Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MMEL1	79258	broad.mit.edu	37	1	2538416	2538416	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2538416C>T	uc001ajy.2	-	7	842	c.628G>A	c.(628-630)GTA>ATA	p.V210I	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	210	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GCCTTACCTACGGTCTCGTTC	0.642													18	35	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19483350	19483350	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19483350G>A	uc001bbi.2	-	41	5834	c.5830C>T	c.(5830-5832)CGC>TGC	p.R1944C	UBR4_uc001bbl.1_5'UTR|UBR4_uc001bbm.1_Missense_Mutation_p.R1155C	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1944					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GAAGCCAAGCGGGTCAGAGTT	0.473													9	34	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27100375	27100375	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27100375C>T	uc001bmv.1	+	17	4460	c.4087C>T	c.(4087-4089)CAA>TAA	p.Q1363*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q1362*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q1363*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q980*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.Q209*|ARID1A_uc009vsm.1_5'UTR|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1363	Gln-rich.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TACAATGTATCAACAGCAACA	0.488			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								35	74	---	---	---	---	PASS
SLC22A15	55356	broad.mit.edu	37	1	116534855	116534855	+	Silent	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116534855C>T	uc001egb.3	+	2	421	c.291C>T	c.(289-291)ATC>ATT	p.I97I	SLC22A15_uc001ega.2_Silent_p.I97I	NM_018420	NP_060890	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	97					ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCACCTCCATCGCCTCGGAGG	0.478													3	5	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152284693	152284693	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152284693C>T	uc001ezu.1	-	3	2705	c.2669G>A	c.(2668-2670)AGA>AAA	p.R890K	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	890	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTTGCACTTCTGGATCCTGA	0.552									Ichthyosis				327	232	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223116265	223116265	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223116265G>A	uc001hnu.1	+	2	247	c.100G>A	c.(100-102)GAC>AAC	p.D34N		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	34					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		CTGTGATGGAGACCATGCAGC	0.498													14	65	---	---	---	---	PASS
OR2L3	391192	broad.mit.edu	37	1	248224828	248224828	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248224828C>T	uc001idx.1	+	1	845	c.845C>T	c.(844-846)CCA>CTA	p.P282L	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	282	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ACCCTCACTCCAATGCTCAAC	0.488													16	66	---	---	---	---	PASS
C2orf84	653140	broad.mit.edu	37	2	24406440	24406440	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24406440C>A	uc002rfc.2	+	5	413	c.327C>A	c.(325-327)TTC>TTA	p.F109L	C2orf84_uc010eyc.2_RNA	NM_001040710	NP_001035800	Q86W67	CB084_HUMAN	hypothetical protein LOC653140	109											0						ACTTCACTTTCACTTCACACT	0.408													21	26	---	---	---	---	PASS
ANKRD53	79998	broad.mit.edu	37	2	71209788	71209788	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71209788G>A	uc002shl.3	+	5	1065	c.864G>A	c.(862-864)CAG>CAA	p.Q288Q	ANKRD53_uc002shk.3_Silent_p.Q288Q|ANKRD53_uc002shm.3_Silent_p.Q199Q	NM_001115116	NP_001108588	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53 isoform a	288											0						TCAAGAGCCAGCTGACCCTCA	0.542													18	61	---	---	---	---	PASS
SMYD5	10322	broad.mit.edu	37	2	73447240	73447240	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73447240G>A	uc002siw.2	+	3	296	c.267G>A	c.(265-267)GGG>GGA	p.G89G	SMYD5_uc010yre.1_5'UTR|SMYD5_uc002six.1_5'Flank	NM_006062	NP_006053	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	89							metal ion binding				0						GGCTGACCGGGAAACCAGGCC	0.557													8	25	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158142597	158142597	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158142597G>C	uc002tzg.2	+	3	1947	c.1692G>C	c.(1690-1692)GAG>GAC	p.E564D	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	564	Catalytic subdomain A.|Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						GCCTCAAAGAGAGACATGGCT	0.343													12	18	---	---	---	---	PASS
ABCB6	10058	broad.mit.edu	37	2	220075187	220075187	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220075187G>A	uc002vkc.1	-	17	2544	c.2267C>T	c.(2266-2268)GCG>GTG	p.A756V	ABCB6_uc010fwe.1_Missense_Mutation_p.A710V	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	756	ABC transporter.				cadmium ion transmembrane transport|cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTATCCAGCGCTGACGTTGC	0.552													4	28	---	---	---	---	PASS
TRAF3IP1	26146	broad.mit.edu	37	2	239237349	239237349	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239237349G>A	uc002vye.2	+	4	496	c.377G>A	c.(376-378)CGG>CAG	p.R126Q	TRAF3IP1_uc002vyf.2_Missense_Mutation_p.R126Q	NM_015650	NP_056465	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting	126	Abolishes microtubules-binding when missing.					cytoplasm|cytoskeleton	protein binding			ovary(1)	1		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		GATGCGGTGCGGAGGGTTTTA	0.483													10	45	---	---	---	---	PASS
RAF1	5894	broad.mit.edu	37	3	12660149	12660149	+	Silent	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12660149G>C	uc003bxf.3	-	2	487	c.72C>G	c.(70-72)GGC>GGG	p.G24G	RAF1_uc011auu.1_5'UTR	NM_002880	NP_002871	P04049	RAF1_HUMAN	v-raf-1 murine leukemia viral oncogene homolog	24					activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)	TGCAGCTGGAGCCATCAAACA	0.458			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				13	38	---	---	---	---	PASS
MLH1	4292	broad.mit.edu	37	3	37089115	37089115	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37089115G>A	uc003cgl.2	+	16	1897	c.1837G>A	c.(1837-1839)GAG>AAG	p.E613K	MLH1_uc011aye.1_Missense_Mutation_p.E372K|MLH1_uc011ayb.1_Missense_Mutation_p.E372K|MLH1_uc010hge.2_Missense_Mutation_p.E613K|MLH1_uc003cgn.3_Missense_Mutation_p.E372K|MLH1_uc011ayc.1_Missense_Mutation_p.E515K|MLH1_uc011ayd.1_Missense_Mutation_p.E372K|MLH1_uc003cgo.2_Missense_Mutation_p.E372K|MLH1_uc010hgk.2_Intron|MLH1_uc010hgn.2_Intron|MLH1_uc010hgm.2_Intron|MLH1_uc010hgo.2_Intron|MLH1_uc010hgp.2_Missense_Mutation_p.E27K|MLH1_uc010hgq.2_Intron	NM_000249	NP_000240	P40692	MLH1_HUMAN	MutL protein homolog 1	613	Interaction with EXO1.				mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	p.0?(1)		large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						ATACATTGTTGAGTTTCTGAA	0.433		1	D|Mis|N|F|S		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				4	125	---	---	---	---	PASS
QARS	5859	broad.mit.edu	37	3	49133523	49133523	+	Intron	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49133523G>C	uc003cvx.2	-						QRICH1_uc010hkq.2_5'Flank|QRICH1_uc003cvu.2_5'Flank|QRICH1_uc003cvv.2_5'Flank|QARS_uc011bcc.1_Intron|QARS_uc011bcd.1_Intron|QARS_uc003cvy.2_Intron|QARS_uc011bce.1_Intron	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase						glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CTGGAGGGCAGAGGGAAAAGG	0.547													4	6	---	---	---	---	PASS
NT5DC2	64943	broad.mit.edu	37	3	52568558	52568558	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52568558C>G	uc003deo.2	-	1	536	c.112G>C	c.(112-114)GAG>CAG	p.E38Q	NT5DC2_uc003den.2_5'Flank|NT5DC2_uc010hmi.2_5'Flank|NT5DC2_uc010hmj.2_5'UTR|LOC440957_uc003dep.2_5'Flank	NM_022908	NP_075059	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2 isoform 2	38							hydrolase activity|metal ion binding				0				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		CCCGTCAACTCCCGGTTTCCC	0.622													27	54	---	---	---	---	PASS
C3orf26	84319	broad.mit.edu	37	3	99536827	99536827	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99536827G>T	uc003dtl.2	+	1	147	c.4G>T	c.(4-6)GCA>TCA	p.A2S	C3orf26_uc003dtk.1_RNA	NM_032359	NP_115735	Q9BQ75	CC026_HUMAN	hypothetical protein LOC84319	2							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(1)	1						AGCTGAAATGGCAGACGATCT	0.642													4	33	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118647512	118647512	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118647512C>T	uc003ebw.2	-	3	515	c.268G>A	c.(268-270)GGT>AGT	p.G90S	IGSF11_uc011biv.1_Missense_Mutation_p.G90S|IGSF11_uc003ebx.2_Missense_Mutation_p.G90S|IGSF11_uc003eby.2_Missense_Mutation_p.G89S|IGSF11_uc003ebz.2_Missense_Mutation_p.G89S|IGSF11_uc010hqs.2_Missense_Mutation_p.G89S	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	90	Ig-like V-type.|Extracellular (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						CCTACCCTACCGTGGAACCGG	0.473													12	38	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124215190	124215190	+	Missense_Mutation	SNP	A	G	G	rs143339367		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124215190A>G	uc003ehg.2	+	33	4986	c.4859A>G	c.(4858-4860)GAT>GGT	p.D1620G	KALRN_uc010hrv.1_Missense_Mutation_p.D1611G|KALRN_uc003ehf.1_Missense_Mutation_p.D1620G|KALRN_uc011bjy.1_Missense_Mutation_p.D1611G	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	1620					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						AGCCAGGGGGATGGGAGCAGC	0.537													12	54	---	---	---	---	PASS
PRMT10	90826	broad.mit.edu	37	4	148559730	148559730	+	Missense_Mutation	SNP	T	C	C	rs114762309		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148559730T>C	uc003ilc.2	-	12	2633	c.2491A>G	c.(2491-2493)AGC>GGC	p.S831G	PRMT10_uc003ilb.2_Missense_Mutation_p.S475G|PRMT10_uc003ild.2_Missense_Mutation_p.S718G	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10	831						cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2						TGCTGAATGCTGAGTACAAGT	0.398													3	97	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160266410	160266410	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160266410A>G	uc003iqg.3	+	18	3258	c.2948A>G	c.(2947-2949)AAT>AGT	p.N983S		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	983					cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TACCTTTCCAATTTGGAGCTA	0.448													57	27	---	---	---	---	PASS
TLL1	7092	broad.mit.edu	37	4	166976380	166976380	+	Silent	SNP	C	T	T	rs142933283		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166976380C>T	uc003irh.1	+	13	2324	c.1677C>T	c.(1675-1677)GAC>GAT	p.D559D	TLL1_uc011cjn.1_Silent_p.D582D|TLL1_uc011cjo.1_Silent_p.D383D	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	559	CUB 2.				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTGTTTCTGACGGAACTGTGA	0.363													12	47	---	---	---	---	PASS
NPR3	4883	broad.mit.edu	37	5	32780823	32780823	+	Intron	SNP	T	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32780823T>G	uc003jhv.2	+						NPR3_uc010iuo.2_Intron|NPR3_uc011cnz.1_Intron|NPR3_uc003jhu.2_Intron	NM_000908	NP_000899	P17342	ANPRC_HUMAN	natriuretic peptide receptor C/guanylate cyclase						osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity			ovary(1)|central_nervous_system(1)	2					Nesiritide(DB04899)	CTTCTGGTCCTGTAGGTATCG	0.473													33	62	---	---	---	---	PASS
MAP1B	4131	broad.mit.edu	37	5	71493006	71493006	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71493006G>A	uc003kbw.3	+	5	4065	c.3824G>A	c.(3823-3825)CGT>CAT	p.R1275H	MAP1B_uc010iyw.1_Missense_Mutation_p.R1292H|MAP1B_uc010iyx.1_Missense_Mutation_p.R1149H|MAP1B_uc010iyy.1_Missense_Mutation_p.R1149H	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1275						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CTGGGTGAACGTAGTGTGAAC	0.517													15	28	---	---	---	---	PASS
RHOBTB3	22836	broad.mit.edu	37	5	95067758	95067758	+	Silent	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95067758C>G	uc003klm.2	+	2	735	c.198C>G	c.(196-198)GTC>GTG	p.V66V	RHOBTB3_uc003klk.1_5'UTR|RHOBTB3_uc003kll.2_Silent_p.V66V	NM_014899	NP_055714	O94955	RHBT3_HUMAN	rho-related BTB domain containing 3	66	Rho-like.				retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		TTGGGAATGTCAAGCTGGTGG	0.597													6	21	---	---	---	---	PASS
HSD17B4	3295	broad.mit.edu	37	5	118865666	118865666	+	Silent	SNP	A	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118865666A>C	uc003ksj.2	+	21	1968	c.1845A>C	c.(1843-1845)ACA>ACC	p.T615T	HSD17B4_uc011cwg.1_Silent_p.T591T|HSD17B4_uc011cwh.1_Silent_p.T597T|HSD17B4_uc011cwi.1_Silent_p.T640T|HSD17B4_uc003ksk.3_Silent_p.T468T|HSD17B4_uc011cwj.1_Silent_p.T468T|HSD17B4_uc010jcn.1_Silent_p.T353T|HSD17B4_uc010jco.1_Missense_Mutation_p.H84P	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	615	Enoyl-CoA hydratase 2.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	CAGCTAAGACACCCTCTGAGG	0.378													7	30	---	---	---	---	PASS
CTNNA1	1495	broad.mit.edu	37	5	138253527	138253527	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138253527C>T	uc003ldh.2	+	11	1581	c.1486C>T	c.(1486-1488)CGT>TGT	p.R496C	CTNNA1_uc011cyx.1_Missense_Mutation_p.R393C|CTNNA1_uc011cyy.1_Missense_Mutation_p.R373C|CTNNA1_uc003ldi.2_Missense_Mutation_p.R194C|CTNNA1_uc003ldj.2_Missense_Mutation_p.R496C|CTNNA1_uc003ldl.2_Missense_Mutation_p.R126C	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	496					adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AAAACAAGTCCGTGTTCTCAC	0.433													73	167	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57467154	57467154	+	Silent	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57467154C>T	uc003pdx.2	+	12	1182	c.1095C>T	c.(1093-1095)TTC>TTT	p.F365F		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	365					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATACACCTTTCAGTTGCCTGA	0.433													7	100	---	---	---	---	PASS
ANKRD6	22881	broad.mit.edu	37	6	90312810	90312810	+	Silent	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90312810C>T	uc003pni.3	+	4	623	c.282C>T	c.(280-282)CTC>CTT	p.L94L	ANKRD6_uc003pne.3_Silent_p.L94L|ANKRD6_uc003pnf.3_Silent_p.L94L|ANKRD6_uc011dzy.1_Silent_p.L94L|ANKRD6_uc010kcd.2_Silent_p.L94L|LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_RNA|ANKRD6_uc003pnh.3_5'UTR	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	94	ANK 3.						protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		TCGCGGCGCTCATCCACGAAG	0.612													3	7	---	---	---	---	PASS
IPCEF1	26034	broad.mit.edu	37	6	154567853	154567853	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154567853G>A	uc003qpx.2	-	5	271	c.115C>T	c.(115-117)CTG>TTG	p.L39L	OPRM1_uc003qpt.1_Silent_p.Q397Q|IPCEF1_uc003qpw.2_Silent_p.L40L|IPCEF1_uc010kjh.2_Silent_p.L40L	NM_015553	NP_056368	Q8WWN9	ICEF1_HUMAN	phosphoinositide-binding protein PIP3-E isoform	39					response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0						GCATGGCCCAGATCTTTACAC	0.423													63	41	---	---	---	---	PASS
SMOC2	64094	broad.mit.edu	37	6	168910644	168910644	+	Missense_Mutation	SNP	C	T	T	rs141002558	byFrequency	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168910644C>T	uc003qws.1	+	2	154	c.134C>T	c.(133-135)GCG>GTG	p.A45V	SMOC2_uc003qwr.1_Missense_Mutation_p.A45V	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	45	Kazal-like.				signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		TTGGACTGTGCGGGTTCGCCC	0.443													4	85	---	---	---	---	PASS
TBP	6908	broad.mit.edu	37	6	170871052	170871052	+	Silent	SNP	G	A	A	rs112083427		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170871052G>A	uc003qxt.2	+	3	460	c.228G>A	c.(226-228)CAG>CAA	p.Q76Q	TBP_uc003qxu.2_Silent_p.Q76Q|TBP_uc011ehf.1_Silent_p.Q56Q|TBP_uc011ehg.1_Silent_p.Q76Q	NM_003194	NP_003185	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription from RNA polymerase III promoter|viral reproduction	transcription factor TFIIA complex|transcription factor TFIID complex	repressing transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.159													3	51	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72413868	72413868	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72413868G>A	uc003twk.2	+	11	3336	c.3336G>A	c.(3334-3336)GGG>GGA	p.G1112G	POM121_uc003twj.2_Silent_p.G847G|POM121_uc010lam.1_Silent_p.G847G	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	1112	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				GGAGCTTTGGGATCAATGTGG	0.652													8	30	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82764213	82764213	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82764213C>T	uc003uhx.2	-	3	2942	c.2653G>A	c.(2653-2655)GCT>ACT	p.A885T	PCLO_uc003uhv.2_Missense_Mutation_p.A885T	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	831	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GTTTGGCCAGCGGTAGGTCGT	0.527													59	140	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98508771	98508771	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98508771G>A	uc003upp.2	+	17	2093	c.1884G>A	c.(1882-1884)GAG>GAA	p.E628E	TRRAP_uc011kis.1_Silent_p.E628E|TRRAP_uc003upr.2_Silent_p.E320E	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	628					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGAAAGAGGAGAAGGAGGTAT	0.468													14	31	---	---	---	---	PASS
MLLT3	4300	broad.mit.edu	37	9	20414343	20414343	+	Silent	SNP	A	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414343A>G	uc003zoe.2	-	5	760	c.501T>C	c.(499-501)AGT>AGC	p.S167S	MLLT3_uc011lne.1_Silent_p.S135S|MLLT3_uc011lnf.1_Silent_p.S164S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Missense_Mutation_p.V129A	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	167	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.139			T	MLL	ALL								7	38	---	---	---	---	PASS
NIPSNAP3B	55335	broad.mit.edu	37	9	107531250	107531250	+	Silent	SNP	G	A	A	rs146813577		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107531250G>A	uc004bci.2	+	3	449	c.378G>A	c.(376-378)ACG>ACA	p.T126T	NIPSNAP3A_uc011lvu.1_Intron|NIPSNAP3B_uc004bcj.1_RNA	NM_018376	NP_060846	Q9BS92	NPS3B_HUMAN	nipsnap homolog 3B	126										pancreas(1)|skin(1)	2						AACAAGAGACGGAAATTACTT	0.383													9	29	---	---	---	---	PASS
NEK6	10783	broad.mit.edu	37	9	127076209	127076209	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127076209A>T	uc004bog.2	+	4	388	c.239A>T	c.(238-240)GAG>GTG	p.E80V	NEK6_uc004bof.2_Missense_Mutation_p.E98V|NEK6_uc004boh.2_Missense_Mutation_p.E114V|NEK6_uc010mwj.2_Missense_Mutation_p.E33V|NEK6_uc010mwk.2_Missense_Mutation_p.E80V|NEK6_uc004boi.2_Missense_Mutation_p.E80V	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2	80	Protein kinase.				apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3						AAGATCTTTGAGATGATGGAC	0.582													4	19	---	---	---	---	PASS
CRAT	1384	broad.mit.edu	37	9	131864843	131864843	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131864843C>T	uc004bxh.2	-	5	748	c.466G>A	c.(466-468)GAG>AAG	p.E156K	CRAT_uc004bxg.2_Missense_Mutation_p.E135K|CRAT_uc004bxk.3_Missense_Mutation_p.E135K	NM_000755	NP_000746	P43155	CACP_HUMAN	carnitine acetyltransferase precursor	156					energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA oxidase|transport	endoplasmic reticulum|mitochondrial inner membrane|peroxisomal matrix	carnitine O-acetyltransferase activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	GGCAGGGTCTCGCTATGGGGT	0.627													7	166	---	---	---	---	PASS
ANUBL1	93550	broad.mit.edu	37	10	46122404	46122404	+	Silent	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46122404G>C	uc001jcp.3	-	7	1109	c.867C>G	c.(865-867)CCC>CCG	p.P289P	ANUBL1_uc001jcl.3_5'UTR|ANUBL1_uc001jcm.3_Silent_p.P289P|ANUBL1_uc009xmu.2_Silent_p.P215P|ANUBL1_uc001jcn.3_Silent_p.P215P|ANUBL1_uc001jco.3_Intron	NM_001128324	NP_001121796	Q86XD8	ANUB1_HUMAN	AN1, ubiquitin-like, homolog	289							zinc ion binding				0						TGGAGATTTCGGGCGGATATG	0.443													26	67	---	---	---	---	PASS
SFXN2	118980	broad.mit.edu	37	10	104492659	104492659	+	Silent	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104492659C>T	uc001kwb.2	+	9	931	c.765C>T	c.(763-765)TTC>TTT	p.F255F	SFXN2_uc001kwc.2_RNA|SFXN2_uc001kwd.2_RNA	NM_178858	NP_849189	Q96NB2	SFXN2_HUMAN	sideroflexin 2	255					iron ion homeostasis	integral to membrane	cation transmembrane transporter activity				0		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)		AATTGCACTTCATGCAGGTAT	0.577													14	30	---	---	---	---	PASS
FAM45A	404636	broad.mit.edu	37	10	120871423	120871423	+	Silent	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120871423C>T	uc001ldw.2	+	3	359	c.315C>T	c.(313-315)TTC>TTT	p.F105F	FAM45A_uc010qsv.1_Silent_p.F97F|FAM45A_uc010qsw.1_Missense_Mutation_p.S4L|FAM45A_uc010qsx.1_RNA|FAM45A_uc010qsy.1_Silent_p.F32F|FAM45A_uc010qsz.1_5'UTR|uc001ldx.2_5'Flank	NM_207009	NP_996892	Q8TCE6	FA45A_HUMAN	hypothetical protein LOC404636	105										ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		ATGCTGCCTTCACTAGGATAT	0.313													4	108	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135094863	135094863	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135094863G>C	uc001lmg.1	-	17	2844	c.2487C>G	c.(2485-2487)TTC>TTG	p.F829L	TUBGCP2_uc001lmf.1_Missense_Mutation_p.F422L|TUBGCP2_uc010qvc.1_Missense_Mutation_p.F857L|TUBGCP2_uc009ybk.1_Missense_Mutation_p.F852L|TUBGCP2_uc010qvd.1_Missense_Mutation_p.F699L|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	829					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GGTGGGCTGAGAAGTTCTTGT	0.602													3	46	---	---	---	---	PASS
CYP2E1	1571	broad.mit.edu	37	10	135345080	135345080	+	Intron	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135345080C>G	uc001lnj.1	+						CYP2E1_uc001lnk.1_Intron|CYP2E1_uc009ybl.1_Intron|CYP2E1_uc009ybm.1_Intron|CYP2E1_uc001lnl.1_5'UTR	NM_000773	NP_000764	P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E,						drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	GCTGGCCCCTCTGCCTTAGGA	0.493									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				25	62	---	---	---	---	PASS
FERMT3	83706	broad.mit.edu	37	11	63990963	63990963	+	Nonstop_Mutation	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63990963G>C	uc001nyl.2	+	15	2152	c.2003G>C	c.(2002-2004)TGA>TCA	p.*668S	FERMT3_uc001nym.2_Nonstop_Mutation_p.*664S|NUDT22_uc009ypd.2_5'Flank|NUDT22_uc001nyp.3_5'Flank|NUDT22_uc009ype.2_5'Flank|NUDT22_uc001nyq.3_5'Flank	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form	668					integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1						GAGGCCTTCTGAGGGCTGTCT	0.667													6	9	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133791120	133791120	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133791120C>T	uc001qgx.3	-	18	2731	c.2500G>A	c.(2500-2502)GTG>ATG	p.V834M		NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	834	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GCCTTGGCCACGCTGTACTTC	0.657													18	38	---	---	---	---	PASS
PIK3C2G	5288	broad.mit.edu	37	12	18499662	18499662	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18499662A>G	uc001rdt.2	+	11	1633	c.1517A>G	c.(1516-1518)CAG>CGG	p.Q506R	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.Q506R|PIK3C2G_uc010sic.1_Missense_Mutation_p.Q284R	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	506					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				GCAGATTTTCAGCCTGTAAAT	0.433													3	64	---	---	---	---	PASS
ANKRD33	341405	broad.mit.edu	37	12	52282011	52282011	+	5'UTR	SNP	G	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52282011G>T	uc001rzf.3	+	1					ANKRD33_uc001rzh.3_Missense_Mutation_p.G14V|ANKRD33_uc001rzd.2_Missense_Mutation_p.G14V|ANKRD33_uc001rze.2_5'UTR|ANKRD33_uc001rzg.3_5'UTR|ANKRD33_uc001rzi.3_5'UTR	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1												0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		GCTTCCTGGGGAGGGATAGTC	0.607													5	97	---	---	---	---	PASS
ERBB3	2065	broad.mit.edu	37	12	56478854	56478854	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56478854G>A	uc001sjh.2	+	3	503	c.310G>A	c.(310-312)GTG>ATG	p.V104M	ERBB3_uc009zoj.2_RNA|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Missense_Mutation_p.V45M|ERBB3_uc001sjg.2_Missense_Mutation_p.V104M	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	104	Extracellular (Potential).		V -> M (in an ovarian mucinous carcinoma sample; somatic mutation).		cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	p.V104M(1)		lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAACCTCCGCGTGGTGCGAGG	0.517													26	99	---	---	---	---	PASS
TMPO	7112	broad.mit.edu	37	12	98938002	98938002	+	Intron	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98938002G>C	uc001tfj.2	+						TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						GTTGATGCTTGAATAGAGCTA	0.403													8	46	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70371050	70371050	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70371050T>A	uc001vip.2	-	7	2253	c.1459A>T	c.(1459-1461)ATC>TTC	p.I487F	KLHL1_uc010thm.1_Missense_Mutation_p.I426F	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	487	Kelch 1.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CCTGCCTGGATCCACAGATTT	0.383													59	55	---	---	---	---	PASS
ZFP106	64397	broad.mit.edu	37	15	42729418	42729418	+	Intron	SNP	C	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42729418C>A	uc001zpw.2	-						ZFP106_uc001zpu.2_Intron|ZFP106_uc001zpv.2_Intron|ZFP106_uc001zpx.2_Intron	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog							nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		tctaCATGTTCTATCAACTTA	0.204													16	51	---	---	---	---	PASS
HCN4	10021	broad.mit.edu	37	15	73616100	73616100	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73616100G>A	uc002avp.2	-	8	3328	c.2334C>T	c.(2332-2334)ATC>ATT	p.I778I		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	778	Cytoplasmic (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		GTGGTGCCTGGATCAGCGGGG	0.687													18	16	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	77064115	77064115	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77064115C>A	uc002bby.2	-	9	1275	c.1216G>T	c.(1216-1218)GAA>TAA	p.E406*	SCAPER_uc002bbx.2_Nonsense_Mutation_p.E160*|SCAPER_uc002bbz.1_Nonsense_Mutation_p.E271*|SCAPER_uc002bca.1_Nonsense_Mutation_p.E271*|SCAPER_uc002bcb.1_Nonsense_Mutation_p.E406*|SCAPER_uc002bcc.1_Nonsense_Mutation_p.E406*	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	405	Glu-rich.					endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						ATTTCATTTTCTATCCTTGCT	0.368													5	116	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84373210	84373210	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84373210C>G	uc002bjz.3	+	3	363	c.139C>G	c.(139-141)CTG>GTG	p.L47V	ADAMTSL3_uc002bjy.1_Missense_Mutation_p.L47V|ADAMTSL3_uc010bmt.1_Missense_Mutation_p.L47V|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.L47V	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	47						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGGAAGTTTTCTGGAAGACAC	0.453													50	152	---	---	---	---	PASS
KIF7	374654	broad.mit.edu	37	15	90171693	90171693	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90171693C>G	uc002bof.2	-	19	4066	c.3989G>C	c.(3988-3990)CGA>CCA	p.R1330P	KIF7_uc010upw.1_Missense_Mutation_p.R816P|C15orf42_uc010upv.1_Intron	NM_198525	NP_940927	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1330					microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding			ovary(2)|lung(1)	3	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CGGGCTGGCTCGTCGCAGTTC	0.672													21	44	---	---	---	---	PASS
TSC2	7249	broad.mit.edu	37	16	2115600	2115600	+	Silent	SNP	G	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2115600G>T	uc002con.2	+	16	1786	c.1680G>T	c.(1678-1680)GTG>GTT	p.V560V	TSC2_uc010bsd.2_Silent_p.V560V|TSC2_uc002coo.2_Silent_p.V560V|TSC2_uc010uvv.1_Silent_p.V523V|TSC2_uc010uvw.1_Silent_p.V511V|TSC2_uc002cop.2_Silent_p.V360V	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	560					cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				TGGAGGATGTGAAGACAGCCG	0.637			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				54	121	---	---	---	---	PASS
ZC3H7A	29066	broad.mit.edu	37	16	11855852	11855852	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11855852C>G	uc002dbk.2	-	17	2325	c.2127G>C	c.(2125-2127)AAG>AAC	p.K709N	ZC3H7A_uc002dbj.2_RNA|ZC3H7A_uc002dbl.2_Missense_Mutation_p.K709N|ZC3H7A_uc002dbm.1_Missense_Mutation_p.K619N	NM_014153	NP_054872	Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	709						nucleus	nucleic acid binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						CGCACACAAACTTTATCTTCA	0.328													3	51	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21136605	21136605	+	Missense_Mutation	SNP	C	T	T	rs139455188	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21136605C>T	uc010vbe.1	-	9	1295	c.1295G>A	c.(1294-1296)CGA>CAA	p.R432Q	DNAH3_uc002die.2_Missense_Mutation_p.R403Q	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	432	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CTCAATGTTTCGACTTGAGTC	0.473													57	40	---	---	---	---	PASS
GPT2	84706	broad.mit.edu	37	16	46958347	46958347	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46958347C>G	uc002eel.2	+	10	1353	c.1259C>G	c.(1258-1260)ACG>AGG	p.T420R	GPT2_uc002eem.2_Missense_Mutation_p.T320R|GPT2_uc002een.2_Missense_Mutation_p.T63R	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	420					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GCAAAGCTGACGGAAGACCTG	0.507													9	60	---	---	---	---	PASS
CBLN1	869	broad.mit.edu	37	16	49313390	49313390	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49313390G>A	uc002efq.2	-	3	846	c.507C>T	c.(505-507)CTC>CTT	p.L169L		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	169	C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).				nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)				GCTCCAGCTTGAGGTATGCTC	0.602													32	33	---	---	---	---	PASS
FHOD1	29109	broad.mit.edu	37	16	67271211	67271211	+	Silent	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67271211C>T	uc002esl.2	-	9	1036	c.924G>A	c.(922-924)GCG>GCA	p.A308A	FHOD1_uc010ced.2_Silent_p.A115A|FHOD1_uc010vjh.1_5'UTR	NM_013241	NP_037373	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	308	GBD/FH3.			EA -> DT (in Ref. 1; AAD39906 and 3; AAO38757).	actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding			breast(2)|ovary(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GCTGGACCAGCGCTTCCATGC	0.662													31	28	---	---	---	---	PASS
ATP2C2	9914	broad.mit.edu	37	16	84497327	84497327	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84497327G>A	uc002fhx.2	+	27	2919	c.2830G>A	c.(2830-2832)GAA>AAA	p.E944K	ATP2C2_uc010chj.2_Missense_Mutation_p.E973K|ATP2C2_uc002fhy.2_Missense_Mutation_p.E961K|ATP2C2_uc002fhz.2_Missense_Mutation_p.E793K|ATP2C2_uc002fia.2_Missense_Mutation_p.E255K	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	944	Cytoplasmic (Potential).				ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2						GATGCACCCTGAAGATGTGTA	0.512													22	55	---	---	---	---	PASS
GALNS	2588	broad.mit.edu	37	16	88891256	88891256	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88891256G>A	uc002fly.3	-	11	1250	c.1161C>T	c.(1159-1161)GGC>GGT	p.G387G	GALNS_uc002flx.2_5'Flank|GALNS_uc010cid.2_Silent_p.G393G|GALNS_uc002flz.3_Silent_p.G70G	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	387						lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)	TCAGCGTGTCGCCACGGTAAT	0.617													12	41	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17696863	17696863	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17696863C>G	uc002grm.2	+	3	1070	c.601C>G	c.(601-603)CTG>GTG	p.L201V	RAI1_uc002grn.1_Missense_Mutation_p.L201V	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	201	Gln-rich.					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		TGCCTCCCCTCTGCCCTTCCC	0.652													22	78	---	---	---	---	PASS
ABCA5	23461	broad.mit.edu	37	17	67261034	67261034	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67261034T>C	uc002jif.2	-	23	4375	c.3157A>G	c.(3157-3159)ACT>GCT	p.T1053A	ABCA5_uc002jib.2_Missense_Mutation_p.T19A|ABCA5_uc002jic.2_Missense_Mutation_p.T276A|ABCA5_uc002jid.2_Intron|ABCA5_uc002jie.2_RNA|ABCA5_uc002jig.2_Missense_Mutation_p.T1053A	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5	1053					cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					TTAAGTTGAGTATAAGCTTTG	0.264													24	16	---	---	---	---	PASS
BAHCC1	57597	broad.mit.edu	37	17	79411745	79411745	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79411745C>A	uc002kaf.2	+	6	2564	c.2564C>A	c.(2563-2565)TCC>TAC	p.S855Y	BAHCC1_uc002kae.2_Missense_Mutation_p.S54Y	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	855	Pro-rich.						DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			TTCCCCGCCTCCGTGGCTGGC	0.721													29	26	---	---	---	---	PASS
ARID3A	1820	broad.mit.edu	37	19	964968	964968	+	Silent	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:964968G>A	uc002lql.2	+	6	1376	c.1086G>A	c.(1084-1086)TCG>TCA	p.S362S		NM_005224	NP_005215	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT- like)	362						cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGCCTACTCGCCAGGCGGGG	0.667													14	30	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11134251	11134251	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11134251C>T	uc002mqf.3	+	20	3201	c.2917C>T	c.(2917-2919)CGG>TGG	p.R973W	SMARCA4_uc010dxp.2_Missense_Mutation_p.R973W|SMARCA4_uc010dxo.2_Missense_Mutation_p.R973W|SMARCA4_uc002mqg.1_Missense_Mutation_p.R973W|SMARCA4_uc010dxq.2_Missense_Mutation_p.R973W|SMARCA4_uc010dxr.2_Missense_Mutation_p.R973W|SMARCA4_uc002mqj.3_Missense_Mutation_p.R973W|SMARCA4_uc010dxs.2_Missense_Mutation_p.R973W|SMARCA4_uc010dxt.1_Missense_Mutation_p.R193W|SMARCA4_uc002mqh.3_Missense_Mutation_p.R96W|SMARCA4_uc002mqi.1_Missense_Mutation_p.R176W	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	973					chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CAAAGTGCTGCGGCCCTTCTT	0.562			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				4	9	---	---	---	---	PASS
CD97	976	broad.mit.edu	37	19	14516688	14516688	+	Silent	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14516688C>G	uc002myl.2	+	14	1881	c.1758C>G	c.(1756-1758)CTC>CTG	p.L586L	CD97_uc002mym.2_Silent_p.L537L|CD97_uc002myn.2_Silent_p.L493L	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor	586	Helical; Name=2; (Potential).				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						ACCTGCACCTCTGCATCTGCC	0.652													24	22	---	---	---	---	PASS
KIAA0355	9710	broad.mit.edu	37	19	34791377	34791377	+	5'UTR	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34791377G>A	uc002nvd.3	+	2					KIAA0355_uc010edk.1_5'UTR	NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710											ovary(1)	1	Esophageal squamous(110;0.162)					TCCCCCTCCCGCATGTATTGC	0.512													22	106	---	---	---	---	PASS
HNRNPL	3191	broad.mit.edu	37	19	39330948	39330948	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39330948C>T	uc010xul.1	-	8	1032	c.1021G>A	c.(1021-1023)GAA>AAA	p.E341K	HNRNPL_uc010ege.1_5'UTR|HNRNPL_uc002ojj.1_5'UTR|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_5'UTR|HNRNPL_uc002ojl.2_5'UTR|HNRNPL_uc010xum.1_Missense_Mutation_p.E208K|HNRNPL_uc002ojp.1_5'UTR|HNRNPL_uc010xun.1_Silent_p.T48T	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	341	Pro-rich.				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CTTCTCCCTTCGTAGTGAGGT	0.687													5	19	---	---	---	---	PASS
IRGC	56269	broad.mit.edu	37	19	44223000	44223000	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44223000C>A	uc002oxh.2	+	2	437	c.290C>A	c.(289-291)TCG>TAG	p.S97*		NM_019612	NP_062558	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	97						membrane	GTP binding|hydrolase activity, acting on acid anhydrides			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(69;0.0435)				ATGCAACCGTCGCCCTATCCA	0.662													3	72	---	---	---	---	PASS
PPFIA3	8541	broad.mit.edu	37	19	49652821	49652821	+	Silent	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49652821C>T	uc002pmr.2	+	28	3704	c.3372C>T	c.(3370-3372)TTC>TTT	p.F1124F	PPFIA3_uc010yai.1_RNA|PPFIA3_uc002pms.2_Silent_p.F983F|PPFIA3_uc002pmt.2_Silent_p.F263F|PPFIA3_uc002pmu.1_Silent_p.F173F	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3	1124						cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		CCAAGTCTTTCAGCCGCTCCC	0.622													21	30	---	---	---	---	PASS
PTH2	113091	broad.mit.edu	37	19	49926559	49926559	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49926559C>A	uc002pnn.1	-	1	140	c.38G>T	c.(37-39)CGG>CTG	p.R13L		NM_178449	NP_848544	Q96A98	TIP39_HUMAN	parathyroid hormone 2 preproprotein	13					neuropeptide signaling pathway	extracellular region					0				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		cagcagcagcCGAACCCGAGG	0.612													3	20	---	---	---	---	PASS
TSKS	60385	broad.mit.edu	37	19	50250006	50250006	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50250006C>T	uc002ppm.2	-	6	724	c.713G>A	c.(712-714)CGG>CAG	p.R238Q		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	238							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		ggcctcctgccgtcgcggcgt	0.284													7	41	---	---	---	---	PASS
SIGLEC11	114132	broad.mit.edu	37	19	50462671	50462671	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50462671G>C	uc010ybh.1	-	5	1094	c.1003C>G	c.(1003-1005)CGA>GGA	p.R335G	SIGLEC11_uc010ybi.1_Missense_Mutation_p.R335G	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	335	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TTCTCCGCTCGGCAGGTGTAG	0.672													11	91	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51918103	51918103	+	Missense_Mutation	SNP	C	G	G	rs145601049	byFrequency	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51918103C>G	uc002pwo.2	-	8	2206	c.1590G>C	c.(1588-1590)CAG>CAC	p.Q530H	SIGLEC10_uc002pwp.2_Missense_Mutation_p.Q472H|SIGLEC10_uc002pwq.2_Intron|SIGLEC10_uc002pwr.2_Intron|SIGLEC10_uc010ycy.1_Intron|SIGLEC10_uc010ycz.1_Intron|SIGLEC10_uc010eow.2_Intron|SIGLEC10_uc002pws.1_Intron	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	530	Extracellular (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		TGGATCCACTCTGGGCCCCAT	0.657													25	156	---	---	---	---	PASS
GNRH2	2797	broad.mit.edu	37	20	3025090	3025090	+	Silent	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3025090C>G	uc002whr.1	+	2	81	c.30C>G	c.(28-30)CTC>CTG	p.L10L	GNRH2_uc002whp.1_Silent_p.L10L|GNRH2_uc002whq.1_Silent_p.L10L|GNRH2_uc010gau.1_Silent_p.L10L|MRPS26_uc002whs.2_5'Flank	NM_001501	NP_001492	O43555	GON2_HUMAN	gonadotropin-releasing hormone 2 isoform a	10					multicellular organismal development|signal transduction	extracellular region|soluble fraction	hormone activity				0						GCCTCCTGCTCCTGCTGCTGC	0.617													14	72	---	---	---	---	PASS
POLR3F	10621	broad.mit.edu	37	20	18455810	18455810	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18455810C>G	uc002wqv.2	+	5	526	c.408C>G	c.(406-408)ATC>ATG	p.I136M	POLR3F_uc002wqw.2_RNA|POLR3F_uc002wqx.2_Missense_Mutation_p.I95M	NM_006466	NP_006457	Q9H1D9	RPC6_HUMAN	DNA-directed RNA polymerase III 39 kDa	136					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|protein binding				0						AAAAGCTTATCAAAGCTGTTA	0.328													16	41	---	---	---	---	PASS
DTD1	92675	broad.mit.edu	37	20	18576746	18576746	+	Silent	SNP	C	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18576746C>A	uc002wrf.3	+	3	392	c.231C>A	c.(229-231)GTC>GTA	p.V77V		NM_080820	NP_543010	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	77					D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2						TTCTGTGTGTCAGCCAGTTTA	0.507													49	46	---	---	---	---	PASS
BRD1	23774	broad.mit.edu	37	22	50191531	50191531	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50191531C>T	uc003biv.2	-	5	2507	c.2020G>A	c.(2020-2022)GGC>AGC	p.G674S	BRD1_uc011arf.1_Missense_Mutation_p.G269S|BRD1_uc011arg.1_Missense_Mutation_p.G723S|BRD1_uc011arh.1_Missense_Mutation_p.G674S|BRD1_uc003biu.3_Missense_Mutation_p.G674S	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	674					histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TCTTCCAAGCCGATGCTGTCC	0.662													39	12	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70339220	70339220	+	Intron	SNP	C	G	G			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70339220C>G	uc004dyy.2	+						MED12_uc011mpq.1_Intron|MED12_uc004dyz.2_Intron|MED12_uc004dza.2_5'Flank	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12						androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					TTTCCTGCCTCAGGATGAACT	0.323													4	5	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70597594	70597594	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70597594G>C	uc004dzu.3	+	6	904	c.853G>C	c.(853-855)GAA>CAA	p.E285Q	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.E306Q	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	285	Protein kinase 1.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				AGTAGAATCAGAAGTCAGCCA	0.512													3	71	---	---	---	---	PASS
ZNF75D	7626	broad.mit.edu	37	X	134421467	134421467	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134421467C>T	uc004eyp.2	-	7	3790	c.1135G>A	c.(1135-1137)GAT>AAT	p.D379N	ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_Missense_Mutation_p.D158N|ZNF75D_uc004eyo.2_Missense_Mutation_p.D284N	NM_007131	NP_009062	P51815	ZN75D_HUMAN	zinc finger protein 75	379	C2H2-type 1.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TTAATAAGATCAGAGCTAACT	0.408													21	85	---	---	---	---	PASS
BGN	633	broad.mit.edu	37	X	152771463	152771463	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152771463G>A	uc004fhr.1	+	4	666	c.494G>A	c.(493-495)CGC>CAC	p.R165H	BGN_uc004fhq.1_RNA	NM_001711	NP_001702	P21810	PGS1_HUMAN	biglycan preproprotein	165	LRR 4.					proteinaceous extracellular matrix|transport vesicle	extracellular matrix structural constituent			breast(2)	2	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTGGAGCTCCGCATCCACGAC	0.607													9	33	---	---	---	---	PASS
UBL4A	8266	broad.mit.edu	37	X	153713871	153713871	+	3'UTR	SNP	G	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153713871G>A	uc004flo.2	-	4						NM_014235	NP_055050	P11441	UBL4A_HUMAN	ubiquitin-like 4						protein modification process|tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	small conjugating protein ligase activity				0	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCATGCTCCGAGAATTCTAT	0.562													29	83	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	6894336	6894337	+	Intron	INS	-	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6894336_6894337insT	uc001aoi.2	+						CAMTA1_uc001aoh.2_Intron	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		tttattttttgttttttttttt	0.228													4	2	---	---	---	---	
CPSF3	51692	broad.mit.edu	37	2	9611342	9611343	+	Intron	INS	-	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9611342_9611343insA	uc002qzo.1	+						CPSF3_uc002qzp.1_Intron|CPSF3_uc002qzq.1_Intron	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		gactccatctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
PLEKHH2	130271	broad.mit.edu	37	2	43984561	43984562	+	Intron	INS	-	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43984561_43984562insT	uc010yny.1	+							NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ttttttctttcttttttttttt	0.129													10	6	---	---	---	---	
OBFC2A	64859	broad.mit.edu	37	2	192548842	192548842	+	Intron	DEL	A	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192548842delA	uc002usx.2	+						OBFC2A_uc002usw.2_Intron|OBFC2A_uc002usy.2_Intron|OBFC2A_uc002usz.2_Intron|OBFC2A_uc002uta.2_Intron	NM_001031716	NP_001026886	Q96AH0	SOSB2_HUMAN	oligonucleotide/oligosaccharide-binding fold						double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	single-stranded DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.061)|Epithelial(96;0.244)			tttgttaattaaaaaaaaaaa	0.234													3	4	---	---	---	---	
RAB7A	7879	broad.mit.edu	37	3	128517688	128517689	+	Intron	DEL	AG	-	-	rs56925997		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128517688_128517689delAG	uc003eks.1	+						RAB7A_uc010hsv.1_Intron|RAB7A_uc003ekt.2_Intron	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		aaaaaaaaaaagaATCCCAGGA	0.208													6	3	---	---	---	---	
ABCC5	10057	broad.mit.edu	37	3	183695545	183695546	+	Intron	INS	-	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183695545_183695546insT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AGTCAATTACAttttttttttt	0.218													8	4	---	---	---	---	
NUDT9	53343	broad.mit.edu	37	4	88359572	88359580	+	Intron	DEL	TAGAAAAGA	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88359572_88359580delTAGAAAAGA	uc003hqq.2	+						NUDT9_uc003hqr.2_Intron|NUDT9_uc010ikl.2_Intron	NM_024047	NP_076952	Q9BW91	NUDT9_HUMAN	nudix-type motif 9 isoform a							mitochondrion	ADP-ribose diphosphatase activity				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		CACCAAAAAGTAGAAAAGATAGTTCATat	0.225													17	12	---	---	---	---	
RNF175	285533	broad.mit.edu	37	4	154669993	154669994	+	Intron	INS	-	AAA	AAA	rs145820112	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154669993_154669994insAAA	uc003int.2	-						RNF175_uc003inu.1_Intron	NM_173662	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175							integral to membrane	zinc ion binding			ovary(1)|pancreas(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				GCGCATTTAGCaaaaaaaacaa	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179208072	179208072	+	IGR	DEL	A	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179208072delA								LOC285501 (296169 upstream) : None (None downstream)																							AAGGGCAGGCAACATGGGCAT	0.532													4	3	---	---	---	---	
SLC22A5	6584	broad.mit.edu	37	5	131714344	131714345	+	Intron	INS	-	ATC	ATC	rs141106891	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131714344_131714345insATC	uc003kww.3	+						SLC22A5_uc003kwx.3_Intron	NM_003060	NP_003051	O76082	S22A5_HUMAN	solute carrier family 22 member 5						positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity				0		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	AGAGCCAACAAATCTGACTCCG	0.416													5	3	---	---	---	---	
EBF1	1879	broad.mit.edu	37	5	158511595	158511595	+	Intron	DEL	G	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158511595delG	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAAAAAAAAAGACCAAAGTTC	0.343			T	HMGA2	lipoma								4	2	---	---	---	---	
TRIM15	89870	broad.mit.edu	37	6	30131318	30131319	+	5'UTR	INS	-	CTCT	CTCT			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30131318_30131319insCTCT	uc010jrx.2	+	1					TRIM10_uc003npn.2_5'Flank|TRIM10_uc003npo.3_5'Flank	NM_033229	NP_150232	Q9C019	TRI15_HUMAN	tripartite motif protein 15						mesodermal cell fate determination	intracellular	zinc ion binding				0						GGCATTCTTGCctctctctctc	0.485													6	4	---	---	---	---	
AIM1	202	broad.mit.edu	37	6	106966842	106966843	+	Intron	DEL	AT	-	-	rs9486376	byFrequency	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106966842_106966843delAT	uc003prh.2	+							NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1								sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ttaaaaaCACATGTGTGCGcac	0.109													5	3	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117704314	117704315	+	Intron	DEL	GC	-	-	rs112993324		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117704314_117704315delGC	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ATCAAATAAGGCGCTTTTTTTT	0.312			T	GOPC|ROS1	glioblastoma|NSCLC								4	2	---	---	---	---	
PSPH	5723	broad.mit.edu	37	7	56085118	56085118	+	Intron	DEL	A	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56085118delA	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AATACAAAAGAAAAAAAAAAA	0.368													5	3	---	---	---	---	
SUMF2	25870	broad.mit.edu	37	7	56136394	56136394	+	Intron	DEL	T	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56136394delT	uc003trv.2	+						PSPH_uc003trj.2_Intron|SUMF2_uc003tro.2_Intron|SUMF2_uc011kcv.1_Intron|SUMF2_uc011kcw.1_Intron|SUMF2_uc011kcx.1_Intron|SUMF2_uc003trt.2_Intron|SUMF2_uc011kcy.1_Intron|SUMF2_uc011kcz.1_Intron|SUMF2_uc003tru.2_Intron|SUMF2_uc011kda.1_Intron|SUMF2_uc003trx.2_Intron	NM_001130069	NP_001123541	Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2 isoform e							endoplasmic reticulum lumen	metal ion binding			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			Tttttctttcttttttttttt	0.189													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142009015	142009016	+	Intron	INS	-	CT	CT			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142009015_142009016insCT	uc011kro.1	+						uc011krp.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		TGTAGTACAGCCAGCTAGTGCA	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7679341	7679342	+	IGR	INS	-	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7679341_7679342insA								FAM90A7 (262107 upstream) : SPAG11A (26060 downstream)																							gactccttctcaaaaaaaaaaa	0.074													4	2	---	---	---	---	
DCTN3	11258	broad.mit.edu	37	9	34615896	34615897	+	Intron	INS	-	AA	AA	rs144108229		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34615896_34615897insAA	uc003zux.1	-						DCTN3_uc003zuw.1_Intron	NM_007234	NP_009165	O75935	DCTN3_HUMAN	dynactin 3 isoform 1						cytokinesis|G2/M transition of mitotic cell cycle|mitosis	centrosome|cleavage furrow|condensed chromosome kinetochore|cytosol|dynactin complex|midbody|perinuclear region of cytoplasm|spindle	protein binding|structural molecule activity				0	all_epithelial(49;0.0863)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.0388)		cgactctgtccaaaaaaaaaaa	0.203													4	4	---	---	---	---	
EXOSC2	23404	broad.mit.edu	37	9	133573185	133573186	+	Intron	INS	-	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133573185_133573186insT	uc004bzu.2	+						EXOSC2_uc011mbz.1_Intron|EXOSC2_uc011mca.1_Intron	NM_014285	NP_055100	Q13868	EXOS2_HUMAN	exosome component 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|positive regulation of cell growth|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	3'-5'-exoribonuclease activity|7S RNA binding|protein binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		ACTGGTTCATGttttttttttt	0.198													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128594141	128594143	+	Intron	DEL	CGC	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128594141_128594143delCGC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GGGTGAGCAGCGCCGCCGCCGCC	0.635													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11158593	11158593	+	IGR	DEL	A	-	-	rs11303970		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11158593delA								ZBED5 (278973 upstream) : GALNTL4 (133828 downstream)																							aaaaaaaaagaaaaaaaaata	0.154													6	3	---	---	---	---	
CLNS1A	1207	broad.mit.edu	37	11	77336693	77336694	+	Intron	DEL	TG	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77336693_77336694delTG	uc001oyk.2	-						CLNS1A_uc001oyl.2_Intron	NM_001293	NP_001284	P54105	ICLN_HUMAN	chloride channel, nucleotide-sensitive, 1A						blood circulation|cell volume homeostasis|chloride transport|ncRNA metabolic process|spliceosomal snRNP assembly	cytoskeleton|cytosol|nucleus|plasma membrane	protein binding			ovary(1)	1	all_cancers(14;5.43e-17)|all_epithelial(13;1.78e-19)		Epithelial(5;1.02e-48)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			tgtgtgtgtatgtgtgtgtgtg	0.302													4	2	---	---	---	---	
XPOT	11260	broad.mit.edu	37	12	64808875	64808876	+	Intron	INS	-	T	T			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64808875_64808876insT	uc001ssb.2	+						XPOT_uc009zqm.1_Intron	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin						intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		CATTTTATGACTTTTTTTTTTT	0.282													6	4	---	---	---	---	
VEZT	55591	broad.mit.edu	37	12	95680561	95680562	+	Intron	INS	-	C	C			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95680561_95680562insC	uc001tdz.2	+						VEZT_uc009ztb.1_Intron|VEZT_uc009ztc.1_Intron|VEZT_uc001tdy.2_Intron	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane							acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						ACTTTTTTACTTTTCCATTCTG	0.401													11	6	---	---	---	---	
VPS33A	65082	broad.mit.edu	37	12	122716609	122716609	+	3'UTR	DEL	A	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122716609delA	uc001ucd.2	-	13					VPS33A_uc001ucc.2_Intron	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33A						lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		gtctcaaaggaaaaaaaaaaa	0.144													5	3	---	---	---	---	
COMMD6	170622	broad.mit.edu	37	13	76102190	76102190	+	Intron	DEL	A	-	-	rs67236741		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76102190delA	uc001vjo.1	-						COMMD6_uc001vjn.1_Intron|COMMD6_uc010aet.1_Intron|COMMD6_uc001vjp.1_Intron	NM_203495	NP_987091	Q7Z4G1	COMD6_HUMAN	COMM domain containing 6 isoform b							cytoplasm|nucleus	protein binding				0		Breast(118;0.0979)|Prostate(6;0.122)		GBM - Glioblastoma multiforme(99;0.0104)		cactctctccaaaaaaaaaaa	0.000													6	3	---	---	---	---	
DNAL1	83544	broad.mit.edu	37	14	74125865	74125865	+	Intron	DEL	T	-	-	rs36115036		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74125865delT	uc001xoq.3	+						DNAL1_uc010aru.2_Intron|DNAL1_uc010arv.2_Intron	NM_031427	NP_113615	Q4LDG9	DNAL1_HUMAN	axonemal dynein light chain 1												0				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)		TATAGTACAAttttttttttt	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103615609	103615613	+	IGR	DEL	AAAAC	-	-	rs150545566		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103615609_103615613delAAAAC								TNFAIP2 (11833 upstream) : EIF5 (184880 downstream)																							aaaaaaaaaaaaaacaaaaaaaaGA	0.244													5	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106877447	106877448	+	Intron	INS	-	TGATCT	TGATCT	rs144817208	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106877447_106877448insTGATCT	uc010tyt.1	-						uc010tyu.1_In_Frame_Ins_p.168_169insRS					Parts of antibodies, mostly variable regions.												0						GAGGGAGACGACTGAGAAGATG	0.584													7	5	---	---	---	---	
TUBGCP4	27229	broad.mit.edu	37	15	43690580	43690580	+	Intron	DEL	T	-	-	rs5812247		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43690580delT	uc001zro.2	+						TUBGCP4_uc001zrn.2_Intron|TUBGCP4_uc010bdh.2_Intron	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		ccccatctcataaaaaaaaaa	0.090													4	3	---	---	---	---	
SHC4	399694	broad.mit.edu	37	15	49176726	49176727	+	Intron	INS	-	T	T	rs146399374	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49176726_49176727insT	uc001zxb.1	-							NM_203349	NP_976224	Q6S5L8	SHC4_HUMAN	rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		attaaataaacttttttttaaa	0.312													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33396130	33396130	+	IGR	DEL	C	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33396130delC								SLC6A10P (499667 upstream) : MIR1826 (569378 downstream)																							CACCAGGTGACCCCCCCACTG	0.557													4	2	---	---	---	---	
CPD	1362	broad.mit.edu	37	17	28771163	28771163	+	Intron	DEL	A	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28771163delA	uc002hfb.1	+						CPD_uc010wbo.1_Intron|CPD_uc010wbp.1_Intron	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor						proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						AGAGTACACGAAAAAAAAAAA	0.378													4	3	---	---	---	---	
NME1-NME2	654364	broad.mit.edu	37	17	49245465	49245466	+	Intron	DEL	TA	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49245465_49245466delTA	uc002itk.2	+						NME1-NME2_uc002itj.2_Intron|NME2_uc002itl.2_Intron|NME2_uc002itm.2_Intron|NME2_uc002itn.2_Intron|NME2_uc002ito.2_Intron	NM_002512	NP_002503	P22392	NDKB_HUMAN	nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			tatatgtgtgtatatatatata	0.297													4	3	---	---	---	---	
TBC1D3P2	440452	broad.mit.edu	37	17	60347260	60347260	+	Intron	DEL	T	-	-	rs71934275		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60347260delT	uc002izq.2	-						TBC1D3P2_uc010woz.1_Intron|uc010wpa.1_5'Flank					SubName: Full=Putative uncharacterized protein TBC1D3E;												0						CTCTGAATGATTTTTTTTTTT	0.448													3	4	---	---	---	---	
LOC146880	146880	broad.mit.edu	37	17	62775140	62775140	+	3'UTR	DEL	C	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62775140delC	uc002jeu.2	-	3					LOC146880_uc010wqc.1_Intron|LOC146880_uc002jet.1_Intron|LOC146880_uc010wqd.1_Intron	NR_027487				Homo sapiens cDNA FLJ30780 fis, clone FEBRA2000856.												0						AAGGGGTGCTCCACCAGTACG	0.652													4	2	---	---	---	---	
HCN2	610	broad.mit.edu	37	19	603265	603265	+	Intron	DEL	G	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:603265delG	uc002lpe.2	+							NM_001194	NP_001185	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic						cell-cell signaling|muscle contraction	voltage-gated potassium channel complex	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATAGGTGCCTGGGGGGAAGGC	0.711													3	3	---	---	---	---	
ZNF791	163049	broad.mit.edu	37	19	12734684	12734685	+	Intron	INS	-	GGG	GGG	rs2861401		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12734684_12734685insGGG	uc002mua.2	+						ZNF791_uc010xml.1_Intron|ZNF791_uc010dyu.1_Intron|ZNF791_uc010xmm.1_Intron	NM_153358	NP_699189	Q3KP31	ZN791_HUMAN	zinc finger protein 791						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						tttttttttttggggggggaca	0.144													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	17169112	17169113	+	IGR	INS	-	T	T	rs142333729	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17169112_17169113insT								OTOR (436304 upstream) : PCSK2 (37639 downstream)																							AAAAGGCTGCATTTTTTTCTCA	0.416													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29633770	29633771	+	Intron	INS	-	AA	AA	rs145484297	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633770_29633771insAA	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TATTTTAATATGTGTTGTGGTA	0.233													2	4	---	---	---	---	
ATP9A	10079	broad.mit.edu	37	20	50313790	50313791	+	Intron	INS	-	TG	TG	rs150084393	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50313790_50313791insTG	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						gtgtgtgtgtctgtgtgtgtgt	0.287													16	13	---	---	---	---	
PI4KA	5297	broad.mit.edu	37	22	21065588	21065588	+	Intron	DEL	A	-	-	rs68066415		TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21065588delA	uc002zsz.3	-						PI4KA_uc010gsp.2_Intron|PI4KA_uc002zsy.3_Intron	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CCTGGGTGCCAGGGGTGAAGG	0.597													4	2	---	---	---	---	
GGT1	2678	broad.mit.edu	37	22	25016169	25016170	+	Intron	INS	-	T	T	rs28418841	by1000genomes	TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016169_25016170insT	uc003aan.1	+						GGT1_uc003aas.1_Intron|GGT1_uc003aat.1_Intron|GGT1_uc003aau.1_Intron|GGT1_uc003aav.1_Intron|GGT1_uc003aaw.1_Intron|GGT1_uc003aax.1_Intron	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	aaaaaaaaaaaaTCTTTCCTCC	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49467015	49467016	+	IGR	INS	-	A	A			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49467015_49467016insA								FAM19A5 (319273 upstream) : C22orf34 (341160 downstream)																							tccttcgttccttccttccttc	0.000													4	2	---	---	---	---	
CD99	4267	broad.mit.edu	37	X	2651191	2651194	+	Intron	DEL	TCTG	-	-			TCGA-C5-A1MI-01	TCGA-C5-A1MI-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2651191_2651194delTCTG	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						cctgccttcctctgtctctccctt	0.191													4	2	---	---	---	---	
