Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SCNN1D	6339	broad.mit.edu	37	1	1223059	1223059	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1223059G>A	uc001adu.1	+	10	1538	c.914G>A	c.(913-915)GGC>GAC	p.G305D	SCNN1D_uc001adt.1_Missense_Mutation_p.G469D|SCNN1D_uc001adw.2_Missense_Mutation_p.G371D|SCNN1D_uc001adx.2_Missense_Mutation_p.G94D|SCNN1D_uc001adv.2_Missense_Mutation_p.G305D	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		CCAGGAGTCGGCCTGGTCCTC	0.701													3	18	---	---	---	---	PASS
ATAD3B	83858	broad.mit.edu	37	1	1421179	1421179	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1421179C>T	uc001afv.2	+	9	1025	c.924C>T	c.(922-924)CTC>CTT	p.L308L	ATAD3B_uc001afx.2_Silent_p.L262L	NM_031921	NP_114127	Q5T9A4	ATD3B_HUMAN	AAA-ATPase  TOB3	308							ATP binding|nucleoside-triphosphatase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GGCGGCTCCTCAGTCGACCCC	0.667													9	34	---	---	---	---	PASS
PRDM16	63976	broad.mit.edu	37	1	3301735	3301735	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3301735G>A	uc001akf.2	+	4	538	c.458G>A	c.(457-459)AGT>AAT	p.S153N	PRDM16_uc001akc.2_Missense_Mutation_p.S153N|PRDM16_uc001akd.2_Missense_Mutation_p.S153N|PRDM16_uc001ake.2_Missense_Mutation_p.S153N|PRDM16_uc009vlh.2_Translation_Start_Site	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	153	SET.				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GACCTGGGCAGTGAGAAGTTC	0.602			T	EVI1	MDS|AML								24	88	---	---	---	---	PASS
LRRC47	57470	broad.mit.edu	37	1	3703465	3703465	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3703465C>T	uc001akx.1	-	2	1053	c.1025G>A	c.(1024-1026)CGA>CAA	p.R342Q		NM_020710	NP_065761	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	342					translation		phenylalanine-tRNA ligase activity|RNA binding			large_intestine(1)|ovary(1)	2	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GTCCATGCCTCGCACCACGGC	0.637													3	13	---	---	---	---	PASS
PIK3CD	5293	broad.mit.edu	37	1	9784049	9784049	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9784049G>A	uc001aqb.3	+	21	2825	c.2617G>A	c.(2617-2619)GAG>AAG	p.E873K	PIK3CD_uc010oaf.1_Missense_Mutation_p.E872K|PIK3CD_uc001aqe.3_Missense_Mutation_p.E897K	NM_005026	NP_005017	O00329	PK3CD_HUMAN	catalytic phosphatidylinositol 3-kinase delta	873	PI3K/PI4K.				phosphatidylinositol-mediated signaling|protein phosphorylation	phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(4)|skin(2)|central_nervous_system(1)	7	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)		TCGAGCCATTGAGGAGTTCAC	0.398													15	61	---	---	---	---	PASS
DNAJC16	23341	broad.mit.edu	37	1	15863294	15863294	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15863294G>T	uc001aws.2	+	4	679	c.559G>T	c.(559-561)GAA>TAA	p.E187*	DNAJC16_uc001awr.1_Nonsense_Mutation_p.E187*|DNAJC16_uc001awt.2_5'UTR	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	187	Cytoplasmic (Potential).|Thioredoxin.				cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		AGTCATTCAAGAACTGGAAGA	0.303													12	61	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19413195	19413195	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19413195C>G	uc001bbi.2	-	100	14669	c.14665G>C	c.(14665-14667)GAC>CAC	p.D4889H	UBR4_uc010ocv.1_Missense_Mutation_p.D412H|UBR4_uc009vph.2_Missense_Mutation_p.D523H|UBR4_uc010ocw.1_Missense_Mutation_p.D553H|UBR4_uc001bbg.2_Missense_Mutation_p.D600H|UBR4_uc001bbh.2_Missense_Mutation_p.D598H	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	4889					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGATGGCAGTCGTAGTGCACA	0.597													8	49	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27059194	27059194	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27059194C>T	uc001bmv.1	+	4	2204	c.1831C>T	c.(1831-1833)CAG>TAG	p.Q611*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q611*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q611*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q228*	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	611					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ATTTGGGTCTCAGGCATCCTC	0.478			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								22	70	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27100988	27100988	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27100988C>T	uc001bmv.1	+	18	4643	c.4270C>T	c.(4270-4272)CAG>TAG	p.Q1424*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q1423*|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q1041*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.Q270*|ARID1A_uc009vsm.1_Intron|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1424					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCTTCCCCTCAGCAAGATGT	0.622			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								21	76	---	---	---	---	PASS
SFN	2810	broad.mit.edu	37	1	27190424	27190424	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27190424G>A	uc001bnc.1	+	1	792	c.721G>A	c.(721-723)GAG>AAG	p.E241K	uc010ofi.1_RNA	NM_006142	NP_006133	P31947	1433S_HUMAN	stratifin	241					DNA damage response, signal transduction resulting in induction of apoptosis|negative regulation of caspase activity|release of cytochrome c from mitochondria	cytoplasm|extracellular space|nucleus	protein domain specific binding|protein kinase C inhibitor activity				0		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		AGAGGGGGGCGAGGCTCCCCA	0.677													23	26	---	---	---	---	PASS
EYA3	2140	broad.mit.edu	37	1	28326465	28326465	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28326465G>A	uc001bpi.1	-						EYA3_uc010ofs.1_Intron|EYA3_uc010oft.1_Intron|EYA3_uc001bpj.2_Intron|EYA3_uc001bpk.1_Intron|EYA3_uc010ofu.1_Intron	NM_001990	NP_001981	Q99504	EYA3_HUMAN	eyes absent 3						anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity			ovary(2)|skin(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		AATTTAAAATGCTTACCTCTA	0.333													22	57	---	---	---	---	PASS
SF3A3	10946	broad.mit.edu	37	1	38444715	38444715	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38444715G>A	uc001cci.2	-	10	896	c.772C>T	c.(772-774)CTG>TTG	p.L258L	SF3A3_uc010oik.1_Silent_p.L205L	NM_006802	NP_006793	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3	258					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nuclear speck	nucleic acid binding|protein binding|zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TCCAAACCCAGAGAAGCCAAC	0.398													15	64	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39916808	39916808	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39916808G>A	uc010oiu.1	+	50	15803	c.15672G>A	c.(15670-15672)GTG>GTA	p.V5224V	MACF1_uc010ois.1_Silent_p.V4722V	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TATACAAGGTGGAGCCACAGC	0.547													24	92	---	---	---	---	PASS
KCNQ4	9132	broad.mit.edu	37	1	41283021	41283021	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41283021C>T	uc001cgh.1	+	2	481	c.399C>T	c.(397-399)CTC>CTT	p.L133L	KCNQ4_uc001cgi.1_Silent_p.L133L	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein	133	Helical; Name=Segment S2; (Potential).				sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			AGTGTCTCCTCATCTTGGTAA	0.577													8	30	---	---	---	---	PASS
LEPRE1	64175	broad.mit.edu	37	1	43215940	43215940	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43215940C>A	uc001chv.2	-	11	1750	c.1637G>T	c.(1636-1638)CGG>CTG	p.R546L	LEPRE1_uc001chw.2_Missense_Mutation_p.R546L|LEPRE1_uc001chx.3_Missense_Mutation_p.R546L	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	546					negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CATGATGCGCCGCACCTTCTC	0.577													3	15	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44054405	44054405	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44054405G>A	uc001cjr.2	+	8	1023	c.683G>A	c.(682-684)CGC>CAC	p.R228H	PTPRF_uc001cjs.2_Missense_Mutation_p.R228H|PTPRF_uc001cju.2_5'Flank|PTPRF_uc009vwt.2_5'Flank|PTPRF_uc001cjv.2_5'Flank	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	228	Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCTGCAGTGCGCCGCGTGGCT	0.662													6	30	---	---	---	---	PASS
KIF2C	11004	broad.mit.edu	37	1	45213065	45213065	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45213065G>C	uc001cmg.3	+	3	290	c.175G>C	c.(175-177)GAT>CAT	p.D59H	KIF2C_uc010olb.1_Missense_Mutation_p.D59H|KIF2C_uc010olc.1_5'UTR|KIF2C_uc001cmh.3_Missense_Mutation_p.D5H	NM_006845	NP_006836	Q99661	KIF2C_HUMAN	kinesin family member 2C	59	Globular (Potential).				blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					GATTGATTTTGATGATGTGGC	0.328													12	59	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75037649	75037649	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037649C>T	uc001dgg.2	-	14	3964	c.3745G>A	c.(3745-3747)GAC>AAC	p.D1249N		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1249	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						GCGCAGGAGTCGTGATCTTTG	0.602													51	53	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91742305	91742305	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91742305G>A	uc001doa.3	-						HFM1_uc009wdb.2_Intron|HFM1_uc010osu.1_Intron|HFM1_uc001dob.3_Intron|HFM1_uc010osv.1_Intron	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTTTACCTATGAAAAGAAACT	0.269													8	30	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91742578	91742578	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91742578G>A	uc001doa.3	-	31	3533	c.3433C>T	c.(3433-3435)CAT>TAT	p.H1145Y	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Missense_Mutation_p.H824Y|HFM1_uc001dob.3_Missense_Mutation_p.H333Y|HFM1_uc010osv.1_Missense_Mutation_p.H829Y	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	1145							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTACAAAGATGATTGCATTCT	0.308													34	147	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91778974	91778974	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91778974C>G	uc001doa.3	-	30	3423	c.3323G>C	c.(3322-3324)AGA>ACA	p.R1108T	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Missense_Mutation_p.R787T|HFM1_uc001dob.3_Missense_Mutation_p.R296T|HFM1_uc010osv.1_Missense_Mutation_p.R792T	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	1108							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TTCAGATTTTCTTTGCATAGT	0.313													21	64	---	---	---	---	PASS
F3	2152	broad.mit.edu	37	1	94996028	94996028	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94996028C>T	uc001dqr.2	-	6	1055	c.876G>A	c.(874-876)CTG>CTA	p.L292L	F3_uc001dqp.2_RNA|F3_uc001dqq.2_RNA|F3_uc001dqs.2_Silent_p.*239*	NM_001993	NP_001984	P13726	TF_HUMAN	coagulation factor III precursor	292	Cytoplasmic (Potential).				activation of caspase activity|activation of plasma proteins involved in acute inflammatory response|anti-apoptosis|blood coagulation, extrinsic pathway|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of protein kinase B signaling cascade	extracellular matrix|extracellular space|integral to membrane	cell surface binding|phospholipid binding|protease binding			central_nervous_system(1)	1		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	ATGAAACATTCAGTGGGGAGT	0.438													11	67	---	---	---	---	PASS
HIAT1	64645	broad.mit.edu	37	1	100534153	100534153	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100534153C>T	uc001dst.2	+							NM_033055	NP_149044	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1						transmembrane transport	integral to membrane|plasma membrane	transporter activity				0		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		GTAAAATCCTCTTCCACTAAG	0.368													22	90	---	---	---	---	PASS
CHI3L2	1117	broad.mit.edu	37	1	111773361	111773361	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111773361C>T	uc001eam.2	+						CHI3L2_uc001ean.2_Intron|CHI3L2_uc001eao.2_Intron|CHI3L2_uc009wga.2_Intron	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a						chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		CACTCTACTCCAGGATCTGCC	0.488													8	40	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114498227	114498227	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114498227G>C	uc001eem.2	+	5	1524	c.1363G>C	c.(1363-1365)GAA>CAA	p.E455Q	HIPK1_uc001eel.2_Missense_Mutation_p.E455Q|HIPK1_uc001een.2_Missense_Mutation_p.E455Q|HIPK1_uc001eeo.2_Missense_Mutation_p.E81Q|HIPK1_uc001eep.2_Missense_Mutation_p.E61Q	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	455	Protein kinase.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAATCAAAAGAAGCTCGGAA	0.323													22	109	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114505025	114505025	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114505025C>T	uc001eem.2	+	9	2229	c.2068C>T	c.(2068-2070)CAG>TAG	p.Q690*	HIPK1_uc001eel.2_Nonsense_Mutation_p.Q690*|HIPK1_uc001een.2_Nonsense_Mutation_p.Q690*|HIPK1_uc001eeo.2_Nonsense_Mutation_p.Q316*|HIPK1_uc001eep.2_Nonsense_Mutation_p.Q296*|HIPK1_uc001eeq.2_5'Flank	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	690					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCAGCTGCTCAGCCACTACA	0.443													16	74	---	---	---	---	PASS
PLEKHO1	51177	broad.mit.edu	37	1	150129573	150129573	+	Intron	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150129573C>G	uc001ett.2	+						PLEKHO1_uc001etr.2_Intron|PLEKHO1_uc001ets.2_Intron|PLEKHO1_uc001etu.2_Intron	NM_016274	NP_057358	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O							cytoplasm|nucleus|plasma membrane				lung(1)	1	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGTACATCTCTTCAGGTCAC	0.557													11	29	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152187617	152187617	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152187617C>G	uc001ezt.1	-	3	6564	c.6488G>C	c.(6487-6489)GGG>GCG	p.G2163A		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2163	24.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAGCCAGACCCATGCTGACC	0.622													28	580	---	---	---	---	PASS
AQP10	89872	broad.mit.edu	37	1	154296858	154296858	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154296858G>A	uc001feu.2	+	6	848	c.808G>A	c.(808-810)GAG>AAG	p.E270K	AQP10_uc001fev.2_3'UTR|ATP8B2_uc001few.2_5'Flank	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	270	Extracellular (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GCACCACCCTGAGGGCCCAGA	0.592											OREG0013832	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	88	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155319338	155319338	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155319338C>T	uc009wqq.2	-	18	7911	c.7431G>A	c.(7429-7431)AAG>AAA	p.K2477K	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Silent_p.K2472K	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2477	Bromo.				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CCTACTTTTTCTTTGGGGGAA	0.438													12	45	---	---	---	---	PASS
NCSTN	23385	broad.mit.edu	37	1	160319399	160319399	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160319399G>C	uc001fvx.2	+	4	499	c.375G>C	c.(373-375)TTG>TTC	p.L125F	NCSTN_uc009wtk.1_RNA|NCSTN_uc001fvy.2_Missense_Mutation_p.L105F|NCSTN_uc010pjf.1_Missense_Mutation_p.L125F|NCSTN_uc001fvz.2_5'Flank|NCSTN_uc010pjg.1_5'Flank	NM_015331	NP_056146	Q92542	NICA_HUMAN	nicastrin precursor	125	Extracellular (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane|melanosome	protein binding			ovary(1)|lung(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGTGTCCTTGACCAAGCCCA	0.502													17	78	---	---	---	---	PASS
CD48	962	broad.mit.edu	37	1	160651194	160651194	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160651194C>T	uc001fwn.2	-	3	482	c.450G>A	c.(448-450)TTG>TTA	p.L150L	CD48_uc001fwo.1_Silent_p.L150L	NM_001778	NP_001769	P09326	CD48_HUMAN	CD48 molecule precursor	150	Ig-like C2-type 2.				blood coagulation|defense response|leukocyte migration	integral to plasma membrane|membrane raft	protein binding				0	all_cancers(52;2.18e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			ATGACAGTTTCAGATAACAGT	0.453													31	127	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161018558	161018558	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161018558C>G	uc001fxl.2	-	12	2599	c.2253G>C	c.(2251-2253)GAG>GAC	p.E751D	USF1_uc001fxi.2_5'Flank|USF1_uc001fxj.2_5'Flank|ARHGAP30_uc001fxk.2_Intron|ARHGAP30_uc001fxm.2_Missense_Mutation_p.E597D|ARHGAP30_uc009wtx.2_Missense_Mutation_p.E424D	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	751	Glu-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CCTCTTCTCTCTCAATTTCTT	0.483													9	237	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161018907	161018907	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161018907C>G	uc001fxl.2	-	12	2250	c.1904G>C	c.(1903-1905)GGA>GCA	p.G635A	ARHGAP30_uc001fxk.2_Missense_Mutation_p.G635A|ARHGAP30_uc001fxm.2_Missense_Mutation_p.G481A|ARHGAP30_uc009wtx.2_Missense_Mutation_p.G308A|ARHGAP30_uc001fxn.1_Missense_Mutation_p.G481A	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	635					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TGCTGCCTCTCCCTCCAGACT	0.587													6	183	---	---	---	---	PASS
ADAMTS4	9507	broad.mit.edu	37	1	161166037	161166037	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161166037G>C	uc001fyt.3	-	3	1442	c.1014C>G	c.(1012-1014)GTC>GTG	p.V338V	ADAMTS4_uc001fyu.2_3'UTR	NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	338	Peptidase M12B.				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCGGGTCACAGACGGTGCCCA	0.567													10	58	---	---	---	---	PASS
C1orf226	400793	broad.mit.edu	37	1	162353076	162353076	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162353076C>A	uc001gby.2	+	2	594	c.422C>A	c.(421-423)TCA>TAA	p.S141*	C1orf226_uc010pkt.1_Nonsense_Mutation_p.S184*	NM_001085375	NP_001078844	A1L170	CA226_HUMAN	hypothetical protein LOC400793 isoform 2	141										ovary(1)	1						CTGATTTCATCACAGCCTGTC	0.602													5	12	---	---	---	---	PASS
DCAF6	55827	broad.mit.edu	37	1	167973897	167973897	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167973897C>T	uc001gew.2	+	10	1486	c.1244C>T	c.(1243-1245)TCT>TTT	p.S415F	DCAF6_uc001gev.2_Missense_Mutation_p.S415F|DCAF6_uc001gex.2_Missense_Mutation_p.S415F|DCAF6_uc010plk.1_Missense_Mutation_p.S384F|DCAF6_uc001gey.2_Missense_Mutation_p.S268F	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b	415					positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						tctacatcctctacaatgtca	0.179													5	27	---	---	---	---	PASS
SOAT1	6646	broad.mit.edu	37	1	179311991	179311991	+	Intron	SNP	T	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179311991T>C	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	AGTTTTCCTTTTCTAGGCACT	0.393													17	92	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186064492	186064492	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186064492G>A	uc001grq.1	+	68	10641	c.10412G>A	c.(10411-10413)AGA>AAA	p.R3471K		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3471	Ig-like C2-type 33.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GCCTGGCTTAGAGATGGCCAG	0.517													16	59	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276247	186276247	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276247G>A	uc001gru.3	+	7	1447	c.1396G>A	c.(1396-1398)GAG>AAG	p.E466K	PRG4_uc001grt.3_Missense_Mutation_p.E425K|PRG4_uc009wyl.2_Missense_Mutation_p.E373K|PRG4_uc009wym.2_Missense_Mutation_p.E332K|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	466	16; approximate.|59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CACTCCCAAGGAGCCTGCACC	0.657													17	70	---	---	---	---	PASS
IGFN1	91156	broad.mit.edu	37	1	201185875	201185875	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201185875C>T	uc001gwc.2	+	5	1841	c.1069C>T	c.(1069-1071)CCT>TCT	p.P357S	IGFN1_uc001gwb.2_RNA	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3						ATTGGTGGCTCCTGAGGGTGA	0.647													11	54	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201843373	201843373	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201843373C>T	uc001gwz.2	+							NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9						protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						TTTCTTCCTTCCCAGACCCAG	0.517													19	97	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201843430	201843430	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201843430C>T	uc001gwz.2	+	21	2813	c.2763C>T	c.(2761-2763)ATC>ATT	p.I921I		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	921					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						TAAAGCTGATCATCAACGAGC	0.522													15	99	---	---	---	---	PASS
KDM5B	10765	broad.mit.edu	37	1	202698923	202698923	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202698923G>C	uc001gyf.2	-	26	4525	c.4409C>G	c.(4408-4410)TCA>TGA	p.S1470*	KDM5B_uc009xag.2_Nonsense_Mutation_p.S1506*|KDM5B_uc001gyg.1_Nonsense_Mutation_p.S1312*	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B	1470					negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						GGATGTGTCTGAGGGCAGGGA	0.483													37	160	---	---	---	---	PASS
ZC3H11A	9877	broad.mit.edu	37	1	203819761	203819761	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203819761C>T	uc001hac.2	+	18	2674	c.2058C>T	c.(2056-2058)CTC>CTT	p.L686L	ZC3H11A_uc001had.2_Silent_p.L686L|ZC3H11A_uc001hae.2_Silent_p.L686L|ZC3H11A_uc001haf.2_Silent_p.L686L|ZC3H11A_uc010pqm.1_Silent_p.L632L	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	686							nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGAAGCCACTCAGCTCCAGCA	0.502													21	72	---	---	---	---	PASS
ZC3H11A	9877	broad.mit.edu	37	1	203821436	203821436	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203821436C>T	uc001hac.2	+	20	2958	c.2342C>T	c.(2341-2343)TCA>TTA	p.S781L	ZC3H11A_uc001had.2_Missense_Mutation_p.S781L|ZC3H11A_uc001hae.2_Missense_Mutation_p.S781L|ZC3H11A_uc001haf.2_Missense_Mutation_p.S781L|ZC3H11A_uc010pqm.1_Missense_Mutation_p.S727L	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	781							nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGGGAGATTTCAGGAGGCAAA	0.463													9	59	---	---	---	---	PASS
RBBP5	5929	broad.mit.edu	37	1	205069166	205069166	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205069166G>C	uc001hbu.1	-	8	909	c.779C>G	c.(778-780)TCT>TGT	p.S260C	RBBP5_uc010prd.1_Missense_Mutation_p.S295C|RBBP5_uc001hbv.1_Missense_Mutation_p.S260C|RBBP5_uc010pre.1_Missense_Mutation_p.S127C	NM_005057	NP_005048	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	260	WD 5.				histone H3-K4 methylation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription, DNA-dependent	MLL1 complex|Set1C/COMPASS complex	methylated histone residue binding|transcription regulatory region DNA binding			lung(1)	1	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CCCATCCCCAGAGAAACAACA	0.507													5	128	---	---	---	---	PASS
RBBP5	5929	broad.mit.edu	37	1	205070807	205070807	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205070807G>A	uc001hbu.1	-	6	683	c.553C>T	c.(553-555)CTT>TTT	p.L185F	RBBP5_uc010prd.1_Missense_Mutation_p.L220F|RBBP5_uc001hbv.1_Missense_Mutation_p.L185F|RBBP5_uc010pre.1_Missense_Mutation_p.L52F	NM_005057	NP_005048	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	185	WD 3.				histone H3-K4 methylation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription, DNA-dependent	MLL1 complex|Set1C/COMPASS complex	methylated histone residue binding|transcription regulatory region DNA binding			lung(1)	1	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			GAAGCAACAAGATCCTGAGAA	0.393													6	188	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214170608	214170608	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214170608G>C	uc001hkh.2	+	2	1002	c.730G>C	c.(730-732)GAG>CAG	p.E244Q	PROX1_uc001hkg.1_Missense_Mutation_p.E244Q	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	244					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		ACAGCAGCTGGAGGACATGCA	0.507													8	47	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214170875	214170875	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214170875G>C	uc001hkh.2	+	2	1269	c.997G>C	c.(997-999)GAA>CAA	p.E333Q	PROX1_uc001hkg.1_Missense_Mutation_p.E333Q	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	333					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CAACAACAAAGAAAGAGACCA	0.507													13	32	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214171342	214171342	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214171342G>C	uc001hkh.2	+	2	1736	c.1464G>C	c.(1462-1464)TTG>TTC	p.L488F	PROX1_uc001hkg.1_Missense_Mutation_p.L488F	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	488					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CCCTTCCCTTGATGGCCTATC	0.602													23	96	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227335194	227335194	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227335194C>G	uc001hqr.2	-	7	1703	c.760G>C	c.(760-762)GAT>CAT	p.D254H	CDC42BPA_uc001hqs.2_Missense_Mutation_p.D254H|CDC42BPA_uc009xes.2_Missense_Mutation_p.D254H|CDC42BPA_uc010pvs.1_Missense_Mutation_p.D254H	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	254	Protein kinase.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				CCTTTTCCATCTTCCATGGCT	0.403													25	68	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228563770	228563770	+	Silent	SNP	C	T	T	rs113725359		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228563770C>T	uc009xez.1	+	99	22892	c.22848C>T	c.(22846-22848)CTC>CTT	p.L7616L	OBSCN_uc001hsr.1_Silent_p.L2245L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	7616	Fibronectin type-III 4.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCAGCAAGCTCTCCCGGGGTG	0.652													22	99	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236717916	236717916	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236717916C>T	uc001hyd.1	-	42	6185	c.6060G>A	c.(6058-6060)ATG>ATA	p.M2020I	HEATR1_uc009xgh.1_Missense_Mutation_p.M1182I	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	2020					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CCAGAGGCATCATCAAGGCTT	0.408													17	107	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947567	237947567	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947567G>A	uc001hyl.1	+	90	12675	c.12555G>A	c.(12553-12555)AAG>AAA	p.K4185K	RYR2_uc010pya.1_Silent_p.K600K	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4185					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGAAAGAGAAGATGGAACTCT	0.517													22	87	---	---	---	---	PASS
OR2G2	81470	broad.mit.edu	37	1	247752501	247752501	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247752501C>G	uc010pyy.1	+	1	840	c.840C>G	c.(838-840)TTC>TTG	p.F280L		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TTTCTCTCTTCTACACTGTGG	0.363													41	132	---	---	---	---	PASS
OR14A16	284532	broad.mit.edu	37	1	247978612	247978612	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247978612G>C	uc001idm.1	-	1	420	c.420C>G	c.(418-420)GTC>GTG	p.V140V		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	140	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGGCTCTTTGGACACAGGTGC	0.527													13	118	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15432833	15432833	+	Missense_Mutation	SNP	C	T	T	rs145651640		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15432833C>T	uc002rcc.1	-	41	4881	c.4855G>A	c.(4855-4857)GAA>AAA	p.E1619K	NBAS_uc010exl.1_Missense_Mutation_p.E691K|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1619										ovary(2)|liver(1)|skin(1)	4						GGCCAGGCTTCGTGCTCATGT	0.468													23	35	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21233619	21233619	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21233619C>G	uc002red.2	-	26	6249	c.6121G>C	c.(6121-6123)GAG>CAG	p.E2041Q		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2041					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TCTCTCATCTCTAAAGCATCA	0.403													43	90	---	---	---	---	PASS
ATP6V1E2	90423	broad.mit.edu	37	2	46739702	46739702	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46739702C>T	uc002ruy.2	-	2	1263	c.149G>A	c.(148-150)CGA>CAA	p.R50Q	ATP6V1E2_uc002ruz.2_Missense_Mutation_p.R50Q	NM_080653	NP_542384	Q96A05	VATE2_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1	50					cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain	proton-transporting ATPase activity, rotational mechanism			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)			AATCTTCAGTCGTTGGGTTTG	0.458													13	189	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48808940	48808940	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48808940C>T	uc010yol.1	+	1	1215	c.1168C>T	c.(1168-1170)CTG>TTG	p.L390L	STON1_uc002rwo.3_Silent_p.L390L|STON1_uc010fbm.2_Silent_p.L390L|STON1-GTF2A1L_uc002rwp.1_Silent_p.L390L|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Silent_p.L390L	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	390					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CCTTGACTTTCTGACTACTGT	0.418													28	35	---	---	---	---	PASS
RTN4	57142	broad.mit.edu	37	2	55252291	55252291	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55252291G>A	uc002rye.2	-	3	3242	c.2944C>T	c.(2944-2946)CCT>TCT	p.P982S	RTN4_uc002ryd.2_Missense_Mutation_p.P776S|RTN4_uc002ryf.2_Intron|RTN4_uc002ryg.2_Intron	NM_020532	NP_065393	Q9NQC3	RTN4_HUMAN	reticulon 4 isoform A	982	Cytoplasmic (Potential).				apoptosis|axonal fasciculation|cerebral cortex radial glia guided migration|endoplasmic reticulum tubular network organization|negative regulation of anti-apoptosis|negative regulation of axon extension|nerve growth factor receptor signaling pathway|regulation of apoptosis|regulation of branching morphogenesis of a nerve|regulation of cell migration	integral to endoplasmic reticulum membrane|nuclear envelope|plasma membrane	protein binding			ovary(2)|large_intestine(1)	3						GTATCGGAAGGAAGTTTTTTC	0.398													26	73	---	---	---	---	PASS
RTN4	57142	broad.mit.edu	37	2	55253040	55253040	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55253040G>C	uc002rye.2	-	3	2493	c.2195C>G	c.(2194-2196)TCT>TGT	p.S732C	RTN4_uc002ryd.2_Missense_Mutation_p.S526C|RTN4_uc002ryf.2_Intron|RTN4_uc002ryg.2_Intron	NM_020532	NP_065393	Q9NQC3	RTN4_HUMAN	reticulon 4 isoform A	732	Cytoplasmic (Potential).				apoptosis|axonal fasciculation|cerebral cortex radial glia guided migration|endoplasmic reticulum tubular network organization|negative regulation of anti-apoptosis|negative regulation of axon extension|nerve growth factor receptor signaling pathway|regulation of apoptosis|regulation of branching morphogenesis of a nerve|regulation of cell migration	integral to endoplasmic reticulum membrane|nuclear envelope|plasma membrane	protein binding			ovary(2)|large_intestine(1)	3						AACTAGCTCAGAATGATCAGG	0.383													32	71	---	---	---	---	PASS
XPO1	7514	broad.mit.edu	37	2	61709528	61709528	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61709528G>A	uc002sbj.2	-	23	3687	c.2959C>T	c.(2959-2961)CCT>TCT	p.P987S	XPO1_uc010fcl.2_Missense_Mutation_p.P983S|XPO1_uc010ypn.1_Missense_Mutation_p.P983S|XPO1_uc002sbk.2_Missense_Mutation_p.P548S|XPO1_uc002sbg.2_Missense_Mutation_p.P184S|XPO1_uc002sbh.2_Missense_Mutation_p.P634S	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1	987					intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TGTAGGTGAGGGAAGGCCGAC	0.259													24	84	---	---	---	---	PASS
SLC1A4	6509	broad.mit.edu	37	2	65217093	65217093	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65217093G>A	uc010yqa.1	+	1	638	c.316G>A	c.(316-318)GAT>AAT	p.D106N	SLC1A4_uc010ypy.1_Intron|SLC1A4_uc010ypz.1_Intron|SLC1A4_uc010fcv.2_Missense_Mutation_p.D106N	NM_003038	NP_003029	P43007	SATT_HUMAN	solute carrier family 1, member 4 isoform 1	106	Helical; (Potential).				cellular nitrogen compound metabolic process|cognition|synaptic transmission, glutamatergic	intermediate filament|melanosome	chloride channel activity|L-alanine transmembrane transporter activity|L-cystine transmembrane transporter activity|L-hydroxyproline transmembrane transporter activity|L-proline transmembrane transporter activity|L-serine transmembrane transporter activity|L-threonine transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(1)	1					L-Alanine(DB00160)	CGCCTCGCTCGATGCCAGCTG	0.677													3	3	---	---	---	---	PASS
ANTXR1	84168	broad.mit.edu	37	2	69472574	69472574	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69472574G>T	uc002sfg.2	+	18	2008	c.1652G>T	c.(1651-1653)AGG>ATG	p.R551M		NM_032208	NP_115584	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1 isoform 1 precursor	551	Cytoplasmic (Potential).|Pro-rich.				actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)|skin(2)	4						cctcccaacagggcacctcct	0.174									Familial_Infantile_Hemangioma				3	31	---	---	---	---	PASS
GFPT1	2673	broad.mit.edu	37	2	69565691	69565691	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69565691G>C	uc002sfh.2	-	13	1335	c.1156C>G	c.(1156-1158)CAA>GAA	p.Q386E		NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate	404	SIS 1.				dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1						TCAAGAACTTGACGTGTCTGC	0.398													18	34	---	---	---	---	PASS
LOXL3	84695	broad.mit.edu	37	2	74762422	74762422	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74762422C>G	uc002smp.1	-	9	1648	c.1576G>C	c.(1576-1578)GAG>CAG	p.E526Q	LOXL3_uc002smo.1_Missense_Mutation_p.E165Q|LOXL3_uc010ffm.1_Missense_Mutation_p.E470Q|LOXL3_uc002smq.1_Missense_Mutation_p.E381Q|LOXL3_uc010ffn.1_Missense_Mutation_p.E381Q	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	526						extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0						CACTCACTCTCAGAACAGATG	0.592													6	24	---	---	---	---	PASS
SEMA4F	10505	broad.mit.edu	37	2	74901687	74901687	+	Silent	SNP	G	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74901687G>T	uc002sna.1	+	8	996	c.885G>T	c.(883-885)CTG>CTT	p.L295L	SEMA4F_uc010ysb.1_3'UTR|SEMA4F_uc010ffq.1_Silent_p.L262L|SEMA4F_uc010ffr.1_5'UTR|SEMA4F_uc002snb.1_5'UTR|SEMA4F_uc002snc.1_Silent_p.L140L	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	295	Sema.|Extracellular (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						AAGCTGACCTGCTCTGTCCAG	0.587													5	103	---	---	---	---	PASS
EIF5B	9669	broad.mit.edu	37	2	99992929	99992929	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99992929G>A	uc002tab.2	+	10	1856	c.1672G>A	c.(1672-1674)GAA>AAA	p.E558K		NM_015904	NP_056988	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	558	Asp/Glu-rich (acidic).				regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(2)|pancreas(1)	3						gggagaaAGTGAAGGCAGTGA	0.239													7	29	---	---	---	---	PASS
LONRF2	164832	broad.mit.edu	37	2	100903453	100903453	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100903453C>T	uc002tal.3	-	11	2633	c.1993G>A	c.(1993-1995)GCG>ACG	p.A665T	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	665	Lon.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						TGGAGAGACGCGAACCAGGAA	0.488													12	44	---	---	---	---	PASS
C2orf76	130355	broad.mit.edu	37	2	120069238	120069238	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120069238G>C	uc002tls.2	-	6	805	c.264C>G	c.(262-264)CTC>CTG	p.L88L	C2orf76_uc010flf.1_Silent_p.L88L|C2orf76_uc010yyg.1_RNA|C2orf76_uc002tlt.2_Silent_p.L88L|C2orf76_uc002tlu.2_Silent_p.L88L	NM_001017927	NP_001017927	Q3KRA6	CB076_HUMAN	hypothetical protein LOC130355	88											0						CTTTCAGCAGGAGTCTTTCGT	0.463													6	22	---	---	---	---	PASS
BIN1	274	broad.mit.edu	37	2	127827588	127827588	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127827588G>A	uc002tns.1	-	5	739	c.394C>T	c.(394-396)CAG>TAG	p.Q132*	BIN1_uc010yzf.1_Nonsense_Mutation_p.Q108*|BIN1_uc010yzg.1_Nonsense_Mutation_p.Q132*|BIN1_uc002tnu.1_Nonsense_Mutation_p.Q132*|BIN1_uc002toa.1_Nonsense_Mutation_p.Q132*|BIN1_uc002tnt.1_Nonsense_Mutation_p.Q132*|BIN1_uc002tnv.1_Nonsense_Mutation_p.Q132*|BIN1_uc002tnw.1_Nonsense_Mutation_p.Q132*|BIN1_uc002tnx.1_Nonsense_Mutation_p.Q132*|BIN1_uc002tny.1_Nonsense_Mutation_p.Q132*|BIN1_uc002tnz.1_Nonsense_Mutation_p.Q132*|BIN1_uc002tob.1_Nonsense_Mutation_p.Q132*|BIN1_uc002toc.1_Nonsense_Mutation_p.Q132*	NM_139343	NP_647593	O00499	BIN1_HUMAN	bridging integrator 1 isoform 1	132	BAR.				cell proliferation|endocytosis|interspecies interaction between organisms|multicellular organismal development	actin cytoskeleton|nucleus				ovary(2)|central_nervous_system(2)|skin(2)|lung(1)	7	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		TCGGGGAACTGGCCCAGGTAC	0.607													7	40	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141243034	141243034	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141243034G>C	uc002tvj.1	-	59	10275	c.9303C>G	c.(9301-9303)CTC>CTG	p.L3101L		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3101	Extracellular (Potential).|LDL-receptor class B 29.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGACCAATAGAGGTTTTTTC	0.398										TSP Lung(27;0.18)			16	47	---	---	---	---	PASS
TNFAIP6	7130	broad.mit.edu	37	2	152226592	152226592	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152226592C>T	uc002txk.2	+	4	529	c.453C>T	c.(451-453)TTC>TTT	p.F151F		NM_007115	NP_009046	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	151	CUB.				cell adhesion|cell-cell signaling|inflammatory response|signal transduction		hyaluronic acid binding				0				BRCA - Breast invasive adenocarcinoma(221;0.131)		CTCCAGGCTTCCCAAATGAGT	0.383													40	101	---	---	---	---	PASS
UPP2	151531	broad.mit.edu	37	2	158977950	158977950	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158977950G>A	uc002tzp.2	+	5	678	c.484G>A	c.(484-486)GAT>AAT	p.D162N	UPP2_uc002tzo.2_Missense_Mutation_p.D219N	NM_173355	NP_775491	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform a	162					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0						TGTAATAACGGATATAGCTGT	0.398													59	152	---	---	---	---	PASS
SLC25A12	8604	broad.mit.edu	37	2	172648021	172648021	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172648021G>A	uc002uhh.2	-	15	1614	c.1525C>T	c.(1525-1527)CTG>TTG	p.L509L	SLC25A12_uc010fqh.2_Silent_p.L402L	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12	509					gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	TCATCAGCCAGAAGTAGTTTG	0.423													18	53	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179401691	179401691	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179401691G>A	uc010zfg.1	-	305	92665	c.92441C>T	c.(92440-92442)TCA>TTA	p.S30814L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S24509L|TTN_uc010zfi.1_Missense_Mutation_p.S24442L|TTN_uc010zfj.1_Missense_Mutation_p.S24317L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31741							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATCACAACTGAGGACACTTC	0.393													8	11	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179634578	179634578	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179634578G>A	uc010zfg.1	-	37	8954	c.8730C>T	c.(8728-8730)GTC>GTT	p.V2910V	TTN_uc010zfh.1_Silent_p.V2864V|TTN_uc010zfi.1_Silent_p.V2864V|TTN_uc010zfj.1_Silent_p.V2864V|TTN_uc002unb.2_Silent_p.V2910V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2910							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACATGGAAGGGACATTGAAGT	0.413													4	140	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183860443	183860443	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183860443C>T	uc002upc.2	-	7	1129	c.727G>A	c.(727-729)GCA>ACA	p.A243T	NCKAP1_uc002upb.2_Missense_Mutation_p.A249T	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	243					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCGGACTGTGCTGGATTAAGC	0.368													21	50	---	---	---	---	PASS
SLC39A10	57181	broad.mit.edu	37	2	196545334	196545334	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196545334C>T	uc002utg.3	+	2	782	c.568C>T	c.(568-570)CAT>TAT	p.H190Y	SLC39A10_uc002uth.3_Missense_Mutation_p.H190Y|SLC39A10_uc010zgp.1_Intron	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),	190	His-rich.				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)			TCATCTTGATCATAACAACAC	0.413													31	70	---	---	---	---	PASS
NOP58	51602	broad.mit.edu	37	2	203155173	203155173	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203155173G>A	uc002uzb.2	+	7	777	c.627G>A	c.(625-627)CAG>CAA	p.Q209Q	SNORD11B_uc010ftq.1_5'Flank|SNORD11_uc002uzd.1_5'Flank	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog	209				LTYCKCLQKVGDRKNYASAK -> YHTASVYRKLAIGRLCL CQ (in Ref. 6; AAF29084).	cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						AGTGTTTACAGAAAGTTGGTG	0.318													12	37	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204073911	204073911	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204073911C>T	uc002uzt.3	+	52	7897	c.7564C>T	c.(7564-7566)CAG>TAG	p.Q2522*	NBEAL1_uc002uzs.3_Nonsense_Mutation_p.Q1163*|NBEAL1_uc002uzu.2_Nonsense_Mutation_p.Q17*	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	2522	WD 2.						binding			ovary(1)|skin(1)	2						ACATACCATTCAGAAAGGTCA	0.378													29	69	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207171629	207171629	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207171629G>C	uc002vbp.2	+	5	2627	c.2377G>C	c.(2377-2379)GAT>CAT	p.D793H		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	793							nucleic acid binding|zinc ion binding			ovary(3)	3						AATAACTTTTGATTCTGATAT	0.383													27	56	---	---	---	---	PASS
BARD1	580	broad.mit.edu	37	2	215645841	215645841	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215645841G>A	uc002veu.2	-	4	892	c.757C>T	c.(757-759)CAG>TAG	p.Q253*	BARD1_uc010zjm.1_Nonsense_Mutation_p.Q109*	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	253					cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CCATTTATCTGAGGACTGGAG	0.393									Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				7	85	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215819966	215819966	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215819966G>A	uc002vew.2	-	43	6573	c.6353C>T	c.(6352-6354)TCA>TTA	p.S2118L	ABCA12_uc002vev.2_Missense_Mutation_p.S1800L|ABCA12_uc010zjn.1_Missense_Mutation_p.S1045L	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	2118	Helical; (Potential).				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTATACCACTGACAGGGAAAC	0.408													11	45	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217347643	217347643	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217347643G>C	uc002vgc.3	+	18	3138	c.2808G>C	c.(2806-2808)CAG>CAC	p.Q936H	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.Q936H|SMARCAL1_uc010fvg.2_Missense_Mutation_p.Q914H	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	936					chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CCAGTCCACAGAAGAAAAGGA	0.418									Schimke_Immuno-Osseous_Dysplasia				48	129	---	---	---	---	PASS
WNT6	7475	broad.mit.edu	37	2	219738577	219738577	+	3'UTR	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219738577C>A	uc002vjc.1	+	4						NM_006522	NP_006513	Q9Y6F9	WNT6_HUMAN	wingless-type MMTV integration site family,						anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|cornea development in camera-type eye|neuron differentiation|odontogenesis of dentine-containing tooth|positive regulation of gene expression|positive regulation of tooth mineralization|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			ovary(2)|skin(1)	3		Renal(207;0.0474)		Epithelial(149;4.53e-07)|all cancers(144;9.3e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCCGCCGCCCGGCCGCTAGA	0.701													2	2	---	---	---	---	PASS
STK16	8576	broad.mit.edu	37	2	220112958	220112958	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220112958C>T	uc002vko.2	+	7	858	c.701C>T	c.(700-702)CCT>CTT	p.P234L	GLB1L_uc002vkm.2_5'Flank|GLB1L_uc002vkn.2_5'Flank|STK16_uc002vks.2_Missense_Mutation_p.P116L|STK16_uc002vkp.2_Missense_Mutation_p.P234L|STK16_uc002vkr.2_Missense_Mutation_p.P167L|STK16_uc002vkq.2_Missense_Mutation_p.P279L	NM_001008910	NP_001008910	O75716	STK16_HUMAN	serine/threonine kinase 16	234	Protein kinase.				protein complex assembly	membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGGAAGGCCCTTATGACATG	0.532													19	47	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225729288	225729288	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225729288C>G	uc010fwz.1	-	13	1823	c.1584G>C	c.(1582-1584)AAG>AAC	p.K528N	DOCK10_uc002vob.2_Missense_Mutation_p.K522N|DOCK10_uc002vod.1_Missense_Mutation_p.K528N	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	528							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGTCTGGGTTCTTAATATAAG	0.269													4	11	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228860227	228860227	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228860227C>A	uc002vpq.2	-	8	4679	c.4632G>T	c.(4630-4632)ATG>ATT	p.M1544I	SPHKAP_uc002vpp.2_Missense_Mutation_p.M1544I|SPHKAP_uc010zlx.1_Intron	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1544						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GCAGGTACCTCATGGATCGCT	0.488													60	166	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1367492	1367492	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1367492G>A	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TTGCCTTTTTGAAACAGCTCC	0.438													7	59	---	---	---	---	PASS
LRRN1	57633	broad.mit.edu	37	3	3886968	3886968	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3886968G>A	uc003bpt.3	+	2	1404	c.643G>A	c.(643-645)GCA>ACA	p.A215T	SUMF1_uc003bps.1_Intron	NM_020873	NP_065924	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1 precursor	215	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		CAAACCCCTCGCAAATTTGAG	0.418													52	153	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33540121	33540121	+	3'UTR	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33540121C>T	uc003cfu.2	-	38					CLASP2_uc003cfs.2_3'UTR|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2											ovary(3)|central_nervous_system(1)	4						TGATGAGCTTCACTAACTTTG	0.423													12	44	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38674567	38674567	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38674567C>T	uc003cio.2	-	2	426	c.232G>A	c.(232-234)GAG>AAG	p.E78K	SCN5A_uc003cin.2_Missense_Mutation_p.E78K|SCN5A_uc003cil.3_Missense_Mutation_p.E78K|SCN5A_uc010hhi.2_Missense_Mutation_p.E78K|SCN5A_uc010hhk.2_Missense_Mutation_p.E78K|SCN5A_uc011ayr.1_Missense_Mutation_p.E78K	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	78					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	TCCAGGGGCTCTCCGATGAGC	0.617													6	25	---	---	---	---	PASS
ZNF660	285349	broad.mit.edu	37	3	44636220	44636220	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44636220C>G	uc003cnl.1	+	3	868	c.535C>G	c.(535-537)CAA>GAA	p.Q179E		NM_173658	NP_775929	Q6AZW8	ZN660_HUMAN	zinc finger protein 660	179	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		AAACCTTACTCAACATCAGCG	0.413													24	59	---	---	---	---	PASS
ITIH1	3697	broad.mit.edu	37	3	52825552	52825552	+	Silent	SNP	C	T	T	rs143276781	byFrequency	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52825552C>T	uc003dfs.2	+	21	2538	c.2514C>T	c.(2512-2514)ATC>ATT	p.I838I	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Silent_p.I439I|ITIH1_uc010hmo.1_Silent_p.I392I|ITIH1_uc003dfu.2_Silent_p.I204I	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	838	Hyaluronan-binding.				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TCCACCCCATCGGTTTTGAAG	0.597													17	46	---	---	---	---	PASS
DCP1A	55802	broad.mit.edu	37	3	53346369	53346369	+	Missense_Mutation	SNP	G	A	A	rs115623412	by1000genomes	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53346369G>A	uc003dgs.3	-	5	505	c.412C>T	c.(412-414)CGG>TGG	p.R138W	DCP1A_uc003dgt.3_RNA	NM_018403	NP_060873	Q9NPI6	DCP1A_HUMAN	DCP1 decapping enzyme homolog A	138					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		TGTTTGTCCCGAGCAGCTTGC	0.527													7	19	---	---	---	---	PASS
ARHGEF3	50650	broad.mit.edu	37	3	56766438	56766438	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56766438G>A	uc003dig.2	-	9	1225	c.1056C>T	c.(1054-1056)TTC>TTT	p.F352F	ARHGEF3_uc011bew.1_Silent_p.F352F|ARHGEF3_uc003dih.2_Silent_p.F384F|ARHGEF3_uc011bev.1_Silent_p.F323F|ARHGEF3_uc003dif.2_Silent_p.F358F|ARHGEF3_uc010hmy.1_Silent_p.F150F|ARHGEF3_uc003dii.2_Silent_p.F352F	NM_019555	NP_062455	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform	352	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CTTGGAACAGGAAAACATGCA	0.463													22	72	---	---	---	---	PASS
ACOX2	8309	broad.mit.edu	37	3	58516240	58516240	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58516240G>A	uc003dkl.2	-	8	1120	c.945C>T	c.(943-945)ATC>ATT	p.I315I		NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2	315					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		AGCGCATGGCGATGACACAGG	0.617													19	46	---	---	---	---	PASS
C3orf14	57415	broad.mit.edu	37	3	62317015	62317015	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62317015G>A	uc003dlf.2	+	5	337	c.193G>A	c.(193-195)GAA>AAA	p.E65K	C3orf14_uc010hnq.2_Missense_Mutation_p.E65K|C3orf14_uc003dlg.2_Missense_Mutation_p.E65K	NM_020685	NP_065736	Q9HBI5	CC014_HUMAN	hypothetical protein LOC57415	65										central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.00023)|KIRC - Kidney renal clear cell carcinoma(15;0.00877)|Kidney(15;0.0101)		AGAAGCAGCAGAAAAGTCACT	0.398													7	48	---	---	---	---	PASS
CHMP2B	25978	broad.mit.edu	37	3	87302931	87302931	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87302931G>A	uc003dqp.3	+	6	861	c.601G>A	c.(601-603)GAA>AAA	p.E201K	CHMP2B_uc011bgn.1_Missense_Mutation_p.E160K	NM_014043	NP_054762	Q9UQN3	CHM2B_HUMAN	chromatin modifying protein 2B	201	MIT-interacting motif.			E -> V (in Ref. 2 and 3).	cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane|mitochondrion|nucleus	protein domain specific binding			skin(2)|ovary(1)	3	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		AATCTCAGATGAAGAGATTGA	0.378													7	34	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97851984	97851984	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97851984C>T	uc011bgt.1	+	1	443	c.443C>T	c.(442-444)TCA>TTA	p.S148L		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						TTAATCTTGTCATATGTAGGT	0.383													23	139	---	---	---	---	PASS
RPL24	6152	broad.mit.edu	37	3	101405524	101405524	+	5'UTR	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101405524G>A	uc003dvh.1	-	1					RPL24_uc003dvi.1_5'UTR	NM_000986	NP_000977	P83731	RL24_HUMAN	ribosomal protein L24						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0						ACTTCATGGCGACAGCTCCAC	0.552													9	32	---	---	---	---	PASS
KIAA1407	57577	broad.mit.edu	37	3	113724430	113724430	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113724430G>C	uc003eax.2	-	10	1940	c.1793C>G	c.(1792-1794)GCA>GGA	p.A598G	KIAA1407_uc011bin.1_RNA|KIAA1407_uc011bio.1_Missense_Mutation_p.A576G|KIAA1407_uc011bip.1_Missense_Mutation_p.A585G	NM_020817	NP_065868	Q8NCU4	K1407_HUMAN	hypothetical protein LOC57577	598										ovary(2)	2						TTCTGTGACTGCTAAGGCATG	0.493													32	133	---	---	---	---	PASS
SLC12A8	84561	broad.mit.edu	37	3	124837625	124837625	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124837625C>G	uc003ehv.3	-	8	1011	c.900G>C	c.(898-900)CTG>CTC	p.L300L	SLC12A8_uc003ehw.3_Silent_p.L329L|SLC12A8_uc010hrz.1_Nonstop_Mutation_p.*174S|SLC12A8_uc003eht.3_Silent_p.L101L|SLC12A8_uc003ehu.3_Silent_p.L53L|SLC12A8_uc010hry.2_Silent_p.L53L	NM_024628	NP_078904	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	300					potassium ion transport	integral to membrane	symporter activity				0						TTTCCGCTATCAGGAAGTCAT	0.532													4	19	---	---	---	---	PASS
CCDC37	348807	broad.mit.edu	37	3	126139026	126139026	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126139026C>T	uc003eiu.1	+	11	1135	c.1036C>T	c.(1036-1038)CAG>TAG	p.Q346*	CCDC37_uc010hsg.1_Nonsense_Mutation_p.Q347*	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	346										ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)		GAGCAGCCCCCAGCAAGGCAG	0.657													6	44	---	---	---	---	PASS
KBTBD12	166348	broad.mit.edu	37	3	127642675	127642675	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127642675C>T	uc010hsr.2	+	1	774	c.771C>T	c.(769-771)ATC>ATT	p.I257I	KBTBD12_uc003ejy.3_Intron|KBTBD12_uc010hsq.2_Intron|KBTBD12_uc003eka.3_Intron|KBTBD12_uc003ejz.2_Silent_p.I257I	NM_207335	NP_997218	Q3ZCT8	KBTBC_HUMAN	kelch domain containing 6	257										ovary(1)	1						TCAAAGCCATCAAGACACCCC	0.403													23	121	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132184866	132184866	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132184866C>T	uc003eor.2	+	18	1985	c.1920C>T	c.(1918-1920)CTC>CTT	p.L640L	DNAJC13_uc010htq.1_Silent_p.L640L	NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	640							heat shock protein binding			ovary(1)|breast(1)	2						TAGTGGGACTCTGGACAGCTG	0.348													9	37	---	---	---	---	PASS
C3orf36	80111	broad.mit.edu	37	3	133647582	133647582	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133647582G>A	uc003epz.1	-	1	1075	c.66C>T	c.(64-66)CTC>CTT	p.L22L		NM_025041	NP_079317	Q3SXR2	CC036_HUMAN	hypothetical protein LOC80111	22										ovary(1)	1						GGACTAGGCTGAGCCCACTAC	0.483													24	74	---	---	---	---	PASS
KY	339855	broad.mit.edu	37	3	134329140	134329140	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134329140C>T	uc010hty.2	-	9	858	c.796G>A	c.(796-798)GAC>AAC	p.D266N	KY_uc011blw.1_Missense_Mutation_p.D266N|KY_uc011blx.1_Missense_Mutation_p.D245N|KY_uc003eqr.1_Missense_Mutation_p.D32N	NM_178554	NP_848649	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	266						cytoskeleton|Z disc	peptidase activity			ovary(2)	2						CAGGCATGGTCAAACTCCCCC	0.612													6	80	---	---	---	---	PASS
CLDN18	51208	broad.mit.edu	37	3	137717751	137717751	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137717751C>T	uc003ero.1	+	1	94	c.41C>T	c.(40-42)TCA>TTA	p.S14L		NM_001002026	NP_001002026	P56856	CLD18_HUMAN	claudin 18 isoform 2	14	Helical; (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity			upper_aerodigestive_tract(1)|ovary(1)	2						TTCGTGGTTTCACTGATTGGG	0.552													20	89	---	---	---	---	PASS
GK5	256356	broad.mit.edu	37	3	141917646	141917646	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141917646C>A	uc003euq.1	-	5	672	c.541G>T	c.(541-543)GAG>TAG	p.E181*	GK5_uc010hus.1_RNA|GK5_uc010hut.1_RNA	NM_001039547	NP_001034636	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)	181					glycerol metabolic process		ATP binding|glycerol kinase activity				0						TTTCTTACCTCAGTCAAGTTC	0.338													25	57	---	---	---	---	PASS
WWTR1	25937	broad.mit.edu	37	3	149374821	149374821	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374821G>A	uc003exe.2	-	1	289	c.273C>T	c.(271-273)CCC>CCT	p.P91P	WWTR1_uc003exf.2_Silent_p.P91P|WWTR1_uc011bns.1_Silent_p.P91P|WWTR1_uc003exh.2_Silent_p.P91P|uc010hvg.1_RNA|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	91					hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GCAGGGACGCGGGCGACGAGT	0.756													3	10	---	---	---	---	PASS
RAP2B	5912	broad.mit.edu	37	3	152880788	152880788	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152880788C>T	uc003ezr.2	+	1	760	c.306C>T	c.(304-306)CGC>CGT	p.R102R		NM_002886	NP_002877	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family precursor	102					Rap protein signal transduction|regulation of protein tyrosine kinase activity	recycling endosome membrane	GTP binding|GTPase activity			lung(2)	2			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AGATCATCCGCGTGAAGCGGT	0.622													14	51	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155551785	155551785	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155551785C>T	uc003fan.3	-	3	1390	c.1009G>A	c.(1009-1011)GAA>AAA	p.E337K	SLC33A1_uc003fao.1_Missense_Mutation_p.E337K	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	337	Extracellular (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ACTCCCTCTTCTACCAATTTC	0.368													15	75	---	---	---	---	PASS
SMC4	10051	broad.mit.edu	37	3	160149569	160149569	+	Missense_Mutation	SNP	G	A	A	rs137888861		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160149569G>A	uc003fdh.2	+	21	3366	c.3253G>A	c.(3253-3255)GAA>AAA	p.E1085K	IFT80_uc003fda.2_Intron|SMC4_uc003fdi.2_Missense_Mutation_p.E1060K|SMC4_uc003fdj.2_Missense_Mutation_p.E1085K|SMC4_uc010hwd.2_Missense_Mutation_p.E1027K|SMC4_uc003fdl.2_Missense_Mutation_p.E788K	NM_001002800	NP_001002800	Q9NTJ3	SMC4_HUMAN	SMC4 structural maintenance of chromosomes	1085					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	ATP binding|protein heterodimerization activity			ovary(1)|breast(1)	2			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CCGGTGTCATGAAATGAAACC	0.388													14	51	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167016251	167016251	+	Intron	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167016251G>C	uc003fep.2	-						ZBBX_uc011bpc.1_Intron|ZBBX_uc003feq.2_Intron	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing							intracellular	zinc ion binding			ovary(2)	2						TAACAACTAAGAAACAAAATA	0.269													17	97	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170786639	170786639	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170786639G>A	uc003fhh.2	-	30	4042	c.3697C>T	c.(3697-3699)CAT>TAT	p.H1233Y	TNIK_uc003fhi.2_Missense_Mutation_p.H1178Y|TNIK_uc003fhj.2_Missense_Mutation_p.H1204Y|TNIK_uc003fhk.2_Missense_Mutation_p.H1225Y|TNIK_uc003fhl.2_Missense_Mutation_p.H1149Y|TNIK_uc003fhm.2_Missense_Mutation_p.H1170Y|TNIK_uc003fhn.2_Missense_Mutation_p.H1196Y|TNIK_uc003fho.2_Missense_Mutation_p.H1141Y|TNIK_uc003fhg.2_Missense_Mutation_p.H411Y|TNIK_uc003fhp.2_Missense_Mutation_p.H165Y	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	1233	CNH.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GTACTTACATGAGATGGTATG	0.363													13	20	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			13	42	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178938934G>A	uc003fjk.2	+	14	2333	c.2176G>A	c.(2176-2178)GAA>AAA	p.E726K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	726					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E726K(2)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAAGAAGGATGAAACACAAAA	0.363		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			7	41	---	---	---	---	PASS
MCCC1	56922	broad.mit.edu	37	3	182756932	182756932	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182756932G>A	uc003fle.2	-						MCCC1_uc010hxi.2_Intron|MCCC1_uc011bqo.1_Intron|MCCC1_uc003flf.2_Intron|MCCC1_uc003flg.2_Intron|MCCC1_uc011bqp.1_Intron	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)						biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	TCCTGAAATTGAAAACCACGG	0.383													13	34	---	---	---	---	PASS
DVL3	1857	broad.mit.edu	37	3	183873587	183873587	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183873587G>A	uc003fms.2	+						DVL3_uc011bqw.1_Intron|DVL3_uc003fmt.2_5'Flank	NM_004423	NP_004414	Q92997	DVL3_HUMAN	dishevelled 3						canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			GATTTCGGGTGAGGATGGCCC	0.642													12	48	---	---	---	---	PASS
FETUB	26998	broad.mit.edu	37	3	186364083	186364083	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186364083C>T	uc010hyq.2	+	6	902	c.641C>T	c.(640-642)TCA>TTA	p.S214L	FETUB_uc011brz.1_Missense_Mutation_p.S66L|FETUB_uc003fqn.2_Missense_Mutation_p.S214L|FETUB_uc003fqo.2_Missense_Mutation_p.S109L|FETUB_uc010hyr.2_Missense_Mutation_p.S177L|FETUB_uc010hys.2_Missense_Mutation_p.S66L|FETUB_uc003fqp.3_Missense_Mutation_p.S149L	NM_014375	NP_055190	Q9UGM5	FETUB_HUMAN	fetuin B precursor	214	Cystatin fetuin-B-type 2.					extracellular space	cysteine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		ATTAAAGAATCACCATGTACT	0.413													24	117	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197409416	197409416	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197409416C>A	uc003fyc.2	-	14	2234	c.2051G>T	c.(2050-2052)CGG>CTG	p.R684L	KIAA0226_uc003fyd.3_Missense_Mutation_p.R639L|KIAA0226_uc003fye.1_Missense_Mutation_p.R416L	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	684					autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		AACACGAATCCGCAGCTTGTA	0.577													3	45	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66231719	66231719	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66231719G>A	uc003hcy.2	-	11	2174	c.1981C>T	c.(1981-1983)CAA>TAA	p.Q661*	EPHA5_uc003hcx.2_Nonsense_Mutation_p.Q593*|EPHA5_uc003hcz.2_Nonsense_Mutation_p.Q639*|EPHA5_uc011cah.1_Nonsense_Mutation_p.Q662*|EPHA5_uc011cai.1_Nonsense_Mutation_p.Q640*|EPHA5_uc003hda.2_Nonsense_Mutation_p.Q662*	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	661	Cytoplasmic (Potential).				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						TGGACAGCTTGATTGGGATCC	0.368										TSP Lung(17;0.13)			22	66	---	---	---	---	PASS
YTHDC1	91746	broad.mit.edu	37	4	69179915	69179915	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69179915C>G	uc003hdx.2	-	17	2439	c.2086G>C	c.(2086-2088)GAC>CAC	p.D696H	YTHDC1_uc003hdy.2_Missense_Mutation_p.D678H	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	696	Arg-rich.									upper_aerodigestive_tract(1)|ovary(1)	2						cgctctctgtctcgtctgtta	0.204													6	17	---	---	---	---	PASS
YTHDC1	91746	broad.mit.edu	37	4	69179929	69179929	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69179929C>G	uc003hdx.2	-	17	2425	c.2072G>C	c.(2071-2073)AGA>ACA	p.R691T	YTHDC1_uc003hdy.2_Missense_Mutation_p.R673T	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	691	Arg-rich.									upper_aerodigestive_tract(1)|ovary(1)	2						tctgttatctctagggcggtc	0.224													5	18	---	---	---	---	PASS
YTHDC1	91746	broad.mit.edu	37	4	69179971	69179971	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69179971C>G	uc003hdx.2	-	17	2383	c.2030G>C	c.(2029-2031)AGA>ACA	p.R677T	YTHDC1_uc003hdy.2_Missense_Mutation_p.R659T	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	677	Arg-rich.									upper_aerodigestive_tract(1)|ovary(1)	2						ttcACGGGGTCTACTTCTCCG	0.244													8	20	---	---	---	---	PASS
YTHDC1	91746	broad.mit.edu	37	4	69188564	69188564	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69188564G>C	uc003hdx.2	-	11	1857	c.1504C>G	c.(1504-1506)CAG>GAG	p.Q502E	YTHDC1_uc003hdy.2_Missense_Mutation_p.Q484E	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	502										upper_aerodigestive_tract(1)|ovary(1)	2						TGAATGACCTGATACAAGTCA	0.443													21	55	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121958175	121958175	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121958175G>A	uc003idq.1	-	4	1478	c.951C>T	c.(949-951)GTC>GTT	p.V317V		NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor	317	Fibronectin type-III 1.										0						TGTTGATGTTGACCACAAATA	0.433													15	67	---	---	---	---	PASS
MAML3	55534	broad.mit.edu	37	4	140640513	140640513	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140640513C>G	uc003ihz.1	-	7	4118	c.3366G>C	c.(3364-3366)TGG>TGC	p.W1122C	MGST2_uc010ioi.1_Intron|MAML3_uc011chd.1_Missense_Mutation_p.W590C	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	1123					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					GCTCCTGCATCCACTCGTCCC	0.527													9	27	---	---	---	---	PASS
TLR2	7097	broad.mit.edu	37	4	154625477	154625477	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154625477C>G	uc003inq.2	+	3	1637	c.1418C>G	c.(1417-1419)TCT>TGT	p.S473C	TLR2_uc003inr.2_Missense_Mutation_p.S473C|TLR2_uc003ins.2_Missense_Mutation_p.S473C	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor	473	LRR 12.|Extracellular (Potential).				cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				AATTTATTTTCTTTGAATTTG	0.358													32	94	---	---	---	---	PASS
KLHL2	11275	broad.mit.edu	37	4	166231823	166231823	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166231823G>A	uc003irb.2	+	10	1417	c.1158G>A	c.(1156-1158)ATG>ATA	p.M386I	KLHL2_uc011cjm.1_Missense_Mutation_p.M390I|KLHL2_uc003irc.2_Missense_Mutation_p.M298I|KLHL2_uc010ira.2_Missense_Mutation_p.M39I	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1	386	Kelch 2.				intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		TTGCTAACATGAGAGACCGGA	0.448													85	254	---	---	---	---	PASS
SC4MOL	6307	broad.mit.edu	37	4	166254663	166254663	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166254663C>G	uc003ire.2	+	2	271	c.141C>G	c.(139-141)TTC>TTG	p.F47L	SC4MOL_uc010irb.2_Missense_Mutation_p.F47L|SC4MOL_uc003irf.2_Intron	NM_006745	NP_006736	Q15800	ERG25_HUMAN	sterol-C4-methyl oxidase-like isoform 1	47					cholesterol biosynthetic process|fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	C-4 methylsterol oxidase activity|iron ion binding				0	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0875)	NADH(DB00157)	ATACAAAGTTCCAGATTGCAA	0.318													20	46	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186379879	186379879	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186379879C>G	uc003ixu.3	-	6	1938	c.1862G>C	c.(1861-1863)AGA>ACA	p.R621T	CCDC110_uc003ixv.3_Missense_Mutation_p.R584T|CCDC110_uc011ckt.1_Missense_Mutation_p.R621T	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	621	Potential.					nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TTTTGCCAATCTTTCTTTCTC	0.338													15	65	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	235338	235338	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:235338G>C	uc003jao.3	+	9	1259	c.1144G>C	c.(1144-1146)GGC>CGC	p.G382R	SDHA_uc003jan.2_Missense_Mutation_p.G382R|SDHA_uc011clv.1_Missense_Mutation_p.G382R|SDHA_uc011clw.1_Missense_Mutation_p.G334R|SDHA_uc003jap.3_Missense_Mutation_p.G382R|SDHA_uc003jaq.3_Missense_Mutation_p.G157R|SDHA_uc003jar.3_Intron	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	382					nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GCGCCTGCCTGGCATTTCAGA	0.592									Familial_Paragangliomas				5	38	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5306693	5306693	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5306693G>A	uc003jdl.2	+	21	3401	c.3263G>A	c.(3262-3264)CGA>CAA	p.R1088Q		NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1088	TSP type-1 5.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						GGAAAGTATCGAGAGCTGGCC	0.488													31	87	---	---	---	---	PASS
MTRR	4552	broad.mit.edu	37	5	7886790	7886790	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7886790C>T	uc003jed.2	+	8	1231	c.1201C>T	c.(1201-1203)CTT>TTT	p.L401F	MTRR_uc003jee.3_Missense_Mutation_p.L374F|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2	401	FAD-binding FR-type.				methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TACCTGGTGTCTTGAAATCCG	0.368													7	65	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37063920	37063920	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37063920C>T	uc003jkl.3	+	46	8388	c.7889C>T	c.(7888-7890)CCT>CTT	p.P2630L	NIPBL_uc003jkk.3_Missense_Mutation_p.P2630L|NIPBL_uc003jkn.2_Missense_Mutation_p.P323L	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	2630					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CATCTGGACCCTGATGAAGAA	0.363													7	16	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43659317	43659317	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43659317C>T	uc003joe.2	+	17	2754	c.2499C>T	c.(2497-2499)GTC>GTT	p.V833V	NNT_uc003jof.2_Silent_p.V833V	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	833	Helical; (Potential).				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	ACATGCCCGTCGTTATCACTG	0.473													38	96	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45353336	45353336	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45353336C>T	uc003jok.2	-	5	1268	c.1243G>A	c.(1243-1245)GAA>AAA	p.E415K		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	415	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ATGTATTGTTCCACTTGCTTA	0.299													12	75	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70806208	70806208	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70806208G>A	uc003kbp.1	+	17	3552	c.3289G>A	c.(3289-3291)GAA>AAA	p.E1097K	BDP1_uc003kbn.1_Missense_Mutation_p.E1097K|BDP1_uc003kbo.2_Missense_Mutation_p.E1097K	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	1097	6.|Potential.|9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AACTGAAAGAGAAATATCCCC	0.443													17	48	---	---	---	---	PASS
RPS23	6228	broad.mit.edu	37	5	81573526	81573526	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81573526G>A	uc003khu.2	-	2	243	c.150C>T	c.(148-150)ATC>ATT	p.I50I	ATP6AP1L_uc003khv.2_5'Flank	NM_001025	NP_001016	P62266	RS23_HUMAN	ribosomal protein S23	50					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|structural constituent of ribosome				0		Lung NSC(167;0.0025)|all_lung(232;0.00278)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-42)|Epithelial(54;8.38e-37)|all cancers(79;1.42e-31)		TTTCCAGCACGATTCCTTTTG	0.408													37	154	---	---	---	---	PASS
RPS23	6228	broad.mit.edu	37	5	81573540	81573540	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81573540G>A	uc003khu.2	-	2	229	c.136C>T	c.(136-138)CAT>TAT	p.H46Y	ATP6AP1L_uc003khv.2_5'Flank	NM_001025	NP_001016	P62266	RS23_HUMAN	ribosomal protein S23	46					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|structural constituent of ribosome				0		Lung NSC(167;0.0025)|all_lung(232;0.00278)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-42)|Epithelial(54;8.38e-37)|all cancers(79;1.42e-31)		CCTTTTGCATGAGAAGCACCT	0.433													37	134	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89933626	89933626	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89933626G>A	uc003kju.2	+	11	2197	c.2101G>A	c.(2101-2103)GCA>ACA	p.A701T	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	701	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAATTCAAAAGCAGTGACCCC	0.413													14	25	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90449160	90449160	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90449160G>A	uc003kju.2	+	89	18843	c.18747G>A	c.(18745-18747)CTG>CTA	p.L6249L	GPR98_uc003kjt.2_Silent_p.L3955L|GPR98_uc003kjw.2_Silent_p.L1910L|GPR98_uc003kjx.2_Silent_p.L277L	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	6249	Cytoplasmic (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGGGGTCACTGATAGCCGATG	0.478													4	15	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118560455	118560455	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118560455C>G	uc003ksd.2	+	37	8447	c.8266C>G	c.(8266-8268)CTT>GTT	p.L2756V	DMXL1_uc010jcl.1_Missense_Mutation_p.L2777V|DMXL1_uc010jcm.1_RNA	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2756	WD 11.									ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TCATCCAACTCTTCCTTACTG	0.254													10	50	---	---	---	---	PASS
TMCO6	55374	broad.mit.edu	37	5	140019389	140019389	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140019389G>C	uc003lgl.2	+	2	252	c.151G>C	c.(151-153)GAG>CAG	p.E51Q	TMCO6_uc011czj.1_Missense_Mutation_p.E51Q|TMCO6_uc003lgm.2_Missense_Mutation_p.E51Q|TMCO6_uc010jft.2_5'UTR|TMCO6_uc003lgn.2_5'Flank|TMCO6_uc003lgo.2_5'Flank	NM_018502	NP_060972	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	51	Potential.|Arg-rich.				protein import into nucleus	cytoplasm|nuclear pore	binding|protein transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACGCCCCAGAGGAAGCTGG	0.677													5	6	---	---	---	---	PASS
PCDHA2	56146	broad.mit.edu	37	5	140176742	140176742	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140176742G>A	uc003lhd.2	+	1	2299	c.2193G>A	c.(2191-2193)GCG>GCA	p.A731A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.A731A|PCDHA2_uc011czy.1_Silent_p.A731A	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	731	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGAGGGTGCGCGCGCGCCAG	0.677													21	77	---	---	---	---	PASS
PCDHB3	56132	broad.mit.edu	37	5	140482562	140482562	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140482562C>G	uc003lio.2	+	1	2329	c.2329C>G	c.(2329-2331)CAG>GAG	p.Q777E	uc003lin.2_5'Flank	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	777	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTTCGTTGCTCAGGGTGCAGA	0.483													21	54	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140754203	140754203	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140754203G>A	uc003ljy.1	+	1	553	c.553G>A	c.(553-555)GAA>AAA	p.E185K	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.E185K	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	185	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGCAAAGCGAAGCCCATGG	0.552													3	16	---	---	---	---	PASS
ITK	3702	broad.mit.edu	37	5	156667073	156667073	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156667073G>A	uc003lwo.1	+	10	935	c.853G>A	c.(853-855)GAG>AAG	p.E285K		NM_005546	NP_005537	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	285	SH2.				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTGTTTAAGTGAGAACAATCC	0.318			T	SYK	peripheral T-cell lymphoma								7	34	---	---	---	---	PASS
STK10	6793	broad.mit.edu	37	5	171544618	171544618	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171544618G>A	uc003mbo.1	-	4	687	c.387C>T	c.(385-387)CTC>CTT	p.L129L		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	129	Protein kinase.						ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGGCTCCGTGAGGCCTCTGT	0.547													8	44	---	---	---	---	PASS
PRR7	80758	broad.mit.edu	37	5	176882210	176882210	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176882210G>C	uc003mgu.1	+	3	634	c.142G>C	c.(142-144)GAG>CAG	p.E48Q	PRR7_uc003mgv.1_Missense_Mutation_p.E48Q|PRR7_uc003mgw.1_Missense_Mutation_p.E48Q	NM_030567	NP_085044	Q8TB68	PRR7_HUMAN	proline rich 7 (synaptic)	48	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic membrane					0	all_cancers(89;1.51e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGACTGCGCGAGCAGAACCT	0.716													6	11	---	---	---	---	PASS
BTNL3	10917	broad.mit.edu	37	5	180431735	180431735	+	Splice_Site	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180431735G>A	uc003mmr.2	+	7	964	c.836_splice	c.e7-1	p.E279_splice	BTNL3_uc010jlp.2_Splice_Site_p.E64_splice	NM_197975	NP_932079	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3 precursor						lipid metabolic process	integral to membrane					0	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			CTTGCTTTCAGAATTGAGAGA	0.512													16	39	---	---	---	---	PASS
PBX2	5089	broad.mit.edu	37	6	32154456	32154456	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32154456G>A	uc003oav.1	-	8	1396	c.1125C>T	c.(1123-1125)CTC>CTT	p.L375L	AGER_uc003oar.2_5'Flank|AGER_uc011dpm.1_5'Flank|AGER_uc011dpn.1_5'Flank|AGER_uc003oal.1_5'Flank|AGER_uc010jtv.1_5'Flank|AGER_uc011dpo.1_5'Flank|AGER_uc003oam.1_5'Flank|AGER_uc003oan.1_5'Flank|AGER_uc003oap.1_5'Flank|AGER_uc003oat.1_5'Flank|AGER_uc003oao.1_5'Flank|AGER_uc003oaq.1_5'Flank|AGER_uc010jtw.1_5'Flank|AGER_uc003oas.1_5'Flank|AGER_uc003oau.1_5'Flank|AGER_uc011dpp.1_5'Flank|AGER_uc011dpq.1_5'Flank|AGER_uc011dpr.1_5'Flank|AGER_uc011dps.1_5'Flank	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	375							transcription factor binding			ovary(1)	1						TCGAGTGTCGGAGTGATTCCA	0.557													9	36	---	---	---	---	PASS
VPS52	6293	broad.mit.edu	37	6	33237985	33237985	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33237985C>G	uc003odm.1	-	2	376	c.166G>C	c.(166-168)GAA>CAA	p.E56Q	VPS52_uc003odn.1_5'UTR|VPS52_uc003odo.1_5'UTR|VPS52_uc011dqy.1_5'UTR|VPS52_uc011dqz.1_5'UTR|RPS18_uc003odp.1_5'Flank|RPS18_uc010jum.1_5'Flank|RPS18_uc003odq.1_5'Flank	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52	56					protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5						CCATCCACTTCATCCAGGATG	0.522													56	151	---	---	---	---	PASS
ENPP4	22875	broad.mit.edu	37	6	46107443	46107443	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46107443G>A	uc003oxy.2	+	2	382	c.123G>A	c.(121-123)CTG>CTA	p.L41L		NM_014936	NP_055751	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	41	Extracellular (Potential).					integral to membrane	hydrolase activity			ovary(3)|skin(1)	4						CTGATTATCTGAAGAACTATG	0.343													32	68	---	---	---	---	PASS
FILIP1	27145	broad.mit.edu	37	6	76022448	76022448	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76022448G>A	uc003pia.2	-	5	3473	c.3100C>T	c.(3100-3102)CGG>TGG	p.R1034W	FILIP1_uc003phy.1_Missense_Mutation_p.R1034W|FILIP1_uc003phz.2_Missense_Mutation_p.R935W|FILIP1_uc010kbe.2_Missense_Mutation_p.R1037W|FILIP1_uc003pib.1_Missense_Mutation_p.R786W	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1034										skin(3)|ovary(1)	4						AGGATTGTCCGTCCCATGGGC	0.468													59	196	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90400388	90400388	+	Intron	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90400388C>G	uc003pnn.1	-							NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CATCACTGCTCTACCTTTTCA	0.473													16	23	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132196904	132196904	+	Intron	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132196904C>G	uc011ecf.1	+						ENPP1_uc003qcy.2_Intron	NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	ACTTCCTTTTCTGGCCATCTA	0.393													4	54	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136599923	136599923	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136599923G>A	uc003qgx.1	-						BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Intron|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_Intron|BCLAF1_uc011ede.1_Intron	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform						induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AACTAAAAATGAAATAAATAT	0.308													4	20	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143093707	143093707	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143093707G>A	uc003qjd.2	-	5	2912	c.2169C>T	c.(2167-2169)ATC>ATT	p.I723I		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	723					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CGGAAGCCATGATGCCCACAG	0.522													26	69	---	---	---	---	PASS
TAB2	23118	broad.mit.edu	37	6	149700292	149700292	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149700292G>C	uc003qmj.2	+	3	1419	c.1241G>C	c.(1240-1242)GGA>GCA	p.G414A	TAB2_uc011eec.1_Missense_Mutation_p.G382A|TAB2_uc010kia.1_Missense_Mutation_p.G414A|TAB2_uc010kib.1_Missense_Mutation_p.G414A|TAB2_uc003qmk.3_RNA	NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN	mitogen-activated protein kinase kinase kinase 7	414					activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0						ACAAACTCTGGAGCATCTGCT	0.493													10	37	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152488928	152488928	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152488928G>A	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTTTTCTGGATCGCTTTCC	0.418										HNSCC(10;0.0054)			9	34	---	---	---	---	PASS
VIP	7432	broad.mit.edu	37	6	153077323	153077323	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153077323C>T	uc003qpe.2	+	5	562	c.390C>T	c.(388-390)TTC>TTT	p.F130F	VIP_uc003qpf.2_Silent_p.F129F|VIP_uc010kjd.2_Silent_p.F129F	NM_003381	NP_003372	P01282	VIP_HUMAN	vasoactive intestinal peptide isoform 1	130					body fluid secretion|G-protein coupled receptor protein signaling pathway|positive regulation of cell proliferation	extracellular region	neuropeptide hormone activity				0		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		ATGCAGTCTTCACTGACAACT	0.378													30	75	---	---	---	---	PASS
CNKSR3	154043	broad.mit.edu	37	6	154727587	154727587	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154727587C>T	uc003qpy.2	-	13	2074	c.1569G>A	c.(1567-1569)GGG>GGA	p.G523G		NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	523	DUF1170.				negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		TCTTTTTGGTCCCTTCCTCCT	0.562													21	56	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159682278	159682278	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159682278C>T	uc010kjv.2	+	19	5431	c.5231C>T	c.(5230-5232)TCG>TTG	p.S1744L		NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1744	Fibronectin type-III 5.					extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		ATCAGCCCTTCGGTCTCATTT	0.348													16	61	---	---	---	---	PASS
AIMP2	7965	broad.mit.edu	37	7	6054882	6054882	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6054882C>G	uc003spo.2	+	2	354	c.241C>G	c.(241-243)CAA>GAA	p.Q81E		NM_006303	NP_006294	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting	81					apoptosis|cell differentiation|multicellular organismal development|tRNA aminoacylation for protein translation	cytosol|nucleus	protein binding			ovary(1)	1						CAAGATGATTCAAACACCAGA	0.458													25	73	---	---	---	---	PASS
C7orf10	79783	broad.mit.edu	37	7	40220584	40220584	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40220584C>G	uc003thn.1	+	2	184	c.139C>G	c.(139-141)CTG>GTG	p.L47V	C7orf10_uc003thm.1_Missense_Mutation_p.L54V|C7orf10_uc003tho.1_Missense_Mutation_p.L47V	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	54							transferase activity			ovary(2)	2						GGTAAAAATTCTGGATCTAAC	0.284													22	153	---	---	---	---	PASS
PMS2L3	5387	broad.mit.edu	37	7	75145031	75145031	+	Intron	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75145031C>G	uc003udp.2	-						PMS2L3_uc003udn.2_Intron|PMS2L3_uc003udq.2_Intron	NM_005395	NP_005386			SubName: Full=Postmeiotic segregation increased 2-like 3; SubName: Full=Postmeiotic segregation increased 2-like 3, isoform CRA_b;												0						ATGTGATAATCTACTAACTTA	0.448								Direct_reversal_of_damage|MMR					27	57	---	---	---	---	PASS
PTCD1	26024	broad.mit.edu	37	7	99032477	99032477	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99032477C>T	uc003uqh.2	-	2	520	c.389G>A	c.(388-390)CGA>CAA	p.R130Q	PTCD1_uc011kiw.1_Missense_Mutation_p.R179Q	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	130										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TCTCCGGCCTCGCCATAATTT	0.552													61	172	---	---	---	---	PASS
GIGYF1	64599	broad.mit.edu	37	7	100284988	100284988	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100284988C>T	uc003uwg.1	-	5	1424	c.415G>A	c.(415-417)GAA>AAA	p.E139K		NM_022574	NP_072096	O75420	PERQ1_HUMAN	PERQ amino acid rich, with GYF domain 1	139										large_intestine(1)|central_nervous_system(1)	2	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TCGCCTTCTTCGATGCTTCTT	0.637													39	126	---	---	---	---	PASS
PRKAR2B	5577	broad.mit.edu	37	7	106793673	106793673	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106793673G>C	uc003vdx.2	+	8	1070	c.895G>C	c.(895-897)GAT>CAT	p.D299H		NM_002736	NP_002727	P31323	KAP3_HUMAN	cAMP-dependent protein kinase, regulatory	299	cAMP 2.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1						AGTATACAACGATGGAGAACA	0.318													6	57	---	---	---	---	PASS
RBM28	55131	broad.mit.edu	37	7	127950891	127950891	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127950891C>A	uc003vmp.2	-	19	2354	c.2239G>T	c.(2239-2241)GGA>TGA	p.G747*	RBM28_uc003vmo.2_Nonsense_Mutation_p.G289*|RBM28_uc011koj.1_Nonsense_Mutation_p.G606*	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	747					mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						AGAGGTGCTCCTTTAGAAGGT	0.453													4	131	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142510352	142510352	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142510352C>G	uc003wbp.2	-	2	366	c.254G>C	c.(253-255)AGA>ACA	p.R85T						SubName: Full=V_segment translation product; Flags: Fragment;																		GTCCTGGGGTCTGGAGGCTGA	0.582													5	14	---	---	---	---	PASS
INSIG1	3638	broad.mit.edu	37	7	155090262	155090262	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155090262C>G	uc003wly.2	+	2	478	c.267C>G	c.(265-267)CTC>CTG	p.L89L	INSIG1_uc011kvu.1_Intron|INSIG1_uc003wlz.2_Silent_p.L89L	NM_005542	NP_005533	O15503	INSI1_HUMAN	insulin induced gene 1 isoform 1	89	Helical; (Potential).				cell proliferation|ER-nuclear sterol response pathway	endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGAGGAGCCTCGTGCTCTTCT	0.657													3	13	---	---	---	---	PASS
DNAJB6	10049	broad.mit.edu	37	7	157160168	157160168	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157160168G>C	uc003wnk.2	+	5	491	c.337G>C	c.(337-339)GAC>CAC	p.D113H	DNAJB6_uc003wnj.2_Missense_Mutation_p.D113H|DNAJB6_uc003wnl.2_Missense_Mutation_p.D100H|DNAJB6_uc011kvy.1_Missense_Mutation_p.D64H|DNAJB6_uc011kvz.1_Missense_Mutation_p.D113H|DNAJB6_uc010lqt.2_Missense_Mutation_p.D113H	NM_058246	NP_490647	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	113	Gly/Phe-rich.|Interaction with HSP70.				intermediate filament organization|negative regulation of caspase activity|protein folding|response to unfolded protein	nucleus|perinuclear region of cytoplasm	ATPase activator activity|chaperone binding|heat shock protein binding|unfolded protein binding			ovary(2)	2	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		ATTTTCATTTGACTTCTTTGG	0.403													15	74	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38205669	38205669	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38205669G>C	uc003xli.2	-	2	539	c.21C>G	c.(19-21)TTC>TTG	p.F7L	WHSC1L1_uc011lbm.1_Missense_Mutation_p.F7L|WHSC1L1_uc010lwe.2_Missense_Mutation_p.F7L|WHSC1L1_uc003xlj.2_Missense_Mutation_p.F7L	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	7					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TCCCTTGCATGAAAGAGAAAG	0.433			T	NUP98	AML								21	74	---	---	---	---	PASS
AGPAT6	137964	broad.mit.edu	37	8	41469775	41469775	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41469775G>A	uc003xnz.2	+	7	1717	c.778G>A	c.(778-780)GAT>AAT	p.D260N		NM_178819	NP_848934	Q86UL3	GPAT4_HUMAN	lysophosphatidic acid acyltransferase zeta	260					acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			CTTGGCCAGCGATGGCTATTA	0.502													16	51	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61765139	61765139	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61765139G>C	uc003xue.2	+	30	6454	c.5977G>C	c.(5977-5979)GAC>CAC	p.D1993H		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1993					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ACAGCAATTTGACTGGAACCA	0.408													4	19	---	---	---	---	PASS
CRH	1392	broad.mit.edu	37	8	67089290	67089290	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67089290G>C	uc003xvy.1	-	2	608	c.423C>G	c.(421-423)CTC>CTG	p.L141L		NM_000756	NP_000747	P06850	CRF_HUMAN	corticotropin releasing hormone precursor	141					female pregnancy|negative regulation of circadian sleep/wake cycle, REM sleep|parturition|positive regulation of circadian sleep/wake cycle, wakefulness|positive regulation of cortisol secretion|signal transduction|synaptic transmission	extracellular region|soluble fraction	neuropeptide hormone activity				0		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	GGTGGCCGCCGAGGGCATTCC	0.672											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	14	---	---	---	---	PASS
LY96	23643	broad.mit.edu	37	8	74939055	74939055	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74939055C>A	uc003yad.2	+	4	454	c.363C>A	c.(361-363)TTC>TTA	p.F121L		NM_015364	NP_056179	Q9Y6Y9	LY96_HUMAN	MD-2 protein precursor	121	Interaction with lipopolysaccharide.				cellular defense response|detection of lipopolysaccharide|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	extracellular space|lipopolysaccharide receptor complex|plasma membrane	coreceptor activity|lipopolysaccharide receptor activity|protein binding				0	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			CATTCTCCTTCAAGGGAATAA	0.303													6	17	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103299757	103299757	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103299757C>T	uc003ykr.1	-	37	4894	c.4861G>A	c.(4861-4863)GAA>AAA	p.E1621K	UBR5_uc003yks.1_Missense_Mutation_p.E1621K	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1621					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CTTTCTGTTTCAGCTGCTGCT	0.408													9	32	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124383164	124383164	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124383164C>T	uc003yqh.3	-	6	814	c.706G>A	c.(706-708)GAT>AAT	p.D236N	ATAD2_uc011lii.1_Silent_p.L27L|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.D236N	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	236					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TCTTGATTATCAGTTGTTTCT	0.303													7	30	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133492621	133492621	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133492621G>A	uc003ytj.2	-	1	384	c.159C>T	c.(157-159)GTC>GTT	p.V53V	KCNQ3_uc010mdt.2_Silent_p.V53V	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	53					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GCGCCAAGGTGACTTGCTCCA	0.692													4	10	---	---	---	---	PASS
ZNF34	80778	broad.mit.edu	37	8	145999086	145999086	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145999086C>A	uc003zdy.3	-	6	1350	c.1248G>T	c.(1246-1248)GAG>GAT	p.E416D	ZNF34_uc010mgb.2_Missense_Mutation_p.E313D|ZNF34_uc003zdx.3_Missense_Mutation_p.E395D	NM_030580	NP_085057	Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	416					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		TATAGGGTTTCTCTCCAGTGT	0.423													8	20	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	418177	418177	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:418177G>A	uc003zgf.2	+	30	3922	c.3810G>A	c.(3808-3810)TTG>TTA	p.L1270L	DOCK8_uc010mgu.2_Silent_p.L572L|DOCK8_uc010mgv.2_Silent_p.L1170L|DOCK8_uc003zgk.2_Silent_p.L728L	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1270					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ATTTCAATTTGAAAACAAGTG	0.423													55	190	---	---	---	---	PASS
DMRT2	10655	broad.mit.edu	37	9	1053808	1053808	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1053808C>G	uc003zha.2	+	3	812	c.612C>G	c.(610-612)GCC>GCG	p.A204A	DMRT2_uc003zgx.3_5'UTR|DMRT2_uc010mgz.2_5'UTR|DMRT2_uc003zgy.3_Silent_p.A48A|DMRT2_uc003zhb.3_Silent_p.A204A|DMRT2_uc011llt.1_Silent_p.A204A|DMRT2_uc011llu.1_Silent_p.A204A|DMRT2_uc011llv.1_Silent_p.A204A	NM_181872	NP_870987	Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor	204					male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		GTTTGCTGGCCAAAAGCATTT	0.418													14	42	---	---	---	---	PASS
RANBP6	26953	broad.mit.edu	37	9	6013755	6013755	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6013755C>G	uc003zjr.2	-	1	1864	c.1853G>C	c.(1852-1854)AGA>ACA	p.R618T	RANBP6_uc011lmf.1_Missense_Mutation_p.R266T|RANBP6_uc003zjs.2_Missense_Mutation_p.R206T	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	618					protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		TTTACACATTCTAGCCCATGC	0.393													53	148	---	---	---	---	PASS
SIGMAR1	10280	broad.mit.edu	37	9	34637231	34637231	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34637231G>C	uc003zvb.2	-	2	412	c.338C>G	c.(337-339)TCC>TGC	p.S113C	SIGMAR1_uc003zva.3_Missense_Mutation_p.S93C|SIGMAR1_uc003zuz.2_Missense_Mutation_p.S24C|SIGMAR1_uc003zvc.2_Missense_Mutation_p.S113C|SIGMAR1_uc003zvd.2_Intron|SIGMAR1_uc011loo.1_Missense_Mutation_p.S113C	NM_005866	NP_005857	Q99720	SGMR1_HUMAN	sigma non-opioid intracellular receptor 1	113	Cytoplasmic (Potential).				ergosterol biosynthetic process|lipid transport	cell junction|endoplasmic reticulum membrane|growth cone|integral to plasma membrane|lipid particle|nuclear inner membrane|nuclear outer membrane	C-8 sterol isomerase activity|drug binding				0					Dextromethorphan(DB00514)	GTGGCCGCGGGAGCCCAAGGC	0.652													4	5	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35259054	35259054	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35259054G>A	uc003zwq.2	+						UNC13B_uc010mkl.1_Intron|UNC13B_uc003zwr.2_Intron	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TGTTGTAAGTGAGAAACTTGT	0.418											OREG0019168	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	24	58	---	---	---	---	PASS
HRCT1	646962	broad.mit.edu	37	9	35906559	35906559	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35906559A>C	uc003zyr.1	+	1	371	c.275A>C	c.(274-276)CAC>CCC	p.H92P	LOC158376_uc003zys.1_5'Flank	NM_001039792	NP_001034881	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	92	His-rich.					integral to membrane					0						caccaccaccacccccgccac	0.393													4	8	---	---	---	---	PASS
CNTNAP3	79937	broad.mit.edu	37	9	39176011	39176011	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39176011G>A	uc004abi.2	-	7	1245	c.1006C>T	c.(1006-1008)CTT>TTT	p.L336F	CNTNAP3_uc004abj.2_Missense_Mutation_p.L336F|CNTNAP3_uc011lqr.1_RNA|CNTNAP3_uc004abk.1_Missense_Mutation_p.L336F|CNTNAP3_uc011lqs.1_Missense_Mutation_p.L336F|CNTNAP3_uc004abl.1_Missense_Mutation_p.L248F	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	336	Extracellular (Potential).|Laminin G-like 1.				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTATAATAAAGATTTTCTAAA	0.403													15	60	---	---	---	---	PASS
ANKS6	203286	broad.mit.edu	37	9	101546366	101546366	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101546366C>T	uc004ayu.2	-	4	1002	c.981G>A	c.(979-981)GCG>GCA	p.A327A	ANKS6_uc004ayt.2_Silent_p.A26A|ANKS6_uc004ayx.1_RNA|ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	327	ANK 9.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)				TCAGTGGCGTCGCCCCGTCCC	0.597													19	42	---	---	---	---	PASS
SMC2	10592	broad.mit.edu	37	9	106875709	106875709	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106875709G>A	uc004bbv.2	+	11	1655	c.1367G>A	c.(1366-1368)AGA>AAA	p.R456K	SMC2_uc004bbu.1_Missense_Mutation_p.R456K|SMC2_uc004bbw.2_Missense_Mutation_p.R456K|SMC2_uc011lvl.1_Missense_Mutation_p.R456K|SMC2_uc010mth.1_Missense_Mutation_p.R406K|SMC2_uc004bbx.2_Missense_Mutation_p.R456K	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	456	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						GCTGTAAAAAGACTTAAAGAA	0.333													12	37	---	---	---	---	PASS
OR13C9	286362	broad.mit.edu	37	9	107379601	107379601	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107379601G>C	uc011lvr.1	-	1	885	c.885C>G	c.(883-885)ATC>ATG	p.I295M		NM_001001956	NP_001001956	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C,	295	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TAAGACTGTAGATTAAAGGAT	0.393													37	144	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123917084	123917084	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123917084G>C	uc004bkx.1	+	25	4289	c.4258G>C	c.(4258-4260)GAA>CAA	p.E1420Q	CEP110_uc004bla.1_Missense_Mutation_p.E868Q|CEP110_uc010mvo.1_Missense_Mutation_p.E89Q|CEP110_uc004blb.1_Missense_Mutation_p.E89Q|CEP110_uc010mvp.1_5'Flank	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	1420	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						TATTGTAGATGAAATTGAGTG	0.388													21	24	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127828300	127828300	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127828300G>A	uc004bpe.2	-						SCAI_uc004bpd.2_Nonsense_Mutation_p.Q46*|SCAI_uc010mwu.2_Intron	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2						negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						ctttccccttgagattgtgaa	0.000													11	41	---	---	---	---	PASS
PKN3	29941	broad.mit.edu	37	9	131476870	131476870	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131476870G>A	uc004bvw.2	+	12	1904	c.1511G>A	c.(1510-1512)GGT>GAT	p.G504D	PKN3_uc010myh.2_Missense_Mutation_p.G504D|PKN3_uc011mbk.1_Missense_Mutation_p.G54D	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta	504	Pro-rich.				signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						ACCCCCTTGGGTGAAGAGATG	0.607													6	49	---	---	---	---	PASS
CACNA1B	774	broad.mit.edu	37	9	140970329	140970329	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140970329G>A	uc004cog.2	+	34	5061	c.4916G>A	c.(4915-4917)CGG>CAG	p.R1639Q	CACNA1B_uc004coi.2_Missense_Mutation_p.R851Q|CACNA1B_uc004cok.1_RNA|CACNA1B_uc010ncp.1_5'UTR	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	1639	IV.|Extracellular (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	AACAACTTCCGGACGTTTTTG	0.547													13	8	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26856371	26856371	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26856371C>G	uc001iss.2	+	15	2276	c.1955C>G	c.(1954-1956)TCA>TGA	p.S652*		NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	652					blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						GATTTCATGTCAGACCTCATG	0.627													7	10	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	69407184	69407184	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69407184G>C	uc009xpn.1	-	2	211	c.88C>G	c.(88-90)CTC>GTC	p.L30V	CTNNA3_uc001jmw.2_Missense_Mutation_p.L30V|CTNNA3_uc001jmx.3_Missense_Mutation_p.L30V|CTNNA3_uc009xpo.1_5'UTR|CTNNA3_uc001jna.2_Missense_Mutation_p.L42V	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	30					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						TGGATTATGAGAGGCTCCAGT	0.378													15	59	---	---	---	---	PASS
PBLD	64081	broad.mit.edu	37	10	70043943	70043943	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70043943C>T	uc001jns.1	-	10	1061	c.858G>A	c.(856-858)CTG>CTA	p.L286L	PBLD_uc001jnr.1_Silent_p.L253L|PBLD_uc001jnt.1_Silent_p.L286L	NM_022129	NP_071412	P30039	PBLD_HUMAN	MAWD binding protein isoform a	286					biosynthetic process		isomerase activity			skin(2)|ovary(1)	3						TCTAGGCTGTCAGTGTGCCCT	0.493													28	51	---	---	---	---	PASS
PBLD	64081	broad.mit.edu	37	10	70066543	70066543	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70066543G>A	uc001jns.1	-	2	262	c.59C>T	c.(58-60)CCT>CTT	p.P20L	PBLD_uc001jnt.1_Missense_Mutation_p.P20L|PBLD_uc001jnu.1_Missense_Mutation_p.P20L|PBLD_uc001jnv.1_Missense_Mutation_p.P20L	NM_022129	NP_071412	P30039	PBLD_HUMAN	MAWD binding protein isoform a	20					biosynthetic process		isomerase activity			skin(2)|ovary(1)	3						AACAGCAGCAGGATTCCCACG	0.368													10	37	---	---	---	---	PASS
HKDC1	80201	broad.mit.edu	37	10	70992572	70992572	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70992572G>A	uc001jpf.3	+	3	412	c.279G>A	c.(277-279)CTG>CTA	p.L93L	HKDC1_uc010qje.1_5'Flank	NM_025130	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	93					glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity			ovary(4)|skin(1)	5						TCCGAGTGCTGAAGGTGCAAG	0.443													23	84	---	---	---	---	PASS
TYSND1	219743	broad.mit.edu	37	10	71899836	71899836	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71899836G>C	uc001jqr.2	-	4	1699	c.1545C>G	c.(1543-1545)TTC>TTG	p.F515L	TYSND1_uc001jqq.2_RNA|TYSND1_uc001jqs.2_3'UTR|TYSND1_uc001jqt.2_RNA	NM_173555	NP_775826	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1 isoform a	515	Serine protease.				proteolysis	peroxisome	serine-type endopeptidase activity			large_intestine(1)	1						TGGGAATGCTGAAGTTCAGGT	0.597													19	62	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72462221	72462221	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72462221G>A	uc001jrh.2	+	3	676	c.676G>A	c.(676-678)GAA>AAA	p.E226K	ADAMTS14_uc001jrg.2_Missense_Mutation_p.E226K	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	226					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						CCTGCACAATGAAGGTAGGCT	0.547													18	34	---	---	---	---	PASS
SLC16A12	387700	broad.mit.edu	37	10	91195879	91195879	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91195879G>C	uc001kgm.2	-	7	1527	c.1136C>G	c.(1135-1137)TCA>TGA	p.S379*	SLC16A12_uc001kgl.2_Nonsense_Mutation_p.S51*	NM_213606	NP_998771	Q6ZSM3	MOT12_HUMAN	solute carrier family 16 (monocarboxylic acid	379	Extracellular (Potential).					integral to membrane|plasma membrane	symporter activity			skin(1)	1						ACCAAGCGCTGATGACAAAGA	0.502													3	25	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91497950	91497950	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91497950G>C	uc001kgs.1	+	20	3424	c.3352G>C	c.(3352-3354)GAA>CAA	p.E1118Q	KIF20B_uc001kgr.1_Missense_Mutation_p.E1078Q|KIF20B_uc001kgt.1_Missense_Mutation_p.E329Q|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1118					cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						AAAAGAAAAAGAAACTCTTAT	0.338													30	61	---	---	---	---	PASS
ALDH18A1	5832	broad.mit.edu	37	10	97380956	97380956	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97380956C>T	uc001kkz.2	-	12	1541	c.1299G>A	c.(1297-1299)TTG>TTA	p.L433L	ALDH18A1_uc001kky.2_Silent_p.L431L|ALDH18A1_uc010qog.1_Silent_p.L322L|ALDH18A1_uc010qoh.1_Silent_p.L221L	NM_002860	NP_002851	P54886	P5CS_HUMAN	pyrroline-5-carboxylate synthetase isoform 1	433	Gamma-glutamyl phosphate reductase.				proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)	CCAGGCTGTTCAATTTGGATG	0.537													3	28	---	---	---	---	PASS
EXOSC1	51013	broad.mit.edu	37	10	99203046	99203046	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99203046C>G	uc001kni.2	-	3	196	c.170G>C	c.(169-171)AGA>ACA	p.R57T	EXOSC1_uc009xvp.1_Intron|ZDHHC16_uc001knp.2_5'Flank|ZDHHC16_uc001knk.2_5'Flank|ZDHHC16_uc001knl.2_5'Flank|ZDHHC16_uc001knm.2_5'Flank|ZDHHC16_uc001knn.2_5'Flank|ZDHHC16_uc010qow.1_5'Flank|ZDHHC16_uc009xvq.2_5'Flank|ZDHHC16_uc001kno.2_5'Flank|ZDHHC16_uc001knj.2_5'Flank	NM_016046	NP_057130	Q9Y3B2	EXOS1_HUMAN	exosomal core protein CSL4	57					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	protein binding|RNA binding				0		Renal(717;0.000147)|Colorectal(252;0.00205)|Ovarian(717;0.00965)		all cancers(201;8.29e-42)|Epithelial(162;5.7e-33)|BRCA - Breast invasive adenocarcinoma(275;0.000315)|Kidney(138;0.000832)|KIRC - Kidney renal clear cell carcinoma(50;0.00269)|STAD - Stomach adenocarcinoma(243;0.202)		CTCTGTTTCTCTCACTACAGA	0.443													69	170	---	---	---	---	PASS
CHUK	1147	broad.mit.edu	37	10	101953849	101953849	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101953849G>A	uc001kqp.2	-	18	1921	c.1866C>T	c.(1864-1866)CTC>CTT	p.L622L		NM_001278	NP_001269	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	622					I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)		CCACCTTAGGGAGTAGATCAA	0.418													16	37	---	---	---	---	PASS
C10orf76	79591	broad.mit.edu	37	10	103751799	103751799	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103751799C>T	uc009xwy.1	-						C10orf76_uc009xwx.1_5'Flank	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		TCATAGGCTTCACACCAAAAA	0.428													8	110	---	---	---	---	PASS
PITX3	5309	broad.mit.edu	37	10	103990664	103990664	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103990664G>A	uc001kuu.1	-	4	670	c.516C>T	c.(514-516)TTC>TTT	p.F172F		NM_005029	NP_005020	O75364	PITX3_HUMAN	paired-like homeodomain 3	172					dopaminergic neuron differentiation|lens morphogenesis in camera-type eye|midbrain development|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		AGTTGAAGGCGAATGGAAAGG	0.697													7	16	---	---	---	---	PASS
PITX3	5309	broad.mit.edu	37	10	103990725	103990725	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103990725G>T	uc001kuu.1	-	4	609	c.455C>A	c.(454-456)TCG>TAG	p.S152*		NM_005029	NP_005020	O75364	PITX3_HUMAN	paired-like homeodomain 3	152					dopaminergic neuron differentiation|lens morphogenesis in camera-type eye|midbrain development|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GTTGCCGTACGAGTAGCCGGG	0.687													4	9	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104139119	104139119	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104139119G>C	uc001kux.1	+	34	4810	c.4570G>C	c.(4570-4572)GAG>CAG	p.E1524Q	GBF1_uc001kuy.1_Missense_Mutation_p.E1520Q|GBF1_uc001kuz.1_Missense_Mutation_p.E1521Q	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1524					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		ACGCCACCTGGAGACAGGTGG	0.607													16	39	---	---	---	---	PASS
DUSP5	1847	broad.mit.edu	37	10	112262487	112262487	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112262487G>A	uc001kzd.2	+	2	643	c.388G>A	c.(388-390)GAG>AAG	p.E130K		NM_004419	NP_004410	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	130	Rhodanese.				endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		AGGGGGATATGAGACTTTCTA	0.408													20	80	---	---	---	---	PASS
PLEKHA1	59338	broad.mit.edu	37	10	124172482	124172482	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124172482G>A	uc001lge.1	+	6	512	c.389G>A	c.(388-390)CGC>CAC	p.R130H	PLEKHA1_uc001lgf.1_Missense_Mutation_p.R130H|PLEKHA1_uc001lgg.1_Missense_Mutation_p.R130H|PLEKHA1_uc001lgh.2_Missense_Mutation_p.R130H	NM_001001974	NP_001001974	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A	130					B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AACCTAAGTCGCCATGGTGAA	0.388													11	60	---	---	---	---	PASS
DOCK1	1793	broad.mit.edu	37	10	129216661	129216661	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129216661G>A	uc001ljt.2	+	45	4549	c.4485G>A	c.(4483-4485)GAG>GAA	p.E1495E	DOCK1_uc010qun.1_Silent_p.E1516E|DOCK1_uc009yaq.2_Silent_p.E490E	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1495	DHR-2.				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ATGCCATTGAGACCATGCAGC	0.597													7	12	---	---	---	---	PASS
PSMD13	5719	broad.mit.edu	37	11	248982	248982	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:248982G>C	uc001lol.2	+	9	941	c.699G>C	c.(697-699)CTG>CTC	p.L233L	PSMD13_uc010qvr.1_RNA|PSMD13_uc001loo.2_Silent_p.L235L|PSMD13_uc001lon.2_Silent_p.L168L|PSMD13_uc001lom.2_Silent_p.L208L|PSMD13_uc001lop.2_Silent_p.L16L	NM_002817	NP_002808	Q9UNM6	PSD13_HUMAN	proteasome 26S non-ATPase subunit 13 isoform 1	233					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding			ovary(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		GGCAGTGGCTGATTGACACCC	0.557													19	30	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1020730	1020730	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1020730C>T	uc001lsw.2	-	28	3645	c.3594G>A	c.(3592-3594)CCG>CCA	p.P1198P		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1198					maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCGTGGTGGGCGGCACTGCAA	0.662													28	86	---	---	---	---	PASS
IPO7	10527	broad.mit.edu	37	11	9424908	9424908	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9424908G>C	uc001mho.2	+	2	298	c.156G>C	c.(154-156)GTG>GTC	p.V52V		NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7	52	Importin N-terminal.				interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		ATTTACCTGTGAGACAGGCAG	0.378													17	38	---	---	---	---	PASS
MRVI1	10335	broad.mit.edu	37	11	10602102	10602102	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10602102G>C	uc010rcc.1	-	20	2781	c.2395C>G	c.(2395-2397)CAA>GAA	p.Q799E	uc001miu.2_Intron|MRVI1_uc001miw.2_Missense_Mutation_p.Q790E|MRVI1_uc010rcb.1_Missense_Mutation_p.Q791E|MRVI1_uc009ygb.1_Missense_Mutation_p.Q484E|MRVI1_uc001mix.2_Missense_Mutation_p.Q484E|MRVI1_uc001miz.2_Missense_Mutation_p.Q708E|MRVI1_uc009ygc.1_Missense_Mutation_p.Q708E|MRVI1_uc010rcd.1_Missense_Mutation_p.Q593E|MRVI1_uc009ygd.1_Missense_Mutation_p.Q484E	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c	772	Glu-rich.				platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		TTCAGGTCTTGAAGTTCTTTG	0.488													42	96	---	---	---	---	PASS
GALNTL4	374378	broad.mit.edu	37	11	11398878	11398878	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11398878G>A	uc001mjo.2	-	5	1249	c.828C>T	c.(826-828)ATC>ATT	p.I276I		NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	276	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		AGGATGGCGAGATGATCCGCT	0.522													8	43	---	---	---	---	PASS
PLEKHA7	144100	broad.mit.edu	37	11	16877407	16877407	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16877407G>A	uc001mmo.2	-	5	375	c.360C>T	c.(358-360)GTC>GTT	p.V120V	PLEKHA7_uc010rcu.1_Silent_p.V120V	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	120					epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						ATGTTTCACTGACCATGCTGG	0.537													33	167	---	---	---	---	PASS
KCNJ11	3767	broad.mit.edu	37	11	17409138	17409138	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17409138G>C	uc001mna.2	-	1	1069	c.501C>G	c.(499-501)ATC>ATG	p.I167M	KCNJ11_uc001mnb.3_Missense_Mutation_p.I80M	NM_000525	NP_000516	B4DWI4	B4DWI4_HUMAN	potassium inwardly-rectifying channel J11	167						integral to membrane	ATP-activated inward rectifier potassium channel activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)		TCTTCATGAAGATGCAGCCAA	0.607											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	11	---	---	---	---	PASS
KCNC1	3746	broad.mit.edu	37	11	17793409	17793409	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17793409C>T	uc001mnk.3	+	2	823	c.768C>T	c.(766-768)TTC>TTT	p.F256F	KCNC1_uc009yhc.1_Silent_p.F256F	NM_004976	NP_004967	P48547	KCNC1_HUMAN	Shaw-related voltage-gated potassium channel	256	Helical; Name=Segment S2; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)	1						TGGTCTGGTTCACCTTCGAGT	0.542													39	109	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18743564	18743564	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18743564G>A	uc009yht.2	-	3	324	c.134C>T	c.(133-135)TCG>TTG	p.S45L	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	45										ovary(4)|large_intestine(2)|kidney(1)	7						CACTATGCTCGAGGACTTCCT	0.607											OREG0020822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	40	---	---	---	---	PASS
TCP11L1	55346	broad.mit.edu	37	11	33079605	33079605	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33079605G>A	uc001mud.2	+	5	958	c.558G>A	c.(556-558)ATG>ATA	p.M186I	TCP11L1_uc009yju.2_Missense_Mutation_p.M1I|TCP11L1_uc010rei.1_Missense_Mutation_p.M186I|TCP11L1_uc001mue.2_Missense_Mutation_p.M186I|TCP11L1_uc001muf.1_5'Flank	NM_018393	NP_060863	Q9NUJ3	T11L1_HUMAN	t-complex 11 (mouse) like 1	186											0						TTATTGGCATGATGGGGACAC	0.428													13	25	---	---	---	---	PASS
MADD	8567	broad.mit.edu	37	11	47296120	47296120	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47296120G>A	uc001ner.1	+	3	260	c.69G>A	c.(67-69)CCG>CCA	p.P23P	MADD_uc001neq.2_Silent_p.P23P|MADD_uc001nev.1_Silent_p.P23P|MADD_uc001nes.1_Silent_p.P23P|MADD_uc001net.1_Silent_p.P23P|MADD_uc009yln.1_Silent_p.P23P|MADD_uc001neu.1_Silent_p.P23P|MADD_uc001nex.2_Silent_p.P23P|MADD_uc001nez.2_Silent_p.P23P|MADD_uc001new.2_Silent_p.P23P	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	23					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		TCAGGCACCCGAGCAGTGATA	0.483													38	135	---	---	---	---	PASS
CTNND1	1500	broad.mit.edu	37	11	57506443	57506443	+	Intron	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57506443C>A	uc001nlf.1	+						TMX2_uc001nlc.1_Intron|TMX2_uc001nld.1_Intron|TMX2_uc001nle.1_Intron|C11orf31_uc010rjx.1_5'Flank	NM_001085462	NP_001078931	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1A						adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				ATATTCTTTTCAGATACAACT	0.393													4	63	---	---	---	---	PASS
MS4A3	932	broad.mit.edu	37	11	59828641	59828641	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59828641C>T	uc001nom.2	+	2	136	c.8C>T	c.(7-9)TCC>TTC	p.S3F	MS4A3_uc001non.2_Missense_Mutation_p.S3F|MS4A3_uc001noo.2_Intron	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	3	Cytoplasmic (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				CCAATGGCCTCCCACGAAGTT	0.488													12	59	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61919295	61919295	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61919295C>G	uc001nsw.1	+	19	2806	c.2604C>G	c.(2602-2604)CTC>CTG	p.L868L	INCENP_uc001nsx.1_Silent_p.L864L|INCENP_uc001nsy.1_Silent_p.L282L	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	868					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						TTCTGGAGCTCTTTGGAACCA	0.577													11	49	---	---	---	---	PASS
HNRNPUL2	221092	broad.mit.edu	37	11	62488794	62488794	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62488794C>T	uc001nuw.2	-	9	1777	c.1584G>A	c.(1582-1584)CGG>CGA	p.R528R	HNRNPUL2_uc001nuu.1_RNA	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like	528					cell killing	nucleus	ATP binding|nucleic acid binding				0						TCCTCTTTGTCCGGGAAGCAA	0.453													50	170	---	---	---	---	PASS
CTSW	1521	broad.mit.edu	37	11	65650772	65650772	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65650772C>T	uc001ogc.1	+	9	939	c.897C>T	c.(895-897)GGC>GGT	p.G299G	CTSW_uc001ogb.1_Silent_p.G299G	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	299					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)		TGGGTTTTGGCAGCGTCAAGT	0.592													4	109	---	---	---	---	PASS
CABP2	51475	broad.mit.edu	37	11	67288598	67288598	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67288598C>G	uc001omc.1	-	4	379	c.277G>C	c.(277-279)GAC>CAC	p.D93H	CABP2_uc001omd.1_Missense_Mutation_p.D36H|CABP2_uc001ome.1_Missense_Mutation_p.D99H	NM_016366	NP_057450	Q9NPB3	CABP2_HUMAN	calcium binding protein 2 isoform 1	93	1 (Potential).|EF-hand 1.				signal transduction	Golgi apparatus|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1						CCGTCCCGGTCTCGGTCAAAC	0.637													20	28	---	---	---	---	PASS
C11orf24	53838	broad.mit.edu	37	11	68031153	68031153	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68031153C>T	uc001onr.3	-						C11orf24_uc001ons.2_Intron	NM_022338	NP_071733	Q96F05	CK024_HUMAN	hypothetical protein LOC53838 precursor							integral to membrane					0						ACAGCTTTCTCACTTACGTGG	0.542													5	12	---	---	---	---	PASS
LRP5	4041	broad.mit.edu	37	11	68153789	68153789	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68153789G>A	uc001ont.2	+	6	1096	c.1021G>A	c.(1021-1023)GAG>AAG	p.E341K	LRP5_uc009ysg.2_5'UTR	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	341	Beta-propeller 2.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						CACAGGAGCCGAGGAGGTGCT	0.657													12	36	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71724989	71724989	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71724989G>A	uc001orl.1	-	15	3732	c.3560C>T	c.(3559-3561)TCG>TTG	p.S1187L	NUMA1_uc009ysw.1_Missense_Mutation_p.S750L|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Missense_Mutation_p.S1187L|NUMA1_uc001orn.2_Missense_Mutation_p.S750L|NUMA1_uc009ysx.1_Missense_Mutation_p.S1187L|NUMA1_uc001oro.1_Missense_Mutation_p.S1187L	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1187	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CCGTTGGGCCGAGGCTAAGGC	0.652			T	RARA	APL								20	22	---	---	---	---	PASS
RSF1	51773	broad.mit.edu	37	11	77412845	77412845	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77412845C>T	uc001oyn.2	-	6	1549	c.1429G>A	c.(1429-1431)GAC>AAC	p.D477N	RSF1_uc001oym.2_Missense_Mutation_p.D225N	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	477					CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			ATATTTCTGTCCTTAGAGGGG	0.398													29	63	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92534124	92534124	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92534124G>A	uc001pdj.3	+	9	7962	c.7945G>A	c.(7945-7947)GAC>AAC	p.D2649N		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2649	Cadherin 24.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTCAGTGGCCGACCTCCTGGA	0.458										TCGA Ovarian(4;0.039)			6	12	---	---	---	---	PASS
AMOTL1	154810	broad.mit.edu	37	11	94533423	94533423	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94533423G>A	uc001pfb.2	+	3	1237	c.1067G>A	c.(1066-1068)AGA>AAA	p.R356K	AMOTL1_uc001pfc.2_Missense_Mutation_p.R306K	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	356						cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CAGCCTGTGAGAACAGATGTG	0.552													35	35	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108160402	108160402	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108160402G>A	uc001pkb.1	+	29	4695	c.4310G>A	c.(4309-4311)AGA>AAA	p.R1437K	ATM_uc009yxr.1_Missense_Mutation_p.R1437K|ATM_uc001pkd.3_Missense_Mutation_p.R89K|ATM_uc001pke.1_Missense_Mutation_p.R89K|ATM_uc010rvw.1_Missense_Mutation_p.R89K|ATM_uc001pkf.2_Missense_Mutation_p.R89K	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1437					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		AAGAAGCACAGAATTCTTAAA	0.313			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			13	17	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108380360	108380360	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108380360G>A	uc001pkk.2	-	6	5985	c.5874C>T	c.(5872-5874)ATC>ATT	p.I1958I	EXPH5_uc010rvy.1_Silent_p.I1770I|EXPH5_uc010rvz.1_Silent_p.I1802I|EXPH5_uc010rwa.1_Silent_p.I1882I	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1958					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CATCCTCATAGATATTAAGCG	0.448													45	72	---	---	---	---	PASS
CLSTN3	9746	broad.mit.edu	37	12	7301773	7301773	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7301773G>T	uc001qsr.2	+	13	2331	c.2053G>T	c.(2053-2055)GAT>TAT	p.D685Y	CLSTN3_uc001qss.2_Missense_Mutation_p.D697Y	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	685	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						GGCCAAAAAGGATGAGAGTTG	0.562													4	17	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9304273	9304273	+	Intron	SNP	A	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9304273A>G	uc001qvl.2	-						PZP_uc009zgl.2_Intron	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						TTCAAGCTGGAGAGAATTAGA	0.433													6	17	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12291364	12291364	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12291364C>G	uc001rah.3	-	16	3644	c.3502G>C	c.(3502-3504)GAA>CAA	p.E1168Q	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.E1168Q	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	1168	Extracellular (Potential).|LDL-receptor class B 20.|Beta-propeller 4.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				TCAATTTTTTCAATCATTTGC	0.418													45	130	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12291406	12291406	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12291406C>G	uc001rah.3	-	16	3602	c.3460G>C	c.(3460-3462)GAA>CAA	p.E1154Q	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.E1154Q	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	1154	Extracellular (Potential).|LDL-receptor class B 19.|Beta-propeller 4.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				AGCCAGTTTTCAAACACAGTA	0.408													40	107	---	---	---	---	PASS
PYROXD1	79912	broad.mit.edu	37	12	21621553	21621553	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21621553G>A	uc001rew.2	+	12	1495	c.1368G>A	c.(1366-1368)ATG>ATA	p.M456I	PYROXD1_uc009ziq.2_Missense_Mutation_p.M197I|PYROXD1_uc009zir.2_Missense_Mutation_p.M162I	NM_024854	NP_079130	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase	456							oxidoreductase activity			ovary(1)	1						ATGGACGAATGATGGGAGCTG	0.368													12	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31278472	31278472	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31278472C>T	uc010sjy.1	-	27	3517	c.3517G>A	c.(3517-3519)GAA>AAA	p.E1173K						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		GATGGAAATTCTTCTGTCTTG	0.418													5	8	---	---	---	---	PASS
ANO6	196527	broad.mit.edu	37	12	45725117	45725117	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45725117G>A	uc001roo.2	+	3	525	c.190G>A	c.(190-192)GAT>AAT	p.D64N	ANO6_uc010sld.1_Missense_Mutation_p.D64N|ANO6_uc010sle.1_Missense_Mutation_p.D64N|ANO6_uc010slf.1_Missense_Mutation_p.D85N|ANO6_uc010slg.1_Missense_Mutation_p.D46N	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a	64	Cytoplasmic (Potential).				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2						CTTTTTTAATGATGGCCAGCG	0.294													6	31	---	---	---	---	PASS
ANO6	196527	broad.mit.edu	37	12	45725130	45725130	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45725130G>A	uc001roo.2	+	3	538	c.203G>A	c.(202-204)AGA>AAA	p.R68K	ANO6_uc010sld.1_Missense_Mutation_p.R68K|ANO6_uc010sle.1_Missense_Mutation_p.R68K|ANO6_uc010slf.1_Missense_Mutation_p.R89K|ANO6_uc010slg.1_Missense_Mutation_p.R50K	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a	68	Cytoplasmic (Potential).				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2						GGCCAGCGAAGAATTGACTTT	0.294													9	28	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49441745	49441745	+	Intron	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49441745C>G	uc001rta.3	-							NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCCCTGAACTCACCTTGCTGT	0.562			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	42	---	---	---	---	PASS
PAN2	9924	broad.mit.edu	37	12	56726779	56726779	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56726779G>A	uc001skx.2	-	2	473	c.100C>T	c.(100-102)CTA>TTA	p.L34L	PAN2_uc001skz.2_Silent_p.L34L|PAN2_uc001sky.2_Silent_p.L34L	NM_001127460	NP_001120932	Q504Q3	PAN2_HUMAN	PAN2 polyA specific ribonuclease subunit homolog	34					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6						ACATTCTGTAGCAGACTTGGG	0.552													12	42	---	---	---	---	PASS
AVPR1A	552	broad.mit.edu	37	12	63544014	63544014	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63544014G>A	uc001sro.1	-	1	2577	c.603C>T	c.(601-603)CGC>CGT	p.R201R		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	201	Extracellular (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	CCCAGCAGTCGCGGGCCTTGG	0.622													21	66	---	---	---	---	PASS
NUP107	57122	broad.mit.edu	37	12	69082777	69082777	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69082777G>A	uc001suf.2	+	2	159	c.44G>A	c.(43-45)CGG>CAG	p.R15Q	uc001sud.1_5'Flank|uc001sue.1_5'Flank|NUP107_uc001sug.2_5'UTR|NUP107_uc010stj.1_5'UTR	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa	15					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			CCTGTAATCCGGGAGGCAGAG	0.368													5	31	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70954692	70954692	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70954692G>A	uc001swb.3	-	15	3567	c.3537C>T	c.(3535-3537)CTC>CTT	p.L1179L	PTPRB_uc010sto.1_Silent_p.L1089L|PTPRB_uc010stp.1_Silent_p.L1089L|PTPRB_uc001swc.3_Silent_p.L1397L|PTPRB_uc001swa.3_Silent_p.L1309L|PTPRB_uc001swd.3_Silent_p.L1396L|PTPRB_uc009zrr.1_Silent_p.L1276L	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1179	Fibronectin type-III 14.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TGGACCCCCTGAGATGACTCA	0.453													32	72	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	73046792	73046792	+	Intron	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73046792G>C	uc001sxa.2	+							NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme						cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TTCTATCTTTGAAGGCTTCTA	0.318													11	31	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78571090	78571090	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78571090C>T	uc001syp.2	+	27	5467	c.5294C>T	c.(5293-5295)TCA>TTA	p.S1765L	NAV3_uc001syo.2_Missense_Mutation_p.S1765L|NAV3_uc010sub.1_Missense_Mutation_p.S1244L|NAV3_uc009zsf.2_Missense_Mutation_p.S596L	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1765						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CAATCTGCTTCAGCGTAAGTT	0.403										HNSCC(70;0.22)			23	59	---	---	---	---	PASS
MGAT4C	25834	broad.mit.edu	37	12	86373204	86373204	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86373204C>T	uc001tai.3	-	8	2550	c.1300G>A	c.(1300-1302)GAA>AAA	p.E434K	MGAT4C_uc001tal.3_Missense_Mutation_p.E434K|MGAT4C_uc001taj.3_Missense_Mutation_p.E434K|MGAT4C_uc001tak.3_Missense_Mutation_p.E434K|MGAT4C_uc010sum.1_Missense_Mutation_p.E458K|MGAT4C_uc001tah.3_Missense_Mutation_p.E434K	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	434	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						TTTTTGAATTCTCCTAGTCTT	0.343													25	52	---	---	---	---	PASS
MGAT4C	25834	broad.mit.edu	37	12	86373637	86373637	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86373637C>A	uc001tai.3	-	8	2117	c.867G>T	c.(865-867)TTG>TTT	p.L289F	MGAT4C_uc001tal.3_Missense_Mutation_p.L289F|MGAT4C_uc001taj.3_Missense_Mutation_p.L289F|MGAT4C_uc001tak.3_Missense_Mutation_p.L289F|MGAT4C_uc010sum.1_Missense_Mutation_p.L313F|MGAT4C_uc001tah.3_Missense_Mutation_p.L289F	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	289	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						GGAAATGAGTCAATAGCCAAT	0.393													25	53	---	---	---	---	PASS
CHPT1	56994	broad.mit.edu	37	12	102120186	102120186	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102120186C>T	uc001tin.2	+						CHPT1_uc001tio.2_Intron|CHPT1_uc001tip.1_Missense_Mutation_p.H394Y	NM_020244	NP_064629	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1						platelet activating factor biosynthetic process|regulation of cell growth	Golgi membrane|integral to membrane|microsome	diacylglycerol binding|diacylglycerol cholinephosphotransferase activity|metal ion binding				0						TGAACAGGTTCACAAGCATAT	0.413													11	42	---	---	---	---	PASS
SART3	9733	broad.mit.edu	37	12	108942982	108942982	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108942982G>A	uc001tmz.1	-	2	556	c.321C>T	c.(319-321)ATC>ATT	p.I107I	SART3_uc009zux.1_5'UTR|SART3_uc010swx.1_Silent_p.I107I|SART3_uc010swy.1_5'UTR|SART3_uc010swz.1_Silent_p.I107I|SART3_uc001tna.1_RNA	NM_014706	NP_055521	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T	107	Potential.				RNA processing	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding			pancreas(1)	1						CATAGACGTTGATAGACAACT	0.438									Porokeratosis				10	33	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109654655	109654655	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109654655C>T	uc001tob.2	+	24	3613	c.3494C>T	c.(3493-3495)TCC>TTC	p.S1165F	ACACB_uc001toc.2_Missense_Mutation_p.S1165F	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	1165					acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	CCAGACATGTCCCAGGTGCTG	0.532													7	28	---	---	---	---	PASS
RAB35	11021	broad.mit.edu	37	12	120541722	120541722	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120541722G>A	uc001txm.1	-	3	280	c.135C>T	c.(133-135)TTC>TTT	p.F45F	RAB35_uc009zww.1_5'UTR|RAB35_uc010szh.1_Silent_p.F45F	NM_006861	NP_006852	Q15286	RAB35_HUMAN	RAB35, member RAS oncogene family	45	Effector region (By similarity).				cytokinesis|endosome transport|protein transport|small GTPase mediated signal transduction	cell projection membrane|clathrin-coated endocytic vesicle|coated pit|endosome|intercellular bridge|melanosome	GTP binding|GTPase activity|phosphatidylinositol-4,5-bisphosphate binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)		TCCGGATCTTGAAATCCACTC	0.617													9	41	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120585024	120585024	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120585024C>G	uc001txo.2	-	38	4792	c.4779G>C	c.(4777-4779)CAG>CAC	p.Q1593H		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1593	HEAT 10.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCAAGCACTTCTGGGTCTTCC	0.547													8	22	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133244079	133244079	+	Intron	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133244079C>G	uc001uks.1	-						POLE_uc010tbq.1_Intron|POLE_uc009zyu.1_Intron	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon						base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		TGCAGCCCCTCAGAGCTCACC	0.592								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					18	78	---	---	---	---	PASS
LNX2	222484	broad.mit.edu	37	13	28122532	28122532	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28122532C>T	uc001url.3	-	10	2322	c.2013G>A	c.(2011-2013)TTG>TTA	p.L671L		NM_153371	NP_699202	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	671	PDZ 4.						zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	6		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		TCTGCTCCTTCAACATGGGAA	0.458													12	24	---	---	---	---	PASS
PAN3	255967	broad.mit.edu	37	13	28866564	28866564	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28866564G>A	uc001urz.2	+	18	2139	c.2131G>A	c.(2131-2133)GAG>AAG	p.E711K	PAN3_uc001ury.2_Missense_Mutation_p.E545K|PAN3_uc001urx.2_Missense_Mutation_p.E657K	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	857	Interaction with PAN2.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		TTCCAGAGATGAGAAGAGTGT	0.353													4	63	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	29012465	29012465	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29012465C>T	uc001usb.3	-	4	691	c.406G>A	c.(406-408)GTA>ATA	p.V136I	FLT1_uc010aar.1_Missense_Mutation_p.V136I|FLT1_uc001usc.3_Missense_Mutation_p.V136I|FLT1_uc010tdp.1_Missense_Mutation_p.V136I	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	136	Extracellular (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	TACATCTCTACGAAAGGTCTA	0.398													11	37	---	---	---	---	PASS
MTRF1	9617	broad.mit.edu	37	13	41814474	41814474	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41814474C>T	uc001uxx.2	-	8	1263	c.793G>A	c.(793-795)GAG>AAG	p.E265K	MTRF1_uc001uxy.2_Missense_Mutation_p.E265K|MTRF1_uc001uxz.2_Missense_Mutation_p.E101K|MTRF1_uc010tff.1_Missense_Mutation_p.E278K|MTRF1_uc001uyc.1_Missense_Mutation_p.E265K	NM_004294	NP_004285	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	265					regulation of translational termination	mitochondrion	translation release factor activity, codon specific				0		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		AGGCCCACCTCGGGGATGCGC	0.552													9	54	---	---	---	---	PASS
C13orf31	144811	broad.mit.edu	37	13	44455648	44455648	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44455648G>A	uc010acg.2	+	2	1012	c.527G>A	c.(526-528)GGA>GAA	p.G176E	CCDC122_uc010acf.2_5'Flank|C13orf31_uc001uzf.3_Missense_Mutation_p.G176E	NM_001128303	NP_001121775	Q8IV20	CM031_HUMAN	hypothetical protein LOC144811	176											0		Lung NSC(96;0.000163)|all_hematologic(4;0.0127)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Breast(139;0.0364)|Lung SC(185;0.0367)|Acute lymphoblastic leukemia(4;0.138)		GBM - Glioblastoma multiforme(144;0.000573)|BRCA - Breast invasive adenocarcinoma(63;0.121)		GCACTGAGAGGAAAATTAACT	0.333													21	72	---	---	---	---	PASS
UTP14C	9724	broad.mit.edu	37	13	52604876	52604876	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52604876C>T	uc001vgb.2	+	2	2471	c.1936C>T	c.(1936-1938)CGC>TGC	p.R646C	UTP14C_uc001vgc.2_RNA	NM_021645	NP_067677	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	646					cell differentiation|meiosis|multicellular organismal development|rRNA processing|spermatogenesis	nucleolus|small-subunit processome				ovary(3)|large_intestine(1)|breast(1)	5		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		CAAGAAAAGACGCCAGTTTCT	0.532													25	71	---	---	---	---	PASS
RBM26	64062	broad.mit.edu	37	13	79942903	79942903	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79942903C>T	uc001vkz.2	-	6	871	c.857G>A	c.(856-858)AGA>AAA	p.R286K	RBM26_uc001vky.2_Missense_Mutation_p.R286K|RBM26_uc001vla.2_Missense_Mutation_p.R286K|RBM26_uc001vkx.2_5'UTR|RBM26_uc001vlb.1_RNA	NM_022118	NP_071401	Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	286					mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		CATGGGTGGTCTTACGTAAGA	0.383													18	81	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329227	88329227	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329227G>C	uc001vln.2	+	2	1803	c.1584G>C	c.(1582-1584)TTG>TTC	p.L528F	SLITRK5_uc010tic.1_Missense_Mutation_p.L287F	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	528	Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCTCTGGCTTGACCCTCCTCA	0.522													20	67	---	---	---	---	PASS
IPO5	3843	broad.mit.edu	37	13	98652861	98652861	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98652861C>T	uc001vnf.1	+	10	1135	c.1070C>T	c.(1069-1071)CCG>CTG	p.P357L	IPO5_uc001vne.2_Missense_Mutation_p.P375L|IPO5_uc010tik.1_Missense_Mutation_p.P232L|IPO5_uc010til.1_Missense_Mutation_p.P297L|IPO5_uc001vng.1_5'Flank	NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5	357	Ran-GTP binding (By similarity).				interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						CTCGTTCTGCCGATGATCAAG	0.413													7	53	---	---	---	---	PASS
IPO5	3843	broad.mit.edu	37	13	98654945	98654945	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98654945G>C	uc001vnf.1	+	12	1306	c.1241G>C	c.(1240-1242)AGA>ACA	p.R414T	IPO5_uc001vne.2_Missense_Mutation_p.R432T|IPO5_uc010tik.1_Missense_Mutation_p.R289T|IPO5_uc010til.1_Missense_Mutation_p.R354T|IPO5_uc001vng.1_Missense_Mutation_p.R35T	NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5	414	HEAT 2.				interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						CAGCATCCAAGAGTAAGGTAT	0.383													17	83	---	---	---	---	PASS
FARP1	10160	broad.mit.edu	37	13	99087954	99087954	+	Silent	SNP	G	A	A	rs149797871	by1000genomes	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99087954G>A	uc001vnj.2	+	19	2604	c.2268G>A	c.(2266-2268)CCG>CCA	p.P756P	FARP1_uc001vnh.2_Silent_p.P756P	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	756					regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TTGTGGTTCCGGGAAGGGTAA	0.507													22	106	---	---	---	---	PASS
SLC15A1	6564	broad.mit.edu	37	13	99361909	99361909	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99361909C>G	uc001vno.2	-	14	1061	c.984G>C	c.(982-984)GTG>GTC	p.V328V		NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide	328	Helical; (Potential).				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	GGATGGCGTTCACGGTCTGCA	0.493													7	56	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103257205	103257205	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103257205G>C	uc001vpi.3	+	2	331	c.228G>C	c.(226-228)GTG>GTC	p.V76V		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	76					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTGGCGATGTGAATACTGCTA	0.343													7	134	---	---	---	---	PASS
FAM70B	348013	broad.mit.edu	37	13	114469200	114469200	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114469200G>A	uc001vuh.2	+	2	186	c.159G>A	c.(157-159)GTG>GTA	p.V53V	FAM70B_uc010tkh.1_Silent_p.V53V	NM_182614	NP_872420	Q8WV15	FA70B_HUMAN	family with sequence similarity 70, member B	53						integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)			CGGAGAATGTGACCGTTGGGG	0.657													10	70	---	---	---	---	PASS
UPF3A	65110	broad.mit.edu	37	13	115067351	115067351	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115067351G>A	uc001vup.2	+	9	1190	c.1153G>A	c.(1153-1155)GAG>AAG	p.E385K	UPF3A_uc001vuq.2_Missense_Mutation_p.E352K|UPF3A_uc001vus.2_Intron|UPF3A_uc001vur.2_RNA|UPF3A_uc001vut.2_Missense_Mutation_p.E184K|UPF3A_uc001vuu.2_Missense_Mutation_p.M38I	NM_023011	NP_075387	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A	385					mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation	cytoplasm|nucleus|plasma membrane	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			skin(1)	1	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GAGTGAGGATGAGCAGAGATG	0.582													4	19	---	---	---	---	PASS
OR4L1	122742	broad.mit.edu	37	14	20528262	20528262	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20528262G>C	uc001vwn.1	+	1	59	c.59G>C	c.(58-60)CGA>CCA	p.R20P		NM_001004717	NP_001004717	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L,	20	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		TTTTTTGGACGATGGGAACTT	0.363													34	118	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22891575	22891575	+	Intron	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22891575C>G	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Missense_Mutation_p.F13L|uc001wdt.1_Intron|uc001wdu.2_Missense_Mutation_p.F13L					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TCTCTCTCTTCTGGGCAGGTA	0.552													7	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22891929	22891929	+	Intron	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22891929G>C	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdt.1_Intron|uc001wdu.2_Missense_Mutation_p.D81H					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TGGTTTCAAAGACAATTTCCA	0.423													15	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22891972	22891972	+	Intron	SNP	T	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22891972T>C	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdt.1_Intron|uc001wdu.2_Missense_Mutation_p.V95A					SubName: Full=Alpha-chain C region; Flags: Fragment;																		AACCTGGCTGTACTTAAGATA	0.448													15	70	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22891979	22891979	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22891979G>A	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdt.1_Intron|uc001wdu.2_Silent_p.K97K					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CTGTACTTAAGATACTTGCAC	0.438													17	72	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36121019	36121019	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36121019C>G	uc001wti.2	-	30	4541	c.4150G>C	c.(4150-4152)GAC>CAC	p.D1384H	RALGAPA1_uc010amp.2_RNA|RALGAPA1_uc001wtj.2_Missense_Mutation_p.D1384H|RALGAPA1_uc010tpv.1_Missense_Mutation_p.D1397H|RALGAPA1_uc010tpw.1_Missense_Mutation_p.D1431H	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	1384	Minimal domain that binds to TCF3/E12 (By similarity).				activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						ACCCTCTTGTCCATTTCATAA	0.274													3	71	---	---	---	---	PASS
FBXO33	254170	broad.mit.edu	37	14	39868938	39868938	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39868938C>T	uc001wvk.2	-	4	1788	c.1450G>A	c.(1450-1452)GAT>AAT	p.D484N		NM_203301	NP_976046	Q7Z6M2	FBX33_HUMAN	F-box protein 33	484											0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		ACTTTCAGATCAGAGCCCCGA	0.448													6	18	---	---	---	---	PASS
PTGDR	5729	broad.mit.edu	37	14	52735042	52735042	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52735042C>T	uc001wzq.2	+	1	612	c.510C>T	c.(508-510)GGC>GGT	p.G170G		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	170	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CTTTCATGGGCTTCGGGAAGT	0.627													23	87	---	---	---	---	PASS
DDHD1	80821	broad.mit.edu	37	14	53522414	53522414	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53522414C>T	uc001xai.2	-	10	2439	c.2209G>A	c.(2209-2211)GAA>AAA	p.E737K	DDHD1_uc001xaj.2_Missense_Mutation_p.E744K|DDHD1_uc001xah.2_Missense_Mutation_p.E737K|DDHD1_uc001xag.2_Missense_Mutation_p.E319K|DDHD1_uc001xak.1_Missense_Mutation_p.E133K	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c	737	DDHD.				lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					GTTATAGATTCTCCATAGTGT	0.408													40	119	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65208765	65208765	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65208765G>A	uc001xho.1	+	16	2799	c.2530G>A	c.(2530-2532)GAG>AAG	p.E844K	PLEKHG3_uc001xhn.1_Missense_Mutation_p.E788K|PLEKHG3_uc001xhp.2_Missense_Mutation_p.E965K|PLEKHG3_uc010aqh.1_Missense_Mutation_p.E386K|PLEKHG3_uc001xhq.1_Missense_Mutation_p.E349K	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	844					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		TGACCTGCATGAGCCACTCTT	0.617													15	37	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65209118	65209118	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65209118G>C	uc001xho.1	+	16	3152	c.2883G>C	c.(2881-2883)AAG>AAC	p.K961N	PLEKHG3_uc001xhn.1_Missense_Mutation_p.K905N|PLEKHG3_uc001xhp.2_Missense_Mutation_p.K1082N|PLEKHG3_uc010aqh.1_Missense_Mutation_p.K503N|PLEKHG3_uc001xhq.1_Missense_Mutation_p.K466N	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	961					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GGGATGGGAAGAGCCCCACTG	0.602													11	35	---	---	---	---	PASS
ERH	2079	broad.mit.edu	37	14	69864951	69864951	+	5'UTR	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69864951C>G	uc001xlc.2	-	1					SLC39A9_uc001xld.3_5'Flank|SLC39A9_uc010aqx.2_5'Flank|SLC39A9_uc001xle.2_5'Flank|SLC39A9_uc001xlf.3_5'Flank|SLC39A9_uc001xlg.3_5'Flank	NM_004450	NP_004441	P84090	ERH_HUMAN	enhancer of rudimentary homolog						cell cycle|pyrimidine nucleoside metabolic process	midbody	protein binding				0				all cancers(60;0.00365)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0507)		TTCTCACCATCGCGCCAAACT	0.652													8	16	---	---	---	---	PASS
TMEM90A	646658	broad.mit.edu	37	14	74876329	74876329	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74876329G>C	uc001xpx.2	-	2	367	c.119C>G	c.(118-120)TCC>TGC	p.S40C		NM_001105579	NP_001099049	A6NDD5	SYN1L_HUMAN	transmembrane protein 90A	40					response to biotic stimulus	Golgi apparatus|integral to membrane					0				BRCA - Breast invasive adenocarcinoma(234;0.00159)		TAGGAGGTAGGAGTAGAGCTT	0.687													11	28	---	---	---	---	PASS
TRAF3	7187	broad.mit.edu	37	14	103336564	103336564	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103336564C>T	uc001ymc.1	+	3	379	c.26C>T	c.(25-27)TCT>TTT	p.S9F	TRAF3_uc001yme.1_Missense_Mutation_p.S9F|TRAF3_uc001ymd.1_Missense_Mutation_p.S9F|TRAF3_uc010txy.1_Missense_Mutation_p.S9F	NM_145725	NP_663777	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3 isoform 1	9					apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		AAGATGGACTCTCCTGGCGCG	0.493													14	56	---	---	---	---	PASS
ASPG	374569	broad.mit.edu	37	14	104571705	104571705	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104571705C>T	uc001yoq.1	+	10	1151	c.1091C>T	c.(1090-1092)TCG>TTG	p.S364L	ASPG_uc001yoo.1_Missense_Mutation_p.S392L|ASPG_uc001yop.1_Missense_Mutation_p.S364L|ASPG_uc001yor.1_Missense_Mutation_p.S364L	NM_001080464	NP_001073933	Q86U10	LPP60_HUMAN	60 kDa lysophospholipase	364					lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0						ACGCCACCCTCGGTGGAAGAG	0.667													3	29	---	---	---	---	PASS
INF2	64423	broad.mit.edu	37	14	105236769	105236769	+	Intron	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105236769G>C	uc010tyi.1	+						AKT1_uc001ypk.2_Intron|AKT1_uc001ypl.2_Intron|AKT1_uc010axa.2_Intron|AKT1_uc001ypm.2_Intron|AKT1_uc001ypn.2_Intron|AKT1_uc001ypj.2_Intron|AKT1_uc010tyk.1_Intron	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1						actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		TGTGGGTGTAGACAGCTCAGA	0.652													5	8	---	---	---	---	PASS
MTA1	9112	broad.mit.edu	37	14	105916392	105916392	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105916392C>T	uc001yqx.2	+						MTA1_uc001yqy.2_Intron|MTA1_uc001yqz.1_Intron|MTA1_uc001yra.1_Intron	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein						signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		CCTTGTCCTTCAGGGGAAATA	0.637													7	34	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28424276	28424276	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28424276G>A	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTTAAGATTAGAATAATCATA	0.368													17	98	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33835814	33835814	+	Intron	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33835814C>A	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAATATAATTCTCTTACAGGA	0.393													36	90	---	---	---	---	PASS
C15orf41	84529	broad.mit.edu	37	15	36983396	36983396	+	Intron	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36983396G>C	uc001zje.3	+						C15orf41_uc001zjd.2_Intron|C15orf41_uc010bbb.1_Intron|C15orf41_uc001zjf.2_Intron|C15orf41_uc010uci.1_Intron	NM_001130010	NP_001123482	Q9Y2V0	CO041_HUMAN	hypothetical protein LOC84529 isoform 1								protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		AGAATTAGAAGATTCTTTCAT	0.328													14	38	---	---	---	---	PASS
PLCB2	5330	broad.mit.edu	37	15	40582813	40582813	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40582813C>A	uc001zld.2	-	29	3475	c.3174G>T	c.(3172-3174)ATG>ATT	p.M1058I	PLCB2_uc001zlc.2_Missense_Mutation_p.M42I|PLCB2_uc010bbo.2_Missense_Mutation_p.M1054I|PLCB2_uc010ucm.1_Missense_Mutation_p.M1043I	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	1058	Potential.				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TGACTTTGGTCATGCCCTGGA	0.577													73	331	---	---	---	---	PASS
PPP1R14D	54866	broad.mit.edu	37	15	41120599	41120599	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41120599G>A	uc001zmy.2	-	1	309	c.241C>T	c.(241-243)CAG>TAG	p.Q81*	PPP1R14D_uc001zmz.2_Nonsense_Mutation_p.Q81*	NM_017726	NP_060196	Q9NXH3	PP14D_HUMAN	protein phosphatase 1, regulatory subunit 14D	81					regulation of phosphorylation	cytoplasm	protein phosphatase inhibitor activity				0		all_cancers(109;6.29e-14)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.88e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		AAGAGCTCCTGAACTTGAGCA	0.627													5	142	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43748527	43748527	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43748527C>A	uc001zrs.2	-	12	2412	c.2264G>T	c.(2263-2265)AGT>ATT	p.S755I	TP53BP1_uc010udp.1_Missense_Mutation_p.S755I|TP53BP1_uc001zrq.3_Missense_Mutation_p.S760I|TP53BP1_uc001zrr.3_Missense_Mutation_p.S760I|TP53BP1_uc010udq.1_Missense_Mutation_p.S760I	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	755					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AATGACAACACTGGAGTCCTC	0.448								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					54	69	---	---	---	---	PASS
DUOXA1	90527	broad.mit.edu	37	15	45411371	45411371	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45411371G>C	uc001zuq.1	-	6	994	c.965C>G	c.(964-966)TCA>TGA	p.S322*	DUOXA1_uc010uem.1_Nonsense_Mutation_p.S277*|DUOXA1_uc001zup.2_Nonsense_Mutation_p.S322*|DUOXA1_uc010bec.2_Nonsense_Mutation_p.S322*|DUOXA1_uc001zur.1_Nonsense_Mutation_p.S277*|DUOXA1_uc010bed.1_Nonsense_Mutation_p.S277*	NM_144565	NP_653166	Q1HG43	DOXA1_HUMAN	Numb-interacting protein	322	Cytoplasmic (Potential).				protein transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)		GGAAGCCTCTGACAGGGGAAT	0.577													12	103	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48056112	48056112	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48056112G>A	uc010bek.2	+	10	1173	c.813G>A	c.(811-813)GAG>GAA	p.E271E	SEMA6D_uc001zvw.2_Silent_p.E271E|SEMA6D_uc001zvx.1_Silent_p.E271E|SEMA6D_uc001zvy.2_Silent_p.E271E|SEMA6D_uc001zvz.2_Silent_p.E271E|SEMA6D_uc001zwa.2_Silent_p.E271E|SEMA6D_uc001zwb.2_Silent_p.E271E|SEMA6D_uc001zwc.2_Silent_p.E271E	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	271	Sema.|Extracellular (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GGGTCCTGGAGAAACACTGGA	0.478													41	124	---	---	---	---	PASS
ADAM10	102	broad.mit.edu	37	15	59009816	59009816	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59009816C>T	uc002afd.1	-	2	610	c.166G>A	c.(166-168)GAA>AAA	p.E56K	ADAM10_uc010bgc.1_RNA|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron|ADAM10_uc002afg.2_Missense_Mutation_p.E56K	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor	56	Extracellular (Potential).				cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		AATTGGTCTTCATGTGAGACT	0.343													13	58	---	---	---	---	PASS
IQCH	64799	broad.mit.edu	37	15	67571776	67571776	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67571776C>G	uc002aqo.1	+	4	360	c.313C>G	c.(313-315)CAG>GAG	p.Q105E	IQCH_uc010ujv.1_5'UTR|IQCH_uc002aqn.1_Intron|IQCH_uc002aqq.1_Intron|IQCH_uc002aqp.1_Intron|IQCH_uc002aqm.2_Missense_Mutation_p.Q105E	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1	105										skin(3)|ovary(1)	4				Colorectal(3;0.0856)		TATTTTCCCTCAGGAATCTGA	0.318													12	46	---	---	---	---	PASS
KIF23	9493	broad.mit.edu	37	15	69718494	69718494	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69718494G>A	uc002asb.2	+	8	937	c.820G>A	c.(820-822)GAG>AAG	p.E274K	KIF23_uc002asc.2_Missense_Mutation_p.E274K|KIF23_uc010bii.2_Missense_Mutation_p.E164K|KIF23_uc010ukc.1_Missense_Mutation_p.E91K|KIF23_uc010bih.1_RNA	NM_138555	NP_612565	Q02241	KIF23_HUMAN	kinesin family member 23 isoform 1	274	Kinesin-motor.				blood coagulation|cytokinesis|microtubule-based movement|mitosis|mitotic spindle elongation	cytosol|kinesin complex|microtubule|midbody|nucleoplasm|spindle	ATP binding|microtubule motor activity|protein binding				0						GAAATCTACTGAGGAGGCTTT	0.368													14	56	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	72057349	72057349	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72057349C>T	uc002atb.1	+						THSD4_uc002ate.2_Intron|THSD4_uc002atg.1_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						TTTTCTGCTTCTTTCTGCAGT	0.498													13	55	---	---	---	---	PASS
CYP11A1	1583	broad.mit.edu	37	15	74637437	74637437	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74637437G>A	uc002axt.2	-	3	728	c.573C>T	c.(571-573)TCC>TCT	p.S191S	CYP11A1_uc002axs.2_Silent_p.S33S|CYP11A1_uc010bjm.1_Silent_p.S33S|CYP11A1_uc010bjn.1_RNA|CYP11A1_uc010bjo.1_Silent_p.S191S|CYP11A1_uc010bjp.1_5'Flank|CYP11A1_uc010ulj.1_Intron|CYP11A1_uc010bjq.2_Silent_p.S191S	NM_000781	NP_000772	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A,	191					C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)	AGTAATTTCCGGAGCCCGCCT	0.587													7	46	---	---	---	---	PASS
SIN3A	25942	broad.mit.edu	37	15	75687038	75687038	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75687038C>T	uc002bai.2	-	14	2519	c.2260G>A	c.(2260-2262)GAG>AAG	p.E754K	SIN3A_uc002baj.2_Missense_Mutation_p.E754K|SIN3A_uc010uml.1_Missense_Mutation_p.E754K	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A	754	Interactions with HDAC1 and ARID4B.|Interaction with NCOR1 (By similarity).				blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						TAGATACTCTCAATCTCATTG	0.413													6	209	---	---	---	---	PASS
ISL2	64843	broad.mit.edu	37	15	76634057	76634057	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76634057C>T	uc002bbw.1	+							NM_145805	NP_665804	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TCCGCCGCCCCAGGTCTCCTT	0.682													10	82	---	---	---	---	PASS
SV2B	9899	broad.mit.edu	37	15	91803606	91803606	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91803606G>A	uc002bqv.2	+	5	1366	c.975G>A	c.(973-975)ATG>ATA	p.M325I	SV2B_uc002bqt.2_Missense_Mutation_p.M325I|SV2B_uc010uqv.1_Missense_Mutation_p.M174I|SV2B_uc002bqu.3_RNA	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog	325	Cytoplasmic (Potential).				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			ACACCAACATGAGAGCTAAGG	0.463													22	82	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101561369	101561369	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101561369C>T	uc002bwr.2	+	13	2040	c.1721C>T	c.(1720-1722)TCA>TTA	p.S574L	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	574	LRR 12.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AAGAGCTTATCAGAGCTCTAC	0.542													12	45	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101598292	101598292	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101598292C>G	uc002bwr.2	+	29	4944	c.4625C>G	c.(4624-4626)TCA>TGA	p.S1542*	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1542					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCCTTCTTCTCATCCCAGGGC	0.582													13	54	---	---	---	---	PASS
RHBDF1	64285	broad.mit.edu	37	16	114768	114768	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:114768G>C	uc002cfl.3	-	6	325	c.177C>G	c.(175-177)ATC>ATG	p.I59M	RHBDF1_uc010uty.1_Missense_Mutation_p.I82M|RHBDF1_uc010utz.1_Missense_Mutation_p.I59M|RHBDF1_uc010bqo.1_RNA	NM_022450	NP_071895	Q96CC6	RHDF1_HUMAN	rhomboid family 1	59	Cytoplasmic (Potential).				cell migration|cell proliferation|negative regulation of protein secretion|protein transport|proteolysis|regulation of epidermal growth factor receptor signaling pathway|regulation of proteasomal protein catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity			ovary(1)|pancreas(1)	2		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				GGGGTGAAGAGATGTGGGCTG	0.637													31	85	---	---	---	---	PASS
RNF151	146310	broad.mit.edu	37	16	2017754	2017754	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2017754G>C	uc002cnt.1	+	3	186	c.178G>C	c.(178-180)GAG>CAG	p.E60Q	RPS2_uc002cnn.2_5'Flank|RPS2_uc002cno.2_5'Flank	NM_174903	NP_777563	Q2KHN1	RN151_HUMAN	ring finger protein 151	60					cell differentiation|spermatogenesis	cytoplasm|nucleus	ubiquitin-protein ligase activity|zinc ion binding				0						CTGTAGGAAAGAGGTGAAAAG	0.532													3	9	---	---	---	---	PASS
CASKIN1	57524	broad.mit.edu	37	16	2237470	2237470	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2237470G>A	uc010bsg.1	-							NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1						signal transduction	cytoplasm				skin(2)	2						AGCCTGGCGGGAAGGCAAGGT	0.677													10	28	---	---	---	---	PASS
ADCY9	115	broad.mit.edu	37	16	4016390	4016390	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4016390C>G	uc002cvx.2	-	11	3987	c.3448G>C	c.(3448-3450)GAC>CAC	p.D1150H		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	1150	Guanylate cyclase 2.|Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						TTGAAGTCGTCCACCACGCGC	0.632													16	61	---	---	---	---	PASS
EMP2	2013	broad.mit.edu	37	16	10641392	10641392	+	Intron	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10641392C>A	uc002czx.2	-							NM_001424	NP_001415	P54851	EMP2_HUMAN	epithelial membrane protein 2						cell proliferation	integral to membrane					0						GGAAAGGAAACTTACATTGTC	0.403													4	9	---	---	---	---	PASS
SNX29	92017	broad.mit.edu	37	16	12155423	12155423	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12155423G>A	uc002dby.3	+	2	64	c.8G>A	c.(7-9)AGC>AAC	p.S3N	SNX29_uc010uyx.1_Missense_Mutation_p.S30N	NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	3					cell communication		phosphatidylinositol binding			ovary(1)	1						CAGATGCACAGCTGGGCTCCG	0.592													4	13	---	---	---	---	PASS
LOC81691	81691	broad.mit.edu	37	16	20839868	20839868	+	Intron	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20839868C>A	uc002dhv.2	+						ERI2_uc002dht.3_Intron|LOC81691_uc002dhx.2_Intron|LOC81691_uc002dhw.2_Intron|LOC81691_uc002dhy.3_Intron	NM_030941	NP_112203	Q96IC2	REXON_HUMAN	exonuclease NEF-sp isoform 1							nucleolus	exonuclease activity|nucleotide binding|RNA binding			ovary(1)|kidney(1)	2						AGGTTAGTATCTTTGCCCAGT	0.398													9	29	---	---	---	---	PASS
UQCRC2	7385	broad.mit.edu	37	16	21964776	21964776	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21964776C>T	uc002djx.2	+	1	168	c.32C>T	c.(31-33)TCG>TTG	p.S11L	UQCRC2_uc002djy.2_Missense_Mutation_p.S11L|UQCRC2_uc010bxa.2_RNA	NM_003366	NP_003357	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	11					aerobic respiration|oxidative phosphorylation|proteolysis|respiratory electron transport chain|transport		metalloendopeptidase activity|zinc ion binding			large_intestine(2)	2				GBM - Glioblastoma multiforme(48;0.0264)		GGCTCTTTCTCGGTGAGCTCA	0.577													6	13	---	---	---	---	PASS
AQP8	343	broad.mit.edu	37	16	25232864	25232864	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25232864C>T	uc002doc.2	+	3	429	c.347C>T	c.(346-348)TCA>TTA	p.S116L		NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8	116	Helical; (Potential).				cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		TACTGGGTCTCACAGCTGCTC	0.627													24	80	---	---	---	---	PASS
INO80E	283899	broad.mit.edu	37	16	30016734	30016734	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30016734G>A	uc002dvg.1	+	7	807	c.706G>A	c.(706-708)GAT>AAT	p.D236N	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|INO80E_uc002dvh.1_RNA|INO80E_uc002dvi.1_3'UTR|INO80E_uc002dvj.1_RNA|INO80E_uc002dvk.1_Missense_Mutation_p.D197N	NM_173618	NP_775889	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	236					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex				skin(1)	1						GGATGGAGACGATGACCTGGT	0.672											OREG0023725	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	6	---	---	---	---	PASS
SLC38A7	55238	broad.mit.edu	37	16	58712778	58712778	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58712778G>A	uc002eod.1	-	4	684	c.291C>T	c.(289-291)ATC>ATT	p.I97I	SLC38A7_uc002eob.1_RNA|SLC38A7_uc002eoc.1_Silent_p.I97I|SLC38A7_uc010vil.1_Silent_p.I8I|SLC38A7_uc002eoe.1_Silent_p.I97I	NM_018231	NP_060701	Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	97	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane				ovary(1)	1						CAAGGCCACTGATGATGAAAA	0.577													5	13	---	---	---	---	PASS
CDH3	1001	broad.mit.edu	37	16	68725654	68725654	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68725654C>T	uc002ewf.2	+	13	2959	c.1827C>T	c.(1825-1827)TTC>TTT	p.F609F	CDH3_uc010vli.1_Silent_p.F554F	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein	609	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TGAAGAAGTTCCTGAAGCAGG	0.517													22	63	---	---	---	---	PASS
ADAT1	23536	broad.mit.edu	37	16	75642774	75642774	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75642774C>G	uc002feo.1	-	8	1258	c.1156G>C	c.(1156-1158)GAT>CAT	p.D386H	ADAT1_uc002fep.1_Missense_Mutation_p.D237H	NM_012091	NP_036223	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	386	A to I editase.				tRNA processing		metal ion binding|RNA binding|tRNA-specific adenosine deaminase activity			ovary(1)|skin(1)	2						CCTGGGCTATCAGCCCTTTTT	0.512													14	38	---	---	---	---	PASS
IL17C	27189	broad.mit.edu	37	16	88706364	88706364	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88706364C>A	uc002fla.2	+	3	527	c.478C>A	c.(478-480)CGC>AGC	p.R160S		NM_013278	NP_037410	Q9P0M4	IL17C_HUMAN	interleukin 17C precursor	160					cell surface receptor linked signaling pathway|cell-cell signaling|inflammatory response	extracellular space|soluble fraction	cytokine activity				0				BRCA - Breast invasive adenocarcinoma(80;0.0477)		GGTGCTGCGCCGCCGGCCCTG	0.706													12	26	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3989912	3989912	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3989912G>A	uc002fxe.2	-	15	2444	c.2380C>T	c.(2380-2382)CTG>TTG	p.L794L	ZZEF1_uc002fxk.1_Silent_p.L794L	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	794							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						AGTAGCTGCAGAAGCAGGGTT	0.507													12	54	---	---	---	---	PASS
PELP1	27043	broad.mit.edu	37	17	4576054	4576054	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4576054C>T	uc002fyi.3	-	16	2458	c.2232G>A	c.(2230-2232)GGG>GGA	p.G744G	PELP1_uc010vsf.1_Silent_p.G597G	NM_014389	NP_055204	Q8IZL8	PELP1_HUMAN	proline, glutamic acid and leucine rich protein	744	Pro-rich.				transcription, DNA-dependent	cytoplasm|MLL1 complex	protein binding			ovary(1)|central_nervous_system(1)	2						GTGGGGGAGTCCCACTAGGGG	0.582													5	11	---	---	---	---	PASS
RNF167	26001	broad.mit.edu	37	17	4848125	4848125	+	Silent	SNP	A	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4848125A>G	uc002fzq.2	+	11	1283	c.867A>G	c.(865-867)CAA>CAG	p.Q289Q	RNF167_uc002fzr.2_Silent_p.Q289Q|RNF167_uc002fzs.2_Silent_p.Q289Q|RNF167_uc002fzt.2_Silent_p.Q289Q|RNF167_uc002fzu.2_Silent_p.Q288Q|RNF167_uc002fzv.2_Silent_p.Q254Q|RNF167_uc002fzx.2_Silent_p.Q253Q|RNF167_uc002fzy.2_Silent_p.Q88Q	NM_015528	NP_056343	Q9H6Y7	RN167_HUMAN	ring finger protein 167 precursor	289					negative regulation of cell cycle|protein polyubiquitination	cytoplasm|endomembrane system|integral to membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						AAGAAACTCAAGGGCAAGAGG	0.592													27	68	---	---	---	---	PASS
GPS2	2874	broad.mit.edu	37	17	7216791	7216791	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7216791G>A	uc002gfv.1	-						GPS2_uc002gfw.1_Intron|GPS2_uc002gfx.1_Intron|NEURL4_uc002gfy.1_Intron|GPS2_uc002gfz.1_Intron	NM_004489	NP_004480	Q13227	GPS2_HUMAN	G protein pathway suppressor 2						cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity			ovary(2)|pancreas(1)	3		Prostate(122;0.157)				CGAAGGAGCTGAGAAAGGAAA	0.507											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	52	---	---	---	---	PASS
GPS2	2874	broad.mit.edu	37	17	7217046	7217046	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7217046G>A	uc002gfv.1	-						GPS2_uc002gfw.1_Intron|GPS2_uc002gfx.1_Intron|NEURL4_uc002gfy.1_Intron|GPS2_uc002gfz.1_Intron	NM_004489	NP_004480	Q13227	GPS2_HUMAN	G protein pathway suppressor 2						cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity			ovary(2)|pancreas(1)	3		Prostate(122;0.157)				CGGGTCTAAGGAAGGAGAATG	0.318													17	52	---	---	---	---	PASS
GPS2	2874	broad.mit.edu	37	17	7217311	7217311	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7217311G>A	uc002gfv.1	-						GPS2_uc002gfw.1_Intron|GPS2_uc002gfx.1_Intron|NEURL4_uc002gfy.1_Intron|GPS2_uc002gfz.1_Intron	NM_004489	NP_004480	Q13227	GPS2_HUMAN	G protein pathway suppressor 2						cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity			ovary(2)|pancreas(1)	3		Prostate(122;0.157)				GGGCTCCCTAGAAAGGGAGAA	0.542													41	88	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7701881	7701881	+	Nonsense_Mutation	SNP	A	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7701881A>T	uc002giu.1	+	54	8418	c.8404A>T	c.(8404-8406)AAG>TAG	p.K2802*		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2802	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCCAGATATCAAGCGTCTGTA	0.537													9	33	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10322273	10322273	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10322273C>T	uc002gmm.2	-	4	380	c.285G>A	c.(283-285)ATG>ATA	p.M95I	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	95	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GATGAGTCATCATGGCCATGT	0.453									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				39	103	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10360825	10360825	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10360825G>C	uc002gmn.2	-	16	1920	c.1809C>G	c.(1807-1809)CCC>CCG	p.P603P	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	603	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TCTCATTCAGGGGGTCCTTGT	0.542													18	60	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10401063	10401063	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10401063C>T	uc002gmo.2	-	31	4447	c.4353G>A	c.(4351-4353)AGG>AGA	p.R1451R	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1451	Potential.			R -> T (in Ref. 4; CAA27380).		muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TATCAAAGTTCCTTTGCTTTT	0.443													6	68	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10401064	10401064	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10401064C>T	uc002gmo.2	-	31	4446	c.4352G>A	c.(4351-4353)AGG>AAG	p.R1451K	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1451	Potential.			R -> T (in Ref. 4; CAA27380).		muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						ATCAAAGTTCCTTTGCTTTTT	0.443													7	69	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10411242	10411242	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10411242C>G	uc002gmo.2	-	17	2023	c.1929G>C	c.(1927-1929)AAG>AAC	p.K643N	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	643	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						AAGAACCCTTCTTCTTACCAC	0.378													19	75	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10448678	10448678	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10448678G>T	uc010coi.2	-	5	618	c.490C>A	c.(490-492)CAG>AAG	p.Q164K	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.Q164K|MYH2_uc010coj.2_Missense_Mutation_p.Q164K	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	164	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						AGCATGAACTGATAGGCGTTG	0.532													52	137	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11573101	11573101	+	Missense_Mutation	SNP	G	A	A	rs143003954	byFrequency	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11573101G>A	uc002gne.2	+	17	3411	c.3343G>A	c.(3343-3345)GTC>ATC	p.V1115I	DNAH9_uc010coo.2_Missense_Mutation_p.V409I	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	1115	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGTGGACCACGTCACTCACAG	0.418													48	137	---	---	---	---	PASS
MAPK7	5598	broad.mit.edu	37	17	19284297	19284297	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19284297C>T	uc002gvn.2	+	4	1161	c.775C>T	c.(775-777)CGC>TGC	p.R259C	B9D1_uc010cqm.1_5'Flank|B9D1_uc002gvl.3_5'Flank|MAPK7_uc002gvo.2_Missense_Mutation_p.R120C|MAPK7_uc002gvq.2_Missense_Mutation_p.R259C|MAPK7_uc002gvp.2_Missense_Mutation_p.R259C	NM_139033	NP_620602	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7 isoform 1	259	Necessary for oligomerization (By similarity).|Protein kinase.				cell cycle|cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					GCTGGCCCGGCGCCAGCTCTT	0.567													4	25	---	---	---	---	PASS
SUZ12	23512	broad.mit.edu	37	17	30302566	30302566	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30302566C>G	uc002hgs.2	+	7	879	c.657C>G	c.(655-657)CTC>CTG	p.L219L	SUZ12_uc002hgt.2_Silent_p.L196L	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1	219					negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				ATCCTGACCTCAATCAAACAA	0.373			T	JAZF1	endometrial stromal tumours								10	37	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33690789	33690789	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33690789G>C	uc010ctp.2	-	4	480	c.38C>G	c.(37-39)TCT>TGT	p.S13C	SLFN11_uc010ctq.2_Missense_Mutation_p.S13C|SLFN11_uc002hjh.3_Missense_Mutation_p.S13C|SLFN11_uc002hjg.3_Missense_Mutation_p.S13C|SLFN11_uc010ctr.2_Missense_Mutation_p.S13C	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	13						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GTCTGGGTAAGATGGTTCCAC	0.408													16	50	---	---	---	---	PASS
ZPBP2	124626	broad.mit.edu	37	17	38024615	38024615	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38024615G>A	uc002hte.2	+	1	161	c.8G>A	c.(7-9)CGA>CAA	p.R3Q	ZPBP2_uc002htf.2_Missense_Mutation_p.R3Q	NM_199321	NP_955353	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2 isoform 2	3					binding of sperm to zona pellucida	extracellular region				ovary(1)	1	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCGATGATGCGAACGTGCGTC	0.692													22	52	---	---	---	---	PASS
KRT15	3866	broad.mit.edu	37	17	39672427	39672427	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39672427C>G	uc002hwy.2	-	4	1020	c.829G>C	c.(829-831)GAG>CAG	p.E277Q	KRT15_uc002hwz.2_Missense_Mutation_p.E179Q|KRT15_uc002hxa.2_Missense_Mutation_p.E112Q|KRT15_uc002hxb.1_Missense_Mutation_p.E112Q	NM_002275	NP_002266	P19012	K1C15_HUMAN	keratin 15	277	Rod.|Coil 2.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000286)				TCCCTCATCTCTGCCAGCACA	0.622													56	202	---	---	---	---	PASS
HAP1	9001	broad.mit.edu	37	17	39881183	39881183	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39881183C>T	uc002hxm.1	-	12	1798	c.1786G>A	c.(1786-1788)GAA>AAA	p.E596K	JUP_uc010wfs.1_Intron|HAP1_uc002hxn.1_Missense_Mutation_p.E544K|HAP1_uc002hxo.1_Missense_Mutation_p.E527K|HAP1_uc002hxp.1_Missense_Mutation_p.E519K	NM_177977	NP_817084	P54257	HAP1_HUMAN	huntingtin-associated protein 1 isoform 2	596	Glu-rich.				brain development|protein localization|synaptic transmission	actin cytoskeleton	protein binding			ovary(2)	2		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			AGCTCCAGTTCCACCTCCTCC	0.622													93	210	---	---	---	---	PASS
VPS25	84313	broad.mit.edu	37	17	40927461	40927461	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40927461G>A	uc002ibi.2	+	4	356	c.316G>A	c.(316-318)GAA>AAA	p.E106K		NM_032353	NP_115729	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25	106					cellular membrane organization|endosome transport|protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endosome membrane|nucleoplasm					0		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		GAGGCCAGAAGAATGGGGGAA	0.458													11	25	---	---	---	---	PASS
WNK4	65266	broad.mit.edu	37	17	40948022	40948022	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40948022C>G	uc002ibj.2	+	16	3423	c.3402C>G	c.(3400-3402)TTC>TTG	p.F1134L	WNK4_uc010wgx.1_Missense_Mutation_p.F798L|CCDC56_uc010wgz.1_Missense_Mutation_p.R79T|CNTD1_uc002ibm.3_5'Flank|CNTD1_uc010wha.1_5'Flank	NM_032387	NP_115763	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	1134					intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		ATGAGGAGTTCTGGGCTGAGC	0.567													5	35	---	---	---	---	PASS
WNK4	65266	broad.mit.edu	37	17	40948044	40948044	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40948044C>T	uc002ibj.2	+	16	3445	c.3424C>T	c.(3424-3426)CGG>TGG	p.R1142W	WNK4_uc010wgx.1_Missense_Mutation_p.R806W|CCDC56_uc010wgz.1_Missense_Mutation_p.E72K|CNTD1_uc002ibm.3_5'Flank|CNTD1_uc010wha.1_5'Flank	NM_032387	NP_115763	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	1142					intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GCAGAGTCTTCGGCAGAAGTG	0.567													5	37	---	---	---	---	PASS
CBX1	10951	broad.mit.edu	37	17	46153372	46153372	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46153372C>A	uc002ind.3	-	3	790	c.309G>T	c.(307-309)AAG>AAT	p.K103N	CBX1_uc002ine.3_Missense_Mutation_p.K103N	NM_006807	NP_006798	P83916	CBX1_HUMAN	heterochromatin protein 1-beta	103						nuclear heterochromatin|nucleoplasm|spindle	chromatin binding|enzyme binding				0						cctcttctttcttcttctttg	0.284													3	17	---	---	---	---	PASS
CBX1	10951	broad.mit.edu	37	17	46153539	46153539	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46153539C>G	uc002ind.3	-	3	623	c.142G>C	c.(142-144)GAG>CAG	p.E48Q	CBX1_uc002ine.3_Missense_Mutation_p.E48Q	NM_006807	NP_006798	P83916	CBX1_HUMAN	heterochromatin protein 1-beta	48	Chromo 1.					nuclear heterochromatin|nucleoplasm|spindle	chromatin binding|enzyme binding				0						GTGTTGTCCTCACTGAAACCA	0.443													17	47	---	---	---	---	PASS
MRPL27	51264	broad.mit.edu	37	17	48447381	48447381	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48447381G>A	uc002iqq.2	-						MRPL27_uc002iqr.2_Silent_p.S84S	NM_016504	NP_057588	Q9P0M9	RM27_HUMAN	mitochondrial ribosomal protein L27						translation	mitochondrial large ribosomal subunit	structural constituent of ribosome				0	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;1.73e-07)			GGGCAGCAACGGAGCAACTCA	0.418													4	24	---	---	---	---	PASS
MRPL27	51264	broad.mit.edu	37	17	48447382	48447382	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48447382G>A	uc002iqq.2	-						MRPL27_uc002iqr.2_Missense_Mutation_p.S84F	NM_016504	NP_057588	Q9P0M9	RM27_HUMAN	mitochondrial ribosomal protein L27						translation	mitochondrial large ribosomal subunit	structural constituent of ribosome				0	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;1.73e-07)			GGCAGCAACGGAGCAACTCAC	0.418													4	25	---	---	---	---	PASS
AKAP1	8165	broad.mit.edu	37	17	55183327	55183327	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55183327G>C	uc002iux.2	+	2	733	c.502G>C	c.(502-504)GAT>CAT	p.D168H	AKAP1_uc010wnl.1_Missense_Mutation_p.D168H|AKAP1_uc002iuy.2_RNA|AKAP1_uc010dcm.2_Missense_Mutation_p.D168H	NM_003488	NP_003479	Q92667	AKAP1_HUMAN	A-kinase anchor protein 1 precursor	168					blood coagulation	cytosol|integral to membrane|mitochondrial outer membrane	protein binding|RNA binding			ovary(1)	1	Breast(9;5.46e-08)					GTGTAAGCAAGATTCCCCCTT	0.567													14	36	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56650663	56650663	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56650663C>T	uc010dcz.1	-	24	3646	c.3528G>A	c.(3526-3528)TTG>TTA	p.L1176L	TEX14_uc002iwr.1_Silent_p.L1170L|TEX14_uc002iws.1_Silent_p.L1130L|TEX14_uc010dda.1_Silent_p.L910L	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a	1176						cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAATATCCGTCAATGATCTAA	0.353													13	201	---	---	---	---	PASS
PPM1E	22843	broad.mit.edu	37	17	57047094	57047094	+	Intron	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57047094C>A	uc002iwx.2	+						PPM1E_uc010ddd.2_Intron	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E						protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GGGAGGTATGCCCCTTTCTCA	0.507													3	33	---	---	---	---	PASS
TRIM37	4591	broad.mit.edu	37	17	57139987	57139987	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57139987G>T	uc002iwy.3	-	11	1327	c.883C>A	c.(883-885)CCT>ACT	p.P295T	TRIM37_uc002iwz.3_Missense_Mutation_p.P295T|TRIM37_uc002ixa.3_Missense_Mutation_p.P173T|TRIM37_uc010woc.1_Missense_Mutation_p.P261T	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	295	MATH.					perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					CTGTAAACAGGATCTGCTCTC	0.383									Mulibrey_Nanism				8	27	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66890334	66890334	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66890334C>G	uc002jhp.2	-	21	3075	c.2896G>C	c.(2896-2898)GAA>CAA	p.E966Q	ABCA8_uc002jhq.2_Missense_Mutation_p.E1006Q|ABCA8_uc010wqq.1_Missense_Mutation_p.E1006Q|ABCA8_uc010wqr.1_Missense_Mutation_p.E945Q|ABCA8_uc002jhr.2_Missense_Mutation_p.E1006Q	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	966						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					GTACTTCTTTCAGTTCGGATA	0.373													10	28	---	---	---	---	PASS
KCNJ16	3773	broad.mit.edu	37	17	68128231	68128231	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68128231G>A	uc002jin.2	+	5	489	c.3G>A	c.(1-3)ATG>ATA	p.M1I	KCNJ16_uc002jio.2_Missense_Mutation_p.M1I|KCNJ16_uc002jip.2_Missense_Mutation_p.M1I|KCNJ16_uc002jiq.2_Missense_Mutation_p.M33I	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	1	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					AGCAAAGAATGAGCTATTACG	0.428													9	25	---	---	---	---	PASS
SLC38A10	124565	broad.mit.edu	37	17	79234147	79234147	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79234147G>A	uc002jzz.1	-	11	1554	c.1179C>T	c.(1177-1179)ACC>ACT	p.T393T	SLC38A10_uc002jzy.1_Silent_p.T311T|SLC38A10_uc002kab.2_Silent_p.T393T	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	393	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CAGACAGTGTGGTGACAGTGC	0.682													3	18	---	---	---	---	PASS
CLUL1	27098	broad.mit.edu	37	18	619248	619248	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:619248G>A	uc002kkp.2	+	3	287	c.142G>A	c.(142-144)GAG>AAG	p.E48K	CLUL1_uc010wys.1_Missense_Mutation_p.E100K|CLUL1_uc002kkq.2_Missense_Mutation_p.E48K	NM_014410	NP_055225	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal) precursor	48					cell death	extracellular region				ovary(2)	2						TGCAGATGAAGAGGTGAAGAA	0.388													14	65	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18567072	18567072	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18567072C>T	uc002kte.2	-	19	3085	c.2144_splice	c.e19-1	p.E715_splice		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein						actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					TTTTCCATCTCTGGGAAAGCA	0.358													15	51	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18586468	18586468	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18586468G>A	uc002kte.2	-	16	2670	c.1729C>T	c.(1729-1731)CAG>TAG	p.Q577*		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	577	Interaction with FHOD1.|Potential.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					GACTCTAACTGACTAATTGAC	0.378													34	104	---	---	---	---	PASS
TTC39C	125488	broad.mit.edu	37	18	21705472	21705472	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21705472C>T	uc002kuw.2	+	10	1830	c.1378C>T	c.(1378-1380)CTT>TTT	p.L460F	TTC39C_uc002kuu.2_Missense_Mutation_p.L399F	NM_001135993	NP_001129465	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C isoform 1	460							binding			ovary(1)	1						GTGGAAAGCTCTTCCAAACTG	0.453													5	89	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54591290	54591290	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54591290C>T	uc002lgk.1	+	22	3875	c.3664C>T	c.(3664-3666)CTG>TTG	p.L1222L	WDR7_uc002lgl.1_Silent_p.L1189L	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	1222										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		GTCCGCTGTTCTGATGGGGCT	0.468													24	89	---	---	---	---	PASS
BSG	682	broad.mit.edu	37	19	581370	581370	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:581370C>G	uc002loz.2	+	6	946	c.848C>G	c.(847-849)TCA>TGA	p.S283*	BSG_uc002loy.2_Nonsense_Mutation_p.S103*|BSG_uc002lpa.2_Nonsense_Mutation_p.S167*|BSG_uc002lpb.2_RNA|BSG_uc010drr.2_Nonsense_Mutation_p.S167*|BSG_uc002lpc.2_Nonsense_Mutation_p.S330*|BSG_uc002lpd.2_5'Flank	NM_001728	NP_001719	P35613	BASI_HUMAN	basigin isoform 1 precursor	283	Extracellular (Potential).|Ig-like V-type.				blood coagulation|cell surface receptor linked signaling pathway|leukocyte migration|pyruvate metabolic process	Golgi membrane|integral to membrane|melanosome	lactate transmembrane transporter activity|mannose binding|protein binding				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGGCCGGTCAGAGCTACAC	0.627													18	49	---	---	---	---	PASS
GRIN3B	116444	broad.mit.edu	37	19	1008173	1008173	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1008173C>T	uc002lqo.1	+	6	2349	c.2349C>T	c.(2347-2349)CTC>CTT	p.L783L	uc002lqp.1_Intron	NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	783	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	ACTCGCCGCTCACCTCCAACC	0.667													4	7	---	---	---	---	PASS
STK11	6794	broad.mit.edu	37	19	1207152	1207152	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1207152C>G	uc002lrl.1	+	1	1355	c.240C>G	c.(238-240)CTC>CTG	p.L80L		NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11	80	Protein kinase.				anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)|p.?(3)|p.G52_P179del(1)		lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		TCAAGATCCTCAAGAAGAAGA	0.617		14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			3	10	---	---	---	---	PASS
GNA11	2767	broad.mit.edu	37	19	3110178	3110178	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3110178C>G	uc002lxd.2	+	2	410	c.168C>G	c.(166-168)ATC>ATG	p.I56M		NM_002067	NP_002058	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein),	56					activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation|regulation of action potential	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			eye(70)|skin(16)	86		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		GCACGTTCATCAAGCAGATGC	0.667			Mis		uveal melanoma								5	6	---	---	---	---	PASS
C19orf28	126321	broad.mit.edu	37	19	3547368	3547368	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3547368G>A	uc002lxz.2	-						C19orf28_uc002lxw.2_Intron|C19orf28_uc002lxx.2_Intron|C19orf28_uc002lxy.2_Intron	NM_174983	NP_778148	Q6NUT3	CS028_HUMAN	hypothetical protein LOC126321 isoform c						transmembrane transport	integral to membrane				breast(1)|pancreas(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)		AACTTCTGCGGAGGCAGAGCC	0.617													14	34	---	---	---	---	PASS
MRPL54	116541	broad.mit.edu	37	19	3762719	3762719	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3762719C>T	uc002lyq.3	+	1	55	c.21C>T	c.(19-21)TTC>TTT	p.F7F	APBA3_uc002lyp.1_5'Flank	NM_172251	NP_758455	Q6P161	RM54_HUMAN	mitochondrial ribosomal protein L54 precursor	7						mitochondrion|ribosome					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		AACGCCTTTTCGGGGCTACCC	0.632													5	98	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9060718	9060718	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9060718G>A	uc002mkp.2	-	3	26932	c.26728C>T	c.(26728-26730)CCC>TCC	p.P8910S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8912	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCATACTGGGAGGTGAAGTG	0.488													27	116	---	---	---	---	PASS
ZNF266	10781	broad.mit.edu	37	19	9524429	9524429	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9524429C>T	uc002mll.2	-	4	1438	c.1172G>A	c.(1171-1173)AGA>AAA	p.R391K	ZNF266_uc002mlm.2_Missense_Mutation_p.R391K|ZNF266_uc002mln.2_Missense_Mutation_p.R391K|ZNF266_uc002mlo.2_Missense_Mutation_p.R391K|ZNF266_uc010dwp.2_Missense_Mutation_p.R391K|ZNF266_uc010dwq.2_Missense_Mutation_p.R391K	NM_198058	NP_932175	Q14584	ZN266_HUMAN	zinc finger protein 266	391	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GCGAGAGGATCTGGCAAAGGC	0.448													14	51	---	---	---	---	PASS
SPC24	147841	broad.mit.edu	37	19	11258507	11258507	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11258507C>T	uc002mql.2	-	4	506	c.474G>A	c.(472-474)GGG>GGA	p.G158G		NM_182513	NP_872319	Q8NBT2	SPC24_HUMAN	spindle pole body component 24 homolog	158	Interaction with the C-terminus of SPBC25.				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding				0						CTTTGACCATCCCTGGCTCAC	0.264													4	12	---	---	---	---	PASS
ZNF440	126070	broad.mit.edu	37	19	11942935	11942935	+	Missense_Mutation	SNP	A	C	C	rs140710381	by1000genomes	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11942935A>C	uc002msp.1	+	4	1100	c.944A>C	c.(943-945)AAG>ACG	p.K315T		NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	315	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TATGAATGTAAGCAGTGTGGG	0.388													11	62	---	---	---	---	PASS
ZNF442	79973	broad.mit.edu	37	19	12461293	12461293	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12461293C>G	uc002mtr.1	-	6	1717	c.1106G>C	c.(1105-1107)AGA>ACA	p.R369T	ZNF442_uc010xmk.1_Missense_Mutation_p.R300T	NM_030824	NP_110451	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	369	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(2)|breast(1)|kidney(1)	4						AGTGTGAGTTCTTTCATGACT	0.413													78	188	---	---	---	---	PASS
WDR83	84292	broad.mit.edu	37	19	12783679	12783679	+	Silent	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12783679G>C	uc002mue.3	+	8	860	c.525G>C	c.(523-525)GTG>GTC	p.V175V	WDR83_uc002muc.2_RNA|WDR83_uc010dyw.2_Silent_p.V175V	NM_001099737	NP_001093207	Q9BRX9	WDR83_HUMAN	mitogen-activated protein kinase organizer 1	175	WD 4.				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|cytoplasm				lung(1)|breast(1)	2						ATGGCCGCGTGAGACGCTATG	0.622													3	5	---	---	---	---	PASS
TSSK6	83983	broad.mit.edu	37	19	19626097	19626097	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19626097C>T	uc002nmr.2	-	1	373	c.140G>A	c.(139-141)CGA>CAA	p.R47Q	TSSK6_uc002nmq.2_RNA|NDUFA13_uc002nms.2_5'Flank|NDUFA13_uc010xqx.1_5'Flank|NDUFA13_uc010xqy.1_5'Flank	NM_032037	NP_114426	Q9BXA6	TSSK6_HUMAN	testis-specific serine kinase 6	47	Protein kinase.				multicellular organismal development|sperm chromatin condensation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			stomach(1)	1						CGGGGGCGCTCGCCGCCGGTC	0.627													16	30	---	---	---	---	PASS
NUDT19	390916	broad.mit.edu	37	19	33183126	33183126	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33183126C>T	uc010edf.2	+	1	260	c.260C>T	c.(259-261)CCG>CTG	p.P87L		NM_001105570	NP_001099040	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety	87	Nudix hydrolase.					mitochondrion|peroxisome	hydrolase activity|metal ion binding				0	Esophageal squamous(110;0.137)					CACGGGCCGCCGCGCTTCGGC	0.726													8	20	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39219659	39219659	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39219659C>T	uc002oja.1	+	20	2501	c.2442C>T	c.(2440-2442)ATC>ATT	p.I814I	ACTN4_uc002ojb.1_Silent_p.I136I	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	814	EF-hand 2.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCAACCGCATCATGAGCCTGG	0.637													13	75	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39219713	39219713	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39219713C>T	uc002oja.1	+	20	2555	c.2496C>T	c.(2494-2496)ATC>ATT	p.I832I	ACTN4_uc002ojb.1_Silent_p.I154I	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	832	EF-hand 2.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AAGCCTTCATCGACTTCATGT	0.607													18	90	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39219929	39219929	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39219929G>T	uc002oja.1	+	21	2652	c.2593G>T	c.(2593-2595)GAG>TAG	p.E865*	ACTN4_uc002ojb.1_Nonsense_Mutation_p.E187*	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	865					platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CATCACAGCTGAGGAGCTGCG	0.687													5	35	---	---	---	---	PASS
BCKDHA	593	broad.mit.edu	37	19	41898888	41898888	+	Intron	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41898888G>C	uc002oqm.3	+						CYP2F1_uc010xvw.1_Intron|EXOSC5_uc002oqo.2_Intron	NM_000709	NP_000700	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0						GGTGTCACCTGAGGAGACAGC	0.498													14	39	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43528938	43528938	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43528938A>G	uc002ovh.1	-	2	442	c.353T>C	c.(352-354)GTC>GCC	p.V118A	PSG11_uc002ouw.2_Missense_Mutation_p.V118A|PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.V118A|PSG11_uc002ovm.1_Missense_Mutation_p.V112A|PSG11_uc002ovn.1_Missense_Mutation_p.V118A|PSG11_uc002ovo.1_Intron|PSG11_uc002ovp.1_Intron			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;	111	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				CTCCCGGGTGACATTCTGGAT	0.438													8	274	---	---	---	---	PASS
ZNF283	284349	broad.mit.edu	37	19	44352686	44352686	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44352686G>A	uc002oxr.3	+	7	2201	c.1933G>A	c.(1933-1935)GAG>AAG	p.E645K	ZNF283_uc002oxp.3_Missense_Mutation_p.E506K	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	645					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				ACTTGTTCATGAGAGAACTCA	0.368													21	106	---	---	---	---	PASS
ZNF283	284349	broad.mit.edu	37	19	44352764	44352764	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44352764G>C	uc002oxr.3	+	7	2279	c.2011G>C	c.(2011-2013)GAG>CAG	p.E671Q	ZNF283_uc002oxp.3_Missense_Mutation_p.E532Q	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	671					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				TTACTCAAATGAGAAAATTGA	0.323													26	75	---	---	---	---	PASS
ZNF222	7673	broad.mit.edu	37	19	44536300	44536300	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44536300C>T	uc002oyc.2	+	4	656	c.473C>T	c.(472-474)TCA>TTA	p.S158L	ZNF284_uc010ejd.2_Intron|ZNF222_uc002oye.2_Missense_Mutation_p.S198L|ZNF222_uc002oyd.2_Missense_Mutation_p.S104L	NM_013360	NP_037492	Q9UK12	ZN222_HUMAN	zinc finger protein 222 isoform 2	158	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Prostate(69;0.0435)				TGTTACATCTCAGCCCTTCAT	0.418													32	172	---	---	---	---	PASS
ZNF222	7673	broad.mit.edu	37	19	44536308	44536308	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44536308C>G	uc002oyc.2	+	4	664	c.481C>G	c.(481-483)CAT>GAT	p.H161D	ZNF284_uc010ejd.2_Intron|ZNF222_uc002oye.2_Missense_Mutation_p.H201D|ZNF222_uc002oyd.2_Missense_Mutation_p.H107D	NM_013360	NP_037492	Q9UK12	ZN222_HUMAN	zinc finger protein 222 isoform 2	161	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Prostate(69;0.0435)				CTCAGCCCTTCATATTCATCA	0.418													34	175	---	---	---	---	PASS
CBLC	23624	broad.mit.edu	37	19	45281228	45281228	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45281228G>A	uc002ozs.2	+	1	103	c.40G>A	c.(40-42)GAG>AAG	p.E14K	CBLC_uc010ejt.2_Missense_Mutation_p.E14K	NM_012116	NP_036248	Q9ULV8	CBLC_HUMAN	Cas-Br-M (murine) ecotropic retroviral	14	4H.|Cbl-PTB.				cell surface receptor linked signaling pathway|negative regulation of epidermal growth factor receptor activity|negative regulation of MAP kinase activity|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	calcium ion binding|epidermal growth factor receptor binding|phosphotyrosine binding|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|skin(1)	6	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				ACAGTGGGAAGAGGCCCGCGC	0.726			M		AML								5	17	---	---	---	---	PASS
PRKD2	25865	broad.mit.edu	37	19	47204219	47204219	+	Intron	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47204219C>T	uc002pfh.2	-						PRKD2_uc002pfg.2_Intron|PRKD2_uc002pfi.2_Intron|PRKD2_uc002pfj.2_Intron|PRKD2_uc010xye.1_Intron|PRKD2_uc002pfk.2_Intron	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A						cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TCTGTGGGGACGGAGGCATCA	0.632													4	46	---	---	---	---	PASS
CARD8	22900	broad.mit.edu	37	19	48725121	48725121	+	Intron	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48725121G>C	uc002pie.3	-						CARD8_uc002pii.3_Intron|CARD8_uc002pid.1_5'Flank|CARD8_uc010xzi.1_Intron|CARD8_uc010els.2_Intron|CARD8_uc010xzj.1_Intron|CARD8_uc010xzk.1_Intron|CARD8_uc002pif.3_Intron|CARD8_uc002pig.3_Intron|CARD8_uc002pih.3_Intron|CARD8_uc010xzl.1_Intron|CARD8_uc010xzm.1_Intron	NM_014959	NP_055774	Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8						negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity				0		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		GCCTAAGGAAGAAGGGGCAGA	0.418													10	44	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50098327	50098327	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50098327C>G	uc002poo.3	+	4	735	c.735C>G	c.(733-735)TTC>TTG	p.F245L		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CAACTCAGTTCAACCTGCTGG	0.697													4	17	---	---	---	---	PASS
NUP62	23636	broad.mit.edu	37	19	50411753	50411753	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50411753C>T	uc002pqx.2	-	2	1416	c.1312G>A	c.(1312-1314)GAG>AAG	p.E438K	IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron|NUP62_uc002pqy.2_Missense_Mutation_p.E438K|NUP62_uc002pqz.2_Missense_Mutation_p.E438K|NUP62_uc002pra.2_Missense_Mutation_p.E438K|NUP62_uc002prb.2_Missense_Mutation_p.E438K|NUP62_uc002prc.2_Missense_Mutation_p.E362K	NM_153719	NP_714941	P37198	NUP62_HUMAN	nucleoporin 62kDa	438	Potential.				carbohydrate metabolic process|cell death|cell surface receptor linked signaling pathway|glucose transport|hormone-mediated signaling pathway|mRNA transport|negative regulation of apoptosis|negative regulation of cell proliferation|nucleocytoplasmic transport|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|protein transport|regulation of glucose transport|transcription, DNA-dependent|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleocytoplasmic shuttling complex|ribonucleoprotein complex|spindle pole	chromatin binding|protein serine/threonine kinase activity|receptor signaling complex scaffold activity|SH2 domain binding|structural constituent of nuclear pore|thyroid hormone receptor binding|ubiquitin binding				0		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TCGATGTTCTCAGCCAGCTTG	0.602													38	118	---	---	---	---	PASS
NUP62	23636	broad.mit.edu	37	19	50413062	50413062	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50413062C>G	uc002pqx.2	-	2	107	c.3G>C	c.(1-3)ATG>ATC	p.M1I	IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron|NUP62_uc002pqy.2_Missense_Mutation_p.M1I|NUP62_uc002pqz.2_Missense_Mutation_p.M1I|NUP62_uc002pra.2_Missense_Mutation_p.M1I|NUP62_uc002prb.2_Missense_Mutation_p.M1I|NUP62_uc002prc.2_Missense_Mutation_p.M1I	NM_153719	NP_714941	P37198	NUP62_HUMAN	nucleoporin 62kDa	1	15 X 9 AA approximate repeats.|1.				carbohydrate metabolic process|cell death|cell surface receptor linked signaling pathway|glucose transport|hormone-mediated signaling pathway|mRNA transport|negative regulation of apoptosis|negative regulation of cell proliferation|nucleocytoplasmic transport|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|protein transport|regulation of glucose transport|transcription, DNA-dependent|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleocytoplasmic shuttling complex|ribonucleoprotein complex|spindle pole	chromatin binding|protein serine/threonine kinase activity|receptor signaling complex scaffold activity|SH2 domain binding|structural constituent of nuclear pore|thyroid hormone receptor binding|ubiquitin binding				0		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TAAACCCGCTCATGGCTCCGG	0.547													6	41	---	---	---	---	PASS
CLEC11A	6320	broad.mit.edu	37	19	51228588	51228588	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51228588C>T	uc002psy.2	+	4	1014	c.836C>T	c.(835-837)TCG>TTG	p.S279L		NM_002975	NP_002966	Q9Y240	CLC11_HUMAN	stem cell growth factor precursor	279	C-type lectin.				positive regulation of cell proliferation	cytoplasm|extracellular region	growth factor activity|sugar binding			ovary(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCCAGCGCCTCGCCGCATCCG	0.716													8	26	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51914460	51914460	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51914460C>G	uc002pwo.2	-	11	2603	c.1987G>C	c.(1987-1989)GAG>CAG	p.E663Q	SIGLEC10_uc002pwp.2_Missense_Mutation_p.E605Q|SIGLEC10_uc002pwq.2_Missense_Mutation_p.E510Q|SIGLEC10_uc002pwr.2_Missense_Mutation_p.E568Q|SIGLEC10_uc010ycy.1_Missense_Mutation_p.E478Q|SIGLEC10_uc010ycz.1_Missense_Mutation_p.E520Q|SIGLEC10_uc010eow.2_Missense_Mutation_p.E380Q	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	663	Cytoplasmic (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		TGGAGCTCCTCTTGGCTCTCC	0.547													23	131	---	---	---	---	PASS
ZNF528	84436	broad.mit.edu	37	19	52919997	52919997	+	3'UTR	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52919997C>G	uc002pzh.2	+	7					ZNF528_uc002pzi.2_3'UTR	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		TCATGAGAGTCCCTACAAACT	0.388													12	28	---	---	---	---	PASS
ZNF600	162966	broad.mit.edu	37	19	53269068	53269068	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53269068G>A	uc002qab.3	-	3	2227	c.1941C>T	c.(1939-1941)TTC>TTT	p.F647F		NM_198457	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	647	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		ATTTGCGACTGAAAACTTTGT	0.368													28	127	---	---	---	---	PASS
MIR520D	574482	broad.mit.edu	37	19	54223361	54223361	+	RNA	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54223361G>C	hsa-mir-520d|MI0003164	+			c.12G>C			MIR517B_hsa-mir-517b|MI0003165_5'Flank|MIR520G_hsa-mir-520g|MI0003166_5'Flank																	0						CTCAAGCTGTGAGTCTACAAA	0.408													4	174	---	---	---	---	PASS
LENG8	114823	broad.mit.edu	37	19	54968077	54968077	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54968077C>G	uc002qfv.1	+	10	1741	c.1597C>G	c.(1597-1599)CCG>GCG	p.P533A	LENG8_uc002qfw.2_Missense_Mutation_p.P570A			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;	533							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		TGCCCCCGACCCGTCCACCGT	0.667													4	26	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57301275	57301275	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57301275C>T	uc002qnr.2	-	8	824	c.442G>A	c.(442-444)GAG>AAG	p.E148K	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_5'UTR|ZIM2_uc010ygr.1_5'UTR|ZIM2_uc002qnq.2_Missense_Mutation_p.E148K|ZIM2_uc010etp.2_Missense_Mutation_p.E148K|ZIM2_uc010ygs.1_Missense_Mutation_p.E148K	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	148					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		TCTAACATCTCTGTGTTCCTC	0.473													4	18	---	---	---	---	PASS
ZNF419	79744	broad.mit.edu	37	19	58004285	58004285	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58004285C>G	uc002qov.2	+	5	600	c.360C>G	c.(358-360)CTC>CTG	p.L120L	ZNF547_uc002qpm.3_Intron|ZNF419_uc010ety.1_Silent_p.L121L|ZNF419_uc010etz.1_Silent_p.L108L|ZNF419_uc010eua.1_Silent_p.L107L|ZNF419_uc002qow.2_Silent_p.L88L|ZNF419_uc010eub.1_Silent_p.L75L|ZNF419_uc010euc.1_Silent_p.L74L	NM_024691	NP_078967	Q96HQ0	ZN419_HUMAN	zinc finger protein 419 isoform 2	120					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		TAGGACTGCTCAGTTCAAACA	0.473													8	64	---	---	---	---	PASS
SNPH	9751	broad.mit.edu	37	20	1286355	1286355	+	Missense_Mutation	SNP	G	A	A	rs148762307	by1000genomes	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1286355G>A	uc002wes.2	+	6	1378	c.1142G>A	c.(1141-1143)CGT>CAT	p.R381H	SNPH_uc002wet.2_Missense_Mutation_p.R425H	NM_014723	NP_055538	O15079	SNPH_HUMAN	syntaphilin	381					synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding			ovary(2)	2						CCCATCACCCGTGGACCCACC	0.667													6	24	---	---	---	---	PASS
RASSF2	9770	broad.mit.edu	37	20	4764948	4764948	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4764948C>G	uc002wld.2	-	11	1006	c.952G>C	c.(952-954)GAG>CAG	p.E318Q	RASSF2_uc002wlc.2_RNA|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_Missense_Mutation_p.E318Q|RASSF2_uc010gbh.2_Intron	NM_170774	NP_739580	P50749	RASF2_HUMAN	Ras association domain family 2	318	SARAH.				cell cycle|signal transduction	nucleus	protein binding			ovary(3)|lung(2)|large_intestine(1)	6						TCGGCTATCTCCTCCAGCCTC	0.592													8	38	---	---	---	---	PASS
COX4I2	84701	broad.mit.edu	37	20	30226891	30226891	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30226891C>G	uc002wwj.1	+	2	146	c.71C>G	c.(70-72)TCA>TGA	p.S24*	COX4I2_uc002wwi.2_Nonsense_Mutation_p.S24*	NM_032609	NP_115998	Q96KJ9	COX42_HUMAN	cytochrome c oxidase subunit IV isoform 2	24					cellular respiration		cytochrome-c oxidase activity			ovary(1)	1	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.01e-05)|all cancers(5;9.46e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00121)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			ATGCACAGCTCAGAAGGCACC	0.607													3	17	---	---	---	---	PASS
DUSP15	128853	broad.mit.edu	37	20	30436311	30436311	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30436311G>A	uc002wwu.1	-	10	861	c.784C>T	c.(784-786)CGC>TGC	p.R262C	FOXS1_uc002wwt.1_5'Flank			Q9H1R2	DUS15_HUMAN	RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;	262						cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCATCTGGGCGCTCGGTTGAG	0.632													12	18	---	---	---	---	PASS
HCK	3055	broad.mit.edu	37	20	30674508	30674508	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30674508G>C	uc002wxh.2	+	9	1084	c.913G>C	c.(913-915)GAG>CAG	p.E305Q	HCK_uc010gdy.2_Missense_Mutation_p.E284Q|HCK_uc002wxi.2_Missense_Mutation_p.E283Q	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	305	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTTCCTGGCAGAGGCCAACGT	0.557													3	57	---	---	---	---	PASS
C20orf134	170487	broad.mit.edu	37	20	32256040	32256040	+	Nonstop_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32256040G>C	uc002wzt.2	+	1	1737	c.737G>C	c.(736-738)TGA>TCA	p.*246S	NECAB3_uc002wzm.3_Intron|NECAB3_uc002wzn.3_Intron|NECAB3_uc002wzo.3_Intron|NECAB3_uc002wzp.3_Intron|NECAB3_uc002wzq.3_Intron|NECAB3_uc002wzr.3_Intron|NECAB3_uc010geo.2_Intron	NM_001024675	NP_001019846	Q5JWF8	CT134_HUMAN	hypothetical protein LOC170487	246										pancreas(1)	1						GTGTTCAACTGAGTCAGGCTG	0.607											OREG0025871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	66	---	---	---	---	PASS
EPB41L1	2036	broad.mit.edu	37	20	34797677	34797677	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34797677G>A	uc002xfb.2	+	15	2107	c.1936G>A	c.(1936-1938)GAC>AAC	p.D646N	EPB41L1_uc002xeu.2_Missense_Mutation_p.D572N|EPB41L1_uc010zvo.1_Missense_Mutation_p.D646N|EPB41L1_uc002xev.2_Missense_Mutation_p.D646N|EPB41L1_uc002xew.2_Missense_Mutation_p.D537N|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Missense_Mutation_p.D572N|EPB41L1_uc010gfq.2_Missense_Mutation_p.D745N	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	646					cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)					GCTCGACCGGGACAAAAGCGA	0.617													14	31	---	---	---	---	PASS
C20orf132	140699	broad.mit.edu	37	20	35749320	35749320	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35749320C>T	uc010zvu.1	-	18	2217	c.2126G>A	c.(2125-2127)GGA>GAA	p.G709E	C20orf132_uc002xgk.2_Missense_Mutation_p.G331E	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1	Error:Variant_position_missing_in_Q9H579_after_alignment											0		Myeloproliferative disorder(115;0.00878)				GAGAAATAGTCCCTGAAGATG	0.433													8	37	---	---	---	---	PASS
KIAA0406	9675	broad.mit.edu	37	20	36641366	36641366	+	Missense_Mutation	SNP	C	T	T	rs146011114	byFrequency	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36641366C>T	uc002xhl.2	-	3	1062	c.853G>A	c.(853-855)GAC>AAC	p.D285N	KIAA0406_uc002xhm.2_Missense_Mutation_p.D285N	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	285							binding				0		Myeloproliferative disorder(115;0.00874)				GTCAACTTGTCGCCAGTCTTT	0.438													6	366	---	---	---	---	PASS
ZHX3	23051	broad.mit.edu	37	20	39832617	39832617	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39832617C>G	uc002xjs.1	-	3	1318	c.940G>C	c.(940-942)GAC>CAC	p.D314H	ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Missense_Mutation_p.D314H|ZHX3_uc002xjt.1_Missense_Mutation_p.D314H|ZHX3_uc002xju.1_Missense_Mutation_p.D314H|ZHX3_uc002xjv.1_Missense_Mutation_p.D314H|ZHX3_uc002xjw.1_Missense_Mutation_p.D314H|ZHX3_uc010ggg.1_Missense_Mutation_p.D314H	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	314	Homeobox 1.|Required for homodimerization and interaction with NFYA.|Required for repressor activity.				negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Myeloproliferative disorder(115;0.00425)				CTGTTAGAGTCCATGGCTGCA	0.542													22	35	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40727169	40727169	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40727169G>A	uc002xkg.2	-	27	3922	c.3738C>T	c.(3736-3738)TTC>TTT	p.F1246F	PTPRT_uc010ggj.2_Silent_p.F1265F|PTPRT_uc010ggi.2_Silent_p.F449F	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1246	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GGGTGACCACGAAGGCGGCAG	0.517													17	44	---	---	---	---	PASS
C20orf177	63939	broad.mit.edu	37	20	58519380	58519380	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58519380G>A	uc002yba.2	+	5	797	c.382G>A	c.(382-384)GAT>AAT	p.D128N	C20orf177_uc010zzx.1_Intron|C20orf177_uc002ybc.2_Missense_Mutation_p.D128N	NM_022106	NP_071389	Q9NTX9	CT177_HUMAN	hypothetical protein LOC63939	128										ovary(2)|breast(1)	3	all_lung(29;0.00693)		BRCA - Breast invasive adenocarcinoma(7;1.22e-08)			AGTTTACTTTGATCTTCACCC	0.458													19	98	---	---	---	---	PASS
CDH26	60437	broad.mit.edu	37	20	58533858	58533858	+	Intron	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58533858G>A	uc002ybe.2	+						CDH26_uc010zzy.1_Intron	NM_177980	NP_817089	Q8IXH8	CAD26_HUMAN	cadherin-like 26 isoform a						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			cAGGTAAGCTGAGCCTGCAGC	0.478													9	35	---	---	---	---	PASS
ARFGAP1	55738	broad.mit.edu	37	20	61918992	61918992	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61918992G>A	uc002yem.2	+	13	1100	c.988G>A	c.(988-990)GAG>AAG	p.E330K	ARFGAP1_uc011aas.1_Missense_Mutation_p.E285K|ARFGAP1_uc011aat.1_Missense_Mutation_p.E217K|ARFGAP1_uc002yel.2_Missense_Mutation_p.E338K|ARFGAP1_uc002yen.2_3'UTR|ARFGAP1_uc002yeo.1_RNA	NM_018209	NP_060679	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating	330					COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)					GAGCTTCTGGGAGACCTTTGG	0.592													4	33	---	---	---	---	PASS
OPRL1	4987	broad.mit.edu	37	20	62729390	62729390	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62729390C>T	uc002yic.2	+	4	871	c.469C>T	c.(469-471)CGT>TGT	p.R157C	OPRL1_uc002yid.2_Missense_Mutation_p.R157C|OPRL1_uc002yif.3_Missense_Mutation_p.R152C	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1	157	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					CCACCCCATCCGTGCCCTCGA	0.572													20	95	---	---	---	---	PASS
ADAMTS1	9510	broad.mit.edu	37	21	28210431	28210431	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28210431C>A	uc002ymf.2	-	9	2826	c.2371G>T	c.(2371-2373)GAC>TAC	p.D791Y		NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1	791	Spacer.				integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding			lung(3)|large_intestine(2)|central_nervous_system(1)	6		Breast(209;0.000962)		Lung(58;0.215)		TACATAATGTCTTGCTCTAAG	0.478													9	45	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40630548	40630548	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40630548C>G	uc002yxk.1	-	18	2075	c.1936G>C	c.(1936-1938)GAT>CAT	p.D646H	BRWD1_uc010goc.1_5'UTR|BRWD1_uc002yxl.2_Missense_Mutation_p.D646H|BRWD1_uc010goe.1_RNA|BRWD1_uc010gof.1_Missense_Mutation_p.D99H|BRWD1_uc010gog.1_RNA|BRWD1_uc010goh.1_RNA|BRWD1_uc010goi.1_Missense_Mutation_p.D366H	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	646					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTGCGTTCATCATTATCATTG	0.358													24	134	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41684283	41684283	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41684283G>A	uc002yyq.1	-	9	2239	c.1787C>T	c.(1786-1788)CCG>CTG	p.P596L	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	596	Extracellular (Potential).|Ig-like C2-type 7.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TATGAAAGGCGGAACTGCAAG	0.448													5	19	---	---	---	---	PASS
DGCR8	54487	broad.mit.edu	37	22	20074120	20074120	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20074120G>C	uc002zri.2	+	2	984	c.634G>C	c.(634-636)GAT>CAT	p.D212H	DGCR8_uc010grz.2_Missense_Mutation_p.D212H|DGCR8_uc002zrj.2_5'Flank	NM_022720	NP_073557	Q8WYQ5	DGCR8_HUMAN	DiGeorge syndrome critical region gene 8	212	Necessary for nuclear localization and retention.|Necessary for interaction with NCL.				primary miRNA processing	cytoplasm|cytoplasm|microtubule cytoskeleton|nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding				0	Colorectal(54;0.0993)					TTTGGAGCTAGATGAAGAAGG	0.473													33	101	---	---	---	---	PASS
SEC14L4	284904	broad.mit.edu	37	22	30890146	30890146	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30890146C>G	uc003aid.2	-	7	671	c.571G>C	c.(571-573)GTT>CTT	p.V191L	SEC14L4_uc011akz.1_Missense_Mutation_p.V191L|SEC14L4_uc003aie.2_Missense_Mutation_p.V176L|SEC14L4_uc003aif.2_Missense_Mutation_p.V137L	NM_174977	NP_777637	Q9UDX3	S14L4_HUMAN	SEC14p-like protein TAP3 isoform a	191	CRAL-TRIO.					integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)	CCTCGAATAACAATTAAATTC	0.493													11	42	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36712675	36712675	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36712675C>T	uc003apg.2	-	12	1498	c.1267G>A	c.(1267-1269)GAG>AAG	p.E423K	MYH9_uc003aph.1_Missense_Mutation_p.E287K	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	423	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						AACATCCGCTCATAGGTCGCC	0.542			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				13	56	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36718516	36718516	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36718516G>A	uc003apg.2	-	6	894	c.663C>T	c.(661-663)TTC>TTT	p.F221F	MYH9_uc003aph.1_Silent_p.F85F	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	221	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						TGGCGTTCCCGAAGGCCTCCA	0.687			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				10	64	---	---	---	---	PASS
TST	7263	broad.mit.edu	37	22	37414596	37414596	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37414596C>G	uc003aqg.2	-	1	878	c.178G>C	c.(178-180)GAC>CAC	p.D60H	TST_uc003aqh.2_Missense_Mutation_p.D60H|MPST_uc003aqi.1_5'Flank|MPST_uc003aqj.2_5'Flank|MPST_uc003aqm.2_5'Flank|MPST_uc011amu.1_5'Flank|MPST_uc003aql.2_5'Flank	NM_003312	NP_003303	Q16762	THTR_HUMAN	thiosulfate sulfurtransferase	60	Rhodanese 1.				cyanate catabolic process|rRNA transport	mitochondrial matrix|plasma membrane	5S rRNA binding|thiosulfate sulfurtransferase activity				0						TCTTCTATGTCAAAGAAAGAG	0.667													2	4	---	---	---	---	PASS
ATF4	468	broad.mit.edu	37	22	39918236	39918236	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39918236C>G	uc003axz.2	+	3	965	c.685C>G	c.(685-687)CTG>GTG	p.L229V	ATF4_uc011aol.1_Missense_Mutation_p.L141V|ATF4_uc003aya.2_Missense_Mutation_p.L229V	NM_182810	NP_877962	P18848	ATF4_HUMAN	activating transcription factor 4	229					cellular amino acid metabolic process|gluconeogenesis|positive regulation of transcription from RNA polymerase II promoter|response to endoplasmic reticulum stress|transcription from RNA polymerase II promoter	cytoplasm|plasma membrane	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.04)					AGAGTCCTATCTGGGGTCTCC	0.537													7	11	---	---	---	---	PASS
UPK3A	7380	broad.mit.edu	37	22	45691457	45691457	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45691457G>C	uc003bfy.2	+	6	727	c.721G>C	c.(721-723)GAT>CAT	p.D241H	UPK3A_uc010gzy.2_Missense_Mutation_p.D120H	NM_006953	NP_008884	O75631	UPK3A_HUMAN	uroplakin 3A precursor	241	Cytoplasmic (Potential).				epithelial cell differentiation	endoplasmic reticulum membrane|integral to membrane					0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GGGGAGTTCTGATGGGGAAAC	0.582													35	114	---	---	---	---	PASS
CERK	64781	broad.mit.edu	37	22	47095273	47095273	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47095273C>A	uc003bia.2	-	8	987	c.880G>T	c.(880-882)GGG>TGG	p.G294W	CERK_uc010hae.2_Missense_Mutation_p.G96W	NM_022766	NP_073603	Q8TCT0	CERK1_HUMAN	ceramide kinase	294					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		ATGATGTCCCCGTAGAAGCCG	0.562													4	105	---	---	---	---	PASS
PIM3	415116	broad.mit.edu	37	22	50356425	50356425	+	Silent	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50356425C>G	uc003bjb.2	+	5	1158	c.705C>G	c.(703-705)CTC>CTG	p.L235L	PIM3_uc011arj.1_5'UTR	NM_001001852	NP_001001852	Q86V86	PIM3_HUMAN	serine/threonine protein kinase pim-3	235	Protein kinase.				cell cycle|negative regulation of apoptosis|regulation of mitotic cell cycle		ATP binding|protein binding|protein serine/threonine kinase activity				0		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		GCGTGCTTCTCTACGATATGG	0.667													4	67	---	---	---	---	PASS
NCAPH2	29781	broad.mit.edu	37	22	50960208	50960208	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50960208C>G	uc003blr.3	+	12	1161	c.1039C>G	c.(1039-1041)CTG>GTG	p.L347V	NCAPH2_uc003blv.2_Missense_Mutation_p.L347V|NCAPH2_uc010hbb.2_Missense_Mutation_p.L198V|NCAPH2_uc003blu.3_RNA|NCAPH2_uc003bls.3_RNA|NCAPH2_uc003blt.3_RNA|NCAPH2_uc003blw.3_RNA|NCAPH2_uc003blx.3_Missense_Mutation_p.L347V|NCAPH2_uc003bly.3_RNA	NM_152299	NP_689512	Q6IBW4	CNDH2_HUMAN	kleisin beta isoform 2	347					chromosome condensation	chromosome|nucleus				ovary(1)|skin(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		GGAGGAGGCTCTGGGACAGAA	0.632													22	59	---	---	---	---	PASS
SH3KBP1	30011	broad.mit.edu	37	X	19713767	19713767	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19713767C>T	uc004czm.2	-	5	799	c.483G>A	c.(481-483)GAG>GAA	p.E161E	SH3KBP1_uc004czl.2_Silent_p.E124E	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a	161					apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						AAATGCCAAGCTCATCCGACT	0.557													34	128	---	---	---	---	PASS
CXorf21	80231	broad.mit.edu	37	X	30577710	30577710	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30577710G>A	uc004dcg.1	-	3	1039	c.763C>T	c.(763-765)CAA>TAA	p.Q255*		NM_025159	NP_079435	Q9HAI6	CX021_HUMAN	hypothetical protein LOC80231	255										ovary(1)	1						CTAGACACTTGAAGACTGATT	0.403													24	125	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34149541	34149541	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34149541C>T	uc004ddg.2	-	1	888	c.855G>A	c.(853-855)AAG>AAA	p.K285K		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	285										ovary(4)|central_nervous_system(1)	5						CGTCAGTTGTCTTCTCCCGGC	0.572													9	29	---	---	---	---	PASS
GPR34	2857	broad.mit.edu	37	X	41555097	41555097	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41555097G>A	uc004dfp.3	+	3	495	c.211G>A	c.(211-213)GGG>AGG	p.G71R	CASK_uc004dfl.3_Intron|CASK_uc004dfm.3_Intron|CASK_uc004dfn.3_Intron|GPR34_uc004dfq.3_Missense_Mutation_p.G71R|GPR34_uc010nhg.2_Missense_Mutation_p.G71R|GPR34_uc004dfr.3_Missense_Mutation_p.G71R	NM_001097579	NP_001091048	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	71	Helical; Name=1; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1						GGGACTGGTTGGGAACATAAT	0.398													6	133	---	---	---	---	PASS
SLC9A7	84679	broad.mit.edu	37	X	46541920	46541920	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46541920G>A	uc004dgu.1	-	2	384	c.376C>T	c.(376-378)CGT>TGT	p.R126C	SLC9A7_uc004dgv.1_Missense_Mutation_p.R126C	NM_032591	NP_115980	Q96T83	SL9A7_HUMAN	solute carrier family 9, member 7	126					regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity			ovary(2)	2						GATTTGTCACGGCCACTGGTA	0.478													11	35	---	---	---	---	PASS
MAGIX	79917	broad.mit.edu	37	X	49019254	49019254	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49019254G>A	uc010nin.1	+	1	74	c.27G>A	c.(25-27)GCG>GCA	p.A9A	MAGIX_uc010nio.1_Silent_p.A9A|MAGIX_uc004dmt.2_Silent_p.A9A|MAGIX_uc004dmu.2_5'Flank|MAGIX_uc004dmw.2_5'Flank	NM_024859	NP_079135	Q9H6Y5	MAGIX_HUMAN	MAGI family member, X-linked isoform a	9											0						GGGGCGCCGCGAACCCTAAGG	0.667													7	16	---	---	---	---	PASS
BMP15	9210	broad.mit.edu	37	X	50659449	50659449	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50659449C>G	uc011mnw.1	+	2	1021	c.1021C>G	c.(1021-1023)CAG>GAG	p.Q341E		NM_005448	NP_005439	O95972	BMP15_HUMAN	bone morphogenetic protein 15 precursor	341					female gamete generation|granulosa cell development|ovarian follicle development	extracellular space	cytokine activity|growth factor activity			ovary(2)	2	Ovarian(276;0.236)					CGCCATTATTCAGAACCTTAT	0.483													20	101	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53228335	53228335	+	Silent	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53228335G>A	uc004drz.2	-	15	2600	c.2067C>T	c.(2065-2067)ATC>ATT	p.I689I	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Silent_p.I622I|KDM5C_uc004dsa.2_Silent_p.I688I	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	689					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						CAGCCTCTGTGATACCCTAAG	0.502			N|F|S		clear cell renal carcinoma								15	81	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53579331	53579331	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53579331C>T	uc004dsp.2	-	63	9224	c.8822G>A	c.(8821-8823)CGA>CAA	p.R2941Q	HUWE1_uc004dsn.2_Missense_Mutation_p.R1765Q	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2941					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TAGGATTCCTCGGGAATCTGC	0.537													11	41	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63488741	63488741	+	Silent	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63488741C>T	uc004dvs.2	-	14	1859	c.1791G>A	c.(1789-1791)CAG>CAA	p.Q597Q	MTMR8_uc011mou.1_Intron	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	597						nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						CTTGATCCATCTGAGCTCGGA	0.507													18	47	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63564952	63564952	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63564952G>A	uc004dvs.2	-	7	906	c.838C>T	c.(838-840)CGG>TGG	p.R280W	MTMR8_uc011mou.1_Missense_Mutation_p.R280W|MTMR8_uc004dvt.1_Missense_Mutation_p.R280W	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	280	Myotubularin phosphatase.					nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						AGACTGCTCCGCATTACATGG	0.488													23	63	---	---	---	---	PASS
DLG3	1741	broad.mit.edu	37	X	69699014	69699014	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69699014G>C	uc004dyi.1	+	10	1748	c.1420G>C	c.(1420-1422)GAA>CAA	p.E474Q	DLG3_uc004dyj.1_Missense_Mutation_p.E137Q|DLG3_uc011mpn.1_5'UTR	NM_021120	NP_066943	Q92796	DLG3_HUMAN	synapse-associated protein 102 isoform a	474					axon guidance|negative regulation of cell proliferation|synaptic transmission	plasma membrane	guanylate kinase activity			large_intestine(1)|pancreas(1)	2	Renal(35;0.156)					CAGTCGCTTTGAATCGAAGAT	0.473													35	71	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	106840647	106840647	+	IGR	SNP	C	G	G			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106840647C>G								CXorf41 (353175 upstream) : PRPS1 (31007 downstream)																							CCCAGGAAATCGAGCCGCTGC	0.597													7	31	---	---	---	---	PASS
SPANXN2	494119	broad.mit.edu	37	X	142795362	142795362	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142795362C>T	uc004fbz.2	-	2	1070	c.316G>A	c.(316-318)GAA>AAA	p.E106K		NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein	106										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GAAGATCCTTCAGATGAGTCC	0.532													26	390	---	---	---	---	PASS
THUMPD2	80745	broad.mit.edu	37	2	39982898	39982899	+	Intron	INS	-	AGTAT	AGTAT	rs10688564		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39982898_39982899insAGTAT	uc002rru.2	-						THUMPD2_uc002rrv.2_Intron|THUMPD2_uc010ynt.1_Intron	NM_025264	NP_079540	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2								methyltransferase activity			skin(1)	1		all_hematologic(82;0.248)				CATCTATTTTGAGTAAATAATA	0.238													4	3	---	---	---	---	
PELI1	57162	broad.mit.edu	37	2	64331637	64331637	+	Intron	DEL	T	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64331637delT	uc002scs.3	-						PELI1_uc002sct.3_Intron	NM_020651	NP_065702	Q96FA3	PELI1_HUMAN	pellino protein						innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol				ovary(1)	1						tggtttgtcatttttttttta	0.025													4	2	---	---	---	---	
EXOC6B	23233	broad.mit.edu	37	2	72725736	72725736	+	Intron	DEL	T	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72725736delT	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						TTTTTTTCGGTTTTTTTTTTT	0.299													5	3	---	---	---	---	
C2orf3	6936	broad.mit.edu	37	2	75919273	75919276	+	Intron	DEL	ATAT	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75919273_75919276delATAT	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						CGATAATGAAatatatatatatat	0.250													12	6	---	---	---	---	
UGGT1	56886	broad.mit.edu	37	2	128914130	128914130	+	Intron	DEL	T	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128914130delT	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						ATGTAGATAAttttttttttt	0.164													4	2	---	---	---	---	
SGEF	26084	broad.mit.edu	37	3	153842162	153842162	+	Intron	DEL	T	-	-	rs66618151		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153842162delT	uc011bog.1	+						SGEF_uc011boh.1_Intron	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine						regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTGCttttccttttttttttt	0.244													4	5	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39230425	39230425	+	Intron	DEL	T	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39230425delT	uc003gtv.2	+						WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						CTTGCAAGAATtttttttttt	0.129													6	3	---	---	---	---	
DDX60L	91351	broad.mit.edu	37	4	169317284	169317285	+	Intron	INS	-	A	A	rs5863929		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169317284_169317285insA	uc003irq.3	-						DDX60L_uc003irr.1_Intron|DDX60L_uc003irs.1_Intron	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TGCTACTATTTAAAAAAAAAAA	0.178													4	3	---	---	---	---	
NPR3	4883	broad.mit.edu	37	5	32739289	32739289	+	Intron	DEL	G	-	-	rs58981865		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32739289delG	uc003jhv.2	+						NPR3_uc010iuo.2_Intron|NPR3_uc011cnz.1_Intron|NPR3_uc003jhu.2_Intron	NM_000908	NP_000899	P17342	ANPRC_HUMAN	natriuretic peptide receptor C/guanylate cyclase						osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity			ovary(1)|central_nervous_system(1)	2					Nesiritide(DB04899)	GTGTGTGTGTGTTTTTTTTTT	0.423													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32546929	32546929	+	Intron	DEL	A	-	-	rs67615547		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32546929delA	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						CTCTACTAACAGTTTCTTTTC	0.478													6	5	---	---	---	---	
YWHAG	7532	broad.mit.edu	37	7	75990616	75990617	+	5'Flank	INS	-	AAAAAAAAAAA	AAAAAAAAAAA			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75990616_75990617insAAAAAAAAAAA	uc011kgj.1	-							NM_012479	NP_036611	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan						G2/M transition of mitotic cell cycle|regulation of neuron differentiation|regulation of signal transduction|regulation of synaptic plasticity	cytosol	insulin-like growth factor receptor binding|protein kinase C binding|protein kinase C inhibitor activity			ovary(1)|lung(1)	2						gactccgtctcaaaaaaaaaaa	0.243													3	3	---	---	---	---	
PNPLA8	50640	broad.mit.edu	37	7	108151484	108151485	+	Intron	INS	-	A	A	rs60102827		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108151484_108151485insA	uc003vff.1	-						PNPLA8_uc003vfg.1_Intron|PNPLA8_uc003vfh.1_Intron|PNPLA8_uc003vfi.1_Intron|PNPLA8_uc003vfj.1_Intron|PNPLA8_uc003vfk.1_Intron	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8						fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						TCTCAAATTGGAAAAAAAAAAA	0.198													4	2	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101011386	101011387	+	Intron	INS	-	A	A	rs35746502		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101011386_101011387insA	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			gcccattccttaaaaaaaaaaa	0.015													3	4	---	---	---	---	
TAF2	6873	broad.mit.edu	37	8	120770135	120770136	+	Intron	INS	-	A	A			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120770135_120770136insA	uc003you.2	-							NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2						G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			gactccatctcaaaaaaaaaac	0.094													3	3	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131179560	131179561	+	Intron	INS	-	A	A	rs111521624		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131179560_131179561insA	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						aaagaaaaaagaaaaaaaaaaa	0.173													5	4	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69420250	69420251	+	Intron	INS	-	CTTA	CTTA			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69420250_69420251insCTTA	uc004afn.2	+							NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						TTATTATTCATCTTTTATTAAA	0.257													12	6	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92286489	92286494	+	Intron	DEL	GGTGGC	-	-	rs144940722	by1000genomes	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92286489_92286494delGGTGGC	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						tggtggtggtggtggcggtgatggag	0.010													4	2	---	---	---	---	
ARHGAP12	94134	broad.mit.edu	37	10	32141655	32141657	+	Intron	DEL	TTC	-	-	rs146488179	by1000genomes	TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32141655_32141657delTTC	uc001ivz.1	-						ARHGAP12_uc001ivy.1_Intron|ARHGAP12_uc009xls.2_Intron|ARHGAP12_uc001iwb.1_Intron|ARHGAP12_uc001iwc.1_Intron|ARHGAP12_uc009xlq.1_Intron|ARHGAP12_uc001iwd.1_Intron|ARHGAP12_uc009xlr.1_Intron	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				CAACAAAAAAttctttttttttt	0.113													6	3	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112363876	112363877	+	Intron	DEL	CT	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112363876_112363877delCT	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		aaaaaaaaaactaaaaaTTAAA	0.109													4	2	---	---	---	---	
PNLIP	5406	broad.mit.edu	37	10	118307590	118307591	+	Intron	DEL	CA	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118307590_118307591delCA	uc001lcm.2	+							NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	Tacacacacgcacacacacaca	0.144													4	2	---	---	---	---	
C11orf46	120534	broad.mit.edu	37	11	30358033	30358034	+	Intron	DEL	CT	-	-	rs77082221		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30358033_30358034delCT	uc001mso.1	+						C11orf46_uc001msp.2_5'Flank	NM_152316	NP_689529	Q8N8R7	CK046_HUMAN	hypothetical protein LOC120534												0						ATTTTATCTCCTTTTTTTTTTT	0.282													3	4	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118266825	118266825	+	Intron	DEL	G	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118266825delG	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		aaaaaaaaaagaaagaaagaa	0.169													4	2	---	---	---	---	
NUP37	79023	broad.mit.edu	37	12	102468735	102468735	+	Intron	DEL	A	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102468735delA	uc001tjc.2	-							NM_024057	NP_076962	Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa						carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			ovary(1)	1						AACACAAATTAAAAAAAAAAA	0.343													15	7	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120194922	120194922	+	Intron	DEL	A	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120194922delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		agactctcttaaaaaaaaaaa	0.000													6	3	---	---	---	---	
POU4F1	5457	broad.mit.edu	37	13	79176484	79176486	+	In_Frame_Del	DEL	TGG	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79176484_79176486delTGG	uc001vkv.2	-	2	558_560	c.324_326delCCA	c.(322-327)CACCAG>CAG	p.H108del	uc001vku.1_Intron	NM_006237	NP_006228	Q01851	PO4F1_HUMAN	POU domain, class 4, transcription factor 1	108	Poly-His.				axonogenesis|regulation of transcription from RNA polymerase II promoter|synapse assembly	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TTCGAGCGCCtggtggtggtggt	0.473													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	82265212	82265212	+	IGR	DEL	C	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82265212delC								None (None upstream) : None (None downstream)																							CTGAGTTGTTCTAAAAAAAAA	0.174													4	2	---	---	---	---	
SIP1	8487	broad.mit.edu	37	14	39597689	39597690	+	Intron	INS	-	T	T	rs149334273		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39597689_39597690insT	uc001wuq.2	+						SIP1_uc001wur.2_Intron|SIP1_uc001wus.2_Intron|SIP1_uc010amx.2_Intron	NM_003616	NP_003607	O14893	GEMI2_HUMAN	SMN-interacting protein 1 isoform alpha						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	Cajal body|cytosol|spliceosomal complex	protein binding				0	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0121)		tttttcttttcttttttttttt	0.000													5	3	---	---	---	---	
NID2	22795	broad.mit.edu	37	14	52527098	52527098	+	Intron	DEL	G	-	-	rs975026		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52527098delG	uc001wzo.2	-						NID2_uc010tqs.1_Intron|NID2_uc010tqt.1_Intron|NID2_uc001wzp.2_Intron	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor							basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					aaaaaaaaaagagagagagag	0.303													6	4	---	---	---	---	
ZC3H14	79882	broad.mit.edu	37	14	89074206	89074206	+	Intron	DEL	T	-	-	rs67044102		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89074206delT	uc001xww.2	+						ZC3H14_uc010twd.1_Intron|ZC3H14_uc010twe.1_Intron|ZC3H14_uc001xwx.2_Intron|ZC3H14_uc010twf.1_Intron|ZC3H14_uc001xwy.2_Intron|ZC3H14_uc010twg.1_Intron|ZC3H14_uc001xxa.2_Intron|ZC3H14_uc001xxc.2_Intron|ZC3H14_uc001xxb.2_Intron	NM_024824	NP_079100	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14 isoform 1							cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3						TACCATCCCCTATCTCACCCT	0.562													4	4	---	---	---	---	
KLC1	3831	broad.mit.edu	37	14	104053826	104053827	+	Intron	INS	-	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104053826_104053827insT	uc010tyd.1	+						C14orf153_uc001ynl.3_Intron|C14orf153_uc010tyc.1_Intron	NM_005552	NP_005543	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 1						blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				ACTTTATCAACttttttttttc	0.163													5	3	---	---	---	---	
NR2F2	7026	broad.mit.edu	37	15	96881005	96881005	+	3'UTR	DEL	A	-	-	rs34678417		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96881005delA	uc010uri.1	+	3					NR2F2_uc002btp.2_3'UTR|NR2F2_uc010urj.1_3'UTR|NR2F2_uc010urk.1_3'UTR	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			TGTGAATTTCAAAAAAAAAAA	0.289													3	3	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600679	600679	+	Intron	DEL	C	-	-	rs113741614		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600679delC	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				TCGGTGAGGGCCCCCAGTCGG	0.716													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33938198	33938198	+	IGR	DEL	G	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33938198delG								None (None upstream) : MIR1826 (27310 downstream)																							TCCCAACCCCGCGTCCTAAAG	0.607													4	2	---	---	---	---	
GCSH	2653	broad.mit.edu	37	16	81121101	81121102	+	Intron	INS	-	A	A	rs8177911		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81121101_81121102insA	uc002fgd.2	-						GCSH_uc002fge.2_Intron	NM_004483	NP_004474	P23434	GCSH_HUMAN	glycine cleavage system protein H (aminomethyl							glycine cleavage complex|mitochondrion	aminomethyltransferase activity				0					Glycine(DB00145)	agactgtctccaaaaaaaaaaa	0.144													9	4	---	---	---	---	
ACSF3	197322	broad.mit.edu	37	16	89178819	89178820	+	Intron	DEL	TC	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89178819_89178820delTC	uc002fmp.2	+						ACSF3_uc010cig.1_Intron|ACSF3_uc010cih.1_Intron|ACSF3_uc002fmq.1_Intron|ACSF3_uc010cii.1_Intron|ACSF3_uc002fmr.1_Intron	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor						fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)		tctctaactgtctctctctctc	0.203													4	2	---	---	---	---	
ALDH3A1	218	broad.mit.edu	37	17	19643966	19643966	+	Intron	DEL	T	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19643966delT	uc010cqu.2	-						ALDH3A1_uc010vzd.1_Intron|ALDH3A1_uc002gwj.2_Intron|ALDH3A1_uc010cqv.2_Intron|ALDH3A1_uc002gwk.2_Intron|ALDH3A1_uc002gwl.1_Intron	NM_001135168	NP_001128640	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3A1						cellular aldehyde metabolic process	cytosol|endoplasmic reticulum	alcohol dehydrogenase (NADP+) activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(1)|pancreas(1)	2	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)	NADH(DB00157)	gtgcattatcttttttttttc	0.000													4	2	---	---	---	---	
SNX11	29916	broad.mit.edu	37	17	46190910	46190911	+	Intron	INS	-	T	T			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46190910_46190911insT	uc002inf.1	+						SNX11_uc010wlg.1_Intron|SNX11_uc010wlh.1_Intron|SNX11_uc010wli.1_Intron|SNX11_uc010wlj.1_Intron|SNX11_uc002ing.1_Intron|SNX11_uc002inh.1_Intron	NM_152244	NP_689450	Q9Y5W9	SNX11_HUMAN	sorting nexin 11						cell communication|protein transport	membrane	phosphatidylinositol binding				0						tgttttttgggttttttttttt	0.168													6	4	---	---	---	---	
SLC35B1	10237	broad.mit.edu	37	17	47783728	47783728	+	Intron	DEL	G	-	-	rs138147992		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47783728delG	uc002iph.1	-						SLC35B1_uc002ipi.1_Intron|SLC35B1_uc002ipj.1_Intron|SLC35B1_uc010wly.1_Intron	NM_005827	NP_005818	P78383	S35B1_HUMAN	solute carrier family 35, member B1							endoplasmic reticulum membrane|integral to membrane|microsome	UDP-galactose transmembrane transporter activity				0						aaaaaaaaaagaaaagaaaag	0.378													5	3	---	---	---	---	
SEPT4	5414	broad.mit.edu	37	17	56603935	56603938	+	Intron	DEL	ACAC	-	-	rs112819371		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56603935_56603938delACAC	uc002iwm.1	-						SEPT4_uc002iwk.1_Intron|SEPT4_uc010wnw.1_Intron|SEPT4_uc002iwl.1_5'UTR|SEPT4_uc002iwn.1_Intron|SEPT4_uc002iwo.1_Intron|SEPT4_uc002iwp.1_Intron|SEPT4_uc010wnx.1_Intron|SEPT4_uc010wny.1_Intron|SEPT4_uc010dcy.1_Intron	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1						apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					acacacacaaacacacacacacac	0.422													4	2	---	---	---	---	
TTC39C	125488	broad.mit.edu	37	18	21711677	21711677	+	Intron	DEL	A	-	-	rs141365091		TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21711677delA	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1						actccatctcaaaaaaaaaaa	0.129													6	3	---	---	---	---	
POLR3F	10621	broad.mit.edu	37	20	18462626	18462627	+	Intron	DEL	AC	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18462626_18462627delAC	uc002wqv.2	+						POLR3F_uc002wqw.2_Intron|POLR3F_uc002wqx.2_Intron	NM_006466	NP_006457	Q9H1D9	RPC6_HUMAN	DNA-directed RNA polymerase III 39 kDa						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|protein binding				0						TCATTCCTTTACtttttttttt	0.213													4	3	---	---	---	---	
SHROOM4	57477	broad.mit.edu	37	X	50378780	50378781	+	Intron	DEL	AA	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378780_50378781delAA	uc004dpe.2	-						SHROOM4_uc004dpd.3_Intron|SHROOM4_uc004dpf.1_Intron	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4						actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					GAGGGTAGGCAAAAAAAAAAAA	0.485													4	2	---	---	---	---	
ACRC	93953	broad.mit.edu	37	X	70812215	70812215	+	Intron	DEL	T	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70812215delT	uc004eae.2	+						BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein							nucleus				ovary(3)	3	Renal(35;0.156)					ACTTTCCTCCTTTTTTTTTGG	0.398													4	2	---	---	---	---	
UBE2A	7319	broad.mit.edu	37	X	118716913	118716913	+	Intron	DEL	A	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118716913delA	uc004erl.2	+						UBE2A_uc004erm.2_Intron|UBE2A_uc004ern.2_Intron|UBE2A_uc004ero.2_Intron|UBE2A_uc004erp.2_Intron	NM_003336	NP_003327	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A isoform 1						histone H2A ubiquitination|positive regulation of cell proliferation|postreplication repair|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|response to UV|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						cttctcccttaaaaaaaaaaa	0.169								Direct_reversal_of_damage|Rad6_pathway					4	2	---	---	---	---	
SPANXC	64663	broad.mit.edu	37	X	140357858	140357858	+	Intron	DEL	T	-	-			TCGA-C5-A1MK-01	TCGA-C5-A1MK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140357858delT	uc004fbl.2	-									Q9NY87	SPNXC_HUMAN	Homo sapiens nuclear-associated protein SPAN-Xa (SPANX) mRNA, complete cds.							cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)					tctctttttcttttttttttc	0.368													11	7	---	---	---	---	
