Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
GPR153	387509	broad.mit.edu	37	1	6314644	6314644	+	Missense_Mutation	SNP	G	A	A	rs147474319		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6314644G>A	uc001amp.1	-	2	582	c.322C>T	c.(322-324)CGC>TGC	p.R108C		NM_207370	NP_997253	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	108	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		ATCCACATGCGGTGGTAGGAG	0.542													27	111	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16892568	16892568	+	Intron	SNP	G	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892568G>T	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGACGAAGGGGTCAAAGGACA	0.333													4	23	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144879063	144879063	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144879063C>T	uc001elw.3	-	27	4678	c.4387G>A	c.(4387-4389)GAG>AAG	p.E1463K	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.E1419K|PDE4DIP_uc001elv.3_Missense_Mutation_p.E470K	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1463					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTCAGCTCCTCAGCCAGCTTC	0.517			T	PDGFRB	MPD								26	226	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144879256	144879256	+	Silent	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144879256C>A	uc001elw.3	-	27	4485	c.4194G>T	c.(4192-4194)CTG>CTT	p.L1398L	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Silent_p.L1354L|PDE4DIP_uc001elv.3_Silent_p.L405L	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1398					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CAACAGCTCTCAGCTTCCAGG	0.537			T	PDGFRB	MPD								19	142	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144879466	144879466	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144879466C>T	uc001elw.3	-	27	4275	c.3984G>A	c.(3982-3984)GAG>GAA	p.E1328E	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Silent_p.E1284E|PDE4DIP_uc001elv.3_Silent_p.E335E	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1328					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AGGGCTTCCTCTCAGAGGAAC	0.532			T	PDGFRB	MPD								25	237	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144879468	144879468	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144879468C>T	uc001elw.3	-	27	4273	c.3982G>A	c.(3982-3984)GAG>AAG	p.E1328K	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.E1284K|PDE4DIP_uc001elv.3_Missense_Mutation_p.E335K	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1328					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGCTTCCTCTCAGAGGAACTA	0.527			T	PDGFRB	MPD								21	234	---	---	---	---	PASS
ECM1	1893	broad.mit.edu	37	1	150482445	150482445	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150482445C>T	uc001eus.2	+	4	470	c.271C>T	c.(271-273)CTG>TTG	p.L91L	ECM1_uc010pce.1_Silent_p.L20L|ECM1_uc010pcf.1_Silent_p.L13L|ECM1_uc001eut.2_Silent_p.L91L|ECM1_uc001euu.2_Silent_p.L120L|ECM1_uc001euv.2_Silent_p.L118L|ECM1_uc009wlu.2_5'UTR	NM_004425	NP_004416	Q16610	ECM1_HUMAN	extracellular matrix protein 1 isoform 1	91					angiogenesis|biomineral tissue development|negative regulation of bone mineralization|negative regulation of peptidase activity|ossification|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade	proteinaceous extracellular matrix	laminin binding|protease binding|protein C-terminus binding|signal transducer activity			ovary(2)|central_nervous_system(1)	3	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			ACAGGAAAAGCTGCTACCTGC	0.597													15	79	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207644373	207644373	+	Silent	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207644373C>A	uc001hfw.2	+	8	1528	c.1434C>A	c.(1432-1434)CTC>CTA	p.L478L	CR2_uc001hfv.2_Silent_p.L478L|CR2_uc009xch.2_Silent_p.L478L|CR2_uc009xci.1_5'UTR	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	478	Sushi 8.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						GAAGGCAACTCTTGACAAAAC	0.418													16	110	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214830629	214830629	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214830629C>T	uc001hkm.2	+	18	9013	c.8839C>T	c.(8839-8841)CCT>TCT	p.P2947S		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	3043	Sufficient for nuclear localization.|Sufficient for centromere localization.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGGACCAACACCTGCTACCCC	0.463													15	65	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216465554	216465554	+	Silent	SNP	T	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216465554T>C	uc001hku.1	-	10	2190	c.1803A>G	c.(1801-1803)GGA>GGG	p.G601G	USH2A_uc001hkv.2_Silent_p.G601G	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	601	Laminin EGF-like 2.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAACTCCTCCTCCCCCTCTGA	0.423										HNSCC(13;0.011)			32	123	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525354	248525354	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525354A>C	uc001ieh.1	+	1	472	c.472A>C	c.(472-474)ATC>CTC	p.I158L		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	158	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTACGTGGCCATCTGCCATCC	0.532													7	258	---	---	---	---	PASS
RAB10	10890	broad.mit.edu	37	2	26257498	26257498	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26257498C>T	uc002rgv.2	+	1	770	c.21C>T	c.(19-21)GAC>GAT	p.D7D		NM_016131	NP_057215	P61026	RAB10_HUMAN	ras-related GTP-binding protein RAB10	7					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGACGTACGACCTGCTTTTCA	0.582													22	43	---	---	---	---	PASS
SNX17	9784	broad.mit.edu	37	2	27599219	27599219	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27599219G>A	uc002rkg.1	+	13	1444	c.1222G>A	c.(1222-1224)GAC>AAC	p.D408N	SNX17_uc010ylj.1_Missense_Mutation_p.D388N|SNX17_uc010ylk.1_Missense_Mutation_p.D194N|SNX17_uc010eza.1_Missense_Mutation_p.D194N|SNX17_uc002rki.1_RNA|SNX17_uc002rkh.1_Missense_Mutation_p.D194N|SNX17_uc010yll.1_Missense_Mutation_p.D194N|SNX17_uc010ylm.1_Missense_Mutation_p.D194N|SNX17_uc010yln.1_Missense_Mutation_p.D396N|SNX17_uc010ylo.1_Missense_Mutation_p.D326N|SNX17_uc010ylp.1_Missense_Mutation_p.D383N|SNX17_uc010ylq.1_Missense_Mutation_p.D194N	NM_014748	NP_055563	Q15036	SNX17_HUMAN	sorting nexin 17	408					cell communication|endosome transport|intracellular protein transport|regulation of endocytosis|signal transduction	cytoplasmic vesicle membrane|cytosol|early endosome|Golgi apparatus	low-density lipoprotein particle receptor binding|phosphatidylinositol binding|protein C-terminus binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGACGCTCAGACAGCCAGCA	0.597													11	81	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32666475	32666475	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32666475C>G	uc010ezu.2	+	17	4023	c.3889C>G	c.(3889-3891)CAA>GAA	p.Q1297E		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	1297					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TGATTTACTTCAAGAGGTCTC	0.328													4	30	---	---	---	---	PASS
NEU2	4759	broad.mit.edu	37	2	233899475	233899475	+	Missense_Mutation	SNP	C	T	T	rs147907558		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233899475C>T	uc010zmn.1	+	2	851	c.851C>T	c.(850-852)TCG>TTG	p.S284L		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	284							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		AGCCCCCGCTCGGGGCCTGGC	0.687													3	36	---	---	---	---	PASS
RAMP1	10267	broad.mit.edu	37	2	238820309	238820309	+	Missense_Mutation	SNP	G	A	A	rs145088404		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238820309G>A	uc002vxj.2	+	3	463	c.331G>A	c.(331-333)GTG>ATG	p.V111M		NM_005855	NP_005846	O60894	RAMP1_HUMAN	receptor activity-modifying protein 1 precursor	111	Extracellular (Potential).				intracellular protein transport|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane	protein transporter activity				0		Breast(86;0.000596)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;9.56e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.49e-11)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.49e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00013)|Lung(119;0.0119)|LUSC - Lung squamous cell carcinoma(224;0.0288)	Pramlintide(DB01278)	AGGCAGGGCCGTGCGGGACCC	0.652													9	21	---	---	---	---	PASS
WDR6	11180	broad.mit.edu	37	3	49051891	49051891	+	Silent	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49051891C>G	uc003cvj.2	+	4	2970	c.2832C>G	c.(2830-2832)CTC>CTG	p.L944L	WDR6_uc011bby.1_Silent_p.L392L|WDR6_uc010hkn.2_Silent_p.L888L|WDR6_uc011bbz.1_Silent_p.L863L	NM_018031	NP_060501	Q9NNW5	WDR6_HUMAN	WD repeat domain 6 protein	914	WD 14.				cell cycle arrest|negative regulation of cell proliferation	cytoplasm				central_nervous_system(1)	1				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		GATGTGTCCTCAAGGTCCACT	0.597											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	82	---	---	---	---	PASS
WDR6	11180	broad.mit.edu	37	3	49052028	49052028	+	Intron	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49052028C>G	uc003cvj.2	+						WDR6_uc011bby.1_Intron|WDR6_uc010hkn.2_Intron|WDR6_uc011bbz.1_Intron	NM_018031	NP_060501	Q9NNW5	WDR6_HUMAN	WD repeat domain 6 protein						cell cycle arrest|negative regulation of cell proliferation	cytoplasm				central_nervous_system(1)	1				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		TTTCCTGGCTCTCAGGAGGCT	0.587											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	63	---	---	---	---	PASS
DALRD3	55152	broad.mit.edu	37	3	49053403	49053403	+	Intron	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49053403C>A	uc003cvk.1	-						DALRD3_uc003cvl.1_Intron|DALRD3_uc003cvm.1_Intron|DALRD3_uc010hko.1_Silent_p.V315V	NM_001009996	NP_001009996	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3						arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GTCTATGCCTCACCATCTCTG	0.537													17	45	---	---	---	---	PASS
DALRD3	55152	broad.mit.edu	37	3	49053409	49053409	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49053409C>T	uc003cvk.1	-	10	1460	c.1440G>A	c.(1438-1440)GAG>GAA	p.E480E	DALRD3_uc003cvl.1_Missense_Mutation_p.D472N|DALRD3_uc003cvm.1_Silent_p.E313E|DALRD3_uc010hko.1_Silent_p.E313E|DALRD3_uc011bca.1_3'UTR	NM_001009996	NP_001009996	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	480					arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCCTCACCATCTCTGTGCGTA	0.547													15	43	---	---	---	---	PASS
DALRD3	55152	broad.mit.edu	37	3	49054734	49054734	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49054734C>G	uc003cvk.1	-	5	874	c.854G>C	c.(853-855)TGT>TCT	p.C285S	DALRD3_uc003cvl.1_Missense_Mutation_p.C285S|DALRD3_uc003cvm.1_Missense_Mutation_p.C118S|DALRD3_uc010hko.1_Missense_Mutation_p.C118S|DALRD3_uc011bca.1_Missense_Mutation_p.C285S	NM_001009996	NP_001009996	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	285					arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CTCCTCCTCACAGCTAACAAC	0.498													15	67	---	---	---	---	PASS
DALRD3	55152	broad.mit.edu	37	3	49054887	49054887	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49054887C>G	uc003cvk.1	-	4	798	c.778G>C	c.(778-780)GAG>CAG	p.E260Q	DALRD3_uc003cvl.1_Missense_Mutation_p.E260Q|DALRD3_uc003cvm.1_Missense_Mutation_p.E93Q|DALRD3_uc010hko.1_Missense_Mutation_p.E93Q|DALRD3_uc011bca.1_Missense_Mutation_p.E260Q	NM_001009996	NP_001009996	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	260					arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGGCTGTCCTCGGGCCAATGC	0.527													11	32	---	---	---	---	PASS
DALRD3	55152	broad.mit.edu	37	3	49055271	49055271	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49055271C>A	uc003cvk.1	-	3	513	c.493G>T	c.(493-495)GAT>TAT	p.D165Y	DALRD3_uc003cvl.1_Missense_Mutation_p.D165Y|DALRD3_uc003cvm.1_5'UTR|DALRD3_uc010hko.1_5'UTR|DALRD3_uc011bca.1_Missense_Mutation_p.D165Y|NDUFAF3_uc003cvn.2_5'Flank	NM_001009996	NP_001009996	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	165					arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ATGTGCGGATCCCGCACAGCT	0.672													6	14	---	---	---	---	PASS
CCDC71	64925	broad.mit.edu	37	3	49201117	49201117	+	Silent	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49201117G>A	uc003cwg.3	-	2	663	c.525C>T	c.(523-525)CTC>CTT	p.L175L		NM_022903	NP_075054	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	175										ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGACAACAGAGAGCCGCATGG	0.587													32	24	---	---	---	---	PASS
TRAIP	10293	broad.mit.edu	37	3	49878446	49878446	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49878446C>A	uc003cxs.1	-	8	783	c.677G>T	c.(676-678)AGG>ATG	p.R226M	TRAIP_uc010hla.1_Intron	NM_005879	NP_005870	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	226	Interaction with CYLD.|Potential.				cell proliferation|induction of apoptosis	perinuclear region of cytoplasm	protein binding|zinc ion binding			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CAAATCCTTCCTCAGCTTGTC	0.493											OREG0015575	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	186	---	---	---	---	PASS
RAB7A	7879	broad.mit.edu	37	3	128516825	128516825	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128516825G>C	uc003eks.1	+	3	325	c.93G>C	c.(91-93)AAG>AAC	p.K31N	RAB7A_uc010hsv.1_Missense_Mutation_p.K31N|RAB7A_uc003ekt.2_Missense_Mutation_p.K7N	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family	31					endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		ATGTGAATAAGAAATTCAGCA	0.428													4	106	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140401673	140401673	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140401673C>T	uc003eto.1	+	2	902	c.711C>T	c.(709-711)CTC>CTT	p.L237L		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	237	B box-type 1.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						GGCCCATCCTCTGCCAGGTCT	0.627													12	87	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186940921	186940921	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186940921C>T	uc003frh.1	-	14	2135	c.1803G>A	c.(1801-1803)CTG>CTA	p.L601L		NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	601	Peptidase S1.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TCACCTCCATCAGGGTCTCTG	0.517													3	58	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	69433510	69433510	+	IGR	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69433510C>G								YTHDC1 (217686 upstream) : UGT2B15 (78806 downstream)																							GGTCCCACTTCTTCAGATCAT	0.323													14	79	---	---	---	---	PASS
BBS12	166379	broad.mit.edu	37	4	123665067	123665067	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123665067C>T	uc003ieu.2	+	2	2213	c.2020C>T	c.(2020-2022)CGC>TGC	p.R674C		NM_152618	NP_689831	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	674					cellular protein metabolic process	cilium	ATP binding			ovary(2)	2						TGAGGCGTGGCGCCGAGCATT	0.368									Bardet-Biedl_syndrome				42	67	---	---	---	---	PASS
GUCY1B3	2983	broad.mit.edu	37	4	156716531	156716531	+	Silent	SNP	G	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156716531G>T	uc003ipc.2	+	7	932	c.765G>T	c.(763-765)TCG>TCT	p.S255S	GUCY1B3_uc011cio.1_Silent_p.S277S|GUCY1B3_uc011cip.1_Silent_p.S235S|GUCY1B3_uc003ipd.2_Silent_p.S183S|GUCY1B3_uc010iqf.2_Silent_p.S255S|GUCY1B3_uc010iqg.2_Silent_p.S183S|GUCY1B3_uc011ciq.1_Silent_p.S183S	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	255					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		CTGTCTTCTCGCTGGTTCGTC	0.348													13	44	---	---	---	---	PASS
SNX25	83891	broad.mit.edu	37	4	186180183	186180183	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186180183C>T	uc003ixh.2	+	3	393	c.204C>T	c.(202-204)CTC>CTT	p.L68L		NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25	68	PXA.				cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GGACTTTACTCACTCATTTCT	0.408													14	63	---	---	---	---	PASS
CHD1	1105	broad.mit.edu	37	5	98217695	98217695	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98217695C>A	uc003knf.2	-	19	2999	c.2851G>T	c.(2851-2853)GGT>TGT	p.G951C		NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	951					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	GGGGCAGAACCTGTATGTAGT	0.333													33	20	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17800192	17800192	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17800192C>T	uc003ncg.3	-	21	2712	c.2607G>A	c.(2605-2607)CTG>CTA	p.L869L	KIF13A_uc003ncf.2_Silent_p.L869L|KIF13A_uc003nch.3_Silent_p.L869L|KIF13A_uc003nci.3_Silent_p.L869L	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	869					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CCCGACATGTCAGCTTTTTGA	0.453													15	159	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17800281	17800281	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17800281C>G	uc003ncg.3	-	21	2623	c.2518G>C	c.(2518-2520)GAG>CAG	p.E840Q	KIF13A_uc003ncf.2_Missense_Mutation_p.E840Q|KIF13A_uc003nch.3_Missense_Mutation_p.E840Q|KIF13A_uc003nci.3_Missense_Mutation_p.E840Q	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	840					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GAGTCATCCTCCACCACACGC	0.468													9	82	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17850652	17850652	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17850652G>C	uc003ncg.3	-	8	724	c.619C>G	c.(619-621)CGA>GGA	p.R207G	KIF13A_uc003ncf.2_Missense_Mutation_p.R207G|KIF13A_uc003nch.3_Missense_Mutation_p.R207G|KIF13A_uc003nci.3_Missense_Mutation_p.R207G	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	207	Kinesin-motor.				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GCTACCGTTCGAGACTTATTT	0.453													6	15	---	---	---	---	PASS
KCNK16	83795	broad.mit.edu	37	6	39286797	39286797	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39286797A>G	uc003ooq.2	-	2	340	c.326T>C	c.(325-327)ATA>ACA	p.I109T	KCNK16_uc003oor.3_Missense_Mutation_p.I109T|KCNK16_uc010jwy.2_Missense_Mutation_p.I109T|KCNK16_uc011dtz.1_Missense_Mutation_p.I109T	NM_032115	NP_115491	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	109						integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(1)	3						CCCTTTACCTATGGTAGTGAC	0.393													12	34	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49582479	49582479	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49582479G>A	uc003ozk.3	-	5	790	c.728C>T	c.(727-729)ACG>ATG	p.T243M	RHAG_uc010jzl.2_Missense_Mutation_p.T243M|RHAG_uc010jzm.2_Missense_Mutation_p.T243M	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	243	Helical; (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					AGAGAAGTACGTGTTTACAAT	0.537													28	52	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117662663	117662663	+	Missense_Mutation	SNP	G	A	A	rs45439298		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117662663G>A	uc003pxp.1	-	29	5001	c.4802C>T	c.(4801-4803)GCC>GTC	p.A1601V	ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1601	Fibronectin type-III 7.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AGGAATTAGGGCCAGGTGTGA	0.428			T	GOPC|ROS1	glioblastoma|NSCLC								19	72	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152655170	152655170	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152655170A>C	uc010kiw.2	-	77	13369	c.12767T>G	c.(12766-12768)TTT>TGT	p.F4256C	SYNE1_uc003qot.3_Missense_Mutation_p.F4185C|SYNE1_uc003qou.3_Missense_Mutation_p.F4256C|SYNE1_uc010kiz.2_Missense_Mutation_p.F11C	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4256	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCTGTAGTAAATTTTTCTAG	0.368										HNSCC(10;0.0054)			48	109	---	---	---	---	PASS
GTF2I	2969	broad.mit.edu	37	7	74131214	74131214	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74131214G>A	uc003uau.2	+	11	1194	c.824G>A	c.(823-825)GGA>GAA	p.G275E	GTF2I_uc003uat.2_Missense_Mutation_p.G255E|GTF2I_uc003uav.2_Missense_Mutation_p.G275E|GTF2I_uc003uaw.2_Missense_Mutation_p.G255E|GTF2I_uc003uay.2_Missense_Mutation_p.G274E|GTF2I_uc003uax.2_Missense_Mutation_p.G255E|uc003uaz.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1	275					negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						TTCTTTTTAGGAAGCCACCAT	0.323													3	26	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149486846	149486846	+	Silent	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149486846C>A	uc010lpk.2	+	31	4620	c.4620C>A	c.(4618-4620)ACC>ACA	p.T1540T		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1540					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTGCCAGCACCTTGCCTGGCC	0.667													3	30	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48839884	48839884	+	Silent	SNP	G	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48839884G>T	uc003xqi.2	-	21	2346	c.2289C>A	c.(2287-2289)ACC>ACA	p.T763T	PRKDC_uc003xqj.2_Silent_p.T763T|PRKDC_uc011ldh.1_Silent_p.T763T	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	763					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				CTGCCAAGGGGGTATAGCTCA	0.398								NHEJ					3	36	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143957648	143957648	+	Intron	SNP	C	T	T	rs6411	byFrequency	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143957648C>T	uc003yxi.2	-						CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_5'UTR|CYP11B1_uc003yxj.2_Intron|CYP11B1_uc010mey.2_Intron	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,						aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	GGCTGGTTGCCGGCCTGACCG	0.637									Familial_Hyperaldosteronism_type_I				3	32	---	---	---	---	PASS
ZER1	10444	broad.mit.edu	37	9	131513487	131513487	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131513487G>A	uc004bwa.1	-	7	1532	c.1099C>T	c.(1099-1101)CGG>TGG	p.R367W		NM_006336	NP_006327	Q7Z7L7	ZER1_HUMAN	zyg-11 homolog B (C. elegans)-like	367					ATP hydrolysis coupled proton transport|regulation of ubiquitin-protein ligase activity	Cul2-RING ubiquitin ligase complex|vacuolar proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism|ubiquitin-protein ligase activity			ovary(1)	1						ATCTCAGGCCGGTGCTCCGTG	0.602													7	11	---	---	---	---	PASS
USP20	10868	broad.mit.edu	37	9	132630591	132630591	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132630591C>T	uc004bys.2	+	11	1209	c.998C>T	c.(997-999)TCC>TTC	p.S333F	USP20_uc004byr.2_Missense_Mutation_p.S333F|USP20_uc004byt.1_Missense_Mutation_p.S333F	NM_001110303	NP_001103773	Q9Y2K6	UBP20_HUMAN	ubiquitin specific protease 20	333					endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|ubiquitin thiolesterase activity|zinc ion binding			lung(1)|breast(1)	2		Ovarian(14;0.00556)				CGCAAGTTCTCCTGGGGCCAG	0.667													6	71	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129907520	129907520	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129907520C>T	uc001lke.2	-	13	2779	c.2584G>A	c.(2584-2586)GAG>AAG	p.E862K	MKI67_uc001lkf.2_Missense_Mutation_p.E502K|MKI67_uc009yav.1_Missense_Mutation_p.E437K|MKI67_uc009yaw.1_Missense_Mutation_p.E12K	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	862					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGCTCTGTCTCAGTATCTGAA	0.423													6	202	---	---	---	---	PASS
PPP2R5B	5526	broad.mit.edu	37	11	64695312	64695312	+	Silent	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64695312G>A	uc001oby.2	+	4	1020	c.435G>A	c.(433-435)GAG>GAA	p.E145E	PPP2R5B_uc001obz.2_Silent_p.E145E	NM_006244	NP_006235	Q15173	2A5B_HUMAN	beta isoform of regulatory subunit B56, protein	145					signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(2)	2						CGCCCAGTGAGAACCCTGAAT	0.522													8	80	---	---	---	---	PASS
PPP2R5B	5526	broad.mit.edu	37	11	64695577	64695577	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64695577G>C	uc001oby.2	+	5	1123	c.538G>C	c.(538-540)GAC>CAC	p.D180H	PPP2R5B_uc001obz.2_Missense_Mutation_p.D180H	NM_006244	NP_006235	Q15173	2A5B_HUMAN	beta isoform of regulatory subunit B56, protein	180					signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(2)	2						GGAGAGCCCAGACTTCCAGCC	0.552													7	93	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68312347	68312347	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68312347C>G	uc001onw.2	+	4	536	c.269C>G	c.(268-270)TCC>TGC	p.S90C	SAPS3_uc010rqb.1_5'UTR|SAPS3_uc001onv.2_Missense_Mutation_p.S90C|SAPS3_uc001ony.3_Missense_Mutation_p.S90C|SAPS3_uc001onx.2_Missense_Mutation_p.S90C|SAPS3_uc009ysh.2_Missense_Mutation_p.S90C|SAPS3_uc001onu.2_Missense_Mutation_p.S90C|SAPS3_uc010rqc.1_5'UTR	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	90					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			TCTGATGTCTCCCAGATGAAT	0.348													4	34	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68312450	68312450	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68312450C>T	uc001onw.2	+	4	639	c.372C>T	c.(370-372)TTC>TTT	p.F124F	SAPS3_uc010rqb.1_Silent_p.F33F|SAPS3_uc001onv.2_Silent_p.F124F|SAPS3_uc001ony.3_Silent_p.F124F|SAPS3_uc001onx.2_Silent_p.F124F|SAPS3_uc009ysh.2_Silent_p.F124F|SAPS3_uc001onu.2_Silent_p.F124F|SAPS3_uc010rqc.1_Silent_p.F33F	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	124					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			CCAGTTTCTTCAGCAAGGTGC	0.393													7	63	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11547437	11547437	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11547437A>G	uc010shk.1	-	2	127	c.92T>C	c.(91-93)CTA>CCA	p.L31P		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACCTGCTATTAGGGAGGGAGA	0.418													31	98	---	---	---	---	PASS
DNAJC14	85406	broad.mit.edu	37	12	56221839	56221839	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56221839G>A	uc001shx.1	-	2	808	c.604C>T	c.(604-606)CCA>TCA	p.P202S	DNAJC14_uc001shu.1_Missense_Mutation_p.P202S|DNAJC14_uc009zob.1_Missense_Mutation_p.P202S|DNAJC14_uc001shy.1_Missense_Mutation_p.P202S	NM_032364	NP_115740	Q6Y2X3	DJC14_HUMAN	dopamine receptor interacting protein	202					protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding			ovary(3)|large_intestine(1)	4						TCCTTCGTTGGAAAGCGGTGC	0.552													13	29	---	---	---	---	PASS
FOXO1	2308	broad.mit.edu	37	13	41134584	41134584	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41134584G>C	uc001uxl.3	-	2	1429	c.1044C>G	c.(1042-1044)TAC>TAG	p.Y348*	FOXO1_uc010acc.1_Nonsense_Mutation_p.Y163*	NM_002015	NP_002006	Q12778	FOXO1_HUMAN	forkhead box O1	348					anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		CAGATGGCGGGTACACCATAG	0.453													10	120	---	---	---	---	PASS
OR4N2	390429	broad.mit.edu	37	14	20295989	20295989	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20295989C>T	uc010tkv.1	+	1	382	c.382C>T	c.(382-384)CGG>TGG	p.R128W		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CGCCATCTGCCGGCCTCTGCA	0.522													6	118	---	---	---	---	PASS
TGFB3	7043	broad.mit.edu	37	14	76438001	76438001	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76438001G>A	uc001xsc.2	-	2	1269	c.413C>T	c.(412-414)TCA>TTA	p.S138L	TGFB3_uc001xsd.2_Missense_Mutation_p.S136L	NM_003239	NP_003230	P10600	TGFB3_HUMAN	transforming growth factor, beta 3 precursor	138					cell growth|cell-cell junction organization|detection of hypoxia|face morphogenesis|in utero embryonic development|induction of apoptosis|lung alveolus development|mammary gland development|menstrual cycle phase|negative regulation of cell proliferation|negative regulation of DNA replication|negative regulation of macrophage cytokine production|negative regulation of neuron apoptosis|odontogenesis|ossification involved in bone remodeling|palate development|platelet activation|platelet degranulation|positive regulation of bone mineralization|positive regulation of cell division|positive regulation of collagen biosynthetic process|positive regulation of DNA replication|positive regulation of epithelial to mesenchymal transition|positive regulation of filopodium assembly|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein secretion|positive regulation of SMAD protein import into nucleus|positive regulation of transcription from RNA polymerase II promoter|response to progesterone stimulus|salivary gland morphogenesis|transforming growth factor beta receptor signaling pathway	extracellular matrix|platelet alpha granule lumen	growth factor activity|identical protein binding|transforming growth factor beta binding|type I transforming growth factor beta receptor binding|type II transforming growth factor beta receptor binding			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0169)		TTTCTCCACTGAGGACACATT	0.522													7	15	---	---	---	---	PASS
CATSPERB	79820	broad.mit.edu	37	14	92102780	92102780	+	Silent	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92102780C>G	uc001xzs.1	-	17	1871	c.1731G>C	c.(1729-1731)GTG>GTC	p.V577V	CATSPERB_uc010aub.1_Silent_p.V99V	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta	577					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				CAGAGTGTATCACTTTTCCAT	0.299													25	68	---	---	---	---	PASS
MIR758	768212	broad.mit.edu	37	14	101492163	101492163	+	5'Flank	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101492163C>G	hsa-mir-758|MI0003757	+						MIR329-1_hsa-mir-329-1|MI0001725_5'Flank|MIR329-2_hsa-mir-329-2|MI0001726_5'Flank																	0						TCCCGCCTTGCAAGCTTTCCT	0.547													3	53	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30749702	30749702	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30749702G>A	uc002dze.1	+	34	8726	c.8341G>A	c.(8341-8343)GTC>ATC	p.V2781I	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.V2576I	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2781	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			AGTGCCTGGGGTCTCTGAGAC	0.647													20	56	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74528657	74528657	+	Splice_Site	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74528657C>A	uc002fcy.3	-	6	1100	c.1050_splice	c.e6+1	p.K350_splice	GLG1_uc002fcx.2_Splice_Site_p.K350_splice|GLG1_uc002fcw.3_Splice_Site_p.K339_splice|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						ATAATACTTACCTTTTCACTC	0.234													12	30	---	---	---	---	PASS
SLC47A1	55244	broad.mit.edu	37	17	19451432	19451432	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19451432C>G	uc002gvy.1	+	4	527	c.441C>G	c.(439-441)GAC>GAG	p.D147E	SLC47A1_uc010vyy.1_RNA|SLC47A1_uc002gvx.2_Missense_Mutation_p.D147E|SLC47A1_uc010vyz.1_Missense_Mutation_p.D124E|SLC47A1_uc010cqp.1_Missense_Mutation_p.D147E|SLC47A1_uc010cqq.1_5'UTR	NM_018242	NP_060712	Q96FL8	S47A1_HUMAN	solute carrier family 47, member 1	147	Extracellular (Potential).					integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)					TCAGGCAGGACCCAGATGTGT	0.607													9	42	---	---	---	---	PASS
GPR179	440435	broad.mit.edu	37	17	36485384	36485384	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36485384C>T	uc002hpz.2	-	11	4089	c.4068G>A	c.(4066-4068)AGG>AGA	p.R1356R		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	1356	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TCTCCACCTTCCTGGCCTCCA	0.627													6	59	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44249455	44249455	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44249455G>A	uc002ikb.2	-	1	140	c.55C>T	c.(55-57)CGG>TGG	p.R19W	KIAA1267_uc002ikc.2_Missense_Mutation_p.R19W|KIAA1267_uc002ikd.2_Missense_Mutation_p.R19W|KIAA1267_uc010dav.2_Missense_Mutation_p.R19W	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	19						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				AGTTTGAACCGGATATGGTGT	0.572													3	74	---	---	---	---	PASS
LRRC59	55379	broad.mit.edu	37	17	48469827	48469827	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48469827C>G	uc002iqt.2	-	4	515	c.361G>C	c.(361-363)GAT>CAT	p.D121H		NM_018509	NP_060979	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	121	Cytoplasmic (Potential).|LRR 5.					endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial nucleoid	protein binding			central_nervous_system(1)	1	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			AGGACAGGATCCAGGGGGTTA	0.532													6	94	---	---	---	---	PASS
DDX42	11325	broad.mit.edu	37	17	61882430	61882430	+	Splice_Site	SNP	G	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61882430G>C	uc002jbu.2	+	8	879	c.622_splice	c.e8-1	p.I208_splice	DDX42_uc002jbv.2_Splice_Site_p.I208_splice|DDX42_uc002jbw.1_5'UTR|DDX42_uc002jbx.2_5'Flank	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						TGGACCTGCAGATTGACTATC	0.328													3	57	---	---	---	---	PASS
EVPL	2125	broad.mit.edu	37	17	74013955	74013955	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74013955C>A	uc002jqi.2	-	14	1803	c.1575G>T	c.(1573-1575)CAG>CAT	p.Q525H	EVPL_uc010wss.1_Missense_Mutation_p.Q547H|EVPL_uc010wst.1_5'UTR	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	525	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						TCAGGAGCTTCTGGGCCTGTG	0.677													4	58	---	---	---	---	PASS
RNF157	114804	broad.mit.edu	37	17	74154479	74154479	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74154479C>G	uc002jqz.2	-	13	1477	c.1408G>C	c.(1408-1410)GGA>CGA	p.G470R	RNF157_uc002jra.2_Missense_Mutation_p.G470R	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157	470	Ser-rich.						zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			ATTACCTCTCCGAGATGCTGA	0.532													4	112	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12502086	12502086	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12502086G>A	uc010dyt.2	-	4	1276	c.1126C>T	c.(1126-1128)CAT>TAT	p.H376Y	ZNF799_uc002mts.3_Intron	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN	zinc finger protein 799	376	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						CTTGAGCTATGAGATAACGCT	0.418													8	173	---	---	---	---	PASS
TMEM38A	79041	broad.mit.edu	37	19	16790942	16790942	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16790942C>T	uc002nes.2	+	2	363	c.272C>T	c.(271-273)TCA>TTA	p.S91L		NM_024074	NP_076979	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	91	Helical; (Potential).					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			central_nervous_system(2)|ovary(1)	3						CTGCTGGCCTCAGCTGTCTGG	0.572													15	30	---	---	---	---	PASS
UBA52	7311	broad.mit.edu	37	19	18684538	18684538	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18684538C>T	uc002njr.2	+	3	284	c.170C>T	c.(169-171)TCA>TTA	p.S57L	UBA52_uc002njs.2_Missense_Mutation_p.S57L|UBA52_uc002njt.2_Missense_Mutation_p.S57L	NM_001033930	NP_001029102	P62987	RL40_HUMAN	ubiquitin and ribosomal protein L40 precursor	57	Ubiquitin-like.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endocrine pancreas development|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|translational elongation|translational termination|viral transcription	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane|ribosome	protein binding|structural constituent of ribosome				0						CGCACTCTCTCAGACTACAAC	0.592													13	30	---	---	---	---	PASS
ZNF578	147660	broad.mit.edu	37	19	53014316	53014316	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53014316G>C	uc002pzp.3	+	6	926	c.682G>C	c.(682-684)GAA>CAA	p.E228Q		NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN	zinc finger protein 578	3					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		ACACATGAGAGAAAAATCTTT	0.318													7	60	---	---	---	---	PASS
CTSZ	1522	broad.mit.edu	37	20	57571710	57571710	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57571710G>A	uc002yai.2	-	5	911	c.785C>T	c.(784-786)TCA>TTA	p.S262L	CTSZ_uc002yaj.3_Missense_Mutation_p.S262L	NM_001336	NP_001327	Q9UBR2	CATZ_HUMAN	cathepsin Z preproprotein	262					proteolysis	endoplasmic reticulum|extracellular space|lysosome	cysteine-type endopeptidase activity			kidney(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)			TTCACCCCATGAATTCCGGAC	0.443													5	115	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34918547	34918547	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34918547G>T	uc002yse.1	+	2	155	c.106G>T	c.(106-108)GAA>TAA	p.E36*	SON_uc002ysb.1_Nonsense_Mutation_p.E36*|SON_uc002ysc.2_Nonsense_Mutation_p.E36*|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Nonsense_Mutation_p.E36*	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	36					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						GCTGAATGGTGAAACAAATAC	0.373													4	49	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34921970	34921970	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34921970G>A	uc002yse.1	+	3	482	c.433G>A	c.(433-435)GAT>AAT	p.D145N	SON_uc002ysb.1_Missense_Mutation_p.D145N|SON_uc002ysc.2_Missense_Mutation_p.D145N|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	145					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						ATCTCATGATGATGGGAACAT	0.313											OREG0003562	type=REGULATORY REGION|Gene=AK091233|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	39	---	---	---	---	PASS
CXorf26	51260	broad.mit.edu	37	X	75394741	75394741	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75394741C>G	uc004ecl.1	+	3	316	c.113C>G	c.(112-114)GCT>GGT	p.A38G		NM_016500	NP_057584	Q9BVG4	CX026_HUMAN	hypothetical protein LOC51260	38											0						ATTGAGATGGCTTGGGCCATG	0.398													5	74	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76776957	76776957	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76776957C>T	uc004ecp.3	-	33	7227	c.6995G>A	c.(6994-6996)AGA>AAA	p.R2332K	ATRX_uc004ecq.3_Missense_Mutation_p.R2294K|ATRX_uc004eco.3_Missense_Mutation_p.R2117K	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	2332					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	AACTTTTTCTCTTCCTTGATT	0.363			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						3	79	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91132649	91132649	+	Silent	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91132649C>T	uc004efk.1	+	2	2255	c.1410C>T	c.(1408-1410)TTC>TTT	p.F470F	PCDH11X_uc004efl.1_Silent_p.F470F|PCDH11X_uc004efo.1_Silent_p.F470F|PCDH11X_uc010nmv.1_Silent_p.F470F|PCDH11X_uc004efm.1_Silent_p.F470F|PCDH11X_uc004efn.1_Silent_p.F470F|PCDH11X_uc004efh.1_Silent_p.F470F|PCDH11X_uc004efj.1_Silent_p.F470F	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	470	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CCCAGTCTTTCGTAACTGTTT	0.433													36	47	---	---	---	---	PASS
MORC4	79710	broad.mit.edu	37	X	106185181	106185181	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106185181C>T	uc004emu.3	-	16	2890	c.2647G>A	c.(2647-2649)GAT>AAT	p.D883N	MORC4_uc004emp.3_Intron|MORC4_uc004emv.3_Intron|MORC4_uc004emw.3_Intron	NM_024657	NP_078933	Q8TE76	MORC4_HUMAN	zinc finger, CW type with coiled-coil domain 2	883							ATP binding|zinc ion binding			ovary(1)	1						TCTAGGTCATCTCCCTCTGGG	0.473													9	110	---	---	---	---	PASS
MTMR1	8776	broad.mit.edu	37	X	149887176	149887176	+	Intron	SNP	A	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149887176A>T	uc004fei.2	+						MTMR1_uc011mya.1_Intron|MTMR1_uc004feg.1_Intron|MTMR1_uc004feh.1_Intron|MTMR1_uc004fej.2_Intron|MTMR1_uc010ntf.2_Intron	NM_003828	NP_003819	Q13613	MTMR1_HUMAN	myotubularin-related protein 1							plasma membrane	protein tyrosine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GCCATTGGTAAGTTTAGTGTG	0.408													5	36	---	---	---	---	PASS
L1CAM	3897	broad.mit.edu	37	X	153128962	153128962	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153128962G>A	uc004fjb.2	-	26	3608	c.3500C>T	c.(3499-3501)CCG>CTG	p.P1167L	L1CAM_uc004fjc.2_Missense_Mutation_p.P1167L|L1CAM_uc010nuo.2_Missense_Mutation_p.P1162L	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	1167	Cytoplasmic (Potential).				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATCTTTCATCGGTCGGGCCTC	0.627													9	43	---	---	---	---	PASS
RPL10	6134	broad.mit.edu	37	X	153629109	153629109	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153629109G>A	uc004fkm.2	+	7	747	c.559G>A	c.(559-561)GAA>AAA	p.E187K	uc010nuv.1_5'Flank|RPL10_uc004fko.2_Silent_p.L132L|RPL10_uc004fkn.1_Missense_Mutation_p.E187K|RPL10_uc004fkp.1_3'UTR|RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Intron	NM_006013	NP_006004	P27635	RL10_HUMAN	ribosomal protein L10	187					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|endoplasmic reticulum	structural constituent of ribosome				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CATGGTGGCTGAAAAGCGGCT	0.527													6	26	---	---	---	---	PASS
RPL11	6135	broad.mit.edu	37	1	24019390	24019390	+	Intron	DEL	C	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24019390delC	uc001bhk.2	+						RPL11_uc001bhl.2_Intron|RPL11_uc001bhm.2_Intron|RPL11_uc001bhn.1_Intron	NM_000975	NP_000966	P62913	RL11_HUMAN	ribosomal protein L11						endocrine pancreas development|protein localization to nucleus|protein targeting|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|rRNA binding|structural constituent of ribosome			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		CAAGAGGTGTCTTTTTTTTTT	0.383													6	3	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62593474	62593474	+	Intron	DEL	A	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62593474delA	uc001dab.2	+						INADL_uc001dac.2_Intron|INADL_uc009wag.2_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						agcgaaactgaaaaaaaaaga	0.095													4	2	---	---	---	---	
CELSR2	1952	broad.mit.edu	37	1	109816863	109816864	+	3'UTR	INS	-	C	C	rs145508961	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109816863_109816864insC	uc001dxa.3	+	34						NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2						dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TAGTGCCAACTCCCCCCCCACC	0.550													2	4	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	146419787	146419788	+	Intron	INS	-	TG	TG			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146419787_146419788insTG	uc001emp.3	+						uc010ozk.1_Intron|uc010ozl.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGAGCTCACACtgtgtgtgtgt	0.351													4	2	---	---	---	---	
ENSA	2029	broad.mit.edu	37	1	150595354	150595355	+	Intron	INS	-	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150595354_150595355insA	uc001eve.2	-						ENSA_uc001evd.2_Intron|ENSA_uc001evb.2_Intron|ENSA_uc001evc.2_Intron	NM_004436	NP_004427	O43768	ENSA_HUMAN	endosulfine alpha isoform 3						cell division|G2/M transition of mitotic cell cycle|mitosis|response to nutrient|transport	cytoplasm	ion channel inhibitor activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity|receptor binding			central_nervous_system(1)	1	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;9.85e-23)|all cancers(9;5.06e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.67e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000701)|LUSC - Lung squamous cell carcinoma(543;0.171)			GAACACAGAAGAAAAAAAAAAA	0.510													4	2	---	---	---	---	
C1orf26	54823	broad.mit.edu	37	1	185191344	185191344	+	Intron	DEL	A	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185191344delA	uc001grg.3	+						C1orf26_uc001grh.3_Intron	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823												0						GTGTTAAGTGAAAAAAAAAAg	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293358	12293358	+	Intron	DEL	C	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293358delC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		tcccttccttcccttccttcc	0.000													4	2	---	---	---	---	
CAD	790	broad.mit.edu	37	2	27459885	27459886	+	Intron	INS	-	T	T	rs149723808		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27459885_27459886insT	uc002rji.2	+						CAD_uc010eyw.2_Intron	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate						'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	TGTCTGAGGAAttttttttttt	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	44254186	44254189	+	IGR	DEL	AAGA	-	-	rs142194312	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44254186_44254189delAAGA								LRPPRC (31042 upstream) : PPM1B (141811 downstream)																							ggaaggaaggaagaaagaaaggaa	0.078													3	4	---	---	---	---	
SP100	6672	broad.mit.edu	37	2	231330900	231330900	+	Intron	DEL	A	-	-	rs72202243		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231330900delA	uc002vqt.2	+						SP100_uc002vqs.2_Intron|SP100_uc002vqu.1_Intron|SP100_uc002vqq.1_Intron|SP100_uc002vqr.1_Intron|SP100_uc010zmc.1_Intron|SP100_uc002vqv.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		actccatctcaaaaaaaaaaa	0.149													6	4	---	---	---	---	
D2HGDH	728294	broad.mit.edu	37	2	242680355	242680356	+	Intron	INS	-	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242680355_242680356insA	uc002wce.1	+						D2HGDH_uc010zpc.1_Intron|D2HGDH_uc010fzq.1_Intron|D2HGDH_uc002wcg.1_Intron	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor						2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		agtccgtctccaaaaaaaaaaa	0.262													4	3	---	---	---	---	
ITPR1	3708	broad.mit.edu	37	3	4715262	4715273	+	Intron	DEL	TTTGTTTGTTTG	-	-	rs112871347		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4715262_4715273delTTTGTTTGTTTG	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Intron	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		GTTTTTGGTTtttgtttgtttgtttgtttgtt	0.137													4	2	---	---	---	---	
C3orf19	51244	broad.mit.edu	37	3	14702848	14702849	+	Intron	INS	-	T	T	rs141125865	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14702848_14702849insT	uc003byw.2	+						C3orf19_uc010hei.1_Intron|C3orf19_uc010hej.2_Intron	NM_016474	NP_057558	Q6PII3	CC019_HUMAN	hypothetical protein LOC51244												0						CTTTTTCAAGATTTTTTTGTGT	0.401													0	7	---	---	---	---	
CAPN7	23473	broad.mit.edu	37	3	15288743	15288743	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15288743delT	uc003bzn.2	+							NM_014296	NP_055111	Q9Y6W3	CAN7_HUMAN	calpain 7						proteolysis	nucleus	calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1						GAAAATTGCCTTTTTTTTTTT	0.353													5	3	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	51266881	51266881	+	Intron	DEL	A	-	-	rs113104131		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51266881delA	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		gactccgtctaaaaaaaaaaa	0.214													3	3	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160965262	160965263	+	Intron	INS	-	T	T			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160965262_160965263insT	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			TAATAGCaaaattttttttttt	0.178													4	2	---	---	---	---	
YEATS2	55689	broad.mit.edu	37	3	183521660	183521660	+	Intron	DEL	A	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183521660delA	uc003fly.2	+							NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TTTTTTCTTTAAAAAAAAAAA	0.328													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	70066030	70066031	+	5'Flank	INS	-	TT	TT	rs60147183		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70066030_70066031insTT	uc003hei.1	+											Homo sapiens cDNA FLJ42278 fis, clone TLIVE2002562.																		AGATTTGAAAAttttttttttt	0.287													4	2	---	---	---	---	
SHROOM3	57619	broad.mit.edu	37	4	77669967	77669968	+	Intron	INS	-	T	T	rs34047499		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77669967_77669968insT	uc011cbx.1	+						SHROOM3_uc003hkg.2_Intron	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			tctgactctgcttttttttttt	0.327													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	146377564	146377564	+	IGR	DEL	A	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146377564delA								OTUD4 (276732 upstream) : SMAD1 (25387 downstream)																							AGATTCTACTAAAAAAAAAAT	0.433													10	5	---	---	---	---	
KIAA1430	57587	broad.mit.edu	37	4	186097219	186097220	+	Intron	INS	-	A	A	rs149317463	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186097219_186097220insA	uc003ixf.3	-						KIAA1430_uc003ixg.2_Intron	NM_020827	NP_065878	Q9P2B7	K1430_HUMAN	hypothetical protein LOC57587												0		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		CAGAAAAGAACAAAAAAAAAAG	0.257													13	6	---	---	---	---	
CCT5	22948	broad.mit.edu	37	5	10254505	10254505	+	Intron	DEL	T	-	-	rs140671145		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10254505delT	uc003jeq.2	+						CCT5_uc011cmq.1_Intron|CCT5_uc003jer.2_Intron|CCT5_uc010its.2_Intron|CCT5_uc011cmr.1_Intron|CCT5_uc011cms.1_Intron|CCT5_uc011cmt.1_Intron	NM_012073	NP_036205	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)						'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2						AGGTCGGACCTTTTTTTTTTT	0.308													4	2	---	---	---	---	
CDH6	1004	broad.mit.edu	37	5	31267935	31267935	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31267935delT	uc003jhe.1	+						CDH6_uc003jhd.1_Intron	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						CTGGTAAGACTTTTTTTTTTT	0.368													3	3	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	90025688	90025688	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90025688delT	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjv.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ACACTGGGTAttttttttttt	0.174													6	3	---	---	---	---	
NRG2	9542	broad.mit.edu	37	5	139244832	139244833	+	Intron	INS	-	C	C			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139244832_139244833insC	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874	O14511	NRG2_HUMAN	neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGGCACGGGCTCCTGCCAAT	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180708698	180708699	+	IGR	INS	-	G	G	rs1815381		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180708698_180708699insG								TRIM52 (20579 upstream) : None (None downstream)																							gggcggtaggcgggggctggag	0.213													1	5	---	---	---	---	
HLA-C	3107	broad.mit.edu	37	6	31237576	31237577	+	Intron	DEL	CA	-	-	rs72558156		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31237576_31237577delCA	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_Intron|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						CCTTCATTGTCACATGTGCTTC	0.520													4	2	---	---	---	---	
IGF2R	3482	broad.mit.edu	37	6	160465465	160465465	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160465465delT	uc003qta.2	+							NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		tctttctttcttttttttttA	0.393													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	167342833	167342834	+	IGR	INS	-	A	A	rs10694728		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167342833_167342834insA								RPS6KA2 (67062 upstream) : RNASET2 (174 downstream)																							GTTTAATAGAGAAAAAAAAAAA	0.480													4	2	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133184644	133184645	+	Intron	INS	-	AC	AC	rs145501006	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133184644_133184645insAC	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GGCACATTAATacacacacaca	0.337													4	4	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69389918	69389918	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69389918delT	uc004afn.2	+						ANKRD20A4_uc010mnw.1_Intron	NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						GAATTATTAATTTTTTTCTGC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38939448	38939450	+	IGR	DEL	AAT	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38939448_38939450delAAT								LOC399744 (198368 upstream) : None (None downstream)																							TCTTACCAACAATATTTGATTCA	0.222													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42528030	42528030	+	IGR	DEL	G	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42528030delG								None (None upstream) : LOC441666 (299285 downstream)																							attatatgaagaaatcccgtt	0.000													8	4	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69995756	69995756	+	Intron	DEL	A	-	-	rs72410022		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69995756delA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						aactctgtctaaaaaaaaaaa	0.234													5	5	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117647344	117647344	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117647344delT	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GACCAAAGACTTTTTTTTTTT	0.488													11	6	---	---	---	---	
ATF7	11016	broad.mit.edu	37	12	53926424	53926424	+	Intron	DEL	A	-	-	rs111391259		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53926424delA	uc001sdy.2	-						ATF7_uc010sok.1_Intron|ATF7_uc001sdz.2_Intron|ATF7_uc010sol.1_Intron	NM_001130059	NP_001123531	P17544	ATF7_HUMAN	activating transcription factor 7 isoform 1						interspecies interaction between organisms	cytoplasm|nuclear periphery|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						CGAGAGAAGGAAAAAAAAAAA	0.493													2	6	---	---	---	---	
SNX6	58533	broad.mit.edu	37	14	35037841	35037841	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35037841delT	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419	Q9UNH7	SNX6_HUMAN	sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		actcagccTGTTTTTTTTTTT	0.194													3	3	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28491744	28491745	+	Intron	INS	-	A	A	rs139539730		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28491744_28491745insA	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TGTCAGTAACTAAAAAAAAAAA	0.347													5	3	---	---	---	---	
RASGRP1	10125	broad.mit.edu	37	15	38792549	38792549	+	Intron	DEL	G	-	-	rs12904148	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38792549delG	uc001zke.3	-						RASGRP1_uc010bbe.2_Intron|RASGRP1_uc010bbf.2_Intron|RASGRP1_uc010bbg.2_Intron|RASGRP1_uc001zkd.3_Intron	NM_005739	NP_005730	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 isoform a						cell differentiation|platelet activation|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|lipid binding|protein binding			large_intestine(1)|ovary(1)	2		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		GGttttttttgttttgttttt	0.179													4	2	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99459491	99459491	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99459491delT	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron|IGF1R_uc010urr.1_Intron	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	TATCTTCTGGttttttttttt	0.224													7	4	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21071848	21071848	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21071848delT	uc010vbe.1	-							NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		tttttttttcttttttttttt	0.209													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33365420	33365420	+	IGR	DEL	A	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33365420delA								SLC6A10P (468957 upstream) : MIR1826 (600088 downstream)																							TACAAACTATAAAAAAACAGA	0.358													4	2	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1377722	1377725	+	Intron	DEL	AAAA	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1377722_1377725delAAAA	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		accctgtctcaaaaaaaaaaaaaa	0.245													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33422636	33422637	+	IGR	INS	-	A	A	rs142073173	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33422636_33422637insA								GALNT1 (130839 upstream) : MIR187 (62144 downstream)																							AGTTAATGCAGAAAAAAAAATG	0.391													4	2	---	---	---	---	
ACAA2	10449	broad.mit.edu	37	18	47328930	47328931	+	Intron	INS	-	AA	AA	rs74176744		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47328930_47328931insAA	uc002ldw.3	-						ACAA2_uc002ldx.3_Intron	NM_006111	NP_006102	P42765	THIM_HUMAN	acetyl-coenzyme A acyltransferase 2						anti-apoptosis|cholesterol biosynthetic process		acetyl-CoA C-acyltransferase activity|protein binding			ovary(1)	1						gactccatctcaaaaaaaaaaa	0.104													3	3	---	---	---	---	
SMAD4	4089	broad.mit.edu	37	18	48573269	48573269	+	Intron	DEL	T	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48573269delT	uc010xdp.1	+						SMAD4_uc010xdo.1_Intron	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4						BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity			pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GATGTGTGTCTTTTTTTTTTT	0.318									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				3	3	---	---	---	---	
HAUS5	23354	broad.mit.edu	37	19	36108384	36108408	+	Intron	DEL	GACTTCCAGGCTGGGAATAGAAGGA	-	-	rs139008634	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36108384_36108408delGACTTCCAGGCTGGGAATAGAAGGA	uc002oam.1	+							NM_015302	NP_056117	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle					0						TGTAGAAGGGGACTTCCAGGCTGGGAATAGAAGGAGACAGTCTCT	0.547													4	2	---	---	---	---	
ZIM3	114026	broad.mit.edu	37	19	57654209	57654209	+	Intron	DEL	T	-	-	rs113123994		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57654209delT	uc002qnz.1	-							NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCTGAAGGTCTTTTTTTTTTT	0.343													5	3	---	---	---	---	
SEL1L2	80343	broad.mit.edu	37	20	13894739	13894740	+	Intron	INS	-	T	T	rs147701926	by1000genomes	TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13894739_13894740insT	uc010gcf.2	-						SEL1L2_uc002woq.3_Intron|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor							integral to membrane	binding			ovary(2)	2						AGATCAGTAGATTTTTTTCATT	0.312													3	7	---	---	---	---	
ZMYND8	23613	broad.mit.edu	37	20	45890815	45890816	+	Intron	INS	-	A	A			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45890815_45890816insA	uc002xta.1	-						ZMYND8_uc010ghq.1_Intron|ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			aactccatctcaaaaaaaaaaa	0.153													5	3	---	---	---	---	
SYAP1	94056	broad.mit.edu	37	X	16759629	16759629	+	Intron	DEL	T	-	-	rs11364120		TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16759629delT	uc004cxp.2	+						SYAP1_uc004cxo.2_Intron|SYAP1_uc011miv.1_Intron	NM_032796	NP_116185	Q96A49	SYAP1_HUMAN	SYAP1 protein											skin(1)	1	Hepatocellular(33;0.0997)					TCAAGTAGAGTTTTTTTTTTT	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	52613556	52613557	+	IGR	DEL	AC	-	-			TCGA-C5-A1MP-01	TCGA-C5-A1MP-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52613556_52613557delAC								XAGE1D (369605 upstream) : SSX8 (38428 downstream)																							acacacacagacacacacacac	0.361													4	3	---	---	---	---	
