Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
COL16A1	1307	broad.mit.edu	37	1	32124127	32124127	+	Missense_Mutation	SNP	G	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32124127G>T	uc001btk.1	-	64	4347	c.3982C>A	c.(3982-3984)CCA>ACA	p.P1328T	COL16A1_uc001bti.1_5'UTR|COL16A1_uc001btj.1_Missense_Mutation_p.P1126T	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	1328	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GGCTGGCCTGGGAGGCCTGCA	0.607													3	22	---	---	---	---	PASS
BAI2	576	broad.mit.edu	37	1	32222827	32222827	+	5'UTR	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32222827C>G	uc001btn.2	-	3					BAI2_uc010ogp.1_5'Flank|BAI2_uc010ogq.1_5'UTR|BAI2_uc001bto.2_5'UTR|BAI2_uc001btq.1_5'Flank|BAI2_uc010ogr.1_5'Flank	NM_001703	NP_001694	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CTCCATAACTCTTGCTCTCCA	0.483													105	181	---	---	---	---	PASS
MAP7D1	55700	broad.mit.edu	37	1	36643631	36643631	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36643631G>T	uc001bzz.2	+	9	1753	c.1537G>T	c.(1537-1539)GAG>TAG	p.E513*	MAP7D1_uc001caa.2_Nonsense_Mutation_p.E481*|MAP7D1_uc001cab.2_Nonsense_Mutation_p.E476*|MAP7D1_uc001cac.2_Nonsense_Mutation_p.E213*|MAP7D1_uc001cad.2_Nonsense_Mutation_p.E59*	NM_018067	NP_060537	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	513	Pro-rich.					cytoplasm|spindle				ovary(3)|breast(2)	5		Myeloproliferative disorder(586;0.0393)				GAGGAAGGAGGAGGCAAAGGA	0.701													15	24	---	---	---	---	PASS
GJA9	81025	broad.mit.edu	37	1	39341324	39341324	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39341324G>A	uc001cct.1	-	2	728	c.447C>T	c.(445-447)CTC>CTT	p.L149L	RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	NM_030772	NP_110399	P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	149	Cytoplasmic (Potential).				cell communication	connexon complex|integral to membrane					0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			AGGTTCCTCTGAGTGGAGCTT	0.423													66	147	---	---	---	---	PASS
KIAA1324	57535	broad.mit.edu	37	1	109714534	109714534	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109714534G>A	uc001dwq.2	+	5	650	c.514G>A	c.(514-516)GAA>AAA	p.E172K	KIAA1324_uc009wex.1_Missense_Mutation_p.E172K|KIAA1324_uc009wey.2_Missense_Mutation_p.E172K|KIAA1324_uc010ovg.1_Missense_Mutation_p.E70K	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor	172	Extracellular (Potential).				macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		CAACACGGACGAATGCACAGC	0.532													19	143	---	---	---	---	PASS
TTF2	8458	broad.mit.edu	37	1	117633147	117633147	+	Intron	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117633147C>G	uc001egy.2	+							NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TTTTTTTATTCTTCCAGGTGA	0.373													22	45	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152281070	152281070	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152281070C>T	uc001ezu.1	-	3	6328	c.6292G>A	c.(6292-6294)GAA>AAA	p.E2098K		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2098	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCAGACTGTTCATGAGTGCTC	0.572									Ichthyosis				131	257	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152281894	152281894	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152281894C>A	uc001ezu.1	-	3	5504	c.5468G>T	c.(5467-5469)GGA>GTA	p.G1823V		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1823	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCCTGCCTTCCTCCTCTGCT	0.582									Ichthyosis				253	549	---	---	---	---	PASS
INTS3	65123	broad.mit.edu	37	1	153719426	153719426	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153719426C>T	uc009wom.2	+						INTS3_uc001fct.2_Intron|INTS3_uc001fcu.2_Intron|INTS3_uc001fcv.2_Intron	NM_023015	NP_075391	Q68E01	INT3_HUMAN	integrator complex subunit 3						DNA repair|G2/M transition checkpoint|response to ionizing radiation|snRNA processing	integrator complex|SOSS complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AACTTTACTTCTCACAGTGTT	0.458													22	68	---	---	---	---	PASS
DENND4B	9909	broad.mit.edu	37	1	153902843	153902843	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153902843C>T	uc001fdd.1	-	28	4822	c.4421G>A	c.(4420-4422)CGG>CAG	p.R1474Q	uc001fdc.1_Intron	NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	1474										ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTGCGCCCGCCGGTGCCTCAG	0.552													33	51	---	---	---	---	PASS
RGL1	23179	broad.mit.edu	37	1	183874076	183874076	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183874076G>A	uc001gqo.2	+	13	1600	c.1443G>A	c.(1441-1443)CAG>CAA	p.Q481Q	RGL1_uc010pof.1_Silent_p.Q286Q|RGL1_uc001gqm.2_Silent_p.Q516Q|RGL1_uc010pog.1_Silent_p.Q479Q|RGL1_uc010poh.1_Silent_p.Q479Q|RGL1_uc010poi.1_Silent_p.Q452Q	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation	481	Ras-GEF.				cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						AGTGGTTCCAGAGGCAGCAGC	0.483													63	86	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186292910	186292910	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186292910G>A	uc001grv.2	-	43	6502	c.6205C>T	c.(6205-6207)CGA>TGA	p.R2069*		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	2069					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGAGGTGCTCGAGGGGCCTGT	0.512			T	NTRK1	papillary thyroid								66	133	---	---	---	---	PASS
TNNT2	7139	broad.mit.edu	37	1	201333443	201333443	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201333443G>A	uc001gwf.2	-	11	541	c.472C>T	c.(472-474)CGG>TGG	p.R158W	TNNT2_uc009wzn.2_5'Flank|TNNT2_uc009wzo.2_5'Flank|TNNT2_uc009wzp.2_5'Flank|TNNT2_uc001gwg.2_Missense_Mutation_p.R148W|TNNT2_uc001gwh.2_Missense_Mutation_p.R143W|TNNT2_uc001gwi.2_Missense_Mutation_p.R118W|TNNT2_uc009wzr.2_Missense_Mutation_p.R89W|TNNT2_uc001gwj.1_5'Flank|TNNT2_uc009wzs.1_Missense_Mutation_p.R123W|TNNT2_uc001gwk.1_Missense_Mutation_p.R89W|TNNT2_uc009wzt.1_Missense_Mutation_p.R148W	NM_000364	NP_000355	P45379	TNNT2_HUMAN	troponin T type 2, cardiac isoform 1	158					ATP catabolic process|muscle filament sliding|negative regulation of ATPase activity|positive regulation of ATPase activity|regulation of heart contraction|response to calcium ion|response to calcium ion|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|tropomyosin binding|troponin C binding|troponin I binding				0						CGGTTCTGCCGCTCCTTCTCC	0.662													26	34	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228486166	228486166	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228486166C>T	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsq.1_Nonsense_Mutation_p.R1147*	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCTGCCTGCACGATTCACTCA	0.547													60	192	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1926313	1926313	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1926313C>T	uc002qxe.2	-	10	2055	c.1228G>A	c.(1228-1230)GAC>AAC	p.D410N	MYT1L_uc002qxd.2_Missense_Mutation_p.D410N|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	410					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GTGGTATCGTCGTCCCGCTCA	0.582													30	55	---	---	---	---	PASS
ADAM17	6868	broad.mit.edu	37	2	9631288	9631288	+	Intron	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9631288G>C	uc002qzu.2	-						IAH1_uc010yiz.1_Intron|ADAM17_uc010ewy.2_Intron|ADAM17_uc010ewz.2_Intron	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17						B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		ATCCTAGAAAGAAACAGCAAG	0.368													28	67	---	---	---	---	PASS
RRM2	6241	broad.mit.edu	37	2	10263000	10263000	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10263000C>T	uc002rah.2	+	1	266	c.75C>T	c.(73-75)CTC>CTT	p.L25L		NM_001034	NP_001025	P31350	RIR2_HUMAN	ribonucleotide reductase M2 polypeptide isoform	25					deoxyribonucleoside diphosphate metabolic process|deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol	ribonucleoside-diphosphate reductase activity|transition metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)		TGAAGGGGCTCAGCTTGGTCG	0.692													5	1	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37295890	37295890	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37295890C>T	uc002rpp.1	-	8	1207	c.1111G>A	c.(1111-1113)GAA>AAA	p.E371K		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	371							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				TGGGCTTTTTCACCTAGCAAA	0.448													37	90	---	---	---	---	PASS
QPCT	25797	broad.mit.edu	37	2	37596909	37596909	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37596909G>A	uc002rqg.2	+	5	927	c.805G>A	c.(805-807)GAA>AAA	p.E269K	QPCT_uc002rqh.2_Missense_Mutation_p.E220K	NM_012413	NP_036545	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase precursor	269					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	extracellular region	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|zinc ion binding			central_nervous_system(1)	1		Ovarian(717;0.051)|all_hematologic(82;0.21)				CAGGTGGTTCGAAAGACTTCA	0.328													60	97	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	51255079	51255079	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51255079G>A	uc010fbq.2	-	2	1810	c.333C>T	c.(331-333)GAC>GAT	p.D111D	NRXN1_uc002rxe.3_Silent_p.D111D|NRXN1_uc002rxd.1_Silent_p.D111D	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	174	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCCAGGCGCCGTCGTTAACCG	0.662													15	42	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56603037	56603037	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56603037C>T	uc002rzn.2	+	5	2041	c.1539C>T	c.(1537-1539)TCC>TCT	p.S513S		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	513										breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CCACACCTTCCCAGCAGCCTG	0.478													22	65	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56603038	56603038	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56603038C>T	uc002rzn.2	+	5	2042	c.1540C>T	c.(1540-1542)CAG>TAG	p.Q514*		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	514										breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CACACCTTCCCAGCAGCCTGA	0.478													23	64	---	---	---	---	PASS
POLR1A	25885	broad.mit.edu	37	2	86258468	86258468	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86258468C>T	uc002sqs.2	-	30	4942	c.4563G>A	c.(4561-4563)GAG>GAA	p.E1521E	POLR1A_uc010ytb.1_Silent_p.E887E	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	1521					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						ACCACAGGCTCTCCTCGGTGT	0.657													67	127	---	---	---	---	PASS
GPAT2	150763	broad.mit.edu	37	2	96690050	96690050	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96690050G>A	uc002svf.2	-	16	1928	c.1705C>T	c.(1705-1707)CCG>TCG	p.P569S	GPAT2_uc002svd.2_Missense_Mutation_p.P388S|GPAT2_uc002sve.2_Missense_Mutation_p.P371S|GPAT2_uc002svg.2_Missense_Mutation_p.P448S|GPAT2_uc010yuh.1_Missense_Mutation_p.P498S|GPAT2_uc002svh.2_Missense_Mutation_p.P569S	NM_207328	NP_997211	Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2,	569					glycerol-3-phosphate metabolic process|phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity				0						CCCTGGGGCGGCACTCTGCCT	0.642													3	17	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100185373	100185373	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100185373G>A	uc002tag.2	-	18	3159	c.2923C>T	c.(2923-2925)CGC>TGC	p.R975C	AFF3_uc002taf.2_Missense_Mutation_p.R1000C	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	975					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						TCGGCACTGCGAGGCCTACAA	0.368													48	124	---	---	---	---	PASS
NPAS2	4862	broad.mit.edu	37	2	101611992	101611992	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101611992G>A	uc002tap.1	+	21	2709	c.2423G>A	c.(2422-2424)CGA>CAA	p.R808Q	NPAS2_uc010yvt.1_Missense_Mutation_p.R873Q|NPAS2_uc010fit.1_3'UTR	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	808					central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						CGTCCTCCCCGAAGGGTCAGC	0.617													11	50	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152359890	152359890	+	Silent	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152359890G>C	uc010fnx.2	-	138	18896	c.18705C>G	c.(18703-18705)GTC>GTG	p.V6235V	NEB_uc002txr.2_Silent_p.V2658V|RIF1_uc002txp.2_Intron|NEB_uc002txq.2_Silent_p.V21V|NEB_uc010zca.1_Silent_p.V66V|NEB_uc010zcb.1_Silent_p.V66V|NEB_uc002txt.3_Silent_p.V740V	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	6235	Nebulin 171.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GATTGCGTTTGACTCTCTCAA	0.328													21	67	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170022443	170022443	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170022443G>C	uc002ues.2	-	62	11970	c.11757C>G	c.(11755-11757)CAC>CAG	p.H3919Q		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3919	LDL-receptor class A 35.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TTTGCTTACAGTGCTCCTCTG	0.453													49	162	---	---	---	---	PASS
KLHL23	151230	broad.mit.edu	37	2	170591579	170591579	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170591579C>G	uc002ufh.1	+	4	393	c.55C>G	c.(55-57)CCA>GCA	p.P19A	KLHL23_uc002ufi.1_Missense_Mutation_p.P19A	NM_144711	NP_653312	Q8NBE8	KLH23_HUMAN	kelch-like 23	19											0						TTCAACACATCCAGTGGATTT	0.338													21	185	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098799	178098799	+	Missense_Mutation	SNP	T	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098799T>A	uc002ulh.3	-	2	801	c.246A>T	c.(244-246)GAA>GAT	p.E82D	NFE2L2_uc002ulg.3_Missense_Mutation_p.E66D|NFE2L2_uc010zfa.1_Missense_Mutation_p.E66D|NFE2L2_uc002uli.3_Missense_Mutation_p.E66D|NFE2L2_uc010fra.2_Missense_Mutation_p.E66D|NFE2L2_uc010frb.2_Missense_Mutation_p.E66D	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	82					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTGGGAGAAATTCACCTGTCT	0.433			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			49	76	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182323022	182323022	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182323022G>C	uc002unu.2	+	2	1060	c.297G>C	c.(295-297)CAG>CAC	p.Q99H	ITGA4_uc002unt.2_Missense_Mutation_p.Q99H|ITGA4_uc010zfl.1_Missense_Mutation_p.Q99H	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	99	FG-GAP 1.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	ATCCCGGCCAGACGTGCGAAC	0.602													9	22	---	---	---	---	PASS
SGOL2	151246	broad.mit.edu	37	2	201440108	201440108	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201440108G>C	uc002uvw.2	+	8	3819	c.3706G>C	c.(3706-3708)GAA>CAA	p.E1236Q	SGOL2_uc010zhd.1_Missense_Mutation_p.E1236Q|SGOL2_uc010zhe.1_Missense_Mutation_p.Q1233H	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	1236					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						AAATAAGTCAGAAGATCTATC	0.333													32	85	---	---	---	---	PASS
UNC80	285175	broad.mit.edu	37	2	210658594	210658594	+	Intron	SNP	G	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210658594G>T	uc010zjc.1	+						UNC80_uc002vdj.1_Intron	NM_032504	NP_115893	Q8N2C7	UNC80_HUMAN	chromosome 2 open reading frame 21 isoform 1							integral to membrane					0						GTACCTGATTGCAATGTTAGG	0.423													34	65	---	---	---	---	PASS
ACSL3	2181	broad.mit.edu	37	2	223789234	223789234	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223789234C>T	uc002vni.2	+	11	1664	c.1213C>T	c.(1213-1215)CAA>TAA	p.Q405*	ACSL3_uc002vnj.2_Nonsense_Mutation_p.Q405*	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	405	Cytoplasmic (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	GAGTAGTTTTCAACGTAATCT	0.318			T	ETV1	prostate								12	50	---	---	---	---	PASS
IQCA1	79781	broad.mit.edu	37	2	237272528	237272528	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237272528G>C	uc002vvz.1	-	15	1946	c.1764C>G	c.(1762-1764)ATC>ATG	p.I588M	IQCA1_uc002vwb.2_Missense_Mutation_p.I596M|IQCA1_uc002vwa.1_RNA|IQCA1_uc010zni.1_Missense_Mutation_p.I547M	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	588							ATP binding			ovary(1)	1						TTTCGGTGCAGATGGCATGGA	0.507													51	105	---	---	---	---	PASS
SLC6A11	6538	broad.mit.edu	37	3	10916770	10916770	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10916770C>G	uc003bvz.2	+	6	915	c.881C>G	c.(880-882)TCC>TGC	p.S294C		NM_014229	NP_055044	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter	294					neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.229)		TCCCGGCTCTCCGACCCCCAG	0.592													32	50	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38648201	38648201	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38648201G>A	uc003cio.2	-	9	1293	c.1099C>T	c.(1099-1101)CGC>TGC	p.R367C	SCN5A_uc003cin.2_Missense_Mutation_p.R367C|SCN5A_uc003cil.3_Missense_Mutation_p.R367C|SCN5A_uc010hhi.2_Missense_Mutation_p.R367C|SCN5A_uc010hhk.2_Missense_Mutation_p.R367C|SCN5A_uc011ayr.1_Missense_Mutation_p.R367C|SCN5A_uc010hhj.1_5'Flank	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	367					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GTCATCAGGCGGAAGAGTGCA	0.607													28	25	---	---	---	---	PASS
IFT122	55764	broad.mit.edu	37	3	129236334	129236334	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129236334C>T	uc003emm.2	+	27	3494	c.3288C>T	c.(3286-3288)TTC>TTT	p.F1096F	IFT122_uc003eml.2_Silent_p.F1147F|IFT122_uc003emn.2_Silent_p.F1037F|IFT122_uc003emo.2_Silent_p.F986F|IFT122_uc003emp.2_Silent_p.F946F|IFT122_uc010htc.2_Silent_p.F1089F|IFT122_uc011bky.1_Silent_p.F887F|IFT122_uc003emq.2_Silent_p.F936F|IFT122_uc003emr.2_Silent_p.F849F|IFT122_uc011bla.1_Silent_p.F870F|IFT122_uc010hte.2_Silent_p.F422F|IFT122_uc003ems.2_Silent_p.F478F	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2	1096					camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						TGGTTGAGTTCTACCTGGAGG	0.572													30	95	---	---	---	---	PASS
TMEM22	80723	broad.mit.edu	37	3	136574394	136574394	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136574394C>T	uc003erf.3	+	2	1306	c.1092C>T	c.(1090-1092)CTC>CTT	p.L364L	TMEM22_uc003erg.3_Silent_p.L364L|TMEM22_uc010hub.2_Silent_p.L364L	NM_001097600	NP_001091069	Q8TBE7	TMM22_HUMAN	transmembrane protein 22	364	DUF6 2.					Golgi apparatus|integral to membrane				ovary(1)	1						TGCAGCTTCTCGTGCTGCACA	0.393													113	386	---	---	---	---	PASS
DZIP1L	199221	broad.mit.edu	37	3	137811366	137811366	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137811366C>G	uc003erq.2	-	5	1092	c.729G>C	c.(727-729)CAG>CAC	p.Q243H	DZIP1L_uc003err.1_Missense_Mutation_p.Q243H	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like	243	Potential.					intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						CTATTTCCCTCTGATGAATGA	0.333													46	173	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141162660	141162660	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141162660G>C	uc003etw.2	+	8	2412	c.1430G>C	c.(1429-1431)AGA>ACA	p.R477T	ZBTB38_uc010hun.2_Missense_Mutation_p.R474T|ZBTB38_uc010huo.2_Missense_Mutation_p.R477T|ZBTB38_uc003ety.2_Missense_Mutation_p.R477T|ZBTB38_uc010hup.2_Missense_Mutation_p.R478T	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	477	C2H2-type 3.				positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AGCCTCCGAAGACATGCAAAT	0.428													73	68	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141162767	141162767	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141162767G>A	uc003etw.2	+	8	2519	c.1537G>A	c.(1537-1539)GAA>AAA	p.E513K	ZBTB38_uc010hun.2_Missense_Mutation_p.E510K|ZBTB38_uc010huo.2_Missense_Mutation_p.E513K|ZBTB38_uc003ety.2_Missense_Mutation_p.E513K|ZBTB38_uc010hup.2_Missense_Mutation_p.E514K	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	513					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						GCATACGGGAGAAAGACGATA	0.388													83	110	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141164162	141164162	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141164162G>C	uc003etw.2	+	8	3914	c.2932G>C	c.(2932-2934)GAG>CAG	p.E978Q	ZBTB38_uc010hun.2_Missense_Mutation_p.E975Q|ZBTB38_uc010huo.2_Missense_Mutation_p.E978Q|ZBTB38_uc003ety.2_Missense_Mutation_p.E978Q|ZBTB38_uc010hup.2_Missense_Mutation_p.E979Q	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	978					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AGAAACTAAAGAGATGCCCAA	0.517													32	37	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142180859	142180859	+	Missense_Mutation	SNP	T	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142180859T>G	uc003eux.3	-	42	7237	c.7115A>C	c.(7114-7116)GAT>GCT	p.D2372A	ATR_uc003euy.1_Missense_Mutation_p.D258A	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2372	PI3K/PI4K.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						CCCACATTCATCATTTAGTGG	0.313								Other_conserved_DNA_damage_response_genes					120	320	---	---	---	---	PASS
TNFSF10	8743	broad.mit.edu	37	3	172229399	172229399	+	Intron	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172229399G>A	uc003fid.2	-						TNFSF10_uc003fie.2_Intron	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,						activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CAACAAAAAAGATACTACCTT	0.323													22	41	---	---	---	---	PASS
PSMD2	5708	broad.mit.edu	37	3	184026613	184026613	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184026613C>T	uc003fnn.1	+	21	2695	c.2662C>T	c.(2662-2664)CTT>TTT	p.L888F	PSMD2_uc011brj.1_Missense_Mutation_p.L729F|PSMD2_uc011brk.1_Missense_Mutation_p.L758F	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	proteasome 26S non-ATPase subunit 2	888					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	TGAGGAGTTTCTTCCTGTTAC	0.527											OREG0015948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	57	306	---	---	---	---	PASS
DCAF16	54876	broad.mit.edu	37	4	17805707	17805707	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17805707C>A	uc003gpn.2	-	3	1119	c.58G>T	c.(58-60)GAA>TAA	p.E20*	DCAF16_uc003gpo.2_RNA	NM_017741	NP_060211	Q9NXF7	DCA16_HUMAN	DDB1 and CUL4 associated factor 16	20	Poly-Glu.					CUL4 RING ubiquitin ligase complex				ovary(1)	1						CTAATATTTTCTTCTTCCTCA	0.418													33	25	---	---	---	---	PASS
TMPRSS11A	339967	broad.mit.edu	37	4	68780365	68780365	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68780365C>G	uc003hdr.1	-	9	1166	c.1045G>C	c.(1045-1047)GAT>CAT	p.D349H	LOC550112_uc003hdl.3_Intron|TMPRSS11A_uc003hds.1_Missense_Mutation_p.D346H	NM_182606	NP_872412	Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A isoform 1	349	Peptidase S1.|Extracellular (Potential).				cell cycle|proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			skin(1)	1						GGTTTTATATCATTGCCATAC	0.383													74	146	---	---	---	---	PASS
HERC5	51191	broad.mit.edu	37	4	89390328	89390328	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89390328G>A	uc003hrt.2	+	9	1308	c.1155G>A	c.(1153-1155)AAG>AAA	p.K385K	HERC5_uc011cdm.1_Silent_p.K23K	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5	385					innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TTAATCTGAAGAGGACAATTC	0.398													6	58	---	---	---	---	PASS
HADH	3033	broad.mit.edu	37	4	108953508	108953508	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108953508C>T	uc003hyq.2	+						HADH_uc010ilx.2_Silent_p.N245N|HADH_uc010ily.2_Intron|HADH_uc003hyr.2_Intron	NM_005327	NP_005318	Q16836	HCDH_HUMAN	L-3-hydroxyacyl-Coenzyme A dehydrogenase						fatty acid beta-oxidation	mitochondrial matrix	3-hydroxyacyl-CoA dehydrogenase activity|NAD+ binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)	NADH(DB00157)	GTGATTCTAACTCGGGTTTGG	0.418													111	288	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115998171	115998171	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115998171G>A	uc003ibu.2	-	2	701	c.22C>T	c.(22-24)CGG>TGG	p.R8W	NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	8	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAACTTCTCCGAAGTTTCACA	0.348													15	30	---	---	---	---	PASS
SYNPO2	171024	broad.mit.edu	37	4	119951968	119951968	+	Silent	SNP	A	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119951968A>C	uc003icm.3	+	4	2234	c.2038A>C	c.(2038-2040)AGA>CGA	p.R680R	SYNPO2_uc010ina.2_Silent_p.R680R|SYNPO2_uc010inb.2_Silent_p.R680R|SYNPO2_uc011cgh.1_Intron|SYNPO2_uc010inc.2_Silent_p.R608R	NM_001128933	NP_001122405	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform b	680						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						GCCAGCAAAAAGAACAGGAAT	0.507													5	82	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126398366	126398366	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126398366C>A	uc003ifj.3	+	13	12350	c.12350C>A	c.(12349-12351)CCA>CAA	p.P4117Q	FAT4_uc011cgp.1_Missense_Mutation_p.P2380Q|FAT4_uc003ifi.1_Missense_Mutation_p.P1595Q	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4117	Laminin G-like 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TCTCTAGAACCAATCCTTCAG	0.393													77	179	---	---	---	---	PASS
TTC29	83894	broad.mit.edu	37	4	147755054	147755054	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147755054C>T	uc003ikw.3	-						TTC29_uc010ipc.2_Intron|TTC29_uc003ikx.3_Intron|TTC29_uc010ipd.1_Intron	NM_031956	NP_114162	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29								binding				0	all_hematologic(180;0.151)					AAGGACCTATCAGGAAGAGAA	0.388													20	52	---	---	---	---	PASS
PDGFC	56034	broad.mit.edu	37	4	157693949	157693949	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157693949C>T	uc003iph.1	-	4	1083	c.592G>A	c.(592-594)GAC>AAC	p.D198N	PDGFC_uc003ipi.1_Missense_Mutation_p.D35N|PDGFC_uc011cis.1_Missense_Mutation_p.D35N|PDGFC_uc011cir.1_Missense_Mutation_p.D42N	NM_016205	NP_057289	Q9NRA1	PDGFC_HUMAN	platelet-derived growth factor C precursor	198					central nervous system development|platelet-derived growth factor receptor signaling pathway|positive regulation of cell division|positive regulation of DNA replication|positive regulation of fibroblast proliferation|vascular endothelial growth factor receptor signaling pathway	endoplasmic reticulum lumen|extracellular space|Golgi membrane|nucleus	cell surface binding|growth factor activity|platelet-derived growth factor receptor binding|protein homodimerization activity			ovary(1)|lung(1)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		CGAATAAGGTCTTCCAAGGTA	0.438													7	110	---	---	---	---	PASS
CHD1	1105	broad.mit.edu	37	5	98212254	98212254	+	Silent	SNP	G	A	A	rs34603291		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98212254G>A	uc003knf.2	-	23	3394	c.3246C>T	c.(3244-3246)TTC>TTT	p.F1082F	CHD1_uc010jbn.2_5'Flank	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1082					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CACTTCCATTGAAACTAATCT	0.388													43	54	---	---	---	---	PASS
SEC24A	10802	broad.mit.edu	37	5	134002535	134002535	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134002535G>A	uc003kzs.2	+	3	876	c.588G>A	c.(586-588)GTG>GTA	p.V196V	SEC24A_uc011cxu.1_5'UTR	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	196	Pro-rich.				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTCCCTTAGTGAATCCACCTC	0.527													36	51	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140755393	140755393	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140755393C>T	uc003ljy.1	+	1	1743	c.1743C>T	c.(1741-1743)TCC>TCT	p.S581S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.S581S	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	581	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCCCGCTCCGCAGAGCCCG	0.667													85	79	---	---	---	---	PASS
SLC36A2	153201	broad.mit.edu	37	5	150696422	150696422	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150696422C>T	uc003lty.2	-	10	1538	c.1408G>A	c.(1408-1410)GAA>AAA	p.E470K	GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_Missense_Mutation_p.E272K	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2	470	Extracellular (Potential).				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAGAGTCTTCTGACTTGAGC	0.552													41	40	---	---	---	---	PASS
C6orf195	154386	broad.mit.edu	37	6	2623874	2623874	+	Silent	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2623874G>C	uc003mtw.2	-	3	1168	c.183C>G	c.(181-183)CCC>CCG	p.P61P		NM_152554	NP_689767	Q96MT4	CF195_HUMAN	hypothetical protein LOC154386	61											0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				GGCCGGACCCGGGAGGGGAGA	0.632													46	58	---	---	---	---	PASS
BTN2A1	11120	broad.mit.edu	37	6	26468224	26468224	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26468224C>T	uc003nib.1	+	8	1243	c.1031C>T	c.(1030-1032)TCA>TTA	p.S344L	BTN2A1_uc003nic.1_3'UTR|BTN2A1_uc003nid.1_Missense_Mutation_p.S192L|BTN2A1_uc011dko.1_Missense_Mutation_p.S283L|BTN2A1_uc010jqk.1_Missense_Mutation_p.S104L	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1	344	Cytoplasmic (Potential).|B30.2/SPRY.				lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						CTCTTCCTGTCAGAGGACCGG	0.577													5	88	---	---	---	---	PASS
PSMB8	5696	broad.mit.edu	37	6	32810860	32810860	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32810860C>T	uc003oce.2	-	2	197	c.154G>A	c.(154-156)GAA>AAA	p.E52K	PSMB8_uc003ocf.2_Missense_Mutation_p.E48K|PSMB8_uc011dqh.1_Missense_Mutation_p.E52K	NM_148919	NP_683720	P28062	PSB8_HUMAN	proteasome beta 8 subunit isoform E2 proprotein	52					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|type I interferon-mediated signaling pathway|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			skin(1)	1						TGGAAGAATTCTGTGGGCTGA	0.488													22	19	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90396657	90396657	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90396657C>G	uc003pnn.1	-	69	11652	c.11536G>C	c.(11536-11538)GAG>CAG	p.E3846Q		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	3846					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATGTGCTTCTCAAGCATCTGA	0.473													31	241	---	---	---	---	PASS
KIAA0776	23376	broad.mit.edu	37	6	96988513	96988513	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96988513C>T	uc003por.2	+	11	1309	c.1261C>T	c.(1261-1263)CGA>TGA	p.R421*	KIAA0776_uc010kck.2_RNA	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376	421					negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		AAAAGATGAGCGAAGAAGGAA	0.303													5	20	---	---	---	---	PASS
BEND3	57673	broad.mit.edu	37	6	107391958	107391958	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107391958G>A	uc003prs.2	-	5	1087	c.437C>T	c.(436-438)TCG>TTG	p.S146L		NM_001080450	NP_001073919	Q5T5X7	BEND3_HUMAN	BEN domain containing 3	146										ovary(3)	3						CAGGTCCCCCGAGGGAGGATT	0.572													89	137	---	---	---	---	PASS
COL28A1	340267	broad.mit.edu	37	7	7472140	7472140	+	Silent	SNP	C	T	T	rs115295026	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7472140C>T	uc003src.1	-	25	2079	c.1962G>A	c.(1960-1962)CCG>CCA	p.P654P	COL28A1_uc011jxe.1_Silent_p.P337P|COL28A1_uc003srd.2_Silent_p.P209P|COL28A1_uc003sre.1_Silent_p.P75P	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	654					cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		GTAAACCCATCGGCCCAGGGG	0.512													22	75	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21603847	21603847	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21603847G>A	uc003svc.2	+	6	1057	c.1026G>A	c.(1024-1026)CTG>CTA	p.L342L		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	342	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TGAGACCTCTGAGGAGACACA	0.423									Kartagener_syndrome				41	78	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21827105	21827105	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21827105G>A	uc003svc.2	+	61	9880	c.9849G>A	c.(9847-9849)TTG>TTA	p.L3283L		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3283	Stalk (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						AACACTATTTGAAAGACCCAG	0.378									Kartagener_syndrome				24	54	---	---	---	---	PASS
AEBP1	165	broad.mit.edu	37	7	44148893	44148893	+	Missense_Mutation	SNP	G	A	A	rs75175945		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44148893G>A	uc003tkb.2	+	9	1408	c.1103G>A	c.(1102-1104)CGA>CAA	p.R368Q	AEBP1_uc003tkc.3_5'Flank|AEBP1_uc003tkd.2_5'Flank	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	368					cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTAGAGCCCCGAAAGGGCGAG	0.652													6	14	---	---	---	---	PASS
AEBP1	165	broad.mit.edu	37	7	44151872	44151872	+	Silent	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44151872C>G	uc003tkb.2	+	17	2474	c.2169C>G	c.(2167-2169)CCC>CCG	p.P723P	AEBP1_uc003tkc.3_Silent_p.P298P|AEBP1_uc003tkd.2_5'UTR	NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	723	Interaction with PTEN (By similarity).				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACCGGGTCCCCAACAATAACT	0.582													9	110	---	---	---	---	PASS
SBDS	51119	broad.mit.edu	37	7	66453398	66453398	+	Missense_Mutation	SNP	T	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66453398T>C	uc003tvm.1	-	5	897	c.713A>G	c.(712-714)AAT>AGT	p.N238S		NM_016038	NP_057122	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome protein	238					bone marrow development|bone mineralization|leukocyte chemotaxis|mature ribosome assembly|mitotic spindle stabilization|positive regulation of translation|ribosomal large subunit biogenesis|rRNA processing	cytoplasm|nucleolus|nucleoplasm|spindle pole	microtubule binding|ribosome binding|rRNA binding			ovary(1)	1						ATCTTTCAGATTGAGTACTTC	0.393			Gene Conversion			AML|MDS			Shwachman-Diamond_syndrome				52	91	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94057017	94057017	+	Missense_Mutation	SNP	T	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94057017T>C	uc003ung.1	+	49	3817	c.3346T>C	c.(3346-3348)TTC>CTC	p.F1116L	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1116					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CGATGGAGACTTCTACAGGGC	0.542										HNSCC(75;0.22)			34	128	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100549721	100549721	+	5'Flank	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100549721C>T	uc003uxk.1	+						uc003uxl.1_5'Flank					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		TCCAACACCTCAACCACCCCG	0.522													18	139	---	---	---	---	PASS
PSMC2	5701	broad.mit.edu	37	7	103008390	103008390	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103008390C>G	uc003vbs.2	+	12	1261	c.1191C>G	c.(1189-1191)ATC>ATG	p.I397M	SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|PSMC2_uc011klo.1_Missense_Mutation_p.I260M	NM_002803	NP_002794	P35998	PRS7_HUMAN	proteasome 26S ATPase subunit 2	397					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0						TGTTTGCCATCAGAGCACGGC	0.423													23	107	---	---	---	---	PASS
CHRM2	1129	broad.mit.edu	37	7	136700956	136700956	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700956G>A	uc003vtf.1	+	4	1967	c.1344G>A	c.(1342-1344)AAG>AAA	p.K448K	CHRM2_uc003vtg.1_Silent_p.K448K|CHRM2_uc003vtj.1_Silent_p.K448K|CHRM2_uc003vtk.1_Silent_p.K448K|CHRM2_uc003vtl.1_Silent_p.K448K|CHRM2_uc003vtm.1_Silent_p.K448K|CHRM2_uc003vti.1_Silent_p.K448K|CHRM2_uc003vto.1_Silent_p.K448K|CHRM2_uc003vtn.1_Silent_p.K448K|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	448	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	CCACCTTCAAGAAGACCTTTA	0.433													25	207	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10466630	10466630	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10466630C>T	uc003wtc.2	-	4	5207	c.4978G>A	c.(4978-4980)GAG>AAG	p.E1660K		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1660					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		ACGCAGGCCTCGCAGGGACAG	0.647													34	39	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48830905	48830905	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48830905G>A	uc003xqi.2	-	22	2515	c.2458C>T	c.(2458-2460)CGG>TGG	p.R820W	PRKDC_uc003xqj.2_Missense_Mutation_p.R820W|PRKDC_uc011ldh.1_Missense_Mutation_p.R820W	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	820					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				TGGGCAGCCCGAGAAAGAGCT	0.338								NHEJ					3	15	---	---	---	---	PASS
ARMC1	55156	broad.mit.edu	37	8	66539550	66539550	+	Silent	SNP	C	T	T	rs140241141	byFrequency	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66539550C>T	uc003xvl.2	-	2	319	c.84G>A	c.(82-84)CCG>CCA	p.P28P	ARMC1_uc011leo.1_5'UTR	NM_018120	NP_060590	Q9NVT9	ARMC1_HUMAN	armadillo repeat-containing protein	28					metal ion transport		metal ion binding			skin(1)	1			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			TTCTGTTTAACGGATCTGCTG	0.493													75	154	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	145024409	145024409	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145024409G>A	uc003zaf.1	-	1	636	c.466C>T	c.(466-468)CCT>TCT	p.P156S	PLEC_uc003zag.1_Intron|PLEC_uc003zah.2_Intron|PLEC_uc003zaj.2_Intron	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	156	Globular 1.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GTGGTAGCAGGCACCACAGGG	0.692													3	2	---	---	---	---	PASS
KIAA2026	158358	broad.mit.edu	37	9	5923062	5923062	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5923062C>T	uc003zjq.3	-	8	3150	c.2934G>A	c.(2932-2934)AAG>AAA	p.K978K	KIAA2026_uc010mht.2_Silent_p.K153K	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	978										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GCTCTGTATGCTTTGATTCAC	0.423													51	93	---	---	---	---	PASS
UHRF2	115426	broad.mit.edu	37	9	6434113	6434113	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6434113C>T	uc003zjy.2	+	3	924	c.584C>T	c.(583-585)ACG>ATG	p.T195M	UHRF2_uc003zjz.2_RNA|UHRF2_uc003zka.1_Translation_Start_Site	NM_152896	NP_690856	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains	195	Interaction with PCNP.				cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		GTACCCTCTACGTCTAATTCA	0.353													26	47	---	---	---	---	PASS
TEK	7010	broad.mit.edu	37	9	27169490	27169490	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27169490C>T	uc003zqi.3	+	4	933	c.491C>T	c.(490-492)TCA>TTA	p.S164L	TEK_uc010mjc.1_Intron|TEK_uc011lnn.1_Missense_Mutation_p.S164L|TEK_uc011lno.1_Missense_Mutation_p.S164L|TEK_uc011lnp.1_Missense_Mutation_p.S60L|TEK_uc003zqj.1_Missense_Mutation_p.S141L	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	164	Extracellular (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		TTCATCCATTCAGTGCCCCGG	0.483													119	254	---	---	---	---	PASS
TPM2	7169	broad.mit.edu	37	9	35685308	35685308	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35685308C>T	uc003zxq.2	-	5	760	c.521G>A	c.(520-522)GGA>GAA	p.G174E	TPM2_uc003zxr.2_Missense_Mutation_p.G174E|TPM2_uc003zxs.2_Missense_Mutation_p.G174E|TPM2_uc010mkz.2_Missense_Mutation_p.G174E|TPM2_uc011lpa.1_Missense_Mutation_p.G174E	NM_213674	NP_998839	P07951	TPM2_HUMAN	tropomyosin 2 (beta) isoform 2	174	By similarity.				muscle filament sliding|regulation of ATPase activity	cytosol|muscle thin filament tropomyosin	actin binding|structural constituent of muscle			ovary(1)	1	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTCCAGCTCTCCTTCCAGGAT	0.617													11	79	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	82006315	82006315	+	IGR	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82006315C>A								None (None upstream) : TLE4 (180563 downstream)																							ACCAGTTGCTCAGCCACCAGC	0.682													15	35	---	---	---	---	PASS
HSDL2	84263	broad.mit.edu	37	9	115221723	115221723	+	Intron	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115221723C>G	uc004bga.1	+						HSDL2_uc011lwv.1_Intron|HSDL2_uc004bgb.1_Intron|HSDL2_uc004bgc.1_Intron|HSDL2_uc011lww.1_Intron	NM_032303	NP_115679	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2							peroxisome	oxidoreductase activity|sterol binding				0						ATGTTTATCTCTCTAGGTGAA	0.373													56	95	---	---	---	---	PASS
HSDL2	84263	broad.mit.edu	37	9	115221855	115221855	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115221855C>T	uc004bga.1	+	10	1235	c.1142C>T	c.(1141-1143)TCA>TTA	p.S381L	HSDL2_uc011lwv.1_Missense_Mutation_p.S260L|HSDL2_uc004bgb.1_Missense_Mutation_p.S215L|HSDL2_uc004bgc.1_Missense_Mutation_p.S308L|HSDL2_uc011lww.1_Missense_Mutation_p.S176L	NM_032303	NP_115679	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	381	SCP2.					peroxisome	oxidoreductase activity|sterol binding				0						AAAATGTTTTCAGGTGAGTTT	0.368													43	94	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123906317	123906317	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123906317C>T	uc004bkx.1	+	18	3039	c.3008C>T	c.(3007-3009)TCC>TTC	p.S1003F	CEP110_uc004bky.1_Missense_Mutation_p.S607F|CEP110_uc004bla.1_Missense_Mutation_p.S451F|CEP110_uc010mvo.1_5'UTR	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	1003	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						CAGCTGAAGTCCCTTCATGGA	0.438													17	33	---	---	---	---	PASS
DAB2IP	153090	broad.mit.edu	37	9	124522191	124522191	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124522191C>T	uc004bln.2	+	6	628	c.559C>T	c.(559-561)CTG>TTG	p.L187L	DAB2IP_uc004blo.2_Silent_p.L91L	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform	215	C2.				activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						GGAGCACATCCTGAAGCTGTG	0.632													10	36	---	---	---	---	PASS
STRBP	55342	broad.mit.edu	37	9	125923338	125923338	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125923338G>A	uc004bns.2	-	7	975	c.545C>T	c.(544-546)TCG>TTG	p.S182L	STRBP_uc004bnt.2_5'UTR|STRBP_uc004bnu.2_Missense_Mutation_p.S168L|STRBP_uc004bnv.2_Missense_Mutation_p.S182L	NM_018387	NP_060857	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	182	DZF.				multicellular organismal development	cytoplasm|nucleus	DNA binding	p.S182S(1)		breast(1)|skin(1)	2						ATCTTTCATCGAAACATTTTC	0.363													13	26	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1598927	1598927	+	Intron	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1598927G>C	uc009xhq.2	-						uc001ign.2_Missense_Mutation_p.Q83H	NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CATGTCAACAGAGTTGTGTGG	0.602													34	108	---	---	---	---	PASS
SEPHS1	22929	broad.mit.edu	37	10	13386938	13386938	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13386938C>T	uc001imk.2	-	2	372	c.13G>A	c.(13-15)GAG>AAG	p.E5K	SEPHS1_uc001imi.2_Missense_Mutation_p.E5K|SEPHS1_uc001imj.2_Missense_Mutation_p.E5K|SEPHS1_uc010qbt.1_Intron|SEPHS1_uc009xje.2_Missense_Mutation_p.E5K	NM_012247	NP_036379	P49903	SPS1_HUMAN	selenophosphate synthetase 1	5					protein modification process		ATP binding|GTP binding|selenide, water dikinase activity			skin(1)	1						TTAAAGGACTCCCGCGTAGAC	0.562													120	140	---	---	---	---	PASS
DCLRE1C	64421	broad.mit.edu	37	10	14976735	14976735	+	Silent	SNP	G	A	A	rs61749165		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14976735G>A	uc001inn.2	-	7	589	c.504C>T	c.(502-504)TTC>TTT	p.F168F	DCLRE1C_uc010qbx.1_Silent_p.F168F|DCLRE1C_uc001inl.2_Silent_p.F48F|DCLRE1C_uc009xji.2_Silent_p.F53F|DCLRE1C_uc001inm.2_Silent_p.F48F|DCLRE1C_uc001ino.2_Silent_p.F53F|DCLRE1C_uc009xjh.2_RNA|DCLRE1C_uc001inp.2_Silent_p.F48F|DCLRE1C_uc001inq.2_Silent_p.F48F|DCLRE1C_uc001inr.2_Silent_p.F53F|DCLRE1C_uc009xjj.1_RNA	NM_001033855	NP_001029027	Q96SD1	DCR1C_HUMAN	artemis protein isoform a	168					DNA recombination	nucleus	5'-3' exonuclease activity|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)	1						TTGGATCACAGAACGTAGTAT	0.368								Involved_in_tolerance_or_repair_of_DNA_crosslinks|NHEJ					152	165	---	---	---	---	PASS
CCNY	219771	broad.mit.edu	37	10	35818947	35818947	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35818947C>T	uc001iyw.3	+	6	628	c.448C>T	c.(448-450)CAC>TAC	p.H150Y	CCNY_uc001iyu.3_Missense_Mutation_p.H96Y|CCNY_uc001iyv.3_Missense_Mutation_p.H96Y|CCNY_uc001iyx.3_Missense_Mutation_p.H96Y|CCNY_uc009xmb.2_Missense_Mutation_p.H125Y|CCNY_uc010qet.1_Missense_Mutation_p.H17Y	NM_145012	NP_659449	Q8ND76	CCNY_HUMAN	cyclin Y isoform 1	150	Cyclin N-terminal.				cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0						TGAAAATCTTCACCCTCTTTC	0.363													59	291	---	---	---	---	PASS
HERC4	26091	broad.mit.edu	37	10	69726539	69726539	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69726539C>T	uc001jng.3	-	16	2138	c.1827G>A	c.(1825-1827)CAG>CAA	p.Q609Q	HERC4_uc009xpq.2_Silent_p.Q150Q|HERC4_uc001jnf.3_RNA|HERC4_uc001jnh.3_Silent_p.Q609Q|HERC4_uc009xpr.2_Silent_p.Q609Q|HERC4_uc001jni.3_Silent_p.Q353Q|HERC4_uc001jnj.2_Silent_p.Q609Q	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a	609					cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						ACTGTATAATCTGTCCCATTT	0.269													15	14	---	---	---	---	PASS
KIAA1274	27143	broad.mit.edu	37	10	72298040	72298040	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72298040C>T	uc001jrd.3	+	12	1609	c.1328C>T	c.(1327-1329)CCG>CTG	p.P443L	KIAA1274_uc001jre.3_5'Flank	NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	443										ovary(2)|central_nervous_system(1)	3						CTGCAGTACCCGCTGGCCTTT	0.647													27	30	---	---	---	---	PASS
PLAU	5328	broad.mit.edu	37	10	75672700	75672700	+	Missense_Mutation	SNP	A	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75672700A>T	uc001jwa.2	+	5	358	c.212A>T	c.(211-213)TAT>TTT	p.Y71F	C10orf55_uc001jvz.1_Intron|PLAU_uc010qkw.1_Missense_Mutation_p.Y54F|PLAU_uc010qkx.1_5'UTR|PLAU_uc001jwb.2_RNA|PLAU_uc001jwc.2_Missense_Mutation_p.Y71F|PLAU_uc009xrq.1_Missense_Mutation_p.Y35F	NM_002658	NP_002649	P00749	UROK_HUMAN	plasminogen activator, urokinase isoform 1	71	Kringle.				blood coagulation|chemotaxis|fibrinolysis|proteolysis|regulation of cell adhesion mediated by integrin|regulation of receptor activity|regulation of smooth muscle cell migration|regulation of smooth muscle cell-matrix adhesion|signal transduction	cell surface|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(2)|kidney(1)	3	Prostate(51;0.0112)				Amiloride(DB00594)|Urokinase(DB00013)	AAAACCTGCTATGAGGGGAAT	0.443													27	31	---	---	---	---	PASS
ADRA2A	150	broad.mit.edu	37	10	112839008	112839008	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112839008G>A	uc001kzo.2	+	1	2219	c.1254G>A	c.(1252-1254)GTG>GTA	p.V418V		NM_000681	NP_000672	P08913	ADA2A_HUMAN	alpha-2A-adrenergic receptor	403	Extracellular (By similarity).				actin cytoskeleton organization|activation of MAPK activity by adrenergic receptor signaling pathway|activation of phospholipase C activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cellular component movement|cellular response to hormone stimulus|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|glucose homeostasis|inhibition of adenylate cyclase activity by adrenergic receptor signaling pathway|intestinal absorption|negative regulation of adrenergic receptor signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cAMP biosynthetic process|negative regulation of epinephrine secretion|negative regulation of insulin secretion involved in cellular response to glucose stimulus|negative regulation of lipid catabolic process|negative regulation of norepinephrine secretion|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cytokine production|positive regulation of membrane protein ectodomain proteolysis|positive regulation of potassium ion transport|positive regulation of wound healing|Rho protein signal transduction	basolateral plasma membrane|cytoplasm|integral to plasma membrane|receptor complex	alpha-1B adrenergic receptor binding|alpha-2C adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|heterotrimeric G-protein binding|norepinephrine binding|protein heterodimerization activity|protein homodimerization activity|protein kinase binding|thioesterase binding				0		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amphetamine(DB00182)|Apraclonidine(DB00964)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Clonidine(DB00575)|Debrisoquin(DB04840)|Dexmedetomidine(DB00633)|Dipivefrin(DB00449)|Epinastine(DB00751)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Guanfacine(DB01018)|Lofexidine(DB04948)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Norepinephrine(DB00368)|Oxymetazoline(DB00935)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pseudoephedrine(DB00852)|Tizanidine(DB00697)|Trazodone(DB00656)|Yohimbine(DB01392)	GGTGCTCCGTGCCACGCACGC	0.582													47	131	---	---	---	---	PASS
ZRANB1	54764	broad.mit.edu	37	10	126655362	126655362	+	Intron	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126655362G>A	uc001lic.2	+						ZRANB1_uc010qug.1_Intron	NM_017580	NP_060050	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1						positive regulation of Wnt receptor signaling pathway|protein K63-linked deubiquitination|Wnt receptor signaling pathway	aggresome|centrosome|intermediate filament cytoskeleton|nucleolus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		TAAGTTTGGCGTTTTGGTTAA	0.328													61	112	---	---	---	---	PASS
C11orf66	220004	broad.mit.edu	37	11	61254085	61254085	+	Intron	SNP	G	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61254085G>T	uc001nru.1	+						C11orf66_uc009ynq.1_Intron	NM_145017	NP_659454	Q7Z5V6	CK066_HUMAN	IIIG9 protein											ovary(1)	1						ACCCCAGAGTGAGTGGCCTTG	0.537													10	19	---	---	---	---	PASS
RNASEH2C	84153	broad.mit.edu	37	11	65487785	65487785	+	Silent	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65487785C>G	uc001ofn.2	-	2	456	c.276G>C	c.(274-276)TCG>TCC	p.S92S	RNASEH2C_uc001ofm.2_RNA	NM_032193	NP_115569	Q8TDP1	RNH2C_HUMAN	ribonuclease H2, subunit C	92					RNA catabolic process	nucleus|ribonuclease H2 complex					0						GCTTCCCCATCGACACCTTCT	0.622													58	108	---	---	---	---	PASS
EFEMP2	30008	broad.mit.edu	37	11	65637669	65637669	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65637669C>T	uc001ofy.3	-	6	724	c.530G>A	c.(529-531)TGC>TAC	p.C177Y	EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.C177Y	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	177	EGF-like 3; calcium-binding (Potential).				blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)		CAGGTTCACGCAGCGGTGCTG	0.667													19	39	---	---	---	---	PASS
PC	5091	broad.mit.edu	37	11	66618223	66618223	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66618223C>T	uc001ojn.1	-	16	2444	c.2395G>A	c.(2395-2397)GAT>AAT	p.D799N	PC_uc001ojo.1_Missense_Mutation_p.D799N|PC_uc001ojp.1_Missense_Mutation_p.D799N|PC_uc001ojm.1_5'Flank	NM_022172	NP_071504	P11498	PYC_HUMAN	pyruvate carboxylase precursor	799	Carboxyltransferase.				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GACATGGAATCAGCTGCCACA	0.637													15	30	---	---	---	---	PASS
SSH3	54961	broad.mit.edu	37	11	67075201	67075201	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67075201C>T	uc001okj.2	+	7	962	c.784C>T	c.(784-786)CCT>TCT	p.P262S	SSH3_uc001okk.2_RNA|SSH3_uc001okl.2_Missense_Mutation_p.P116S	NM_017857	NP_060327	Q8TE77	SSH3_HUMAN	slingshot homolog 3	262					regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton|nucleus	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CAGCGCCGAGCCTGGCGGGTC	0.647													18	38	---	---	---	---	PASS
KCNE3	10008	broad.mit.edu	37	11	74168589	74168589	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74168589G>A	uc001ovc.2	-	3	367	c.20C>T	c.(19-21)ACG>ATG	p.T7M	KCNE3_uc001ovd.2_Missense_Mutation_p.T7M	NM_005472	NP_005463	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related	7						integral to membrane	voltage-gated potassium channel activity			ovary(1)	1	Breast(11;2.86e-06)					CCAGGTCTCCGTTCCATTGGT	0.567													25	97	---	---	---	---	PASS
OR8B8	26493	broad.mit.edu	37	11	124310460	124310460	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124310460G>A	uc010sal.1	-	1	522	c.522C>T	c.(520-522)GTC>GTT	p.V174V		NM_012378	NP_036510	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B,	174	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TGTAGTGGTTGACAAGGTTAT	0.493													29	25	---	---	---	---	PASS
DDX23	9416	broad.mit.edu	37	12	49230515	49230515	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49230515G>A	uc001rsm.2	-	10	1164	c.1073C>T	c.(1072-1074)TCT>TTT	p.S358F		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	358						catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6						CTTTTTCTGAGACCAATGACG	0.532													101	239	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49420492	49420492	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49420492C>T	uc001rta.3	-	48	15257	c.15257G>A	c.(15256-15258)CGA>CAA	p.R5086Q		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	5086					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TAGCAGTCCTCGGTGCAGGGC	0.592			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			20	43	---	---	---	---	PASS
POU6F1	5463	broad.mit.edu	37	12	51584291	51584291	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51584291C>T	uc001rxy.2	-	5	837	c.645G>A	c.(643-645)CGG>CGA	p.R215R	POU6F1_uc001rxz.2_Silent_p.R215R|POU6F1_uc001rya.2_Silent_p.R215R	NM_002702	NP_002693	Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	215					brain development|heart development|muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1						CTTCCTGGTTCCGCAGTTCAG	0.572													18	367	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56091557	56091557	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56091557G>A	uc001shh.2	-	9	1563	c.1343C>T	c.(1342-1344)TCA>TTA	p.S448L	ITGA7_uc001shg.2_Missense_Mutation_p.S444L|ITGA7_uc010sps.1_Missense_Mutation_p.S351L|ITGA7_uc009znw.2_5'Flank|ITGA7_uc009znx.2_Missense_Mutation_p.S331L	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	488	FG-GAP 7.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						CAAGCTGCCTGACAGGGAGTA	0.607													51	72	---	---	---	---	PASS
SLC39A5	283375	broad.mit.edu	37	12	56628597	56628597	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56628597C>T	uc010sqj.1	+						SLC39A5_uc010sqi.1_Intron|SLC39A5_uc010sqk.1_Intron	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion						zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						GTATGACCCTCAATTCTCCAG	0.408													72	158	---	---	---	---	PASS
SLC39A5	283375	broad.mit.edu	37	12	56629335	56629335	+	Intron	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56629335C>G	uc010sqj.1	+						SLC39A5_uc010sqi.1_Intron|SLC39A5_uc010sqk.1_Intron	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion						zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						CTGACCTTCTCTCTGTCAGGC	0.592													127	308	---	---	---	---	PASS
SLC39A5	283375	broad.mit.edu	37	12	56629341	56629341	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56629341C>T	uc010sqj.1	+						SLC39A5_uc010sqi.1_Intron|SLC39A5_uc010sqk.1_Intron	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion						zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						TTCTCTCTGTCAGGCACAAGA	0.587													137	320	---	---	---	---	PASS
SLC39A5	283375	broad.mit.edu	37	12	56630255	56630255	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56630255C>A	uc010sqj.1	+	9	1278	c.1021C>A	c.(1021-1023)CAG>AAG	p.Q341K	SLC39A5_uc010sqk.1_Missense_Mutation_p.Q341K	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion	341	Cytoplasmic (Potential).				zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						GATGGCCCTTCAGCCCCTACA	0.527													47	89	---	---	---	---	PASS
SLC39A5	283375	broad.mit.edu	37	12	56630958	56630958	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56630958C>T	uc010sqj.1	+	12	1570	c.1313C>T	c.(1312-1314)TCA>TTA	p.S438L	SLC39A5_uc010sqk.1_Missense_Mutation_p.S438L	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion	438	Cytoplasmic (Potential).				zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						CTGCTCCAGTCAGGGCTGTCC	0.647													22	90	---	---	---	---	PASS
SLC39A5	283375	broad.mit.edu	37	12	56631000	56631000	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56631000C>T	uc010sqj.1	+	12	1612	c.1355C>T	c.(1354-1356)TCT>TTT	p.S452F	SLC39A5_uc010sqk.1_Missense_Mutation_p.S452F	NM_173596	NP_775867	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (metal ion	452	Helical; (Potential).				zinc ion transport	basolateral plasma membrane|integral to membrane	metal ion transmembrane transporter activity			ovary(1)|skin(1)	2						AGCCTCGTGTCTGGAGCCCTG	0.642													31	94	---	---	---	---	PASS
B4GALNT1	2583	broad.mit.edu	37	12	58021901	58021901	+	Intron	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58021901C>G	uc001spg.1	-						B4GALNT1_uc010sru.1_Intron	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1						lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AGCCCCTGCCCTACCAGGTCC	0.672													24	55	---	---	---	---	PASS
RBM19	9904	broad.mit.edu	37	12	114385129	114385129	+	Intron	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114385129G>A	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					AGCCCAGGACGGGGCCTCACC	0.537													63	116	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123087422	123087422	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123087422G>A	uc001ucv.2	+	47	5035	c.4872G>A	c.(4870-4872)TCG>TCA	p.S1624S	KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	1624					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TCTTAATTTCGAAATTAATGA	0.328													33	94	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132529427	132529427	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132529427C>T	uc001ujn.2	+	36	6748	c.6713C>T	c.(6712-6714)CCC>CTC	p.P2238L	EP400_uc001ujl.2_Missense_Mutation_p.P2237L|EP400_uc001ujm.2_Missense_Mutation_p.P2157L	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2274					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GAAGCCACTCCCATCCCAGAG	0.607													35	88	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32776660	32776660	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32776660C>T	uc001utx.2	+	31	4510	c.4014C>T	c.(4012-4014)TTC>TTT	p.F1338F	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	1338					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TCCCCCTCTTCTCAGGTACCA	0.463													21	61	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67801613	67801613	+	Silent	SNP	T	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67801613T>C	uc001vik.2	-	2	1652	c.960A>G	c.(958-960)AGA>AGG	p.R320R	PCDH9_uc001vil.2_Silent_p.R320R|PCDH9_uc010thl.1_Silent_p.R320R|PCDH9_uc001vin.3_Silent_p.R320R	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	320	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CTGTCTCCTCTCTATCTAAGG	0.478													54	150	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23869468	23869468	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23869468C>T	uc001wjv.2	-	14	1645	c.1578G>A	c.(1576-1578)GAG>GAA	p.E526E	MYH6_uc010akp.1_Silent_p.E526E	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	526	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GAGGCACCTTCTCGATGAGGT	0.542													36	81	---	---	---	---	PASS
C14orf106	55320	broad.mit.edu	37	14	45693467	45693467	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45693467C>G	uc001wwf.2	-	11	2782	c.2323G>C	c.(2323-2325)GAA>CAA	p.E775Q		NM_018353	NP_060823	Q6P0N0	M18BP_HUMAN	chromosome 14 open reading frame 106	775					cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm	DNA binding				0						GTTTCACTTTCTTCACTTGAC	0.348													64	134	---	---	---	---	PASS
SOCS4	122809	broad.mit.edu	37	14	55509864	55509864	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55509864G>C	uc001xbo.2	+	3	670	c.105G>C	c.(103-105)AAG>AAC	p.K35N	SOCS4_uc001xbp.2_Missense_Mutation_p.K35N	NM_199421	NP_955453	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	35					intracellular signal transduction|negative regulation of signal transduction|regulation of growth					ovary(1)|kidney(1)	2						GGAGTGGAAAGAAGTTATCTT	0.383													31	73	---	---	---	---	PASS
MAP3K9	4293	broad.mit.edu	37	14	71267429	71267429	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71267429C>T	uc001xmm.2	-	2	775	c.775G>A	c.(775-777)GAG>AAG	p.E259K	MAP3K9_uc001xml.2_Missense_Mutation_p.E259K	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase	259	Protein kinase.				activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		ACAATTGCCTCATCATGTAAG	0.498													60	112	---	---	---	---	PASS
IVD	3712	broad.mit.edu	37	15	40703564	40703564	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40703564C>T	uc001zls.3	+						IVD_uc001zlq.2_Intron	NM_002225	NP_002216	P26440	IVD_HUMAN	isovaleryl Coenzyme A dehydrogenase isoform 1						leucine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|isovaleryl-CoA dehydrogenase activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)		TGAGGCCACTCTCAACTTGGG	0.507													71	159	---	---	---	---	PASS
LYSMD4	145748	broad.mit.edu	37	15	100269463	100269463	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100269463C>T	uc002bvk.2	-	3	819	c.756G>A	c.(754-756)TTG>TTA	p.L252L	LYSMD4_uc002bvj.1_Intron|LYSMD4_uc010bou.1_Intron|LYSMD4_uc002bvl.2_Silent_p.L253L|LYSMD4_uc002bvm.2_3'UTR|LYSMD4_uc010bov.2_Silent_p.L252L			Q5XG99	LYSM4_HUMAN	SubName: Full=cDNA FLJ77040, highly similar to Homo sapiens LysM, putative peptidoglycan-binding, domain containing 4, mRNA; SubName: Full=LysM, putative peptidoglycan-binding, domain containing 4, isoform CRA_c;	252	Cytoplasmic (Potential).				cell wall macromolecule catabolic process	integral to membrane					0	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)			CAGTTGTGTTCAAGCTATTAG	0.478													76	137	---	---	---	---	PASS
CHSY1	22856	broad.mit.edu	37	15	101719133	101719133	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101719133C>G	uc002bwt.1	-	4	1352	c.869G>C	c.(868-870)AGA>ACA	p.R290T	CHSY1_uc010usd.1_Missense_Mutation_p.R18T	NM_014918	NP_055733	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	290	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity				0	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATGGAGATCTCTAATGTACCC	0.398													30	67	---	---	---	---	PASS
FAM86A	196483	broad.mit.edu	37	16	5140074	5140074	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5140074C>T	uc002cyo.2	-						FAM86A_uc002cyp.2_Intron	NM_201400	NP_958802	Q96G04	FA86A_HUMAN	hypothetical protein LOC196483 isoform 1												0						GTGCCCGGGGCTGGGCATTAC	0.622													17	36	---	---	---	---	PASS
ARHGAP17	55114	broad.mit.edu	37	16	24988547	24988547	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24988547C>T	uc002dnb.2	-	3	280	c.187G>A	c.(187-189)GAG>AAG	p.E63K	ARHGAP17_uc002dnc.2_Missense_Mutation_p.E63K|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dng.1_Missense_Mutation_p.E63K	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1	63	BAR.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		TGTCTCCTCTCGGCATCGGTG	0.542													16	58	---	---	---	---	PASS
BBS2	583	broad.mit.edu	37	16	56531748	56531748	+	Silent	SNP	G	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56531748G>T	uc002ejd.2	-	14	1938	c.1704C>A	c.(1702-1704)ATC>ATA	p.I568I		NM_031885	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2 protein	568					adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding			ovary(1)	1						CCATTGACTGGATGATATCAC	0.373									Bardet-Biedl_syndrome				51	88	---	---	---	---	PASS
CES3	23491	broad.mit.edu	37	16	66995225	66995225	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66995225G>A	uc002eqt.2	+	1	88	c.15G>A	c.(13-15)GTG>GTA	p.V5V	CES3_uc010cdz.2_Silent_p.V5V|CES3_uc010cea.2_RNA	NM_024922	NP_079198	Q6UWW8	EST3_HUMAN	carboxylesterase 3 precursor	5						endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity			ovary(3)|central_nervous_system(2)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		AGAGAGCAGTGAGAGTGGAGT	0.572											OREG0023869	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	37	---	---	---	---	PASS
SMYD4	114826	broad.mit.edu	37	17	1684631	1684631	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1684631C>A	uc002ftm.3	-	11	2532	c.2364G>T	c.(2362-2364)ATG>ATT	p.M788I		NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	788							zinc ion binding			skin(3)|kidney(2)	5						AACAGGATTTCATCTTCTGGA	0.527													45	84	---	---	---	---	PASS
ITGAE	3682	broad.mit.edu	37	17	3661017	3661017	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3661017C>T	uc002fwo.3	-	9	1102	c.1003G>A	c.(1003-1005)GAG>AAG	p.E335K		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	335	VWFA.|Extracellular (Potential).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		GCAAAGCGCTCAACACCCTGC	0.577													197	410	---	---	---	---	PASS
NEURL4	84461	broad.mit.edu	37	17	7222533	7222533	+	Intron	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7222533G>A	uc002gga.1	-						NEURL4_uc002gfy.1_5'Flank|GPS2_uc002gfz.1_5'Flank|NEURL4_uc002ggb.1_Intron	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1								protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						CGCACCTGGGGAAGAAAGAAC	0.562													5	46	---	---	---	---	PASS
ACAP1	9744	broad.mit.edu	37	17	7252323	7252323	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7252323C>T	uc002ggd.2	+	18	1894	c.1688C>T	c.(1687-1689)TCT>TTT	p.S563F	KCTD11_uc002gge.3_5'Flank	NM_014716	NP_055531	Q15027	ACAP1_HUMAN	centaurin beta1	563	Required for interaction with GULP1.				intracellular signal transduction|lipid metabolic process|protein transport|regulation of ARF GTPase activity		ARF GTPase activator activity|phospholipase C activity|protein binding|zinc ion binding			breast(2)|large_intestine(1)	3						GAGCCCCCCTCTGAGGACCTG	0.592													55	155	---	---	---	---	PASS
ACAP1	9744	broad.mit.edu	37	17	7252471	7252471	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7252471C>G	uc002ggd.2	+	18	2042	c.1836C>G	c.(1834-1836)ATC>ATG	p.I612M	KCTD11_uc002gge.3_5'Flank	NM_014716	NP_055531	Q15027	ACAP1_HUMAN	centaurin beta1	612	Required for interaction with GULP1.|ANK 1.				intracellular signal transduction|lipid metabolic process|protein transport|regulation of ARF GTPase activity		ARF GTPase activator activity|phospholipase C activity|protein binding|zinc ion binding			breast(2)|large_intestine(1)	3						CACCGCTGATCCAGGCCACAG	0.602													27	64	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10248901	10248901	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10248901G>A	uc002gmk.1	-	14	1386	c.1296C>T	c.(1294-1296)GCC>GCT	p.A432A	MYH13_uc010vvf.1_Silent_p.A107A	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	432	Myosin head-like.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TCTCGTAGACGGCTTTGGCCA	0.507													65	174	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10366968	10366968	+	Intron	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10366968G>A	uc002gmn.2	-						uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						CCCCTTAAGAGAAATGAATAA	0.448													34	59	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15976884	15976884	+	Splice_Site	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15976884C>T	uc002gpo.2	-	28	3911	c.3671_splice	c.e28-1	p.N1224_splice	NCOR1_uc002gpn.2_Splice_Site_p.N1240_splice|NCOR1_uc002gpp.1_Splice_Site_p.N1131_splice|NCOR1_uc010vwb.1_Intron|NCOR1_uc010coy.2_Splice_Site_p.N132_splice|NCOR1_uc010vwc.1_Splice_Site_p.N35_splice	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TTCTTAATATCTACAGAATAC	0.348													39	55	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29553644	29553644	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29553644C>T	uc002hgg.2	+	18	2526	c.2193C>T	c.(2191-2193)CTC>CTT	p.L731L	NF1_uc002hgh.2_Silent_p.L731L|NF1_uc010csn.1_Silent_p.L591L|NF1_uc002hgi.1_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	731					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGCATAACCTCTTGCCCAACT	0.458			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			79	155	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29554588	29554588	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29554588C>G	uc002hgg.2	+	20	2706	c.2373C>G	c.(2371-2373)ATC>ATG	p.I791M	NF1_uc002hgh.2_Missense_Mutation_p.I791M|NF1_uc010csn.1_Missense_Mutation_p.I651M|NF1_uc002hgi.1_Translation_Start_Site	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	791					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CAAAGCTAATCCTTAACTATC	0.363			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			27	69	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29556206	29556206	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29556206C>A	uc002hgg.2	+	21	2906	c.2573C>A	c.(2572-2574)TCT>TAT	p.S858Y	NF1_uc002hgh.2_Missense_Mutation_p.S858Y|NF1_uc010csn.1_Missense_Mutation_p.S718Y|NF1_uc002hgi.1_Translation_Start_Site	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	858					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGAAGCAATTCTGGCCTGGCA	0.507			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			21	54	---	---	---	---	PASS
RAD51L3	5892	broad.mit.edu	37	17	33430470	33430470	+	Intron	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33430470C>G	uc002hir.2	-						RFFL_uc002hiq.2_Intron|RAD51L3_uc010ctj.2_Intron|RAD51L3_uc010wcd.1_Intron|RAD51L3_uc002his.2_Intron|RAD51L3_uc010ctk.2_Intron|RAD51L3_uc010wce.1_Intron|RAD51L3_uc002hit.2_Intron|RAD51L3_uc002hiu.2_Intron	NM_002878	NP_002869	O75771	RA51D_HUMAN	RAD51-like 3 isoform 1						DNA repair|reciprocal meiotic recombination	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CCACATCACTCACCTTCCCTC	0.612								Direct_reversal_of_damage|Homologous_recombination					38	106	---	---	---	---	PASS
CACNA1G	8913	broad.mit.edu	37	17	48677083	48677083	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48677083C>T	uc002irk.1	+	17	3925	c.3553C>T	c.(3553-3555)CGC>TGC	p.R1185C	CACNA1G_uc002iri.1_Missense_Mutation_p.R1185C|CACNA1G_uc002irj.1_Missense_Mutation_p.R1162C|CACNA1G_uc002irl.1_Missense_Mutation_p.R1162C|CACNA1G_uc002irm.1_Missense_Mutation_p.R1162C|CACNA1G_uc002irn.1_Missense_Mutation_p.R1162C|CACNA1G_uc002iro.1_Missense_Mutation_p.R1162C|CACNA1G_uc002irp.1_Missense_Mutation_p.R1185C|CACNA1G_uc002irq.1_Missense_Mutation_p.R1162C|CACNA1G_uc002irr.1_Missense_Mutation_p.R1185C|CACNA1G_uc002irs.1_Missense_Mutation_p.R1185C|CACNA1G_uc002irt.1_Missense_Mutation_p.R1185C|CACNA1G_uc002irv.1_Missense_Mutation_p.R1185C|CACNA1G_uc002irw.1_Missense_Mutation_p.R1162C|CACNA1G_uc002iru.1_Missense_Mutation_p.R1162C|CACNA1G_uc002irx.1_Missense_Mutation_p.R1098C|CACNA1G_uc002iry.1_Missense_Mutation_p.R1098C|CACNA1G_uc002irz.1_Missense_Mutation_p.R1098C|CACNA1G_uc002isa.1_Missense_Mutation_p.R1098C|CACNA1G_uc002isb.1_Missense_Mutation_p.R1098C|CACNA1G_uc002isc.1_Missense_Mutation_p.R1098C|CACNA1G_uc002isd.1_Missense_Mutation_p.R1098C|CACNA1G_uc002ise.1_Missense_Mutation_p.R1098C|CACNA1G_uc002isf.1_Missense_Mutation_p.R1098C|CACNA1G_uc002isg.1_Missense_Mutation_p.R1098C|CACNA1G_uc002ish.1_Missense_Mutation_p.R1098C|CACNA1G_uc002isi.1_Missense_Mutation_p.R1075C|CACNA1G_uc002isj.2_5'UTR	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	1185	Cytoplasmic (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	AGGGCTGCATCGCACTGCCAG	0.682													10	19	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8380291	8380291	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8380291C>T	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				TTTGTGTTTGCAGAGCTATAA	0.418													22	75	---	---	---	---	PASS
ZNF532	55205	broad.mit.edu	37	18	56587446	56587446	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56587446G>A	uc002lho.2	+	4	2474	c.1927G>A	c.(1927-1929)GAA>AAA	p.E643K	ZNF532_uc002lhp.2_Missense_Mutation_p.E641K|ZNF532_uc010xeg.1_Missense_Mutation_p.E641K|ZNF532_uc002lhr.2_Missense_Mutation_p.E641K|ZNF532_uc002lhs.2_Missense_Mutation_p.E641K	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	643					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						CGTGCGCATCGAAGTAACGTG	0.517													32	75	---	---	---	---	PASS
ZNF532	55205	broad.mit.edu	37	18	56587869	56587869	+	Intron	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56587869G>C	uc002lho.2	+						ZNF532_uc002lhp.2_Intron|ZNF532_uc010xeg.1_Intron|ZNF532_uc002lhr.2_Intron|ZNF532_uc002lhs.2_Intron	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						TGGACAAGTAGAGTATCATTT	0.413													34	60	---	---	---	---	PASS
SERPINB11	89778	broad.mit.edu	37	18	61390278	61390278	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61390278C>G	uc002ljk.3	+	9	886	c.824C>G	c.(823-825)TCT>TGT	p.S275C	SERPINB11_uc010xes.1_Missense_Mutation_p.S100C|SERPINB11_uc010dqd.2_Missense_Mutation_p.S161C|SERPINB11_uc002ljj.3_Missense_Mutation_p.S161C|SERPINB11_uc010dqe.2_Missense_Mutation_p.S74C|SERPINB11_uc010dqf.2_Missense_Mutation_p.S73C	NM_080475	NP_536723	Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B, member 11	275					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			breast(1)	1		Esophageal squamous(42;0.129)				ACAAGCTCTTCTAACATGATG	0.423													9	14	---	---	---	---	PASS
GADD45B	4616	broad.mit.edu	37	19	2476585	2476585	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2476585C>T	uc002lwb.1	+	2	325	c.103C>T	c.(103-105)CGC>TGC	p.R35C	GADD45B_uc010dtd.1_Missense_Mutation_p.R20C|GADD45B_uc002lwc.1_Missense_Mutation_p.R20C	NM_015675	NP_056490	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	35					activation of MAPKKK activity|apoptosis|cell differentiation|multicellular organismal development|response to stress						0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCCAGGATCGCCTCACAGT	0.667											OREG0025141	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	46	---	---	---	---	PASS
GPR108	56927	broad.mit.edu	37	19	6732334	6732334	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6732334G>A	uc002mfp.2	-	12	1111	c.1065C>T	c.(1063-1065)TTC>TTT	p.F355F	GPR108_uc010duv.2_5'Flank|GPR108_uc002mfn.2_Silent_p.F26F|GPR108_uc002mfo.3_Silent_p.F113F|GPR108_uc010duw.2_RNA	NM_001080452	NP_001073921	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108 isoform 1	355	Helical; Name=3; (Potential).					integral to membrane					0						CGTACTTGATGAAGGCCCAGC	0.622													45	97	---	---	---	---	PASS
KANK3	256949	broad.mit.edu	37	19	8398786	8398786	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8398786C>T	uc010dwa.2	-						KANK3_uc002mjp.1_Silent_p.R59R	NM_198471	NP_940873	Q6NY19	KANK3_HUMAN	ankyrin repeat domain 47												0						CTAGCGAGCGCCGCTCACCTC	0.706													6	9	---	---	---	---	PASS
LYL1	4066	broad.mit.edu	37	19	13211489	13211489	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13211489C>G	uc002mwi.2	-	3	770	c.409G>C	c.(409-411)GAG>CAG	p.E137Q		NM_005583	NP_005574	P12980	LYL1_HUMAN	lymphoblastic leukemia derived sequence 1	137					B cell differentiation|blood vessel maturation|definitive hemopoiesis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding				0			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			AGGTCCAGCTCACAGTGGCTT	0.562			T	TRB@	T-ALL								61	251	---	---	---	---	PASS
PKN1	5585	broad.mit.edu	37	19	14554355	14554355	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14554355G>A	uc002myp.2	+	3	564	c.396G>A	c.(394-396)GAG>GAA	p.E132E	PKN1_uc002myq.2_Silent_p.E138E	NM_002741	NP_002732	Q16512	PKN1_HUMAN	protein kinase N1 isoform 2	132	REM 2.				activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding			ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						CGGGCCTGGAGAAGCAGTTGG	0.647													11	20	---	---	---	---	PASS
GLT25D1	79709	broad.mit.edu	37	19	17678289	17678289	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17678289C>T	uc002nhc.1	+	4	576	c.564C>T	c.(562-564)GTC>GTT	p.V188V	GLT25D1_uc010eax.1_5'Flank	NM_024656	NP_078932	Q8NBJ5	GT251_HUMAN	glycosyltransferase 25 domain containing 1	188					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0						AGACGGTGGTCGCCCCCATGC	0.582													27	46	---	---	---	---	PASS
ELL	8178	broad.mit.edu	37	19	18557290	18557290	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18557290C>T	uc002njh.2	-	10	1605	c.1533G>A	c.(1531-1533)CTG>CTA	p.L511L	ELL_uc010ebq.2_Silent_p.L454L|ELL_uc002njg.2_Silent_p.L378L	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II	511					positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		CTGCGTACTTCCTGAAACAGG	0.637			T	MLL	AL								4	16	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23556540	23556540	+	Intron	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23556540C>T	uc002nre.2	-						ZNF91_uc010xrj.1_Intron	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TCACTCTCACCTACCTGTGGG	0.448													19	87	---	---	---	---	PASS
SCGBL	284402	broad.mit.edu	37	19	35085427	35085427	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35085427C>T	uc002nvn.2	-	1	64	c.42G>A	c.(40-42)CTG>CTA	p.L14L		NM_001025591	NP_001020762	Q4G0G5	SCGBL_HUMAN	secretoglobin-like precursor	14						extracellular region	binding				0						CGCTGCAGATCAGAGCCAGCA	0.597													26	83	---	---	---	---	PASS
HKR1	284459	broad.mit.edu	37	19	37853929	37853929	+	Missense_Mutation	SNP	A	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37853929A>G	uc002ogb.2	+	6	1501	c.1232A>G	c.(1231-1233)AAG>AGG	p.K411R	HKR1_uc002ofx.2_Missense_Mutation_p.K127R|HKR1_uc002ofy.2_Missense_Mutation_p.K127R|HKR1_uc002oga.2_Missense_Mutation_p.K393R|HKR1_uc010xto.1_Missense_Mutation_p.K393R|HKR1_uc002ogc.2_Missense_Mutation_p.K392R|HKR1_uc010xtp.1_Missense_Mutation_p.K350R|HKR1_uc002ogd.2_Missense_Mutation_p.K350R	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1	411					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCAGGAGAGAAGCCTTACATT	0.512													9	136	---	---	---	---	PASS
RTN2	6253	broad.mit.edu	37	19	45997610	45997610	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45997610C>A	uc002pcb.2	-	4	856	c.628G>T	c.(628-630)GGC>TGC	p.G210C	RTN2_uc002pcc.2_Missense_Mutation_p.G210C|RTN2_uc002pcd.2_RNA	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A	210						integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GTCCCAGAGCCCGGACTGAGC	0.607													31	66	---	---	---	---	PASS
EML2	24139	broad.mit.edu	37	19	46116846	46116846	+	Missense_Mutation	SNP	C	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46116846C>A	uc002pcn.2	-	18	1812	c.1777G>T	c.(1777-1779)GAC>TAC	p.D593Y	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Missense_Mutation_p.D477Y|EML2_uc010xxl.1_Missense_Mutation_p.D740Y|EML2_uc010xxm.1_Missense_Mutation_p.D794Y	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	593	WD 10.				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		TTGCCAAAGTCATCAGCTGAA	0.587													43	92	---	---	---	---	PASS
FGF21	26291	broad.mit.edu	37	19	49259545	49259545	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49259545C>T	uc002pkn.1	+	2	624	c.52C>T	c.(52-54)CTG>TTG	p.L18L	FUT1_uc002pkk.2_5'Flank|FUT1_uc002pkl.1_5'Flank|FUT1_uc002pkm.1_5'Flank|FGF21_uc002pko.1_Silent_p.L18L	NM_019113	NP_061986	Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21 precursor	18					cell-cell signaling|positive regulation of ERK1 and ERK2 cascade|positive regulation of glucose import	extracellular region|soluble fraction	growth factor activity			breast(1)	1		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		GGTTTCTGTGCTGGCTGGTCT	0.627													47	68	---	---	---	---	PASS
MYH14	79784	broad.mit.edu	37	19	50747551	50747551	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50747551G>C	uc002prr.1	+	10	1190	c.1143G>C	c.(1141-1143)AAG>AAC	p.K381N	MYH14_uc010enu.1_Missense_Mutation_p.K389N|MYH14_uc002prq.1_Missense_Mutation_p.K389N	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	381	Myosin head-like.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TTGCCTTGAAGAGAGAACGGA	0.627													13	44	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52714601	52714601	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52714601C>T	uc002pyp.2	+	4	518	c.359C>T	c.(358-360)TCG>TTG	p.S120L	PPP2R1A_uc010ydk.1_Missense_Mutation_p.S65L|PPP2R1A_uc010epm.1_Missense_Mutation_p.S160L|PPP2R1A_uc002pyq.2_5'UTR	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	120	PP2A subunit B binding.|SV40 small T antigen binding.|HEAT 3.|Polyoma small and medium T antigens Binding.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CACGAGCACTCGCCCTCTGAC	0.662			Mis		clear cell ovarian carcinoma								45	95	---	---	---	---	PASS
CST2	1470	broad.mit.edu	37	20	23807192	23807192	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23807192C>T	uc002wtq.1	-	1	121	c.106G>A	c.(106-108)GAT>AAT	p.D36N		NM_001322	NP_001313	P09228	CYTT_HUMAN	cystatin SA precursor	36						extracellular region	cysteine-type endopeptidase inhibitor activity				0						AGGTCTGCATCATAGATGCCA	0.597													27	34	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40084593	40084593	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40084593C>T	uc002xka.1	-	19	3034	c.2856G>A	c.(2854-2856)GTG>GTA	p.V952V	CHD6_uc002xkd.2_Silent_p.V930V	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	952	Helicase C-terminal.				chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				GTAGGTCCTCCACCTCCATTT	0.458													94	239	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60893713	60893713	+	Intron	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60893713G>A	uc002ycq.2	-							NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGCACTAGCCGAGACCAGGGT	0.672													6	16	---	---	---	---	PASS
MYT1	4661	broad.mit.edu	37	20	62853251	62853251	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62853251G>C	uc002yii.2	+	14	2611	c.2247G>C	c.(2245-2247)GAG>GAC	p.E749D	MYT1_uc002yih.2_Missense_Mutation_p.E451D|MYT1_uc002yij.2_Missense_Mutation_p.E408D	NM_004535	NP_004526	Q01538	MYT1_HUMAN	myelin transcription factor 1	749					cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TGCAGTCAGAGCCAGCAGCCC	0.567													7	52	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22746206	22746206	+	Silent	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22746206C>T	uc002yld.1	+	9	1317	c.1068C>T	c.(1066-1068)GTC>GTT	p.V356V	NCAM2_uc011acb.1_Silent_p.V214V|NCAM2_uc011acc.1_Silent_p.V381V	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	356	Ig-like C2-type 4.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GTATCGAAGTCAAAGGGCAGC	0.423													26	116	---	---	---	---	PASS
LCA5L	150082	broad.mit.edu	37	21	40795190	40795190	+	Missense_Mutation	SNP	C	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40795190C>G	uc002yxu.2	-	5	862	c.549G>C	c.(547-549)TTG>TTC	p.L183F	LCA5L_uc002yxv.2_Missense_Mutation_p.L183F|LCA5L_uc002yxw.1_Missense_Mutation_p.L183F|LCA5L_uc002yxx.1_Missense_Mutation_p.L45F|LCA5L_uc002yxy.2_RNA	NM_152505	NP_689718	O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	183	Potential.										0		Prostate(19;1.2e-06)				CTATAGCTTTCAAATGCCTAA	0.289													28	52	---	---	---	---	PASS
TFF1	7031	broad.mit.edu	37	21	43786545	43786545	+	Silent	SNP	G	A	A	rs142874600		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43786545G>A	uc002zax.1	-	1	100	c.60C>T	c.(58-60)CTC>CTT	p.L20L		NM_003225	NP_003216	P04155	TFF1_HUMAN	trefoil factor 1 precursor	20					carbohydrate metabolic process|response to estradiol stimulus		growth factor activity				0						CCAGGGTGCCGAGGGCCAGCA	0.632													4	60	---	---	---	---	PASS
UBASH3A	53347	broad.mit.edu	37	21	43867194	43867194	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43867194G>A	uc002zbe.2	+	15	1912	c.1876G>A	c.(1876-1878)GAA>AAA	p.E626K	UBASH3A_uc002zbf.2_Missense_Mutation_p.E588K|UBASH3A_uc010gpc.2_RNA|UBASH3A_uc010gpd.2_RNA|UBASH3A_uc010gpe.2_Silent_p.V515V	NM_018961	NP_061834	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing,	626	Phosphatase-like.					cytosol|nucleus				ovary(3)	3						GTGCTTCTGTGAAGAAAATAA	0.463													77	167	---	---	---	---	PASS
RAB36	9609	broad.mit.edu	37	22	23495275	23495275	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23495275G>A	uc002zwv.1	+	5	521	c.481G>A	c.(481-483)GAA>AAA	p.E161K	RAB36_uc010gtw.1_Missense_Mutation_p.E139K	NM_004914	NP_004905	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	161					protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		GGTGGACTTTGAAATTGAGCG	0.507													58	140	---	---	---	---	PASS
ZNF645	158506	broad.mit.edu	37	X	22291584	22291584	+	Missense_Mutation	SNP	C	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22291584C>T	uc004dai.1	+	1	525	c.476C>T	c.(475-477)CCG>CTG	p.P159L		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	159						intracellular	zinc ion binding			lung(1)|pancreas(1)	2						CATATTGCTCCGCCACAAACT	0.463													89	104	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44942757	44942757	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44942757G>A	uc004dge.3	+	23	3712	c.3337G>A	c.(3337-3339)GTA>ATA	p.V1113I	KDM6A_uc011mkz.1_Missense_Mutation_p.V1165I|KDM6A_uc011mla.1_Missense_Mutation_p.V1068I|KDM6A_uc011mlb.1_Missense_Mutation_p.V1120I|KDM6A_uc011mlc.1_Missense_Mutation_p.V817I|KDM6A_uc011mld.1_Missense_Mutation_p.V752I	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	1113	JmjC.				histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						TGTGCGTGTCGTATCAGCAGG	0.418			D|N|F|S		renal|oesophageal SCC|MM								19	94	---	---	---	---	PASS
OTUD6A	139562	broad.mit.edu	37	X	69282720	69282720	+	Missense_Mutation	SNP	G	C	C			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69282720G>C	uc004dxu.1	+	1	380	c.346G>C	c.(346-348)GAG>CAG	p.E116Q		NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A	116										lung(1)|skin(1)	2						CTTCCAGGCTGAGATGTCGGA	0.622													9	2	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125299507	125299507	+	Missense_Mutation	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125299507G>A	uc004euk.1	-	1	428	c.401C>T	c.(400-402)CCC>CTC	p.P134L		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	134										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						CCGCATGAGGGGGATGCGCGT	0.647													8	138	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135427980	135427980	+	Silent	SNP	G	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135427980G>A	uc004ezu.1	+	6	2406	c.2115G>A	c.(2113-2115)CTG>CTA	p.L705L	GPR112_uc010nsb.1_Silent_p.L500L|GPR112_uc010nsc.1_Silent_p.L472L	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	705	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TCACCCCACTGAAAGCATCTC	0.388													6	91	---	---	---	---	PASS
ESPNP	284729	broad.mit.edu	37	1	17034125	17034126	+	Frame_Shift_Ins	INS	-	AGCT	AGCT	rs141324796	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17034125_17034126insAGCT	uc001azn.1	-	3	478_479	c.364_365insAGCT	c.(364-366)TGGfs	p.W122fs	ESPNP_uc010ocj.1_Frame_Shift_Ins_p.W52fs	NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						CAGCAGCAGCCAGCTGAGCACC	0.663													4	3	---	---	---	---	
ANKRD13C	81573	broad.mit.edu	37	1	70802830	70802831	+	Intron	DEL	AC	-	-	rs72044252		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70802830_70802831delAC	uc001dex.3	-						ANKRD13C_uc009wbk.2_Intron	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C						protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						CATGATTCAAacacacacacac	0.312													3	4	---	---	---	---	
SNX27	81609	broad.mit.edu	37	1	151664882	151664883	+	Intron	INS	-	T	T	rs71740107		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151664882_151664883insT	uc001eyn.1	+						SNX27_uc001eyo.2_Intron|SNX27_uc001eyp.2_Intron	NM_030918	NP_112180	Q96L92	SNX27_HUMAN	sorting nexin family member 27						cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTTCTCCTTCCttttttttttt	0.366													9	5	---	---	---	---	
UBE2Q1	55585	broad.mit.edu	37	1	154524838	154524840	+	Intron	DEL	CTC	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154524838_154524840delCTC	uc001fff.1	-							NM_017582	NP_060052	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q								ATP binding|protein binding|ubiquitin-protein ligase activity				0	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCCACTCACACTCCTCCTCAACT	0.542													74	50	---	---	---	---	
FMO2	2327	broad.mit.edu	37	1	171178335	171178336	+	3'UTR	INS	-	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171178335_171178336insA	uc001ghk.1	+	9					FMO2_uc010pmd.1_3'UTR	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2						drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ACCTCCTAAAGAAAAAAAAAAA	0.351													4	2	---	---	---	---	
DYNC2LI1	51626	broad.mit.edu	37	2	44032037	44032038	+	Intron	INS	-	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44032037_44032038insA	uc002rtk.2	+						DYNC2LI1_uc002rtj.2_Intron|DYNC2LI1_uc002rtl.2_Intron|DYNC2LI1_uc010ynz.1_Intron	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTGTGGGGGTTAAAAAAAAAAA	0.361													3	3	---	---	---	---	
C2orf7	84279	broad.mit.edu	37	2	73460294	73460298	+	5'UTR	DEL	GGGCC	-	-	rs3832032		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73460294_73460298delGGGCC	uc002siy.2	-	1					CCT7_uc002siz.2_5'Flank|CCT7_uc002sja.2_5'Flank|CCT7_uc010yrf.1_5'Flank|CCT7_uc010feu.2_5'Flank|CCT7_uc010yrg.1_5'Flank|CCT7_uc010yrh.1_5'Flank|CCT7_uc010yri.1_5'Flank	NM_032319	NP_115695	Q9BSG0	PADC1_HUMAN	chromosome 2 open reading frame 7 precursor							extracellular region					0						ACCATCTCCAgggccgggcccggcc	0.639													3	3	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153378397	153378397	+	Intron	DEL	C	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153378397delC	uc002tye.2	+							NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						CTGCAAGTTACCAATTTGGAA	0.383													13	6	---	---	---	---	
MYNN	55892	broad.mit.edu	37	3	169492418	169492419	+	Intron	INS	-	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169492418_169492419insT	uc003fft.2	+						MYNN_uc011bpm.1_Intron|MYNN_uc003ffu.2_Intron|MYNN_uc003ffv.2_Intron|MYNN_uc010hwo.2_Intron	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			GTAGATTTGTATTTTTTCCATT	0.302													56	37	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183838225	183838226	+	IGR	INS	-	AG	AG			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183838225_183838226insAG								HTR3E (13443 upstream) : EIF2B5 (14584 downstream)																							ggaaggaaggaaggaaggaagg	0.000													4	2	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184552423	184552423	+	Intron	DEL	T	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184552423delT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc003fpc.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AATGTTTTTCTTTTTTTTTTT	0.343													4	3	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243417	120243418	+	5'Flank	INS	-	TC	TC	rs144572173	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243417_120243418insTC	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						TTAATTCTTATTAATTAATTCT	0.282													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	183768091	183768092	+	IGR	DEL	GT	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183768091_183768092delGT								ODZ3 (43914 upstream) : DCTD (43153 downstream)																							AGTACAGATCgtgtgtgtgtgt	0.302													4	2	---	---	---	---	
SLC9A3	6550	broad.mit.edu	37	5	474946	474946	+	Intron	DEL	G	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:474946delG	uc003jbe.2	-						SLC9A3_uc011clx.1_Intron|LOC25845_uc003jbd.2_5'Flank|LOC25845_uc010itb.1_5'Flank	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen							cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			gagacctggagggagaggAGC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44716765	44716766	+	IGR	INS	-	GAAG	GAAG	rs144322268	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44716765_44716766insGAAG								FGF10 (327981 upstream) : MRPS30 (92261 downstream)																							gaaggaagcaagaaggaaggaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	98023150	98023151	+	IGR	INS	-	GGAA	GGAA	rs59946738		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98023150_98023151insGGAA								None (None upstream) : RGMB (81848 downstream)																							gaaggaaggaagaaagaggaag	0.045													4	2	---	---	---	---	
HCG4	54435	broad.mit.edu	37	6	29760353	29760373	+	RNA	DEL	GCGGGCGCCGTGGATGGAGCA	-	-	rs146714150		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29760353_29760373delGCGGGCGCCGTGGATGGAGCA	uc003nns.2	-	1		c.478_498delTGCTCCATCCACGGCGCCCGC			uc010jrm.1_In_Frame_Del_p.AGAVDGA111del|uc003nnt.2_In_Frame_Del_p.RAPWMEQ147del|uc011dma.1_5'Flank	NR_002139				Homo sapiens clone HCG IV.9 unknown mRNA.												0						GGATGGAGCCGCGGGCGCCGTGGATGGAGCAGGAGGGGCCG	0.674													3	3	---	---	---	---	
TREML2	79865	broad.mit.edu	37	6	41169021	41169022	+	5'Flank	INS	-	A	A	rs143585501	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41169021_41169022insA	uc010jxm.1	-							NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid						T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGCCCCAAGCCGGGAGGACTCA	0.634													3	3	---	---	---	---	
MRPL2	51069	broad.mit.edu	37	6	43023097	43023098	+	Intron	INS	-	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43023097_43023098insA	uc003ots.1	-						CUL7_uc011dvb.1_5'Flank|CUL7_uc003otq.2_5'Flank|CUL7_uc010jyh.2_5'Flank|KLC4_uc003otr.1_Intron	NM_015950	NP_057034	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2 precursor						translation	mitochondrion|ribosome	structural constituent of ribosome				0		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		actctgtctcgaaaaaaaaaaa	0.203													7	4	---	---	---	---	
RNASET2	8635	broad.mit.edu	37	6	167360094	167360105	+	Intron	DEL	TTGAAGGTACGC	-	-	rs2236312	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167360094_167360105delTTGAAGGTACGC	uc003qve.2	-						RNASET2_uc003qvh.2_Intron|RNASET2_uc003qvf.2_Intron|RNASET2_uc003qvg.2_Intron|RNASET2_uc003qvi.1_Intron	NM_003730	NP_003721	O00584	RNT2_HUMAN	ribonuclease T2 precursor						RNA catabolic process	extracellular region	ribonuclease T2 activity|RNA binding				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)		AAAGATGACTTTGAAGGTACGCTTGTGAAGAA	0.363													4	3	---	---	---	---	
LFNG	3955	broad.mit.edu	37	7	2566972	2566973	+	3'UTR	DEL	GT	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2566972_2566973delGT	uc003smf.2	+	8					LFNG_uc003smg.2_Intron	NM_001040167	NP_001035257	Q8NES3	LFNG_HUMAN	lunatic fringe isoform a						organ morphogenesis	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		gtgcgtgtgcgtgtgtgtgtgt	0.579													6	3	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44294369	44294375	+	Intron	DEL	ACCAACT	-	-	rs111901158		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44294369_44294375delACCAACT	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						catcaccaccaccaactaccaccatca	0.029													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46544293	46544294	+	IGR	INS	-	AAGGAAGGAAGG	AAGGAAGGAAGG	rs142346752	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46544293_46544294insAAGGAAGGAAGG								IGFBP3 (583422 upstream) : TNS3 (770459 downstream)																							aggaaggaagtaaggaaggaag	0.000													3	5	---	---	---	---	
AP4M1	9179	broad.mit.edu	37	7	99701510	99701511	+	Intron	INS	-	AA	AA	rs80333897		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99701510_99701511insAA	uc003utb.3	+						MCM7_uc003usw.1_5'Flank|MCM7_uc003usx.1_5'Flank|AP4M1_uc011kjg.1_Intron|AP4M1_uc010lgl.1_Intron|AP4M1_uc003utc.3_Intron|AP4M1_uc010lgm.2_Intron|AP4M1_uc003utd.2_Intron|AP4M1_uc011kjh.1_Intron|AP4M1_uc003ute.3_Intron|AP4M1_uc003utf.3_Intron	NM_004722	NP_004713	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					actaaaaatgcaaaaaAAAAAA	0.228													4	2	---	---	---	---	
PCM1	5108	broad.mit.edu	37	8	17871605	17871605	+	Intron	DEL	A	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17871605delA	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc011kyi.1_Intron|PCM1_uc011kyj.1_Intron|PCM1_uc003wyk.3_Intron|PCM1_uc011kyk.1_Intron	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		CTTTAAAGCTAAAAAAAAAAA	0.284			T	RET|JAK2	papillary thyroid|CML|MPD								3	3	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48812833	48812834	+	Intron	INS	-	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48812833_48812834insA	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				GAACTCTTGGGAAAAAAAAAAC	0.376								NHEJ					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134727338	134727379	+	IGR	DEL	TCCTTCCTCCCTCCCTTCCTTCCTCCCTTCCTTCCTTCCTTC	-	-	rs71293266	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134727338_134727379delTCCTTCCTCCCTCCCTTCCTTCCTCCCTTCCTTCCTTCCTTC								ST3GAL1 (143155 upstream) : ZFAT (762654 downstream)																							cttccttccttccttcctccctcccttccttcctcccttccttccttccttctttcttccct	0.033													6	3	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395300	33395300	+	Intron	DEL	C	-	-	rs77570582		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395300delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_5'UTR|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGCAGCCTCGCCCACACACGC	0.602													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70117457	70117458	+	IGR	INS	-	G	G			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70117457_70117458insG								LOC100133920 (452508 upstream) : FOXD4L5 (58251 downstream)																							aagaaagaaaaaGAGAGAGAGA	0.074													4	2	---	---	---	---	
CARD9	64170	broad.mit.edu	37	9	139259410	139259411	+	Intron	INS	-	AGG	AGG	rs146336925	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139259410_139259411insAGG	uc004chg.3	-						DNLZ_uc004chf.1_5'Flank|DNLZ_uc011mdv.1_5'Flank|CARD9_uc011mdw.1_Intron	NM_052813	NP_434700	Q9H257	CARD9_HUMAN	caspase recruitment domain protein 9 isoform 1						positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JNK cascade|positive regulation of stress-activated MAPK cascade|regulation of apoptosis	cytoplasm	CARD domain binding|protein homodimerization activity			pancreas(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		GTGCCCAAGAAAGGGGGATCCA	0.624													3	4	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7249383	7249386	+	Intron	DEL	GAAA	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7249383_7249386delGAAA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						aagaaagaaggaaagaaagaaaga	0.000													5	3	---	---	---	---	
RPAP3	79657	broad.mit.edu	37	12	48096335	48096336	+	Intron	INS	-	A	A			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48096335_48096336insA	uc001rpr.2	-						RPAP3_uc010slk.1_Intron|RPAP3_uc001rps.2_Intron	NM_024604	NP_078880	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3 isoform								binding			ovary(1)	1	Lung SC(27;0.192)					gactccatcacaaaaaaaaaga	0.094													4	2	---	---	---	---	
LOC144438	144438	broad.mit.edu	37	12	49086750	49086750	+	5'Flank	DEL	A	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49086750delA	uc001rsd.3	-							NR_024266				Homo sapiens cDNA FLJ11223 fis, clone PLACE1008209.												0						TTCTTAGTCCAAAAAAAAAAA	0.323													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128232137	128232140	+	IGR	DEL	TTCC	-	-	rs71696637		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128232137_128232140delTTCC								None (None upstream) : TMEM132C (667151 downstream)																							ctttccttctttccttccttcctt	0.265													3	4	---	---	---	---	
ATP12A	479	broad.mit.edu	37	13	25260915	25260916	+	Intron	INS	-	GAAA	GAAA	rs9553419	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25260915_25260916insGAAA	uc001upp.2	+						ATP12A_uc010aaa.2_Intron	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A						ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	aaggaaggaaggaaagaaagaa	0.223													4	2	---	---	---	---	
NPAS3	64067	broad.mit.edu	37	14	33776799	33776800	+	Intron	INS	-	TGTGTGTGTGTGTG	TGTGTGTGTGTGTG	rs150499764	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33776799_33776800insTGTGTGTGTGTGTG	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TTTTTTTTCAAtgtgtgtgtgt	0.262													4	2	---	---	---	---	
ACOT2	10965	broad.mit.edu	37	14	74036674	74036675	+	Intron	INS	-	C	C	rs139052625	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74036674_74036675insC	uc001xon.3	+						ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2						acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		TTATGTGTATgcccccccgccg	0.272													6	5	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106816594	106816595	+	Intron	INS	-	AA	AA	rs142838600	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106816594_106816595insAA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CATCTAAAAATTTAGTCCTATT	0.436													4	2	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40921669	40921670	+	Intron	INS	-	T	T	rs146526741		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40921669_40921670insT	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGAGAGttttcttttttttttt	0.153													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	41471775	41471788	+	IGR	DEL	GAAAGGAAAGAAAG	-	-	rs60400317	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41471775_41471788delGAAAGGAAAGAAAG								INO80 (63435 upstream) : EXD1 (3145 downstream)																							agacaggaaagaaaggaaagaaaggaaaggaaag	0.009													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85070233	85070233	+	IGR	DEL	A	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85070233delA								GOLGA6L5 (10155 upstream) : UBE2Q2P1 (194 downstream)																							AGTCAAGGGGAAAAGGTAAAA	0.388													4	3	---	---	---	---	
PGPEP1L	145814	broad.mit.edu	37	15	99514433	99514440	+	Intron	DEL	GGGGGGGT	-	-	rs67495544		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99514433_99514440delGGGGGGGT	uc002bum.2	-						PGPEP1L_uc010bop.2_Intron|PGPEP1L_uc002bun.2_Intron	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein						proteolysis		cysteine-type peptidase activity				0						TGGGGGGGGGGGGGGGGTGGGCACCAAG	0.615													3	4	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54509149	54509152	+	IGR	DEL	AAGC	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54509149_54509152delAAGC								IRX3 (188771 upstream) : IRX5 (455959 downstream)																							gaaggaaggaaagcaggaaagcag	0.186													6	4	---	---	---	---	
CA5A	763	broad.mit.edu	37	16	87926753	87926753	+	Intron	DEL	T	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87926753delT	uc002fkn.1	-							NM_001739	NP_001730	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial precursor						one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0513)		tctttctttcttttttttttc	0.179													4	2	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	69293	69294	+	Intron	INS	-	TTTCT	TTTCT	rs146351269	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69293_69294insTTTCT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		cggccTAATAGTTTCATTTCTT	0.099													4	3	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11597945	11597946	+	Intron	INS	-	GCTTTC	GCTTTC	rs12946318	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11597945_11597946insGCTTTC	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ctttcttgctttcttgctttct	0.198													3	4	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16649585	16649586	+	Intron	INS	-	T	T			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16649585_16649586insT	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						ctctctctctcttttttttttt	0.109													4	2	---	---	---	---	
CRHR1	1394	broad.mit.edu	37	17	43807913	43807914	+	Intron	INS	-	A	A	rs111610904		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43807913_43807914insA	uc002ijp.2	+						CRHR1_uc010wjx.1_Intron			P34998	CRFR1_HUMAN	SubName: Full=cDNA FLJ60308, highly similar to Corticotropin-releasing factor receptor 1;						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		aggaaggaaggaaggaaggaag	0.262													6	6	---	---	---	---	
MPO	4353	broad.mit.edu	37	17	56351709	56351716	+	Intron	DEL	GTGTGTGT	-	-	rs72051182		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56351709_56351716delGTGTGTGT	uc002ivu.1	-							NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase						anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	GAATCTAGGAgtgtgtgtgtgtgtgtgt	0.341													4	2	---	---	---	---	
ST8SIA5	29906	broad.mit.edu	37	18	44272373	44272373	+	Intron	DEL	T	-	-	rs77603253		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44272373delT	uc002lcj.1	-						ST8SIA5_uc002lci.1_Intron|ST8SIA5_uc010xcy.1_Intron|ST8SIA5_uc010xcz.1_Intron|ST8SIA5_uc010dno.1_Intron	NM_013305	NP_037437	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide						glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						tctttgtttcttttttttttt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11727879	11727880	+	IGR	INS	-	AAAAGAAAAGAAAA	AAAAGAAAAGAAAA	rs148111754	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11727879_11727880insAAAAGAAAAGAAAA								None (None upstream) : BTBD3 (143597 downstream)																							aggaaggaaggaaAAGAAAAGA	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15436915	15436915	+	Intron	DEL	G	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15436915delG	uc002yjk.2	+						uc002yjl.2_Intron					Homo sapiens, clone IMAGE:4102980, mRNA.																		CCCCTGGGACGGGGGCCTTGG	0.687													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33157590	33157592	+	IGR	DEL	CAT	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33157590_33157592delCAT								SFRS15 (53159 upstream) : HUNK (88036 downstream)																							ccaccaccaccatcaccaccatc	0.000													4	2	---	---	---	---	
CBS	875	broad.mit.edu	37	21	44476000	44476001	+	Intron	INS	-	T	T	rs79861734		TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44476000_44476001insT	uc002zcu.2	-						CBS_uc002zcs.1_Intron|CBS_uc002zct.2_Intron|CBS_uc002zcw.3_Intron|CBS_uc002zcv.2_Intron|CBS_uc002zcx.2_3'UTR	NM_000071	NP_000062	P35520	CBS_HUMAN	cystathionine-beta-synthase						cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	gaatttgcatctttttttTTTT	0.238													4	2	---	---	---	---	
TUBGCP6	85378	broad.mit.edu	37	22	50683032	50683033	+	5'UTR	INS	-	T	T	rs150242575	by1000genomes	TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50683032_50683033insT	uc003bkb.1	-	1					TUBGCP6_uc010har.1_5'UTR|TUBGCP6_uc010has.1_RNA|TUBGCP6_uc010hau.1_5'UTR	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6						G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CAGAACTGGTATTTTTTAAAGG	0.609													4	2	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467584	1467585	+	Intron	DEL	TT	-	-			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467584_1467585delTT	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tctttctttctttttctttctt	0.045													8	4	---	---	---	---	
KDM6A	7403	broad.mit.edu	37	X	44938746	44938747	+	Intron	INS	-	TATG	TATG			TCGA-DS-A0VK-01	TCGA-DS-A0VK-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44938746_44938747insTATG	uc004dge.3	+						KDM6A_uc011mkz.1_Intron|KDM6A_uc011mla.1_Intron|KDM6A_uc011mlb.1_Intron|KDM6A_uc011mlc.1_Intron|KDM6A_uc011mld.1_Intron	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide						histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						TCgtatgtatatatgtatgtat	0.144			D|N|F|S		renal|oesophageal SCC|MM								6	3	---	---	---	---	
