Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PTCHD2	57540	broad.mit.edu	37	1	11575526	11575526	+	Silent	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11575526G>C	uc001ash.3	+	5	1692	c.1554G>C	c.(1552-1554)CTG>CTC	p.L518L	PTCHD2_uc001asi.1_Silent_p.L518L	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	518	Helical; (Potential).|SSD.				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGGGCATCCTGAATGGGGTGG	0.577													20	41	---	---	---	---	PASS
PRAMEF4	400735	broad.mit.edu	37	1	12941851	12941851	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12941851C>T	uc001aun.2	-	3	770	c.699G>A	c.(697-699)ATG>ATA	p.M233I		NM_001009611	NP_001009611	O60810	PRAM4_HUMAN	PRAME family member 4	233										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGATTCCTCATGTGGCCCA	0.493													62	277	---	---	---	---	PASS
TMCO2	127391	broad.mit.edu	37	1	40717196	40717196	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40717196C>G	uc001cfe.2	+	2	572	c.479C>G	c.(478-480)TCT>TGT	p.S160C		NM_001008740	NP_001008740	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	160						integral to membrane				ovary(1)	1	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			GATTGCTCCTCTGAGCCCTAC	0.443													17	50	---	---	---	---	PASS
WDR78	79819	broad.mit.edu	37	1	67359062	67359062	+	Missense_Mutation	SNP	C	T	T	rs146236465		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67359062C>T	uc001dcx.2	-	3	436	c.380G>A	c.(379-381)CGA>CAA	p.R127Q	WDR78_uc001dcy.2_Missense_Mutation_p.R127Q|WDR78_uc001dcz.2_Missense_Mutation_p.R127Q|WDR78_uc009wax.2_5'Flank	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	127										ovary(2)	2						GTAAAGAGGTCGGGGAGTAAC	0.348													42	96	---	---	---	---	PASS
VPS72	6944	broad.mit.edu	37	1	151149168	151149168	+	Silent	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151149168G>T	uc001exe.1	-	6	1090	c.1047C>A	c.(1045-1047)CTC>CTA	p.L349L	TMOD4_uc001exd.2_5'Flank|TMOD4_uc001exc.3_5'Flank|TMOD4_uc010pct.1_5'Flank	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1	349	Poly-Pro.|Pro-rich.				chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGAGCCAGGGAGGGGCTCAG	0.572													66	102	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155753850	155753850	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155753850C>A	uc001flz.2	-	14	1916	c.1819G>T	c.(1819-1821)GAA>TAA	p.E607*	GON4L_uc001fly.1_Nonsense_Mutation_p.E607*|GON4L_uc009wrh.1_Nonsense_Mutation_p.E607*|GON4L_uc001fma.1_Nonsense_Mutation_p.E607*|GON4L_uc001fmc.2_Nonsense_Mutation_p.E607*|GON4L_uc001fmd.3_Nonsense_Mutation_p.E607*|GON4L_uc009wri.2_Nonsense_Mutation_p.E193*|GON4L_uc009wrj.1_Nonsense_Mutation_p.E122*|GON4L_uc001fme.2_Nonsense_Mutation_p.E435*	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	607					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCATCATCTTCCATGTTGGAG	0.502													29	54	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155755146	155755146	+	Silent	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155755146C>T	uc001flz.2	-	13	1864	c.1767G>A	c.(1765-1767)CTG>CTA	p.L589L	GON4L_uc001fly.1_Silent_p.L589L|GON4L_uc009wrh.1_Silent_p.L589L|GON4L_uc001fma.1_Silent_p.L589L|GON4L_uc001fmc.2_Silent_p.L589L|GON4L_uc001fmd.3_Silent_p.L589L|GON4L_uc009wri.2_Silent_p.L175L|GON4L_uc009wrj.1_Silent_p.L104L|GON4L_uc001fme.2_Silent_p.L417L|GON4L_uc001fmf.2_Silent_p.L283L	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	589					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GCTCTTCCATCAGCTCATTTA	0.328													43	97	---	---	---	---	PASS
RIT1	6016	broad.mit.edu	37	1	155874261	155874261	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155874261C>T	uc001fmh.1	-	5	457	c.270G>A	c.(268-270)ATG>ATA	p.M90I	RIT1_uc010pgr.1_Missense_Mutation_p.M54I	NM_006912	NP_008843	Q92963	RIT1_HUMAN	Ras-like without CAAX 1	90					nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			breast(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			CTCCTGCCCTCATATACTGGT	0.433													13	33	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223116341	223116341	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223116341A>G	uc001hnu.1	+	2	323	c.176A>G	c.(175-177)AAT>AGT	p.N59S		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	59					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		CTGCAACTTAATGGCACGGTC	0.498													43	47	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27465560	27465560	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27465560G>A	uc002rji.2	+	41	6457	c.6295G>A	c.(6295-6297)GTC>ATC	p.V2099I	CAD_uc010eyw.2_Missense_Mutation_p.V2036I	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	2099	ATCase (Aspartate transcarbamylase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CCAGTATCGTGTCAGCCTGCG	0.642													34	39	---	---	---	---	PASS
HOXD4	3233	broad.mit.edu	37	2	177017631	177017631	+	Silent	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177017631G>A	uc002uks.2	+	2	978	c.729G>A	c.(727-729)CCG>CCA	p.P243P		NM_014621	NP_055436	P09016	HXD4_HUMAN	homeobox D4	243						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		ATTTACAGCCGATGGCCAAAG	0.582													39	50	---	---	---	---	PASS
SMARCC1	6599	broad.mit.edu	37	3	47755907	47755907	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47755907T>G	uc003crq.2	-	8	908	c.790A>C	c.(790-792)AAG>CAG	p.K264Q	SMARCC1_uc011bbd.1_Missense_Mutation_p.K155Q	NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated	264					chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		TCATTTACCTTCCATGGTTTT	0.209													3	42	---	---	---	---	PASS
MST1	4485	broad.mit.edu	37	3	49723542	49723542	+	Missense_Mutation	SNP	G	C	C	rs2087732		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49723542G>C	uc003cxg.2	-	9	1172	c.1100C>G	c.(1099-1101)GCC>GGC	p.A367G	MST1_uc011bcs.1_Missense_Mutation_p.P406A|MST1_uc010hkx.2_3'UTR|MST1_uc011bct.1_3'UTR	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	353	Kringle 3.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GTAGCAAAAGGCCGCGCGCAT	0.672													3	4	---	---	---	---	PASS
RFT1	91869	broad.mit.edu	37	3	53140827	53140827	+	Intron	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53140827C>T	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN	RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		TACAGAATTTCATCTTACCCT	0.289													15	3	---	---	---	---	PASS
FRMD4B	23150	broad.mit.edu	37	3	69336920	69336920	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69336920T>C	uc003dnv.2	-	5	774	c.484A>G	c.(484-486)AAG>GAG	p.K162E	FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnx.1_Missense_Mutation_p.K108E|FRMD4B_uc003dny.2_Missense_Mutation_p.K162E	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	162	FERM.					cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		ACACAGGCCTTTGCATTCAGG	0.458													8	1	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	122003151	122003151	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122003151G>T	uc003eev.3	+	7	2722	c.2350G>T	c.(2350-2352)GCT>TCT	p.A784S	CASR_uc003eew.3_Missense_Mutation_p.A794S	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	784	Helical; Name=5; (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CTGCCTGCTGGCTGCCATCTG	0.552													19	16	---	---	---	---	PASS
PLSCR4	57088	broad.mit.edu	37	3	145913067	145913067	+	Silent	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145913067G>C	uc010huy.2	-	8	1118	c.789C>G	c.(787-789)GTC>GTG	p.V263V	PLSCR4_uc010huz.2_Silent_p.V263V|PLSCR4_uc003evt.3_Silent_p.V263V|PLSCR4_uc010hva.2_Silent_p.V173V|PLSCR4_uc003evu.3_Silent_p.V158V	NM_001128305	NP_001121777	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4 isoform a	263	Cytoplasmic (By similarity).				blood coagulation|phospholipid scrambling	integral to membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding				0						CAAGGGATTTGACCTGGAATG	0.383													23	52	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167051706	167051706	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167051706T>C	uc003fep.2	-	10	919	c.596A>G	c.(595-597)GAT>GGT	p.D199G	ZBBX_uc011bpc.1_Missense_Mutation_p.D199G|ZBBX_uc003feq.2_Missense_Mutation_p.D170G	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	199						intracellular	zinc ion binding			ovary(2)	2						TTTGGGTTCATCTGGATTAAC	0.338													11	338	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			45	188	---	---	---	---	PASS
ETV5	2119	broad.mit.edu	37	3	185783591	185783591	+	Intron	SNP	T	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185783591T>A	uc003fpz.2	-						ETV5_uc003fpy.2_Intron	NM_004454	NP_004445	P41161	ETV5_HUMAN	ets variant gene 5 (ets-related molecule)						cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|skin(2)|breast(1)	5	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			ATAGCACAATTTGATGCTGAC	0.478			T	TMPRSS2|SCL45A3	Prostate 								37	388	---	---	---	---	PASS
FETUB	26998	broad.mit.edu	37	3	186364037	186364037	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186364037T>A	uc010hyq.2	+	6	856	c.595T>A	c.(595-597)TGG>AGG	p.W199R	FETUB_uc011brz.1_Missense_Mutation_p.W51R|FETUB_uc003fqn.2_Missense_Mutation_p.W199R|FETUB_uc003fqo.2_Missense_Mutation_p.W94R|FETUB_uc010hyr.2_Missense_Mutation_p.W162R|FETUB_uc010hys.2_Missense_Mutation_p.W51R|FETUB_uc003fqp.3_Missense_Mutation_p.W134R	NM_014375	NP_055190	Q9UGM5	FETUB_HUMAN	fetuin B precursor	199	Cystatin fetuin-B-type 2.					extracellular space	cysteine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		CTCATAACAGTGGGTGGTCGG	0.423													19	406	---	---	---	---	PASS
UTS2D	257313	broad.mit.edu	37	3	190999976	190999976	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190999976C>T	uc003fsu.2	-	5	790	c.3G>A	c.(1-3)ATG>ATA	p.M1I		NM_198152	NP_937795	Q765I0	UTS2B_HUMAN	urotensin 2 domain containing precursor	1						extracellular region	hormone activity				0	all_cancers(143;1.77e-09)|Ovarian(172;0.103)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000214)		GGATCTTGTTCATGTTAAAAA	0.383													22	80	---	---	---	---	PASS
ELMOD2	255520	broad.mit.edu	37	4	141446613	141446613	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141446613G>T	uc003iik.2	+	2	123	c.31G>T	c.(31-33)GGG>TGG	p.G11W		NM_153702	NP_714913	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	11					phagocytosis|regulation of defense response to virus|response to virus	cytoskeleton	GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)					GTTCTTCTATGGGCACTTTTT	0.353													13	82	---	---	---	---	PASS
ELMOD2	255520	broad.mit.edu	37	4	141446614	141446614	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141446614G>T	uc003iik.2	+	2	124	c.32G>T	c.(31-33)GGG>GTG	p.G11V		NM_153702	NP_714913	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	11					phagocytosis|regulation of defense response to virus|response to virus	cytoskeleton	GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)					TTCTTCTATGGGCACTTTTTT	0.353													13	81	---	---	---	---	PASS
HPGD	3248	broad.mit.edu	37	4	175414436	175414436	+	Silent	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175414436C>T	uc003itu.2	-	6	718	c.528G>A	c.(526-528)GTG>GTA	p.V176V	HPGD_uc003itt.2_Silent_p.V43V|HPGD_uc003itv.2_Intron|HPGD_uc011ckf.1_Silent_p.V55V|HPGD_uc010irp.2_Silent_p.V55V|HPGD_uc010irq.2_Intron|HPGD_uc011ckg.1_Silent_p.V108V|HPGD_uc011ckh.1_Silent_p.V55V	NM_000860	NP_000851	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	176					female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity				0		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	NADH(DB00157)	CATTCAGTCTCACACCACTGT	0.363													12	34	---	---	---	---	PASS
TMEM174	134288	broad.mit.edu	37	5	72469967	72469967	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72469967A>G	uc010izc.2	+	2	755	c.707A>G	c.(706-708)GAA>GGA	p.E236G		NM_153217	NP_694949	Q8WUU8	TM174_HUMAN	transmembrane protein 174	236						integral to membrane				ovary(1)	1		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		CCCCCTTATGAAGAAATATAC	0.483													19	61	---	---	---	---	PASS
HSD17B4	3295	broad.mit.edu	37	5	118844859	118844859	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118844859C>T	uc003ksj.2	+	16	1480	c.1357C>T	c.(1357-1359)CTT>TTT	p.L453F	HSD17B4_uc011cwg.1_Missense_Mutation_p.L429F|HSD17B4_uc011cwh.1_Missense_Mutation_p.L435F|HSD17B4_uc011cwi.1_Missense_Mutation_p.L478F|HSD17B4_uc003ksk.3_Missense_Mutation_p.L306F|HSD17B4_uc011cwj.1_Missense_Mutation_p.L306F|HSD17B4_uc010jcn.1_Missense_Mutation_p.L191F	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	453	Enoyl-CoA hydratase 2.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	TGAGAAGGAACTTATATGCCA	0.363													19	107	---	---	---	---	PASS
PCDHAC1	56135	broad.mit.edu	37	5	140308267	140308267	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140308267C>T	uc003lih.2	+	1	1966	c.1790C>T	c.(1789-1791)TCC>TTC	p.S597F	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Missense_Mutation_p.S597F	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	597	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTGGCTTTCCTACCACATC	0.512													33	75	---	---	---	---	PASS
ATP10B	23120	broad.mit.edu	37	5	160071195	160071195	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160071195C>A	uc003lym.1	-	9	1665	c.818G>T	c.(817-819)GGC>GTC	p.G273V	ATP10B_uc003lyp.2_Missense_Mutation_p.G273V|ATP10B_uc011deg.1_Missense_Mutation_p.G317V|ATP10B_uc003lyo.2_Missense_Mutation_p.G245V	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	273	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GATGGTGCAGCCTCGAAGCAG	0.498													38	17	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180056292	180056292	+	Nonsense_Mutation	SNP	G	A	A	rs146006663		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180056292G>A	uc003mma.3	-	7	1031	c.952C>T	c.(952-954)CGA>TGA	p.R318*	FLT4_uc003mlz.3_Nonsense_Mutation_p.R318*|FLT4_uc003mmb.1_5'UTR|FLT4_uc011dgy.1_Nonsense_Mutation_p.R318*|FLT4_uc011dgz.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	318	Ig-like C2-type 3.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	TCCCGAAATCGCTGGATGCCG	0.607									Congenital_Hereditary_Lymphedema				15	37	---	---	---	---	PASS
GMPR	2766	broad.mit.edu	37	6	16295255	16295255	+	Silent	SNP	T	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16295255T>G	uc003nbs.2	+	9	990	c.876T>G	c.(874-876)ACT>ACG	p.T292T		NM_006877	NP_006868	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	292					nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				AGGGTAAGACTGTGGAAGTTC	0.502													42	22	---	---	---	---	PASS
KIFC1	3833	broad.mit.edu	37	6	33371529	33371529	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33371529G>T	uc003oef.3	+	6	829	c.379G>T	c.(379-381)GGA>TGA	p.G127*	KIFC1_uc011drf.1_Splice_Site_p.R119_splice	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1	127					blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0						TCCCATGGCAGGAGGGAAGAA	0.493													24	41	---	---	---	---	PASS
KIFC1	3833	broad.mit.edu	37	6	33371530	33371530	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33371530G>A	uc003oef.3	+	6	830	c.380G>A	c.(379-381)GGA>GAA	p.G127E	KIFC1_uc011drf.1_Missense_Mutation_p.R119K	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1	127					blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0						CCCATGGCAGGAGGGAAGAAA	0.498													24	41	---	---	---	---	PASS
BTBD9	114781	broad.mit.edu	37	6	38560593	38560593	+	Silent	SNP	T	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38560593T>C	uc003ooa.3	-	5	1149	c.573A>G	c.(571-573)TTA>TTG	p.L191L	BTBD9_uc003ony.3_Silent_p.L123L|BTBD9_uc010jwv.2_Silent_p.L123L|BTBD9_uc010jww.2_RNA|BTBD9_uc010jwx.2_Silent_p.L191L	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a	191	BACK.				cell adhesion						0						ATGAGTCTCTTAACACGATGT	0.373													24	37	---	---	---	---	PASS
C6orf108	10591	broad.mit.edu	37	6	43193806	43193806	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43193806C>T	uc003ouo.2	-	3	358	c.341G>A	c.(340-342)CGG>CAG	p.R114Q	C6orf108_uc003oup.2_Missense_Mutation_p.R114Q	NM_006443	NP_006434	O43598	RCL_HUMAN	putative c-Myc-responsive isoform 1	114					cell proliferation|deoxyribonucleoside monophosphate catabolic process|positive regulation of cell growth	cytoplasm|nucleus	deoxyribonucleoside 5'-monophosphate N-glycosidase activity|nucleoside deoxyribosyltransferase activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0123)|OV - Ovarian serous cystadenocarcinoma(102;0.0531)			GCACAGGATCCGCTTGTTAAA	0.632													19	15	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123319098	123319098	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123319098G>T	uc003pzi.1	+	2	1045	c.176G>T	c.(175-177)CGG>CTG	p.R59L		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	59					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CGCTTCTTGCGGGCTAGGAAG	0.547													4	137	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152716799	152716799	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152716799C>T	uc010kiw.2	-	51	8166	c.7564G>A	c.(7564-7566)GAT>AAT	p.D2522N	SYNE1_uc003qot.3_Missense_Mutation_p.D2529N|SYNE1_uc003qou.3_Missense_Mutation_p.D2522N|SYNE1_uc010kjb.1_Missense_Mutation_p.D2505N	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2522	Cytoplasmic (Potential).|Spectrin 5.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGTGCTGATCTTCAAAGCTA	0.348										HNSCC(10;0.0054)			68	30	---	---	---	---	PASS
ELMO1	9844	broad.mit.edu	37	7	36910022	36910022	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36910022C>G	uc003tfk.1	-	20	2188	c.1881G>C	c.(1879-1881)GAG>GAC	p.E627D	ELMO1_uc003tfi.1_Missense_Mutation_p.E147D|ELMO1_uc003tfj.1_Missense_Mutation_p.E147D|ELMO1_uc011kbb.1_RNA|ELMO1_uc011kbc.1_Missense_Mutation_p.E531D|ELMO1_uc010kxg.1_Missense_Mutation_p.E627D	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	627	PH.				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						GGGCACCTTTCTCTTTCATAT	0.458													35	46	---	---	---	---	PASS
CYP3A43	64816	broad.mit.edu	37	7	99445165	99445165	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99445165G>A	uc003urx.1	+	5	476	c.373G>A	c.(373-375)GAA>AAA	p.E125K	CYP3A43_uc003ury.1_Missense_Mutation_p.E125K|CYP3A43_uc003urz.1_Missense_Mutation_p.E125K|CYP3A43_uc003usa.1_RNA|CYP3A43_uc010lgi.1_Intron|CYP3A43_uc003usb.1_5'UTR	NM_057095	NP_476436	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A,	125			Missing (in allele CYP3A43*2).		xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)|skin(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Cetirizine(DB00341)|Doxycycline(DB00254)	TGAAGATGAAGAATGGAAGAG	0.353													38	57	---	---	---	---	PASS
ZKSCAN1	7586	broad.mit.edu	37	7	99627904	99627904	+	Silent	SNP	C	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99627904C>A	uc003usk.1	+	5	924	c.705C>A	c.(703-705)TCC>TCA	p.S235S	ZKSCAN1_uc003usl.1_Silent_p.S199S|ZKSCAN1_uc003usm.1_Silent_p.S22S	NM_003439	NP_003430	P17029	ZKSC1_HUMAN	zinc finger protein 36	235	KRAB.				viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TGGCTGTGTCCCTCATTCTGG	0.502													3	37	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142575713	142575713	+	Silent	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142575713G>C	uc003wbx.1	-	2	411	c.195C>G	c.(193-195)CTC>CTG	p.L65L	TRPV6_uc003wbw.1_5'Flank|TRPV6_uc010lou.1_5'UTR	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	65	ANK 1.|Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CCTCATACTTGAGCAACTTGT	0.517													19	33	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25198414	25198414	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25198414T>A	uc003xeg.2	+	23	2486	c.2349T>A	c.(2347-2349)GAT>GAA	p.D783E	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.D497E|DOCK5_uc003xei.2_Missense_Mutation_p.D353E|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	783						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGAGCAAAGATGGAGATGAGT	0.388													9	10	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116617063	116617063	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116617063G>A	uc003ynz.2	-	3	1553	c.1094C>T	c.(1093-1095)TCT>TTT	p.S365F	TRPS1_uc011lhy.1_Missense_Mutation_p.S369F|TRPS1_uc003yny.2_Missense_Mutation_p.S378F|TRPS1_uc010mcy.2_Missense_Mutation_p.S365F	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	365					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GGAGGGGAGAGAAGCTTTTAT	0.413									Langer-Giedion_syndrome				17	48	---	---	---	---	PASS
IFNA4	3441	broad.mit.edu	37	9	21187444	21187444	+	Silent	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21187444G>A	uc003zon.2	-	1	155	c.87C>T	c.(85-87)ACC>ACT	p.T29T		NM_021068	NP_066546	P05014	IFNA4_HUMAN	interferon, alpha 4 precursor	29					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CCAGGCTGTGGGTCTGAGGCA	0.512													3	59	---	---	---	---	PASS
ROR2	4920	broad.mit.edu	37	9	94495419	94495419	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94495419C>T	uc004arj.1	-	6	1121	c.922G>A	c.(922-924)GAG>AAG	p.E308K	ROR2_uc004ari.1_Missense_Mutation_p.E168K|ROR2_uc004ark.2_Missense_Mutation_p.E308K	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	308	Extracellular (Potential).				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						CCCAGCCTCTCGGCTGGGATG	0.687													9	1	---	---	---	---	PASS
SLC34A3	142680	broad.mit.edu	37	9	140126613	140126613	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140126613G>A	uc004cmf.1	+	3	361	c.175G>A	c.(175-177)GAG>AAG	p.E59K	SLC34A3_uc004cmc.1_5'UTR|SLC34A3_uc004cmd.1_Missense_Mutation_p.E59K|SLC34A3_uc011met.1_Missense_Mutation_p.E59K	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	59	Cytoplasmic (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GCCCTGGAAAGGTGGGTCTGG	0.647													10	79	---	---	---	---	PASS
LIPA	3988	broad.mit.edu	37	10	90984904	90984904	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90984904G>A	uc001kga.3	-	6	788	c.620C>T	c.(619-621)GCC>GTC	p.A207V	LIPA_uc001kgb.3_Missense_Mutation_p.A151V|LIPA_uc001kgc.3_Missense_Mutation_p.A209V|LIPA_uc010qnf.1_Missense_Mutation_p.A12V|LIPA_uc009xtq.2_Missense_Mutation_p.A207V|LIPA_uc009xtr.1_5'Flank	NM_000235	NP_000226	P38571	LICH_HUMAN	lipase A precursor	207					lipid catabolic process	lysosome	lipase activity|sterol esterase activity				0		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		AGTACAGAAGGCGACGGAAGC	0.478													119	33	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112349666	112349666	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112349666G>A	uc001kze.2	+	15	1552	c.1426G>A	c.(1426-1428)GAG>AAG	p.E476K		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	476	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GTGGAGAGAAGAGAATGCAGA	0.358													27	15	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904865	55904865	+	Silent	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904865C>T	uc010riz.1	-	1	330	c.330G>A	c.(328-330)TCG>TCA	p.S110S		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	110	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					TCATTACCTCCGATACAATAA	0.478													22	87	---	---	---	---	PASS
FAM111A	63901	broad.mit.edu	37	11	58919992	58919992	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58919992C>A	uc010rkp.1	+	5	1078	c.851C>A	c.(850-852)TCA>TAA	p.S284*	FAM111A_uc010rkq.1_Nonsense_Mutation_p.S284*|FAM111A_uc010rkr.1_Nonsense_Mutation_p.S284*|FAM111A_uc001nno.2_Nonsense_Mutation_p.S284*|FAM111A_uc001nnp.2_Nonsense_Mutation_p.S284*|FAM111A_uc001nnq.2_Nonsense_Mutation_p.S284*	NM_001142521	NP_001135993	Q96PZ2	F111A_HUMAN	hypothetical protein LOC63901	284					proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_epithelial(135;0.139)				AATCCTGAGTCAGAGAAAAGA	0.413													24	27	---	---	---	---	PASS
RBM4	5936	broad.mit.edu	37	11	66411229	66411229	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66411229G>A	uc009yrj.2	+	3	1209	c.721G>A	c.(721-723)GTG>ATG	p.V241M	RBM4_uc009yrk.2_Missense_Mutation_p.V216M|RBM4_uc001oiw.1_Missense_Mutation_p.V241M|RBM4_uc001oix.1_Intron|RBM4_uc010rpj.1_Intron|RBM4_uc001oiy.1_Missense_Mutation_p.V241M|RBM4_uc001oiz.1_Missense_Mutation_p.V241M	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	241	Interaction with TNPO3.				circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		AGCTGCCTCCGTGTATAATTA	0.567													13	26	---	---	---	---	PASS
LRP5	4041	broad.mit.edu	37	11	68131409	68131409	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68131409T>A	uc001ont.2	+	4	956	c.881T>A	c.(880-882)TTC>TAC	p.F294Y	LRP5_uc009ysg.2_5'UTR	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	294	Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						CGGCAGCCTTTCTGTGAGTGC	0.358													11	10	---	---	---	---	PASS
LRRC32	2615	broad.mit.edu	37	11	76371805	76371805	+	Silent	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76371805G>T	uc001oxq.3	-	3	1075	c.832C>A	c.(832-834)CGG>AGG	p.R278R	LRRC32_uc001oxr.3_Silent_p.R278R|LRRC32_uc010rsf.1_Silent_p.R278R	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	278	LRR 10.|Extracellular (Potential).					integral to plasma membrane					0						GTGGGGAGCCGGATGAGGTTG	0.652													3	48	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49425644	49425644	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49425644G>A	uc001rta.3	-	39	12844	c.12844C>T	c.(12844-12846)CGA>TGA	p.R4282*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4282	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CCCTGAGGTCGAGGCCCTGCC	0.677			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			19	15	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49434415	49434415	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49434415G>A	uc001rta.3	-	31	7138	c.7138C>T	c.(7138-7140)CAG>TAG	p.Q2380*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2380	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AATGGGGGCTGAGCATATGGG	0.652			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			13	23	---	---	---	---	PASS
C1QL4	338761	broad.mit.edu	37	12	49729936	49729936	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49729936G>A	uc001rtz.1	-	1	1036	c.325C>T	c.(325-327)CGC>TGC	p.R109C		NM_001008223	NP_001008224	Q86Z23	C1QL4_HUMAN	complement component 1, q subcomponent-like 4	109	C1q.					collagen					0						AAAGCAATGCGAGGCACGTAG	0.731													7	9	---	---	---	---	PASS
KRT77	374454	broad.mit.edu	37	12	53088579	53088579	+	Intron	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53088579G>A	uc001saw.2	-						KRT77_uc009zmi.2_Intron	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN	keratin 77							keratin filament	structural molecule activity			ovary(1)	1						CAGCTCCTGCGAGGCATGGCG	0.592													5	43	---	---	---	---	PASS
ATP2B1	490	broad.mit.edu	37	12	90036009	90036009	+	Nonsense_Mutation	SNP	A	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90036009A>C	uc001tbh.2	-	2	513	c.332T>G	c.(331-333)TTA>TGA	p.L111*	ATP2B1_uc001tbg.2_Nonsense_Mutation_p.L111*	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b	111	Helical; (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						TAATATAATTAAAGTGACATC	0.353													12	315	---	---	---	---	PASS
CMKLR1	1240	broad.mit.edu	37	12	108685762	108685762	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108685762G>C	uc009zuw.2	-	3	1169	c.978C>G	c.(976-978)TTC>TTG	p.F326L	CMKLR1_uc001tmw.2_Missense_Mutation_p.F326L|CMKLR1_uc001tmv.2_Missense_Mutation_p.F324L|CMKLR1_uc009zuv.2_Missense_Mutation_p.F326L	NM_001142345	NP_001135817	Q99788	CML1_HUMAN	chemokine-like receptor 1 isoform a	326	Cytoplasmic (Potential).				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity			lung(3)|ovary(1)|pancreas(1)	5						GGGCCACCTTGAACTTCTTGA	0.507													32	33	---	---	---	---	PASS
OAS2	4939	broad.mit.edu	37	12	113442868	113442868	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113442868G>A	uc001tuj.2	+	7	1449	c.1309G>A	c.(1309-1311)GAA>AAA	p.E437K	OAS2_uc001tui.1_Missense_Mutation_p.E437K	NM_016817	NP_058197	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2 isoform 1	437	OAS domain 2.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(1)	1						GGAAATCCATGAACAGCTGAA	0.502													15	28	---	---	---	---	PASS
OAS2	4939	broad.mit.edu	37	12	113442910	113442910	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113442910G>C	uc001tuj.2	+	7	1491	c.1351G>C	c.(1351-1353)GAA>CAA	p.E451Q	OAS2_uc001tui.1_Missense_Mutation_p.E451Q	NM_016817	NP_058197	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2 isoform 1	451	OAS domain 2.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(1)	1						GGAGGAGCTTGAAGTCAGCTT	0.488													13	33	---	---	---	---	PASS
GJB2	2706	broad.mit.edu	37	13	20763590	20763590	+	Nonsense_Mutation	SNP	C	T	T	rs104894413		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20763590C>T	uc001umy.2	-	2	346	c.131G>A	c.(130-132)TGG>TAG	p.W44*		NM_004004	NP_003995	P29033	CXB2_HUMAN	gap junction protein beta 2	44	Extracellular (Potential).		W -> C (in DFNA3A).|W -> S (in DFNA3A; does not affect protein trafficking; affects the ability to form functional channels; dominant negative effect).		cell-cell signaling|cellular membrane organization|gap junction assembly|sensory perception of sound|transport	connexon complex|ER-Golgi intermediate compartment|integral to membrane					0		all_cancers(29;3.95e-22)|all_epithelial(30;2.36e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000435)|Epithelial(112;0.000722)|OV - Ovarian serous cystadenocarcinoma(117;0.0096)|Lung(94;0.0236)|LUSC - Lung squamous cell carcinoma(192;0.0738)		CTCATCTCCCCACACCTCCTT	0.542									Keratitis_Ichthyosis_and_Deafness_syndrome		OREG0022282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	70	---	---	---	---	PASS
NUPL1	9818	broad.mit.edu	37	13	25889520	25889520	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25889520G>C	uc001uqi.2	+	6	846	c.600G>C	c.(598-600)TTG>TTC	p.L200F	NUPL1_uc001uqg.1_Missense_Mutation_p.L200F|NUPL1_uc001uqj.2_Missense_Mutation_p.L188F	NM_014089	NP_054808	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1 isoform a	200	14 X 2 AA repeats of F-G.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		CTTTAGGGTTGACTTTGGGAA	0.373													152	194	---	---	---	---	PASS
OR4K14	122740	broad.mit.edu	37	14	20482425	20482425	+	Nonsense_Mutation	SNP	G	A	A	rs149149480	byFrequency	TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20482425G>A	uc010tky.1	-	1	928	c.928C>T	c.(928-930)CAA>TAA	p.Q310*		NM_001004712	NP_001004712	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K,	310	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GGATTTCATTGAAAAGTCACC	0.358													46	50	---	---	---	---	PASS
PRMT5	10419	broad.mit.edu	37	14	23394235	23394235	+	Silent	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23394235G>A	uc001whm.1	-	8	883	c.792C>T	c.(790-792)TTC>TTT	p.F264F	PRMT5_uc001whl.1_Silent_p.F247F|PRMT5_uc010akd.1_RNA|PRMT5_uc010tnf.1_Silent_p.F158F|PRMT5_uc010tng.1_Silent_p.F203F|PRMT5_uc010tnh.1_Silent_p.F220F|PRMT5_uc001whn.1_Silent_p.F93F	NM_006109	NP_006100	O14744	ANM5_HUMAN	protein arginine methyltransferase 5 isoform a	264					cell proliferation|histone H4-R3 methylation|ncRNA metabolic process|regulation of mitosis|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	histone-arginine N-methyltransferase activity|protein binding|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding			ovary(1)	1	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		CTGTGATGATGAACTGCACCT	0.473													10	121	---	---	---	---	PASS
CTAGE5	4253	broad.mit.edu	37	14	39764153	39764153	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39764153C>G	uc001wvg.3	+	8	928	c.592C>G	c.(592-594)CAA>GAA	p.Q198E	CTAGE5_uc010tqe.1_Missense_Mutation_p.Q160E|CTAGE5_uc001wuz.3_Missense_Mutation_p.Q186E|CTAGE5_uc001wuy.3_Missense_Mutation_p.Q118E|CTAGE5_uc001wvb.3_Missense_Mutation_p.Q169E|CTAGE5_uc001wvc.3_Missense_Mutation_p.Q143E|CTAGE5_uc001wva.3_Missense_Mutation_p.Q169E|CTAGE5_uc001wve.1_Missense_Mutation_p.Q174E|CTAGE5_uc001wvh.3_Missense_Mutation_p.Q198E|CTAGE5_uc001wvf.3_Missense_Mutation_p.Q123E|CTAGE5_uc001wvi.3_Missense_Mutation_p.Q203E|CTAGE5_uc010amz.2_5'UTR|CTAGE5_uc001wvj.3_Missense_Mutation_p.Q169E	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	198	Potential.			Q -> P (in Ref. 1; AAB86593).			enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		CAAGATATTTCAAATGAATGA	0.338													59	70	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59113479	59113479	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59113479A>G	uc001xdw.2	+	4	2302	c.2138A>G	c.(2137-2139)TAC>TGC	p.Y713C	DACT1_uc010trv.1_Missense_Mutation_p.Y432C|DACT1_uc001xdx.2_Missense_Mutation_p.Y676C|DACT1_uc010trw.1_Missense_Mutation_p.Y432C	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	713					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						CCTCTGCCCTACGCCAGCCCC	0.672													23	26	---	---	---	---	PASS
PPP4R4	57718	broad.mit.edu	37	14	94741747	94741747	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94741747C>T	uc001ycs.1	+	24	2640	c.2486C>T	c.(2485-2487)CCA>CTA	p.P829L		NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	829						cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						AGTAGCGTTCCATCTTCCTTT	0.433													8	143	---	---	---	---	PASS
ZNF839	55778	broad.mit.edu	37	14	102793113	102793113	+	Silent	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102793113G>A	uc001ylo.2	+	2	1082	c.732G>A	c.(730-732)ACG>ACA	p.T244T	ZNF839_uc010awk.1_Silent_p.T360T|ZNF839_uc001ylp.2_RNA|ZNF839_uc001ylq.1_Silent_p.T244T|ZNF839_uc001ylr.2_Silent_p.T244T	NM_018335	NP_060805	A8K0R7	ZN839_HUMAN	zinc finger protein 839	244						intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2						GGGGGTGCACGGAGGAAAGGA	0.632													6	7	---	---	---	---	PASS
C15orf2	23742	broad.mit.edu	37	15	24923096	24923096	+	Silent	SNP	C	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24923096C>A	uc001ywo.2	+	1	2556	c.2082C>A	c.(2080-2082)CCC>CCA	p.P694P		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	694					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CCAAACCTCCCATTGAAACCA	0.507													66	21	---	---	---	---	PASS
MFGE8	4240	broad.mit.edu	37	15	89450573	89450573	+	Silent	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89450573G>A	uc002bng.3	-	3	353	c.240C>T	c.(238-240)AAC>AAT	p.N80N	MFGE8_uc002bnf.3_5'UTR|MFGE8_uc002bnh.3_Silent_p.N80N|MFGE8_uc010bnn.2_Silent_p.N72N|MFGE8_uc010upq.1_Silent_p.N36N|MFGE8_uc010upr.1_Silent_p.N80N|MFGE8_uc010bno.2_Silent_p.N36N	NM_005928	NP_005919	Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein isoform a	80	F5/8 type C 1.				angiogenesis|cell adhesion|interspecies interaction between organisms|single fertilization					ovary(1)	1	Lung NSC(78;0.0392)|all_lung(78;0.077)					AGTTGGCAATGTTCCCATTCT	0.642													7	9	---	---	---	---	PASS
POLR3E	55718	broad.mit.edu	37	16	22334233	22334233	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22334233G>T	uc002dkk.2	+	14	1205	c.1049G>T	c.(1048-1050)TGC>TTC	p.C350F	POLR3E_uc002dkj.1_Missense_Mutation_p.C350F|POLR3E_uc002dkm.2_Missense_Mutation_p.C314F|POLR3E_uc010vbr.1_Missense_Mutation_p.C350F|POLR3E_uc002dkl.2_Missense_Mutation_p.C350F|POLR3E_uc010vbs.1_Missense_Mutation_p.C314F|POLR3E_uc010vbt.1_Missense_Mutation_p.C294F	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E	350					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		GAGGTGCTCTGCAGGGGCCGA	0.637													7	8	---	---	---	---	PASS
NXN	64359	broad.mit.edu	37	17	722672	722672	+	Intron	SNP	C	T	T	rs148834799	by1000genomes	TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:722672C>T	uc002fsa.2	-						NXN_uc002fsb.1_Missense_Mutation_p.R163H|NXN_uc010vqd.1_Intron|NXN_uc002frz.2_Intron|NXN_uc010vqe.1_Intron	NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		GGGCCTGGAGCGCCTACCTTG	0.577													24	25	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2139835	2139835	+	Silent	SNP	C	G	G	rs151227752		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2139835C>G	uc002fub.1	-	10	2875	c.2820G>C	c.(2818-2820)CTG>CTC	p.L940L	SMG6_uc010vqv.1_Silent_p.L32L|uc002fuc.1_5'Flank	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	940					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						TCATAAGCTGCAGCATGCGGG	0.468													37	44	---	---	---	---	PASS
CAMTA2	23125	broad.mit.edu	37	17	4883235	4883235	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4883235G>T	uc002gah.1	-	9	1490	c.1382C>A	c.(1381-1383)CCC>CAC	p.P461H	CAMTA2_uc010cku.1_Missense_Mutation_p.P484H|CAMTA2_uc002gag.1_Missense_Mutation_p.P460H|CAMTA2_uc002gai.1_Missense_Mutation_p.P463H|CAMTA2_uc010ckv.1_Missense_Mutation_p.P108H|CAMTA2_uc010vsu.1_Missense_Mutation_p.P274H	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	461					cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						tgaaggtatgggtggggCAGC	0.463													4	82	---	---	---	---	PASS
NCRNA00188	125144	broad.mit.edu	37	17	16342647	16342647	+	Silent	SNP	A	G	G	rs148434726		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16342647A>G	uc002gqc.2	+	1	347	c.192A>G	c.(190-192)ACA>ACG	p.T64T	NCRNA00188_uc010vwf.1_RNA|NCRNA00188_uc010vwg.1_RNA|NCRNA00188_uc010vwh.1_RNA|NCRNA00188_uc010cpd.2_RNA|NCRNA00188_uc002gqb.3_RNA|NCRNA00188_uc010vwi.1_RNA|NCRNA00188_uc010vwj.1_RNA|NCRNA00188_uc002gqa.3_RNA|NCRNA00188_uc010vwk.1_RNA|NCRNA00188_uc010vwl.1_RNA|NCRNA00188_uc010vwm.1_RNA|NCRNA00188_uc010vwn.1_RNA|NCRNA00188_uc010cpe.2_RNA|NCRNA00188_uc010vwo.1_RNA|NCRNA00188_uc010vwp.1_RNA|SNORD49B_uc010cpf.2_5'Flank|SNORD49A_uc010cpg.1_5'Flank|SNORD65_uc002gqf.1_5'Flank	NR_027667				RecName: Full=Putative uncharacterized protein C17orf45, mitochondrial; Flags: Precursor;												0						GTAGGGCCACATCTGCCAGAG	0.667													22	30	---	---	---	---	PASS
SREBF1	6720	broad.mit.edu	37	17	17719223	17719223	+	Silent	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17719223G>A	uc002gru.1	-	12	2528	c.2334C>T	c.(2332-2334)TCC>TCT	p.S778S	SREBF1_uc002grp.1_Silent_p.S397S|SREBF1_uc002grq.1_Silent_p.S297S|SREBF1_uc002grr.1_Silent_p.S524S|SREBF1_uc002grs.1_Silent_p.S754S|SREBF1_uc002grt.1_Silent_p.S808S|MIR33B_hsa-mir-33b|MI0003646_5'Flank	NM_004176	NP_004167	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription	778	Cytoplasmic (Potential).				cellular response to starvation|cholesterol metabolic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleus	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|sterol response element binding			skin(1)	1						TACTGAGCACGGACCAGTCCC	0.647													17	28	---	---	---	---	PASS
MFAP4	4239	broad.mit.edu	37	17	19288463	19288463	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19288463C>T	uc002gvt.2	-	5	494	c.469G>A	c.(469-471)GAG>AAG	p.E157K	MFAP4_uc002gvr.2_RNA|MFAP4_uc002gvs.2_Missense_Mutation_p.E181K	NM_002404	NP_002395	P55083	MFAP4_HUMAN	microfibrillar-associated protein 4 precursor	157	Fibrinogen C-terminal.				cell adhesion|signal transduction	microfibril	receptor binding				0	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CCATCCTCCTCTGCGCTGACC	0.572													44	36	---	---	---	---	PASS
GOSR2	9570	broad.mit.edu	37	17	45012390	45012390	+	Intron	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45012390C>T	uc002ila.2	+						GOSR2_uc010wkh.1_Intron|GOSR2_uc002iky.2_Intron|GOSR2_uc002ikz.2_Intron	NM_004287	NP_004278	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2 isoform A						cellular membrane fusion|ER to Golgi vesicle-mediated transport|protein transport	Golgi membrane|integral to membrane	transporter activity			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(9;0.102)			GTGTTTCTTTCACAGGACTCT	0.498													40	44	---	---	---	---	PASS
QRICH2	84074	broad.mit.edu	37	17	74288517	74288517	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74288517G>T	uc002jrd.1	-	4	1973	c.1793C>A	c.(1792-1794)CCT>CAT	p.P598H	QRICH2_uc010wsz.1_Missense_Mutation_p.P524H|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	598	Gln-rich.						protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						ATCTGCACCAGGTTGGACCAA	0.448													23	28	---	---	---	---	PASS
C17orf62	79415	broad.mit.edu	37	17	80402346	80402346	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80402346C>G	uc002kez.2	-	5	468	c.420G>C	c.(418-420)CAG>CAC	p.Q140H	C17orf62_uc002kex.2_5'UTR|C17orf62_uc002key.2_5'UTR|C17orf62_uc002kfa.2_Missense_Mutation_p.Q140H|C17orf62_uc010dir.2_Missense_Mutation_p.Q140H|C17orf62_uc002kfb.3_Missense_Mutation_p.Q140H|C17orf62_uc002kfc.3_Missense_Mutation_p.Q126H|C17orf62_uc002kfd.3_5'UTR|C17orf62_uc002kfe.3_5'UTR	NM_001100407	NP_001093877	Q9BQA9	CQ062_HUMAN	hypothetical protein LOC79415 isoform a	140						integral to membrane	protein binding				0	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TGACTGCACTCTGCGTGAGGG	0.622													25	28	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63526275	63526275	+	Missense_Mutation	SNP	C	T	T	rs141136047		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63526275C>T	uc002ljz.2	+	9	1812	c.1487C>T	c.(1486-1488)CCG>CTG	p.P496L	CDH7_uc002lka.2_Missense_Mutation_p.P496L|CDH7_uc002lkb.2_Missense_Mutation_p.P496L	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	496	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				AATGCCCAGCCGGGGCAGGTA	0.433													11	36	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67781755	67781755	+	Silent	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67781755G>A	uc002lkp.2	-	27	3677	c.3609C>T	c.(3607-3609)GTC>GTT	p.V1203V	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Silent_p.V291V	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	1203							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				GTTGTTGCCTGACAGCAGTCC	0.398													22	55	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9065853	9065853	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9065853G>C	uc002mkp.2	-	3	21797	c.21593C>G	c.(21592-21594)TCT>TGT	p.S7198C		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7200	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGCTAAGGCAGAGGAAGGGGA	0.493													78	54	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9067041	9067041	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9067041G>A	uc002mkp.2	-	3	20609	c.20405C>T	c.(20404-20406)TCC>TTC	p.S6802F		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6804	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAGGGAAGAGGAGAAGCTGGT	0.468													52	33	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9068288	9068288	+	Silent	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9068288G>C	uc002mkp.2	-	3	19362	c.19158C>G	c.(19156-19158)GTC>GTG	p.V6386V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6388	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTTTGTCAAAGACCGTGCTTG	0.463													37	22	---	---	---	---	PASS
ZNF563	147837	broad.mit.edu	37	19	12429781	12429781	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12429781C>T	uc002mtp.2	-	4	1296	c.1058G>A	c.(1057-1059)CGA>CAA	p.R353Q		NM_145276	NP_660319	Q8TA94	ZN563_HUMAN	zinc finger protein 563	353	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCATGATATCGAACTAAACT	0.413													31	96	---	---	---	---	PASS
ZNF443	10224	broad.mit.edu	37	19	12542024	12542024	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12542024G>A	uc002mtu.2	-	4	1160	c.962C>T	c.(961-963)TCC>TTC	p.S321F		NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	321	C2H2-type 7.				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						AAGGGAACCGGAAACACTGAA	0.433													47	127	---	---	---	---	PASS
SLC25A42	284439	broad.mit.edu	37	19	19221580	19221580	+	Silent	SNP	C	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19221580C>G	uc002nlf.1	+	8	1003	c.852C>G	c.(850-852)CTC>CTG	p.L284L		NM_178526	NP_848621	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	284	Solcar 3.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			TGCGCGGCCTCTACAAAGGCT	0.687													15	5	---	---	---	---	PASS
GATAD2A	54815	broad.mit.edu	37	19	19605195	19605195	+	Intron	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19605195C>T	uc010xqt.1	+						GATAD2A_uc010xqu.1_Intron|GATAD2A_uc010xqv.1_Intron|GATAD2A_uc010xqw.1_Intron	NM_017660	NP_060130	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A						DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CACTCCAGGTCAGTGTCCTTT	0.617													7	8	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39051944	39051944	+	Silent	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39051944C>T	uc002oit.2	+	90	12604	c.12474C>T	c.(12472-12474)CGC>CGT	p.R4158R	RYR1_uc002oiu.2_Silent_p.R4153R|RYR1_uc002oiv.1_Silent_p.R1067R	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	4158					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	ATGACCCTCGCCTGCACAACT	0.637													19	31	---	---	---	---	PASS
CCDC8	83987	broad.mit.edu	37	19	46915956	46915956	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46915956G>A	uc002pep.2	-	1	964	c.112C>T	c.(112-114)CGG>TGG	p.R38W		NM_032040	NP_114429	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	38						plasma membrane				ovary(3)	3				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		agccgctcccgaaattctgct	0.085													14	39	---	---	---	---	PASS
ENTPD6	955	broad.mit.edu	37	20	25203510	25203510	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25203510C>T	uc002wuj.2	+	12	1262	c.1082C>T	c.(1081-1083)TCA>TTA	p.S361L	ENTPD6_uc010zsz.1_Missense_Mutation_p.S143L|ENTPD6_uc002wum.2_Missense_Mutation_p.S344L|ENTPD6_uc010zta.1_Missense_Mutation_p.S361L|ENTPD6_uc002wun.2_Missense_Mutation_p.S327L|ENTPD6_uc002wuk.2_Missense_Mutation_p.S360L|ENTPD6_uc002wul.2_Missense_Mutation_p.S360L|ENTPD6_uc010ztb.1_Missense_Mutation_p.S333L|ENTPD6_uc010ztc.1_Missense_Mutation_p.S333L|ENTPD6_uc002wuo.2_Missense_Mutation_p.S113L|ENTPD6_uc010ztd.1_Missense_Mutation_p.S109L|ENTPD6_uc010gdk.1_RNA|ENTPD6_uc010gdl.1_RNA	NM_001247	NP_001238	O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6	361	Lumenal (Potential).					Golgi membrane|integral to membrane	nucleoside-diphosphatase activity				0						GCCAGAGTGTCAGAGGTCCTT	0.582													34	50	---	---	---	---	PASS
SNTA1	6640	broad.mit.edu	37	20	31996362	31996362	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31996362A>T	uc002wzd.1	-	8	1741	c.1469T>A	c.(1468-1470)ATC>AAC	p.I490N	SNTA1_uc010zuf.1_Missense_Mutation_p.I415N	NM_003098	NP_003089	Q13424	SNTA1_HUMAN	acidic alpha 1 syntrophin	490	Calmodulin-binding (By similarity).|SU.				muscle contraction	cell junction|cytoplasm|cytoskeleton|sarcolemma	actin binding|calmodulin binding			skin(1)	1						GAAGGAGTGGATGATGAAGAC	0.607													19	31	---	---	---	---	PASS
GDAP1L1	78997	broad.mit.edu	37	20	42907771	42907771	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42907771G>T	uc002xlq.2	+	6	1002	c.935G>T	c.(934-936)CGG>CTG	p.R312L	GDAP1L1_uc010zwl.1_Missense_Mutation_p.R331L|GDAP1L1_uc010zwm.1_Missense_Mutation_p.R254L|GDAP1L1_uc010zwn.1_Missense_Mutation_p.R120L	NM_024034	NP_076939	Q96MZ0	GD1L1_HUMAN	ganglioside-induced differentiation-associated	312	GST C-terminal.									large_intestine(1)	1		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TTTGCCTTCCGGAAAGTCCTG	0.592													3	77	---	---	---	---	PASS
MATN4	8785	broad.mit.edu	37	20	43929600	43929600	+	Silent	SNP	C	G	G			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43929600C>G	uc002xnn.2	-	6	1126	c.939G>C	c.(937-939)GTG>GTC	p.V313V	MATN4_uc002xno.2_Silent_p.V272V|MATN4_uc002xnp.2_Silent_p.V231V|MATN4_uc010zwr.1_Silent_p.V261V|MATN4_uc002xnr.1_Silent_p.V313V	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	354	EGF-like 4.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				GGCCCTCGCTCACACACTGGA	0.612											OREG0025977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	24	---	---	---	---	PASS
IFNAR1	3454	broad.mit.edu	37	21	34727805	34727805	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34727805G>A	uc002yrn.2	+	11	1771	c.1624G>A	c.(1624-1626)GAT>AAT	p.D542N	IFNAR1_uc011adv.1_Missense_Mutation_p.D473N	NM_000629	NP_000620	P17181	INAR1_HUMAN	interferon-alpha receptor 1 precursor	542	Cytoplasmic (Potential).				JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	integral to plasma membrane	type I interferon receptor activity			central_nervous_system(1)|skin(1)	2					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	TTCTAATGAAGATGAAAGCGA	0.348													39	59	---	---	---	---	PASS
XK	7504	broad.mit.edu	37	X	37587667	37587667	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37587667T>A	uc004ddq.2	+	3	1369	c.1287T>A	c.(1285-1287)AGT>AGA	p.S429R		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	429	Cytoplasmic (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)				GTAAAACAAGTCCTGAGCCTG	0.478													36	52	---	---	---	---	PASS
IGBP1	3476	broad.mit.edu	37	X	69353869	69353869	+	Silent	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69353869C>T	uc004dxv.2	+	1	571	c.72C>T	c.(70-72)GAC>GAT	p.D24D	IGBP1_uc004dxw.2_Silent_p.D24D	NM_001551	NP_001542	P78318	IGBP1_HUMAN	immunoglobulin binding protein 1	24					B cell activation|negative regulation of caspase activity|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|regulation of microtubule-based movement|response to interleukin-1|response to tumor necrosis factor|signal transduction	cytoplasm	protein phosphatase type 2A regulator activity			kidney(1)|pancreas(1)	2						AGTTACTGGACGAAGTAGAAG	0.572											OREG0019849	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	18	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73069529	73069529	+	RNA	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73069529G>A	uc004ebm.1	-	1		c.3060C>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						AGTCAGTACTGAAGATCAGCA	0.383													20	23	---	---	---	---	PASS
CYSLTR1	10800	broad.mit.edu	37	X	77529174	77529174	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77529174G>C	uc004edb.2	-	3	470	c.70C>G	c.(70-72)CAA>GAA	p.Q24E	CYSLTR1_uc010nma.2_Missense_Mutation_p.Q24E|CYSLTR1_uc010nmb.2_Missense_Mutation_p.Q24E	NM_006639	NP_006630	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	24	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|respiratory gaseous exchange	integral to plasma membrane|membrane fraction	leukotriene receptor activity			ovary(1)	1					Amlexanox(DB01025)|Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	GAATACACTTGATTGCGGAAG	0.418													40	61	---	---	---	---	PASS
TNMD	64102	broad.mit.edu	37	X	99854613	99854613	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99854613G>A	uc004efy.3	+	7	1079	c.853G>A	c.(853-855)GGC>AGC	p.G285S	TNMD_uc004efz.2_3'UTR	NM_022144	NP_071427	Q9H2S6	TNMD_HUMAN	tenomodulin	285	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1						ACCTTTACTAGGCTACTACCC	0.512													15	22	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101095751	101095751	+	Intron	SNP	C	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101095751C>T	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						TCTGGCTCCCCCTTCTCACCT	0.522													19	19	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122387320	122387320	+	Silent	SNP	G	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122387320G>A	uc004etq.3	+	4	728	c.435G>A	c.(433-435)TTG>TTA	p.L145L	GRIA3_uc004etr.3_Silent_p.L145L|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Silent_p.L129L	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	145	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	GCCCAGCCTTGAAGGGCGCTA	0.532													56	63	---	---	---	---	PASS
RER1	11079	broad.mit.edu	37	1	2333944	2333945	+	Intron	INS	-	C	C	rs146801696	by1000genomes	TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2333944_2333945insC	uc001aje.1	+						RER1_uc001ajf.1_Intron	NM_007033	NP_008964	O15258	RER1_HUMAN	RER1 retention in endoplasmic reticulum 1						retrograde vesicle-mediated transport, Golgi to ER	integral to Golgi membrane					0	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.28e-37)|OV - Ovarian serous cystadenocarcinoma(86;8.29e-23)|GBM - Glioblastoma multiforme(42;4.71e-08)|Colorectal(212;4.73e-05)|COAD - Colon adenocarcinoma(227;0.00021)|Kidney(185;0.00116)|BRCA - Breast invasive adenocarcinoma(365;0.00459)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0182)|Lung(427;0.204)		ACTGCTCCGTTCCCAGCACGGC	0.644													5	6	---	---	---	---	
RBP7	116362	broad.mit.edu	37	1	10068112	10068112	+	Intron	DEL	A	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10068112delA	uc001aqq.2	+						RBP7_uc009vms.2_Intron	NM_052960	NP_443192	Q96R05	RET7_HUMAN	retinol binding protein 7, cellular							cytoplasm	retinal binding|retinol binding|transporter activity				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	actccatctcaaaaaaaaaaa	0.189													4	2	---	---	---	---	
FRRS1	391059	broad.mit.edu	37	1	100181377	100181378	+	Intron	INS	-	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100181377_100181378insA	uc001dsh.1	-							NM_001013660	NP_001013682	Q6ZNA5	FRRS1_HUMAN	stromal cell derived factor receptor 2 homolog						electron transport chain|transport	integral to membrane	ferric-chelate reductase activity|metal ion binding			skin(1)	1		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		GTAGCCAGGTTAAGAAAAAAAA	0.366													4	2	---	---	---	---	
VTCN1	79679	broad.mit.edu	37	1	117699714	117699715	+	Intron	INS	-	AT	AT	rs145887761	by1000genomes	TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117699714_117699715insAT	uc001ehb.2	-						VTCN1_uc001ehc.2_Intron|VTCN1_uc009whf.1_Intron	NM_024626	NP_078902	Q7Z7D3	VTCN1_HUMAN	V-set domain containing T cell activation							integral to membrane|plasma membrane					0	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		CAATCATTTTGatatatatata	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152716737	152716738	+	IGR	INS	-	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152716737_152716738insT								C1orf68 (23833 upstream) : KPRP (13768 downstream)																							GCACTGATTTCTTTTTTTTTCT	0.416													3	6	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153790790	153790790	+	Intron	DEL	C	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790790delC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCAAGGttttctttttttttt	0.189													10	5	---	---	---	---	
TMEM183A	92703	broad.mit.edu	37	1	202991831	202991831	+	Intron	DEL	A	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202991831delA	uc001gyu.1	+						TMEM183A_uc001gyv.1_Intron|TMEM183A_uc001gyw.1_Intron|TMEM183A_uc001gyx.1_Intron|TMEM183A_uc001gyy.2_5'Flank	NM_001079809	NP_001073277	Q8IXX5	T183A_HUMAN	transmembrane protein 183B							integral to membrane					0			BRCA - Breast invasive adenocarcinoma(75;0.18)			gtcctttctcaaaaaaaaaaa	0.144													5	4	---	---	---	---	
NBAS	51594	broad.mit.edu	37	2	15678502	15678502	+	Intron	DEL	A	-	-	rs66736557		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15678502delA	uc002rcc.1	-						NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4						ATTATTTCTGAAAAAAAAATC	0.179													5	3	---	---	---	---	
PNO1	56902	broad.mit.edu	37	2	68388973	68388973	+	Intron	DEL	A	-	-	rs113134222		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68388973delA	uc002seh.2	+							NM_020143	NP_064528	Q9NRX1	PNO1_HUMAN	partner of NOB1							nucleolus	RNA binding				0						ATTAGGCATTAAAAAAAAAAA	0.169													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90447339	90447342	+	Intron	DEL	TCTA	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90447339_90447342delTCTA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GTTTGTTACCTCTATCTACTGTCT	0.353													4	2	---	---	---	---	
SEPT2	4735	broad.mit.edu	37	2	242265494	242265495	+	Frame_Shift_Ins	INS	-	A	A			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242265494_242265495insA	uc002wbc.2	+	4	517_518	c.96_97insA	c.(94-99)GTGAAAfs	p.V32fs	SEPT2_uc002wbd.2_Frame_Shift_Ins_p.V32fs|SEPT2_uc002wbf.2_Frame_Shift_Ins_p.V32fs|SEPT2_uc002wbg.2_Frame_Shift_Ins_p.V32fs|SEPT2_uc002wbh.2_Frame_Shift_Ins_p.V32fs|SEPT2_uc010zop.1_Frame_Shift_Ins_p.V67fs	NM_001008491	NP_001008491	Q15019	SEPT2_HUMAN	septin 2	32_33					cell division|mitosis	actin cytoskeleton|cleavage furrow|condensed chromosome kinetochore|midbody|nucleolus|septin complex|spindle	GTP binding			central_nervous_system(1)	1		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		GAAAATCAGTGAAAAAAGGTTT	0.366													43	30	---	---	---	---	
TMCC1	23023	broad.mit.edu	37	3	129370755	129370755	+	Intron	DEL	G	-	-	rs112117397		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129370755delG	uc003emz.3	-						TMCC1_uc003emy.3_Intron|TMCC1_uc011blc.1_Intron|TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1						TTATAAATATGCTGGAGCCTT	0.433													3	3	---	---	---	---	
COPB2	9276	broad.mit.edu	37	3	139086136	139086136	+	Intron	DEL	T	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139086136delT	uc003etf.3	-						COPB2_uc011bmv.1_Intron|COPB2_uc010hui.2_Intron	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						TTCCTTGGAAttttttttttt	0.149													4	3	---	---	---	---	
CCDC111	201973	broad.mit.edu	37	4	185613052	185613052	+	Intron	DEL	T	-	-	rs10567357		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185613052delT	uc003iwk.2	+						CCDC111_uc003iwj.2_Intron|CCDC111_uc003iwl.2_Intron|CCDC111_uc003iwm.2_Intron|CCDC111_uc003iwn.2_Intron	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111						DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)		aatacaaaccttttttttttt	0.025													5	3	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170610064	170610064	+	Intron	DEL	T	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170610064delT	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc003mbd.2_5'Flank|RANBP17_uc010jjs.2_5'Flank|RANBP17_uc003mbc.2_5'Flank	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGAAATTATATTTTTTTATAA	0.254			T	TRD@	ALL								1	6	---	---	---	---	
NSD1	64324	broad.mit.edu	37	5	176636530	176636530	+	Intron	DEL	A	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176636530delA	uc003mfr.3	+						NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_Intron	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		actctgtctcaaaaaaaaaaa	0.124			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180708698	180708699	+	IGR	INS	-	G	G	rs1815381		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180708698_180708699insG								TRIM52 (20579 upstream) : None (None downstream)																							gggcggtaggcgggggctggag	0.213													4	2	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29938364	29938366	+	Intron	DEL	AAT	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29938364_29938366delAAT	uc011dmb.1	+							NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						GGACACAGAGAATAATAATACTA	0.468													4	4	---	---	---	---	
SMPDL3A	10924	broad.mit.edu	37	6	123125129	123125130	+	Intron	INS	-	T	T	rs112270814		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123125129_123125130insT	uc003pzg.2	+						SMPDL3A_uc003pzh.2_Intron	NM_006714	NP_006705	Q92484	ASM3A_HUMAN	acid sphingomyelinase-like phosphodiesterase 3A						sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|protein binding|sphingomyelin phosphodiesterase activity				0				GBM - Glioblastoma multiforme(226;0.236)		GAttttctttcttttttttttt	0.129													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	9765988	9765988	+	IGR	DEL	T	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9765988delT								PER4 (90541 upstream) : None (None downstream)																							GCTCCCTCTGTTTTTCGCGCG	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142013698	142013699	+	Intron	DEL	CT	-	-	rs36111580		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013698_142013699delCT	uc011kro.1	+						uc011krp.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CTGAGTGTGACTCTGCCCCGTC	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49297743	49297743	+	IGR	DEL	A	-	-	rs140564135		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49297743delA								UBE2V2 (323291 upstream) : EFCAB1 (325608 downstream)																							CGGAGGCAGGAAAAAAAAAAG	0.428													5	3	---	---	---	---	
FER1L6	654463	broad.mit.edu	37	8	125034095	125034096	+	Intron	INS	-	T	T	rs138450142	by1000genomes	TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125034095_125034096insT	uc003yqw.2	+						uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGCTTTATTCATTTTTTTTTCA	0.386													4	3	---	---	---	---	
ABCA2	20	broad.mit.edu	37	9	139913877	139913877	+	Intron	DEL	T	-	-	rs35180161		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139913877delT	uc011mem.1	-						ABCA2_uc011mel.1_Intron|ABCA2_uc004ckl.1_Intron|ABCA2_uc004ckm.1_Intron|ABCA2_uc004ckn.1_5'Flank|ABCA2_uc004cko.1_Intron	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2						cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CCTCCCCACCttttttttttt	0.318													6	3	---	---	---	---	
PSMD13	5719	broad.mit.edu	37	11	243018	243019	+	Intron	DEL	TC	-	-	rs147993367		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:243018_243019delTC	uc001lol.2	+						PSMD13_uc010qvr.1_Intron|PSMD13_uc001loo.2_Intron|PSMD13_uc001lon.2_Intron|PSMD13_uc001lom.2_Intron	NM_002817	NP_002808	Q9UNM6	PSD13_HUMAN	proteasome 26S non-ATPase subunit 13 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding			ovary(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		atggttccaatctcttgacctc	0.045													2	4	---	---	---	---	
IGSF22	283284	broad.mit.edu	37	11	18741911	18741911	+	Intron	DEL	T	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18741911delT	uc009yht.2	-						IGSF22_uc001mpa.2_Intron	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22											ovary(4)|large_intestine(2)|kidney(1)	7						GTAGGAGGCCTTTTTTTTTTT	0.483													10	5	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69971958	69971959	+	Intron	DEL	AC	-	-	rs10792912		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69971958_69971959delAC	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						tcaaaaaaaaacaaaaaaagag	0.262													5	3	---	---	---	---	
AMOTL1	154810	broad.mit.edu	37	11	94602310	94602310	+	Intron	DEL	A	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94602310delA	uc001pfb.2	+						AMOTL1_uc001pfc.2_Intron	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1							cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				GACTAGATTTAAAAAAAAAAA	0.393													4	2	---	---	---	---	
RPS25	6230	broad.mit.edu	37	11	118888388	118888388	+	Intron	DEL	A	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118888388delA	uc001pun.2	-						TRAPPC4_uc010ryn.1_5'Flank|TRAPPC4_uc010ryo.1_5'Flank|TRAPPC4_uc010ryp.1_5'Flank|TRAPPC4_uc001pup.2_5'Flank|TRAPPC4_uc010ryq.1_5'Flank	NM_001028	NP_001019	P62851	RS25_HUMAN	ribosomal protein S25						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		AAACAAAAACAAAAAAAAAAC	0.438													4	3	---	---	---	---	
ARHGEF12	23365	broad.mit.edu	37	11	120348771	120348772	+	Intron	INS	-	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120348771_120348772insT	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TTTATGGATTGTTTTTTTTTTT	0.322			T	MLL	AML								6	3	---	---	---	---	
TEAD4	7004	broad.mit.edu	37	12	3129551	3129551	+	Intron	DEL	G	-	-	rs3837514		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3129551delG	uc010sej.1	+						TEAD4_uc010sek.1_Intron|TEAD4_uc001qln.2_Intron	NM_003213	NP_003204	Q15561	TEAD4_HUMAN	TEA domain family member 4 isoform 1						hippo signaling cascade|muscle organ development|skeletal system development		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			CTTGCTCGGCGGTTCCATGCA	0.527													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68946696	68946696	+	IGR	DEL	T	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68946696delT								MDM1 (220535 upstream) : RAP1B (57956 downstream)																							caaattattcttttttTTTTT	0.179													4	2	---	---	---	---	
FGD6	55785	broad.mit.edu	37	12	95475444	95475445	+	Intron	INS	-	AT	AT	rs143543201	by1000genomes	TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95475444_95475445insAT	uc001tdp.3	-						FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						ACATAGGTAAGATATATATATA	0.208													5	3	---	---	---	---	
IFT81	28981	broad.mit.edu	37	12	110566616	110566616	+	Intron	DEL	G	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110566616delG	uc001tqi.2	+						IFT81_uc001tqh.2_Intron|IFT81_uc001tqj.2_Intron|IFT81_uc001tqg.2_Intron	NM_001143779	NP_001137251	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81-like isoform 1						cell differentiation|multicellular organismal development|spermatogenesis	intraflagellar transport particle B|microtubule-based flagellum				ovary(1)	1						aaaaaaaaaaGATTCCTTGGG	0.154													6	3	---	---	---	---	
B3GALTL	145173	broad.mit.edu	37	13	31821088	31821089	+	Intron	INS	-	T	T	rs71192686		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31821088_31821089insT	uc010aaz.2	+							NM_194318	NP_919299	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like						fucose metabolic process	endoplasmic reticulum membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		cttttcttttcttttttttttt	0.302													9	9	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600679	600679	+	Intron	DEL	C	-	-	rs113741614		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600679delC	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				TCGGTGAGGGCCCCCAGTCGG	0.716													6	3	---	---	---	---	
KIAA0100	9703	broad.mit.edu	37	17	26950601	26950601	+	Intron	DEL	A	-	-	rs35696171		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26950601delA	uc002hbu.2	-						KIAA0100_uc002hbt.2_5'Flank	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor							extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					CACCATGAGGAAAAAAAAAAA	0.368													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48313505	48313506	+	IGR	DEL	GC	-	-	rs79272585		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48313505_48313506delGC								COL1A1 (34505 upstream) : TMEM92 (38331 downstream)																							AAGGGAAACTGCtttttttttt	0.238													6	4	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153023	7153028	+	Intron	DEL	ACCACA	-	-	rs149041762	by1000genomes	TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153023_7153028delACCACA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	acacacacacaccacacacacacacc	0.170													4	2	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9006225	9006226	+	Intron	INS	-	CT	CT	rs142182629	by1000genomes	TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9006225_9006226insCT	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCCTGGAGCCAGTTTCCTGGAT	0.480													4	2	---	---	---	---	
TULP2	7288	broad.mit.edu	37	19	49384468	49384468	+	Intron	DEL	C	-	-	rs68173909		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49384468delC	uc002pkz.2	-							NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2						visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		ttttttttttctttttttttt	0.199													4	2	---	---	---	---	
ARFRP1	10139	broad.mit.edu	37	20	62333350	62333351	+	Intron	INS	-	C	C	rs59166240		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62333350_62333351insC	uc002yga.2	-						ARFRP1_uc002ygc.2_Intron|ARFRP1_uc002ygh.3_Intron|ARFRP1_uc011abf.1_Intron|ARFRP1_uc011abg.1_Intron|ARFRP1_uc002yge.2_Intron|ARFRP1_uc002ygd.2_Intron|ARFRP1_uc002ygf.2_Intron|ARFRP1_uc002ygg.2_Intron|ARFRP1_uc011abh.1_Intron	NM_003224	NP_003215	Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1						small GTPase mediated signal transduction	Golgi apparatus|membrane fraction	GTP binding|GTPase activity			breast(1)|skin(1)	2	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			CACTCCCTCTGCCCCCCCCCCC	0.683													4	2	---	---	---	---	
GART	2618	broad.mit.edu	37	21	34903298	34903299	+	Intron	INS	-	T	T			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34903298_34903299insT	uc002yrx.2	-						GART_uc002yrz.2_Intron|GART_uc010gmd.2_Intron|GART_uc002yry.2_Intron|GART_uc002ysa.2_Intron	NM_000819	NP_000810	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase,						'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|metal ion binding|methyltransferase activity|phosphoribosylamine-glycine ligase activity|phosphoribosylformylglycinamidine cyclo-ligase activity|phosphoribosylglycinamide formyltransferase activity|protein binding			ovary(1)	1					Pemetrexed(DB00642)	GGAAAAGTTTGTTTTTTTTTTT	0.277													8	5	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31298126	31298127	+	Intron	DEL	CC	-	-	rs56186828		TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31298126_31298127delCC	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Intron|OSBP2_uc003ajb.2_Intron|OSBP2_uc011ald.1_Intron|OSBP2_uc010gwd.1_Intron	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						AAAAAAAAAACCAAAAAAAAAA	0.282													7	5	---	---	---	---	
SH3KBP1	30011	broad.mit.edu	37	X	19666468	19666471	+	Intron	DEL	GGAA	-	-			TCGA-C5-A1ML-01	TCGA-C5-A1ML-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19666468_19666471delGGAA	uc004czm.2	-						SH3KBP1_uc011mje.1_Intron|SH3KBP1_uc011mjf.1_Intron|SH3KBP1_uc004czl.2_Intron	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a						apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						agagaaggagggaaggaaggaagg	0.000													3	3	---	---	---	---	
