	NP_001127854	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform a						regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						ccatccatccatctgtccatccat	0.088													1	5	---	---	---	---	
SATB1	6304	broad.mit.edu	37	3	18458183	18458183	+	Intron	DEL	A	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18458183delA	uc003cbh.2	-						SATB1_uc003cbi.2_Intron|SATB1_uc003cbj.2_Intron	NM_002971	NP_002962	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1						cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						GAAGTAATTTAAAAAAAAAAT	0.373													4	2	---	---	---	---	
PROK2	60675	broad.mit.edu	37	3	71821711	71821711	+	3'UTR	DEL	A	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71821711delA	uc003dpa.3	-	4					PROK2_uc003doz.3_3'UTR	NM_001126128	NP_001119600	Q9HC23	PROK2_HUMAN	prokineticin 2 isoform a precursor						activation of MAPK activity|angiogenesis|anti-apoptosis|cell proliferation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response|neuropeptide signaling pathway|positive regulation of smooth muscle contraction|sensory perception of pain|spermatogenesis	extracellular region	G-protein-coupled receptor binding				0		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		CTCTTTCGATAAAAAAAAAAA	0.299													6	3	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113165656	113165657	+	Intron	INS	-	A	A	rs138860348	by1000genomes	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113165656_113165657insA	uc003eag.3	-						CCDC52_uc003eaf.3_Intron	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						TCCAACGAGGTAAATTATTTGT	0.243													3	3	---	---	---	---	
C5orf44	80006	broad.mit.edu	37	5	64948170	64948171	+	Intron	INS	-	C	C	rs72764462	by1000genomes	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64948170_64948171insC	uc003jtz.3	+						C5orf44_uc003jua.3_Intron|C5orf44_uc003juc.3_Intron|C5orf44_uc010iwv.2_Intron	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2											ovary(1)	1						tcttttcttttttttttttttt	0.158													3	3	---	---	---	---	
NLN	57486	broad.mit.edu	37	5	65081432	65081433	+	Intron	INS	-	A	A	rs10542542		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65081432_65081433insA	uc003juf.2	+						NLN_uc003jue.2_Intron|NLN_uc003jug.2_Intron|NLN_uc010iww.2_5'Flank	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor						proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		ATCATGAATCCAAAAAAAAAAA	0.248													4	2	---	---	---	---	
DMXL1	1657	broad.mit.edu	37	5	118510896	118510896	+	Intron	DEL	G	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118510896delG	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATTAGGTCTTGAAAAAAAATC	0.269													16	22	---	---	---	---	
ALDH7A1	501	broad.mit.edu	37	5	125885821	125885822	+	Intron	INS	-	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125885821_125885822insT	uc003ktx.2	-						ALDH7A1_uc003ktv.2_Intron|ALDH7A1_uc003kty.2_Intron|ALDH7A1_uc011cxa.1_Intron	NM_001182	NP_001173	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1						cellular aldehyde metabolic process|lysine catabolic process|sensory perception of sound	cytosol|mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity|betaine-aldehyde dehydrogenase activity|L-aminoadipate-semialdehyde dehydrogenase activity			kidney(2)|ovary(1)	3		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)	NADH(DB00157)|Pyridoxine(DB00165)	GACTACAGCAGTTTTTTTAAGT	0.312													37	19	---	---	---	---	
AFF4	27125	broad.mit.edu	37	5	132234183	132234183	+	Intron	DEL	T	-	-	rs67779737		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132234183delT	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tcttcttgtcttttttttttt	0.119													9	6	---	---	---	---	
HNRNPH1	3187	broad.mit.edu	37	5	179045488	179045489	+	Intron	INS	-	A	A	rs143326702	by1000genomes	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179045488_179045489insA	uc003mkf.3	-						HNRNPH1_uc011dgn.1_5'Flank|HNRNPH1_uc003mkg.3_Intron|HNRNPH1_uc003mke.3_Intron|HNRNPH1_uc003mkh.3_Intron	NM_005520	NP_005511	P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1						regulation of RNA splicing	actin cytoskeleton|catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|poly(U) RNA binding|protein binding				0						ACCAGAAATTCACTCAATAAAT	0.332													5	4	---	---	---	---	
HIST1H2BL	8340	broad.mit.edu	37	6	27778338	27778339	+	5'Flank	DEL	TC	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27778338_27778339delTC	uc003njl.2	-							NM_003519	NP_003510	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl						nucleosome assembly	nucleosome|nucleus	DNA binding				0						AAGATCTGTTTCTCTCAGGAAT	0.470													9	5	---	---	---	---	
MUC21	394263	broad.mit.edu	37	6	30955765	30955765	+	Intron	DEL	T	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30955765delT	uc003nsh.2	+						MUC21_uc003nsi.1_Intron	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor							integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CTATTGACTCTTCTTTTTTTA	0.498													78	51	---	---	---	---	
SLC22A16	85413	broad.mit.edu	37	6	110759758	110759764	+	Intron	DEL	ATATAAC	-	-	rs138799996	byFrequency	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110759758_110759764delATATAAC	uc003puf.2	-						SLC22A16_uc003pue.2_Intron	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN	solute carrier family 22, member 16						acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity			ovary(1)	1		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)		tatattacttatataacagaaaaagaa	0.111													5	4	---	---	---	---	
RFX6	222546	broad.mit.edu	37	6	117239025	117239028	+	Intron	DEL	CACT	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117239025_117239028delCACT	uc003pxm.2	+							NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6						glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						TTGTCATACACACTCACACACAAC	0.314													6	3	---	---	---	---	
ZMIZ2	83637	broad.mit.edu	37	7	44798683	44798684	+	Intron	INS	-	AA	AA	rs71563954		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44798683_44798684insAA	uc003tlr.2	+						ZMIZ2_uc003tlq.2_Intron|ZMIZ2_uc003tls.2_Intron|ZMIZ2_uc003tlt.2_5'Flank|ZMIZ2_uc010kyj.2_5'Flank	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						tgtctcaaattaaaaaaaaaaa	0.198													12	6	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151873935	151873954	+	Frame_Shift_Del	DEL	GTCTTTTCTCCATCATTTAG	-	-	rs148752146		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151873935_151873954delGTCTTTTCTCCATCATTTAG	uc003wla.2	-	38	8803_8822	c.8584_8603delCTAAATGATGGAGAAAAGAC	c.(8584-8604)CTAAATGATGGAGAAAAGACTfs	p.L2862fs	MLL3_uc003wkz.2_Frame_Shift_Del_p.L1923fs|MLL3_uc003wky.2_Frame_Shift_Del_p.L371fs	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2862_2868					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ATGCAAAGAAGTCTTTTCTCCATCATTTAGGTCTGAGTGA	0.405			N		medulloblastoma								106	52	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3443840	3443841	+	Intron	INS	-	A	A	rs11463049		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3443840_3443841insA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACTTCTTTAGGAAAAAAAAAAA	0.342													3	7	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100403604	100403604	+	Intron	DEL	A	-	-	rs74650444		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100403604delA	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGAGAGAGAGAAAAAAAAAAG	0.328													4	2	---	---	---	---	
BAALC	79870	broad.mit.edu	37	8	104183511	104183512	+	Intron	INS	-	AGAG	AGAG	rs142506224	by1000genomes	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104183511_104183512insAGAG	uc003yld.2	+						BAALC_uc003yle.2_Intron|uc003ylf.2_Intron|uc010mcb.1_Intron	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			aaaagaaagaaagagagaaGGA	0.084													6	5	---	---	---	---	
YME1L1	10730	broad.mit.edu	37	10	27434219	27434219	+	Intron	DEL	A	-	-	rs72362930		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27434219delA	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN	YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1						gaaaaattGCAAAAAAAAAAA	0.159													4	3	---	---	---	---	
COL13A1	1305	broad.mit.edu	37	10	71640182	71640182	+	Intron	DEL	G	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71640182delG	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron|COL13A1_uc001jqk.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	ccttccctttggttcctctct	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130262702	130262703	+	IGR	INS	-	A	A	rs66538679		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130262702_130262703insA								MKI67 (338234 upstream) : None (None downstream)																							cctcctcctccccatccttccc	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	49785470	49785471	+	IGR	INS	-	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49785470_49785471insA								FNDC3A (1556 upstream) : MLNR (9003 downstream)																							aaaatgataataaaaaaaaaaa	0.213													2	5	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92839211	92839212	+	Intron	INS	-	CCTTCCTT	CCTTCCTT			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92839211_92839212insCCTTCCTT	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GGGTCACTGTCccttccttcct	0.168													4	2	---	---	---	---	
EVL	51466	broad.mit.edu	37	14	100607736	100607737	+	Intron	INS	-	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100607736_100607737insA	uc001ygt.2	+						EVL_uc001ygu.2_Intron|EVL_uc010avu.2_Intron|EVL_uc001ygw.1_5'Flank	NM_016337	NP_057421	Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)				AGGGGGTGCCCAAGCCTGTCCT	0.649													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102989826	102989837	+	IGR	DEL	AGGGAGGAAGGA	-	-	rs11626505	by1000genomes	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102989826_102989837delAGGGAGGAAGGA								ANKRD9 (13698 upstream) : RCOR1 (69396 downstream)																							ggagggagggagggaggaaggaaggaaggaag	0.255													4	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106573171	106573171	+	Intron	DEL	C	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106573171delC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CCCTGGTGGTCCCAAGGGACC	0.667													11	7	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28525479	28525480	+	Intron	DEL	CA	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28525479_28525480delCA	uc001zbj.2	-						HERC2_uc001zbl.1_Intron	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACAATGTGGCCACAGTTTGTTG	0.347													13	18	---	---	---	---	
BNIP2	663	broad.mit.edu	37	15	59963272	59963273	+	Intron	INS	-	A	A	rs71425880		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59963272_59963273insA	uc010uhc.1	-						BNIP2_uc002agi.3_5'Flank|BNIP2_uc010uhb.1_Intron	NM_004330	NP_004321	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 2						anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding			ovary(1)	1						aactccgtctcaaaaaaaaaaa	0.099													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78202278	78202278	+	IGR	DEL	C	-	-	rs71145877		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78202278delC								LINGO1 (213803 upstream) : LOC645752 (4281 downstream)																							TTGACAGTGGCTCCCCCAGCC	0.577													4	4	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74394379	74394380	+	Intron	INS	-	A	A	rs142790741	by1000genomes	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394379_74394380insA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						TAGTCATCCTTAAACAAAATTC	0.327													5	3	---	---	---	---	
CDK12	51755	broad.mit.edu	37	17	37618252	37618252	+	5'UTR	DEL	G	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37618252delG	uc010cvv.2	+	1					CDK12_uc010wef.1_5'UTR|CDK12_uc002hrw.3_5'UTR	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich						mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						agttggggttgggggggtggg	0.493										TCGA Ovarian(9;0.13)			4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025820	64025821	+	Intron	INS	-	TAAA	TAAA	rs144628903	by1000genomes	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025820_64025821insTAAA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gaccctgtctctaaataaacaa	0.114													6	3	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3134953	3134954	+	Intron	INS	-	T	T			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3134953_3134954insT	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TTATTTTACGAttttttttttt	0.168													3	3	---	---	---	---	
C19orf10	56005	broad.mit.edu	37	19	4668862	4668862	+	Intron	DEL	T	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4668862delT	uc002may.2	-							NM_019107	NP_061980	Q969H8	CS010_HUMAN	hypothetical protein LOC56005 precursor							ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		acccgactaattttttttttt	0.000													6	3	---	---	---	---	
RAB3D	9545	broad.mit.edu	37	19	11447650	11447651	+	Intron	INS	-	A	A			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11447650_11447651insA	uc002mqy.2	-							NM_004283	NP_004274	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family						exocytosis|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(2)	2						tgtctcgagagaaaaaaaaaaa	0.000													6	4	---	---	---	---	
MLL4	9757	broad.mit.edu	37	19	36224005	36224006	+	Frame_Shift_Ins	INS	-	C	C	rs147972814	by1000genomes	TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36224005_36224006insC	uc010eei.2	+	29	6555_6556	c.6555_6556insC	c.(6553-6558)AAACCCfs	p.K2185fs		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2185_2186					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGCCCCCCAAACCCGCCACATC	0.629													5	3	---	---	---	---	
CEACAM21	90273	broad.mit.edu	37	19	42083433	42083434	+	Intron	DEL	AC	-	-			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42083433_42083434delAC	uc002ore.3	+						CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_Intron|CEACAM21_uc002org.3_Intron	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane				ovary(1)	1						ACCCAGTAGGacacacacacac	0.302													6	4	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43614037	43614039	+	Intron	DEL	CCT	-	-	rs79792173		TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43614037_43614039delCCT	uc003bdt.1	-							NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				actccttgtccctcctcagactg	0.256													2	4	---	---	---	---	
GAGE12J	729396	broad.mit.edu	37	X	49228012	49228013	+	Intron	INS	-	GT	GT			TCGA-C5-A1M9-01	TCGA-C5-A1M9-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49228012_49228013insGT	uc004dnl.3	+						GAGE13_uc004dnn.3_Intron|GAGE8_uc011mne.1_Intron|GAGE8_uc011mnf.1_Intron|GAGE8_uc011mng.1_Intron|GAGE2A_uc004dnr.3_Intron|GAGE8_uc004dnq.3_Intron|GAGE2A_uc004dnv.3_Intron|GAGE4_uc011mnk.1_Intron|GAGE2A_uc004dny.3_Intron|GAGE8_uc011mnl.1_Intron|GAGE8_uc004dnz.3_Intron|GAGE12D_uc011mnm.1_Intron|GAGE8_uc011mnh.1_Intron|GAGE2B_uc011mnj.1_Intron|GAGE2C_uc004doa.2_Intron|GAGE2D_uc004dob.3_Intron	NM_001098406	NP_001465	A6NER3	GG12J_HUMAN	G antigen 12J												0	Ovarian(276;0.236)					tgtgtgtgttcgtgtgtgtgtg	0.347													4	2	---	---	---	---	
