Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CASZ1	54897	broad.mit.edu	37	1	10699536	10699536	+	Silent	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10699536C>T	uc001aro.2	-	21	5063	c.4743G>A	c.(4741-4743)ACG>ACA	p.T1581T		NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	1581	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TGCCCACCACCGTGTGGCGGC	0.687													6	6	---	---	---	---	PASS
PLEKHM2	23207	broad.mit.edu	37	1	16044409	16044409	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16044409C>T	uc010obo.1	+	4	526	c.299C>T	c.(298-300)GCC>GTC	p.A100V		NM_015164	NP_055979	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M	100	RUN.|Interaction with KIF5B.				Golgi organization	cytoplasm	kinesin binding			ovary(1)	1		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CTGTACCTGGCCCTCAACGAG	0.562													8	11	---	---	---	---	PASS
EPB41	2035	broad.mit.edu	37	1	29314294	29314294	+	Silent	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29314294G>A	uc001brm.1	+	1	352	c.345G>A	c.(343-345)GAG>GAA	p.E115E	EPB41_uc001brg.1_5'UTR|EPB41_uc001brh.1_5'UTR|EPB41_uc001bri.1_Silent_p.E115E|EPB41_uc001brj.1_5'UTR|EPB41_uc009vtk.1_Silent_p.E115E|EPB41_uc001brk.2_Silent_p.E115E|EPB41_uc001brl.1_Silent_p.E115E|EPB41_uc009vtl.1_5'UTR|EPB41_uc009vtm.1_5'UTR	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	115					blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GTCAGAAAGAGATAGAATTTG	0.423													90	165	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35579239	35579239	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35579239G>A	uc001bym.2	+	11	1956	c.1808G>A	c.(1807-1809)CGA>CAA	p.R603Q	ZMYM1_uc001byn.2_Missense_Mutation_p.R603Q|ZMYM1_uc010ohu.1_Missense_Mutation_p.R584Q|ZMYM1_uc001byo.2_Missense_Mutation_p.R243Q|ZMYM1_uc009vut.2_Missense_Mutation_p.R528Q	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	603						nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAAACATTTCGACTTATGAAT	0.318													57	81	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37270815	37270815	+	Missense_Mutation	SNP	T	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37270815T>A	uc001caz.2	-	15	2473	c.2338A>T	c.(2338-2340)ACC>TCC	p.T780S	GRIK3_uc001cba.1_Missense_Mutation_p.T780S	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	780	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	ATGGCGATGGTGATCTTGTCC	0.592													24	59	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148251868	148251868	+	Intron	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148251868G>A	uc001eqe.2	-						LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron|uc010pah.1_3'UTR|uc010pai.1_3'UTR|uc001eqz.2_3'UTR|uc001erb.2_3'UTR|uc001erd.3_3'UTR|uc001erc.3_RNA|uc010paj.1_3'UTR			Q86T75	NBPFB_HUMAN	SubName: Full=cDNA FLJ78770;							cytoplasm					0						GGCTTAGTAAGGGCTGTTTAT	0.468													152	228	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148346705	148346705	+	Silent	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148346705G>A	uc001eqf.2	-	1	87	c.52C>T	c.(52-54)CTA>TTA	p.L18L	LOC200030_uc001eqe.2_5'UTR|LOC200030_uc001eqg.2_5'UTR|NBPF14_uc009wkf.1_RNA|uc001erd.3_Silent_p.L18L|uc001erc.3_RNA|uc010paj.1_5'UTR|uc010pav.1_Silent_p.L18L|uc010paw.1_5'UTR	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672	18						cytoplasm					0						TTGATTTCTAGAATGTTCATC	0.512													6	244	---	---	---	---	PASS
NBPF15	284565	broad.mit.edu	37	1	148594456	148594456	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148594456G>A	uc001esc.2	+	19	2318	c.1829G>A	c.(1828-1830)AGA>AAA	p.R610K		NM_173638	NP_775909	Q8N660	NBPFF_HUMAN	hypothetical protein LOC284565	610	NBPF 6.					cytoplasm					0	all_hematologic(923;0.032)					TCACTGGATAGATGTTATTCG	0.453													222	400	---	---	---	---	PASS
DDR2	4921	broad.mit.edu	37	1	162737062	162737062	+	Silent	SNP	T	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162737062T>C	uc001gcf.2	+	12	1671	c.1206T>C	c.(1204-1206)ATT>ATC	p.I402I	DDR2_uc001gcg.2_Silent_p.I402I	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	402	Helical; (Potential).				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			GGATCCTGATTGGCTGCTTGG	0.478													15	240	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204408075	204408075	+	Silent	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204408075G>A	uc001haw.2	-	24	3983	c.3504C>T	c.(3502-3504)GAC>GAT	p.D1168D	PIK3C2B_uc010pqv.1_Silent_p.D1140D	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	1168	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TCTCATACTCGTCCTCCCCAG	0.597													10	43	---	---	---	---	PASS
DISP1	84976	broad.mit.edu	37	1	223176989	223176989	+	Silent	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223176989C>T	uc001hnu.1	+	8	2397	c.2250C>T	c.(2248-2250)TCC>TCT	p.S750S		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	750					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)		TGGAGTTATCCGAGTTCCAGG	0.463													70	123	---	---	---	---	PASS
PSEN2	5664	broad.mit.edu	37	1	227076555	227076555	+	Missense_Mutation	SNP	G	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227076555G>T	uc009xeo.1	+	8	1019	c.592G>T	c.(592-594)GCC>TCC	p.A198S	PSEN2_uc009xep.1_Missense_Mutation_p.A198S|PSEN2_uc001hqk.2_RNA	NM_000447	NP_000438	P49810	PSN2_HUMAN	presenilin 2 isoform 1	198	Lumenal (Potential).				amyloid precursor protein catabolic process|anti-apoptosis|apoptosis|beta-amyloid metabolic process|calcium ion transport|induction of apoptosis by extracellular signals|intracellular signal transduction|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear inner membrane|perinuclear region of cytoplasm|Z disc	aspartic-type endopeptidase activity|protein binding			lung(2)	2		Prostate(94;0.0771)				CTACAATGTGGCCATGGACTA	0.577													12	97	---	---	---	---	PASS
TRIM54	57159	broad.mit.edu	37	2	27505742	27505742	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27505742G>A	uc002rjo.2	+	1	143	c.143G>A	c.(142-144)CGC>CAC	p.R48H	TRIM54_uc002rjn.2_Missense_Mutation_p.R48H	NM_187841	NP_912730	Q9BYV2	TRI54_HUMAN	ring finger protein 30 isoform 2	48	RING-type.				cell differentiation|microtubule-based process|multicellular organismal development|negative regulation of microtubule depolymerization	microtubule|sarcomere	signal transducer activity|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACCTGTGCCGCAAATGTGCC	0.587													5	234	---	---	---	---	PASS
TEX261	113419	broad.mit.edu	37	2	71221896	71221896	+	5'UTR	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71221896C>T	uc002shn.2	-	1					TEX261_uc010fdy.2_5'Flank	NM_144582	NP_653183	Q6UWH6	TX261_HUMAN	testis expressed sequence 261							integral to membrane					0						ATGGCGCCCCCACCCGCCCGC	0.587													5	0	---	---	---	---	PASS
PSD4	23550	broad.mit.edu	37	2	113955395	113955395	+	Silent	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113955395C>T	uc002tjc.2	+	14	2712	c.2529C>T	c.(2527-2529)CAC>CAT	p.H843H	PSD4_uc002tjd.2_Silent_p.H463H|PSD4_uc002tje.2_Silent_p.H813H|PSD4_uc002tjf.2_Silent_p.H464H|PSD4_uc002tjg.2_Silent_p.H9H|PSD4_uc010yxs.1_Silent_p.H73H|PSD4_uc002tjh.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	843	PH.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						TGGGGGTGCACCACTCGCTGG	0.642													8	22	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130877709	130877709	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130877709G>A	uc010fmh.2	-	3	780	c.380C>T	c.(379-381)GCC>GTC	p.A127V		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	127						cell cortex	ATP binding			skin(3)|ovary(2)	5						CTCCATGAAGGCACTGTCATC	0.587													45	65	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	131976355	131976355	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131976355C>T	uc002tsn.2	+	1	432	c.380C>T	c.(379-381)GCC>GTC	p.A127V	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	127							ATP binding				0						GATGACAGCGCCTTCATGGAG	0.597													8	135	---	---	---	---	PASS
PLEKHM3	389072	broad.mit.edu	37	2	208865987	208865987	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208865987C>T	uc002vcl.2	-	2	867	c.377G>A	c.(376-378)CGG>CAG	p.R126Q	PLEKHM3_uc002vcm.2_Missense_Mutation_p.R126Q	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	126					intracellular signal transduction		metal ion binding			ovary(1)	1						CCGGTCCCTCCGACGCTGACA	0.468													43	93	---	---	---	---	PASS
MLH1	4292	broad.mit.edu	37	3	37038100	37038100	+	Intron	SNP	G	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37038100G>C	uc003cgl.2	+						MLH1_uc011aye.1_Intron|MLH1_uc011ayb.1_Intron|MLH1_uc010hge.2_Intron|MLH1_uc003cgn.3_Intron|MLH1_uc011ayc.1_Intron|MLH1_uc011ayd.1_Intron|MLH1_uc003cgo.2_Intron	NM_000249	NP_000240	P40692	MLH1_HUMAN	MutL protein homolog 1						mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding			large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						TTTTCTGTTTGATTTGCCAGT	0.368		1	D|Mis|N|F|S		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				36	24	---	---	---	---	PASS
ARIH2	10425	broad.mit.edu	37	3	49004687	49004687	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49004687G>A	uc003cvb.2	+	6	829	c.517G>A	c.(517-519)GTC>ATC	p.V173I	ARIH2_uc003cvc.2_Missense_Mutation_p.V173I|ARIH2_uc003cvf.2_Missense_Mutation_p.V91I|ARIH2_uc010hkl.2_Missense_Mutation_p.V173I	NM_006321	NP_006312	O95376	ARI2_HUMAN	ariadne homolog 2	173	RING-type 1; atypical.				developmental cell growth|hemopoietic stem cell proliferation|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		CTCAGTTCTCGTCAAGGACGG	0.493													7	96	---	---	---	---	PASS
ARIH2	10425	broad.mit.edu	37	3	49008073	49008073	+	Missense_Mutation	SNP	G	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49008073G>T	uc003cvb.2	+	8	1018	c.706G>T	c.(706-708)GTT>TTT	p.V236F	ARIH2_uc003cvc.2_Missense_Mutation_p.V236F|ARIH2_uc003cvf.2_Missense_Mutation_p.V154F|ARIH2_uc010hkl.2_Missense_Mutation_p.V236F	NM_006321	NP_006312	O95376	ARI2_HUMAN	ariadne homolog 2	236	IBR-type.				developmental cell growth|hemopoietic stem cell proliferation|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		CTGCCCCATGGTTATTCGGGT	0.527													3	97	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124209703	124209703	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124209703C>T	uc003ehg.2	+	30	4680	c.4553C>T	c.(4552-4554)ACG>ATG	p.T1518M	KALRN_uc010hrv.1_Missense_Mutation_p.T1509M|KALRN_uc003ehf.1_Missense_Mutation_p.T1518M|KALRN_uc011bjy.1_Missense_Mutation_p.T1509M	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	1518	PH 1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TCAGGACACACGAAATATGTT	0.512													60	49	---	---	---	---	PASS
MCM2	4171	broad.mit.edu	37	3	127340510	127340510	+	Missense_Mutation	SNP	G	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127340510G>C	uc003ejp.2	+	16	2666	c.2609G>C	c.(2608-2610)CGT>CCT	p.R870P	MCM2_uc011bkm.1_Missense_Mutation_p.R740P|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_Missense_Mutation_p.R823P	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	870					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4						TTGCAGGCTCGTCAGATCAAC	0.502													6	41	---	---	---	---	PASS
GPR160	26996	broad.mit.edu	37	3	169802324	169802324	+	Silent	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169802324C>T	uc003fgi.2	+	4	1154	c.564C>T	c.(562-564)TTC>TTT	p.F188F	GPR160_uc010hwq.2_Silent_p.F188F	NM_014373	NP_055188	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	188	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TGTCATTTTTCATGGTGATGA	0.403													7	128	---	---	---	---	PASS
SPATA16	83893	broad.mit.edu	37	3	172631502	172631502	+	Silent	SNP	G	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172631502G>T	uc003fin.3	-	10	1694	c.1536C>A	c.(1534-1536)ACC>ACA	p.T512T		NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	512					cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TTCCTTCAAGGGTGTCCATAG	0.358													4	118	---	---	---	---	PASS
SCFD2	152579	broad.mit.edu	37	4	53773624	53773624	+	Missense_Mutation	SNP	C	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53773624C>A	uc003gzu.2	-	7	1976	c.1842G>T	c.(1840-1842)AAG>AAT	p.K614N	SCFD2_uc010igm.2_Intron	NM_152540	NP_689753	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	614					protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GTTACTTTACCTTCATGAACA	0.438													4	119	---	---	---	---	PASS
ALPK1	80216	broad.mit.edu	37	4	113353125	113353125	+	Missense_Mutation	SNP	A	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113353125A>C	uc003iap.3	+	11	2701	c.2422A>C	c.(2422-2424)AAT>CAT	p.N808H	ALPK1_uc003ian.3_Missense_Mutation_p.N808H|ALPK1_uc011cfx.1_Missense_Mutation_p.N730H|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Missense_Mutation_p.N636H	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	808							ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GGTCCTGCACAATTCTCTGGG	0.498													14	10	---	---	---	---	PASS
GAB1	2549	broad.mit.edu	37	4	144359596	144359596	+	Silent	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144359596G>A	uc003ije.2	+	4	1397	c.1038G>A	c.(1036-1038)CCG>CCA	p.P346P	GAB1_uc003ijd.2_Silent_p.P346P|GAB1_uc011chq.1_Silent_p.P243P	NM_002039	NP_002030	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1 isoform b	346					cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)					CTCGGCCACCGAAACCACATC	0.493													38	15	---	---	---	---	PASS
LNPEP	4012	broad.mit.edu	37	5	96322254	96322254	+	Silent	SNP	C	T	T	rs142457895		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96322254C>T	uc003kmv.1	+	4	1525	c.1011C>T	c.(1009-1011)GTC>GTT	p.V337V	LNPEP_uc003kmw.1_Silent_p.V323V	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	337	Extracellular (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		AGTCATCAGTCGTTCTAGATG	0.383													77	58	---	---	---	---	PASS
CATSPER3	347732	broad.mit.edu	37	5	134345118	134345118	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134345118G>T	uc003lag.2	+	6	942	c.874G>T	c.(874-876)GGA>TGA	p.G292*		NM_178019	NP_821138	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	292					cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GATGCTCATGGGAGAGAAGCA	0.562													4	68	---	---	---	---	PASS
HLA-DMB	3109	broad.mit.edu	37	6	32905075	32905075	+	Missense_Mutation	SNP	C	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32905075C>A	uc003ocl.1	-	3	729	c.496G>T	c.(496-498)GCC>TCC	p.A166S	HLA-DMB_uc003ocj.1_3'UTR|HLA-DMB_uc003ock.1_5'Flank|HLA-DMB_uc010jud.1_Missense_Mutation_p.A35S|HLA-DMB_uc010jue.1_Missense_Mutation_p.A35S|HLA-DMB_uc010juf.1_Missense_Mutation_p.A35S|HLA-DMB_uc011dql.1_Missense_Mutation_p.A166S	NM_002118	NP_002109	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM	166	Lumenal (Potential).|Ig-like C1-type.|Beta-2.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TTGGGCTGGGCAGTCTTGTGC	0.562													53	106	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33148097	33148097	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33148097G>A	uc003ocx.1	-	12	1525	c.1297C>T	c.(1297-1299)CGA>TGA	p.R433*	COL11A2_uc010jul.1_5'Flank|COL11A2_uc003ocy.1_Nonsense_Mutation_p.R347*|COL11A2_uc003ocz.1_Nonsense_Mutation_p.R326*	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	433	Nonhelical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						AGCCCTGCTCGGCCAGGGGGG	0.527													39	69	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90405382	90405382	+	Missense_Mutation	SNP	T	G	G			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90405382T>G	uc003pnn.1	-	61	9829	c.9713A>C	c.(9712-9714)CAG>CCG	p.Q3238P		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	3238					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAAGCGTGCCTGGGGAAGCCA	0.587													7	76	---	---	---	---	PASS
L3MBTL3	84456	broad.mit.edu	37	6	130399706	130399706	+	Silent	SNP	T	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130399706T>C	uc003qbt.2	+	14	1418	c.1248T>C	c.(1246-1248)TGT>TGC	p.C416C	L3MBTL3_uc003qbu.2_Silent_p.C391C	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a	416	MBT 2.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		CTTTCAGGTGTGAAGCATCAA	0.338													38	88	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152647696	152647696	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152647696C>A	uc010kiw.2	-	79	15630	c.15028G>T	c.(15028-15030)GAG>TAG	p.E5010*	SYNE1_uc003qot.3_Nonsense_Mutation_p.E4939*|SYNE1_uc003qou.3_Nonsense_Mutation_p.E5010*|SYNE1_uc010kiz.2_Nonsense_Mutation_p.E765*	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5010	Spectrin 15.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGGGCATCCTCAAGCCAGTCA	0.433										HNSCC(10;0.0054)			4	52	---	---	---	---	PASS
EZR	7430	broad.mit.edu	37	6	159191859	159191859	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159191859C>A	uc003qrt.3	-	9	1242	c.1027G>T	c.(1027-1029)GAG>TAG	p.E343*	EZR_uc011efr.1_5'Flank|EZR_uc011efs.1_Nonsense_Mutation_p.E311*|EZR_uc003qru.3_Nonsense_Mutation_p.E343*	NM_003379	NP_003370	P15311	EZRI_HUMAN	ezrin	343	Interaction with SCYL3.				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TCCTCCTTCTCGCGCATCATC	0.542													4	131	---	---	---	---	PASS
PTPN12	5782	broad.mit.edu	37	7	77267950	77267950	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77267950C>T	uc003ugh.2	+	17	2274	c.2183C>T	c.(2182-2184)GCG>GTG	p.A728V	PTPN12_uc011kgp.1_Missense_Mutation_p.A609V|PTPN12_uc011kgq.1_Missense_Mutation_p.A598V|PTPN12_uc010lds.2_Missense_Mutation_p.A460V	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type	728						soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3						GATCATCCAGCGGGAGGTATT	0.358													95	40	---	---	---	---	PASS
ZNF395	55893	broad.mit.edu	37	8	28218546	28218546	+	Silent	SNP	T	G	G			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28218546T>G	uc003xgq.2	-	2	184	c.96A>C	c.(94-96)CCA>CCC	p.P32P	ZNF395_uc003xgt.2_Silent_p.P32P|ZNF395_uc003xgr.2_Silent_p.P32P|ZNF395_uc003xgs.2_Silent_p.P32P	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	32					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GCTCCGAGGGTGGGGCAGCCG	0.677													6	22	---	---	---	---	PASS
LRRC6	23639	broad.mit.edu	37	8	133623614	133623614	+	Intron	SNP	A	G	G			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133623614A>G	uc003ytk.2	-						LRRC6_uc003ytl.2_Intron	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6							cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			ATATACCTTCAAAATTAAACA	0.318													14	40	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143614774	143614774	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143614774G>A	uc003ywm.2	+	24	3700	c.3517G>A	c.(3517-3519)GAC>AAC	p.D1173N		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1173	Helical; Name=7; (Potential).				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CGCTGTCTTCGACTCGCTGGA	0.672													12	10	---	---	---	---	PASS
RGP1	9827	broad.mit.edu	37	9	35752745	35752745	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35752745G>A	uc011lpf.1	+	9	1191	c.1050G>A	c.(1048-1050)TGG>TGA	p.W350*	GBA2_uc011lpd.1_5'Flank|RGP1_uc011lpe.1_Nonsense_Mutation_p.W390*	NM_001080496	NP_001073965	Q92546	RGP1_HUMAN	RGP1 retrograde golgi transport homolog	350										ovary(1)	1	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTACCACCTGGACAGGACCTG	0.557													17	25	---	---	---	---	PASS
RECK	8434	broad.mit.edu	37	9	36117064	36117064	+	Missense_Mutation	SNP	G	A	A	rs142114378		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36117064G>A	uc003zyv.2	+	17	2229	c.2143G>A	c.(2143-2145)GCG>ACG	p.A715T	RECK_uc003zyw.2_Missense_Mutation_p.A587T|RECK_uc003zyx.2_RNA	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor	715	Kazal-like 2.					anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			AAGACAGCTCGCGTGTGACCA	0.458													47	55	---	---	---	---	PASS
C9orf9	11092	broad.mit.edu	37	9	135759455	135759455	+	Missense_Mutation	SNP	C	T	T	rs141999397	byFrequency	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135759455C>T	uc004cbx.1	+	2	232	c.121C>T	c.(121-123)CGG>TGG	p.R41W	C9orf9_uc004cby.1_Missense_Mutation_p.R41W|C9orf9_uc004cbz.1_Missense_Mutation_p.R41W	NM_018956	NP_061829	Q96E40	CI009_HUMAN	Rsb-66 protein	41								p.?(1)			0				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		CGACAAGATCCGGCCCATCTC	0.512													34	38	---	---	---	---	PASS
SEC61A2	55176	broad.mit.edu	37	10	12198972	12198972	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12198972G>A	uc001ile.2	+	8	830	c.683G>A	c.(682-684)CGA>CAA	p.R228Q	SEC61A2_uc010qbq.1_Missense_Mutation_p.R206Q|SEC61A2_uc001ilf.3_RNA|SEC61A2_uc001ilh.3_RNA|SEC61A2_uc001ilg.3_Missense_Mutation_p.R228Q	NM_018144	NP_060614	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform a	228	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				GACAAAGTCCGAGCTTTACGG	0.443													60	33	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38343652	38343652	+	Silent	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38343652G>A	uc001izh.2	+	5	775	c.597G>A	c.(595-597)CTG>CTA	p.L199L	ZNF33A_uc001izg.2_Silent_p.L200L|ZNF33A_uc010qev.1_Silent_p.L206L|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	199						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						GGAACACACTGAGTCATCATG	0.348													31	16	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38343662	38343662	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38343662G>A	uc001izh.2	+	5	785	c.607G>A	c.(607-609)GAG>AAG	p.E203K	ZNF33A_uc001izg.2_Missense_Mutation_p.E204K|ZNF33A_uc010qev.1_Missense_Mutation_p.E210K|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	203						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						GAGTCATCATGAGGAGACTTT	0.348													33	15	---	---	---	---	PASS
RRP12	23223	broad.mit.edu	37	10	99126355	99126355	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99126355G>A	uc001knf.2	-	28	3378	c.3239C>T	c.(3238-3240)TCA>TTA	p.S1080L	RRP12_uc001kne.2_Missense_Mutation_p.S95L|RRP12_uc009xvl.2_Missense_Mutation_p.S197L|RRP12_uc009xvm.2_Missense_Mutation_p.S798L|RRP12_uc010qou.1_Missense_Mutation_p.S1019L|RRP12_uc009xvn.2_Missense_Mutation_p.S980L	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	1080	Glu-rich.					integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CTCGTCCTCTGAGTCAGCTAA	0.602													6	103	---	---	---	---	PASS
INPP5A	3632	broad.mit.edu	37	10	134523970	134523970	+	Intron	SNP	G	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134523970G>T	uc001llp.2	+						INPP5A_uc001llo.1_Intron|INPP5A_uc001llq.2_Intron	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		ggtaggtgtgggcgggcaggt	0.244													3	17	---	---	---	---	PASS
PPFIBP2	8495	broad.mit.edu	37	11	7647010	7647010	+	Silent	SNP	T	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7647010T>C	uc001mfj.3	+	8	1102	c.714T>C	c.(712-714)GCT>GCC	p.A238A	PPFIBP2_uc010rbb.1_Silent_p.A161A|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Silent_p.A161A|PPFIBP2_uc010rbd.1_Silent_p.A80A|PPFIBP2_uc010rbe.1_Silent_p.A126A|PPFIBP2_uc001mfl.3_Silent_p.A95A	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2	238	Potential.				cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TCTTCCAGGCTGAAGTCGCCC	0.572													3	49	---	---	---	---	PASS
LRRN4CL	221091	broad.mit.edu	37	11	62455621	62455621	+	Silent	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62455621G>A	uc001nun.2	-	2	667	c.360C>T	c.(358-360)GAC>GAT	p.D120D		NM_203422	NP_981967	Q8ND94	LRN4L_HUMAN	LRRN4 C-terminal like precursor	120	Fibronectin type-III.|Extracellular (Potential).					integral to membrane					0						CCTCGCTGCCGTCCCAAAGCA	0.657													5	5	---	---	---	---	PASS
GALNT8	26290	broad.mit.edu	37	12	4870147	4870147	+	Silent	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4870147C>T	uc001qne.1	+	7	1289	c.1197C>T	c.(1195-1197)GTC>GTT	p.V399V		NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	399	Lumenal (Potential).|Catalytic subdomain B.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4						GAGGGAAGGTCGAGATTTTGC	0.522													44	47	---	---	---	---	PASS
TAC3	6866	broad.mit.edu	37	12	57406622	57406622	+	Missense_Mutation	SNP	C	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57406622C>A	uc001smp.2	-	5	436	c.276G>T	c.(274-276)AAG>AAT	p.K92N	TAC3_uc001smr.2_RNA|TAC3_uc001smq.2_RNA|TAC3_uc001smt.2_RNA|TAC3_uc001sms.2_RNA|TAC3_uc010sqy.1_RNA|TAC3_uc001smu.2_Intron|TAC3_uc001smv.2_Intron|TAC3_uc001smo.2_Intron	NM_013251	NP_037383	Q9UHF0	TKNK_HUMAN	tachykinin 3 precursor	92					female pregnancy|neuropeptide signaling pathway|tachykinin receptor signaling pathway	extracellular space|soluble fraction	receptor binding			ovary(1)|skin(1)	2						GGACGCTCCTCTTGCCCATAA	0.507													4	142	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	23005087	23005087	+	Intron	SNP	G	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23005087G>C	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wde.1_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wez.2_Intron|uc010ajx.1_Intron|uc001wfb.1_Intron|uc001wfd.1_Intron|uc001wfe.2_Intron|uc001wfg.2_Intron|uc001wfh.1_Intron|uc001wfi.2_Intron|uc001wfk.2_Intron|uc001wfl.2_Intron|uc010ajy.1_Intron|uc001wfn.2_Intron|uc001wfp.2_Intron|uc001wfq.1_Intron|uc001wfr.1_Intron|uc010ajz.1_Intron|uc001wfs.1_Intron|uc001wft.1_Intron|uc001wfu.2_Intron|uc001wfv.1_Intron|uc001wfw.1_Intron|uc001wfx.2_Intron|uc001wfy.1_Intron|uc001wfz.1_Intron|uc001wgc.2_Intron|uc001wgd.2_Intron|uc001wge.3_Intron|uc001wgf.2_Intron|uc010tmw.1_Intron|uc010tmx.1_5'Flank|uc010tmy.1_5'Flank|uc010akb.1_5'Flank|uc001wgh.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		AGTTATGTCAGAGTGTGAACA	0.448													39	60	---	---	---	---	PASS
WDR76	79968	broad.mit.edu	37	15	44127315	44127315	+	Silent	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44127315C>T	uc001zti.1	+	3	542	c.519C>T	c.(517-519)AAC>AAT	p.N173N		NM_024908	NP_079184	Q9H967	WDR76_HUMAN	WD repeat domain 76	173											0		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		TATCAGAAAACGCAGACTTTT	0.294													5	157	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1810463	1810463	+	Silent	SNP	T	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1810463T>C	uc002cmk.2	+	12	1504	c.1384T>C	c.(1384-1386)TTG>CTG	p.L462L	MAPK8IP3_uc002cml.2_Silent_p.L456L|MAPK8IP3_uc010uvl.1_Silent_p.L463L	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	462	Potential.				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						GAGGGGCGAGTTGGAGGCTGC	0.532													40	15	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18853011	18853011	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18853011C>T	uc002dfm.2	-	41	6935	c.6572G>A	c.(6571-6573)CGA>CAA	p.R2191Q	SMG1_uc010bwb.2_Missense_Mutation_p.R2051Q|SMG1_uc010bwa.2_Missense_Mutation_p.R922Q|SMG1_uc002dfo.3_Missense_Mutation_p.R489Q	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	2191	PI3K/PI4K.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						AGAATAGTGTCGAGCATGGAA	0.433													15	334	---	---	---	---	PASS
NCRNA00169	400508	broad.mit.edu	37	16	21328281	21328281	+	RNA	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21328281C>T	uc010bwr.1	+	3		c.673C>T				NR_026675				Homo sapiens cDNA FLJ41766 fis, clone IMR322006222.											central_nervous_system(1)	1						TAAATAAGAACGGACCTTTCG	0.438													177	248	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61687700	61687700	+	Missense_Mutation	SNP	C	G	G			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61687700C>G	uc002eog.1	-	12	2464	c.2212G>C	c.(2212-2214)GCC>CCC	p.A738P		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	738	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TATGGCGGGGCCGTGGGATCA	0.507													5	39	---	---	---	---	PASS
CTCF	10664	broad.mit.edu	37	16	67660622	67660622	+	Intron	SNP	G	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67660622G>T	uc002etl.2	+						CTCF_uc010cek.2_Intron|CTCF_uc002etm.1_5'Flank	NM_006565	NP_006556	P49711	CTCF_HUMAN	CCCTC-binding factor						chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		TAGACAGGTAGGAACCTTCAT	0.423													4	81	---	---	---	---	PASS
AARS	16	broad.mit.edu	37	16	70303578	70303578	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70303578G>A	uc002eyn.1	-	7	1015	c.905C>T	c.(904-906)GCT>GTT	p.A302V	AARS_uc010vlu.1_Missense_Mutation_p.A132V	NM_001605	NP_001596	P49588	SYAC_HUMAN	alanyl-tRNA synthetase	302					alanyl-tRNA aminoacylation|tRNA processing	cytosol|soluble fraction	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			pancreas(1)	1		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)	L-Alanine(DB00160)	GATGGTCCGAGCGTGGTCAGC	0.597													90	162	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32956104	32956104	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32956104C>T	uc002hif.2	+	5	1277	c.949C>T	c.(949-951)CGG>TGG	p.R317W		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	317	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTCAGTCAAGCGGAGGATCAT	0.612													23	42	---	---	---	---	PASS
KRT36	8689	broad.mit.edu	37	17	39643888	39643888	+	Silent	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39643888G>A	uc002hwt.2	-	4	801	c.801C>T	c.(799-801)TGC>TGT	p.C267C		NM_003771	NP_003762	O76013	KRT36_HUMAN	keratin 36	267	Rod.|Coil 2.					intermediate filament	protein binding|structural constituent of epidermis				0		Breast(137;0.000286)				CCTCGTACTGGCATCTCATAT	0.597													4	161	---	---	---	---	PASS
C18orf10	25941	broad.mit.edu	37	18	34376837	34376837	+	Silent	SNP	T	G	G			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34376837T>G	uc002kzw.1	-	7	1262	c.834A>C	c.(832-834)GGA>GGC	p.G278G	C18orf10_uc002kzv.1_Intron|C18orf10_uc010xci.1_Silent_p.G243G|C18orf10_uc002kzx.1_Silent_p.G235G	NM_015476	NP_056291	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2	278						cytoplasm|microtubule				skin(1)	1						GACCGGAGGGTCCTGAGGGCC	0.562													10	105	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54605881	54605881	+	Missense_Mutation	SNP	A	G	G			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54605881A>G	uc002lgk.1	+	24	4160	c.3949A>G	c.(3949-3951)ATG>GTG	p.M1317V	WDR7_uc002lgl.1_Missense_Mutation_p.M1284V	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	1317										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		TATTGAAAAGATGCCCACAGA	0.353													37	59	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59166539	59166539	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59166539G>A	uc010dps.1	+	2	379	c.367G>A	c.(367-369)GAC>AAC	p.D123N	CDH20_uc002lif.2_Missense_Mutation_p.D117N	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	123	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				TCAGAGGCTCGACCGAGAGGA	0.547													23	19	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65181691	65181691	+	Missense_Mutation	SNP	G	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65181691G>T	uc002lke.1	-	2	1409	c.185C>A	c.(184-186)CCC>CAC	p.P62H		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	52						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				CTTTTGGTTGGGTCTGAAATC	0.373													58	108	---	---	---	---	PASS
MBD3L1	85509	broad.mit.edu	37	19	8953854	8953854	+	Missense_Mutation	SNP	G	C	C			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8953854G>C	uc002mko.2	+	1	586	c.500G>C	c.(499-501)AGA>ACA	p.R167T		NM_145208	NP_660209	Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like	167					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						GTCAGAGAGAGACTCGCAATA	0.478													9	24	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8999020	8999020	+	Intron	SNP	C	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8999020C>A	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCAGTGGATACTCACTGCTAG	0.537													4	3	---	---	---	---	PASS
ZNF493	284443	broad.mit.edu	37	19	21607379	21607379	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21607379C>T	uc002npx.2	+	2	1814	c.1534C>T	c.(1534-1536)CGG>TGG	p.R512W	ZNF493_uc002npw.2_Missense_Mutation_p.R640W|ZNF493_uc002npy.2_Missense_Mutation_p.R512W	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	512	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AGCTTTTAAGCGGTCCTCACA	0.388													27	42	---	---	---	---	PASS
CLIP3	25999	broad.mit.edu	37	19	36517911	36517911	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36517911C>T	uc010eeq.1	-	3	625	c.343G>A	c.(343-345)GGG>AGG	p.G115R	uc002ocy.2_Intron|CLIP3_uc002ocz.1_Missense_Mutation_p.G115R	NM_015526	NP_056341	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	115					chaperone-mediated protein transport|fat cell differentiation|membrane biogenesis|negative regulation of microtubule polymerization|peptidyl-L-cysteine S-palmitoylation|positive regulation of apoptosis|positive regulation of endocytosis|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose transport|positive regulation of protein phosphorylation	early endosome membrane|Golgi stack|membrane raft|microsome|plasma membrane|recycling endosome membrane|trans-Golgi network membrane	ganglioside binding|microtubule binding			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCGGTCAGCCCGTCACGATCG	0.632													19	39	---	---	---	---	PASS
CALM3	808	broad.mit.edu	37	19	47109124	47109124	+	Intron	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47109124C>T	uc002pew.2	+						CALM3_uc010ekp.2_Intron|CALM3_uc010xyc.1_Intron	NM_005184	NP_005175	P62158	CALM_HUMAN	calmodulin 3						activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding			ovary(1)	1		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000683)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0341)	Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)	GGTGAGTCTGCTATCCCCCTC	0.537													36	46	---	---	---	---	PASS
C20orf12	55184	broad.mit.edu	37	20	18395005	18395005	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18395005C>T	uc010zsa.1	-	12	1495	c.1286G>A	c.(1285-1287)CGC>CAC	p.R429H	C20orf12_uc010zrz.1_5'Flank|C20orf12_uc002wqp.3_Missense_Mutation_p.R120H|C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Missense_Mutation_p.R296H|C20orf12_uc002wqq.3_Missense_Mutation_p.R410H|C20orf12_uc002wqu.1_RNA|C20orf12_uc010gct.1_RNA	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184	237						intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				AGAAAAAGGGCGAGGTTCCTC	0.537													20	34	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47886788	47886788	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47886788C>A	uc002xui.2	-	3	1808	c.1561G>T	c.(1561-1563)GGA>TGA	p.G521*		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	521							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TCCTGGAGTCCTTCCAGGACG	0.532													5	153	---	---	---	---	PASS
KCNG1	3755	broad.mit.edu	37	20	49626346	49626346	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49626346G>A	uc002xwa.3	-	2	825	c.530C>T	c.(529-531)GCG>GTG	p.A177V	KCNG1_uc002xwb.2_Missense_Mutation_p.A177V	NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G,	177	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2						CACCATCTCCGCGAACTCCTC	0.701													29	31	---	---	---	---	PASS
BID	637	broad.mit.edu	37	22	18222870	18222870	+	Intron	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18222870C>T	uc002znd.1	-						BID_uc002znc.1_Intron|BID_uc002zne.1_Intron|BID_uc010gra.1_RNA|BID_uc002znf.1_Intron|BID_uc010grb.1_Intron|BID_uc010grc.1_Intron	NM_001196	NP_001187	P55957	BID_HUMAN	BH3 interacting domain death agonist isoform 2						activation of pro-apoptotic gene products|establishment of protein localization in membrane|induction of apoptosis by intracellular signals|induction of apoptosis via death domain receptors|neuron apoptosis|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|release of cytochrome c from mitochondria	cytosol|membrane fraction|mitochondrial outer membrane	death receptor binding				0		all_epithelial(15;0.198)		Lung(27;0.0419)		TCCATGAAGGCCACGCTCAAC	0.507													3	13	---	---	---	---	PASS
SLC25A1	6576	broad.mit.edu	37	22	19165323	19165323	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19165323C>T	uc002zoz.2	-	4	473	c.358G>A	c.(358-360)GAC>AAC	p.D120N	SLC25A1_uc002zoy.2_Missense_Mutation_p.D17N|SLC25A1_uc002zpa.2_Missense_Mutation_p.D68N	NM_005984	NP_005975	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier;	120					gluconeogenesis|long-chain fatty-acyl-CoA biosynthetic process|mitochondrial citrate transport|triglyceride biosynthetic process	integral to membrane|mitochondrial inner membrane	citrate transmembrane transporter activity|protein binding				0	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		CGCGTGCTGTCCAGCCGTCCC	0.701													9	12	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41565529	41565529	+	Missense_Mutation	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41565529G>A	uc003azl.3	+	26	4590	c.4195G>A	c.(4195-4197)GAT>AAT	p.D1399N		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1399				D->Y: Does not interact with TFAP2A and inhibits transcriptional coactivation of TFAP2A by CITED2. Does not inhibit interaction with CITED2, DNA-binding of TFAP2A or nuclear localization of TFAP2A or CITED2.	apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding	p.D1399Y(1)		haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						ATCTTACCTCGATAGTGTTCA	0.338			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				169	38	---	---	---	---	PASS
KLHDC7B	113730	broad.mit.edu	37	22	50987890	50987890	+	Missense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50987890C>T	uc003bmi.2	+	1	1429	c.1295C>T	c.(1294-1296)GCG>GTG	p.A432V		NM_138433	NP_612442	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	432	Kelch 3.									central_nervous_system(1)	1		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCCCACGCGCGCCACTCCCC	0.672													81	15	---	---	---	---	PASS
PHF6	84295	broad.mit.edu	37	X	133549136	133549136	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133549136C>T	uc004exj.2	+	8	1022	c.820C>T	c.(820-822)CGA>TGA	p.R274*	PHF6_uc004exk.2_Nonsense_Mutation_p.R274*|PHF6_uc011mvk.1_Nonsense_Mutation_p.R240*|PHF6_uc004exh.2_Nonsense_Mutation_p.R275*|PHF6_uc010nrr.2_Nonsense_Mutation_p.R274*|PHF6_uc004exi.2_Nonsense_Mutation_p.R275*	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1	274					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GGAGATTAAACGAGGAAAAAG	0.343													19	164	---	---	---	---	PASS
PASD1	139135	broad.mit.edu	37	X	150841059	150841059	+	Silent	SNP	G	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150841059G>A	uc004fev.3	+	14	2174	c.1842G>A	c.(1840-1842)CAG>CAA	p.Q614Q		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	614						nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTGTCCAGAGAGCAGCTG	0.488													49	99	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153693147	153693147	+	Missense_Mutation	SNP	G	A	A	rs149034613		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153693147G>A	uc004flm.2	+	10	2152	c.1979G>A	c.(1978-1980)CGC>CAC	p.R660H		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	660	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGTAAGTACCGCCACACGTGT	0.652													3	10	---	---	---	---	PASS
PLEKHG5	57449	broad.mit.edu	37	1	6579467	6579469	+	Intron	DEL	CCT	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6579467_6579469delCCT	uc001anp.1	-						PLEKHG5_uc001anq.1_Intron	NM_198681	NP_941374	O94827	PKHG5_HUMAN	pleckstrin homology domain containing family G						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		TGTCCTCAAACCTCCTTTCTAGA	0.493													52	24	---	---	---	---	
ASAP3	55616	broad.mit.edu	37	1	23758498	23758499	+	Intron	INS	-	A	A	rs143586833		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23758498_23758499insA	uc001bha.2	-						ASAP3_uc001bgy.1_Intron|ASAP3_uc001bgz.1_Intron|ASAP3_uc010odz.1_Intron|ASAP3_uc010oea.1_Intron|ASAP3_uc001bhb.2_Intron	NM_017707	NP_060177	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	cytoplasm	ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						GCCTCTAGGAtttttttttttt	0.213													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	53174727	53174728	+	IGR	INS	-	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53174727_53174728insA								C1orf163 (10689 upstream) : ZYG11B (17403 downstream)																							ccctgtctcagaaaaaaaaaaa	0.233													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612003_120612004delGG	uc001eik.2	-	1	273_274	c.17_18delCC	c.(16-18)CCCfs	p.P6fs	NOTCH2_uc001eil.2_Frame_Shift_Del_p.P6fs|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	6					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGCAGAGCGGGGCGCAGGGC	0.663			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				17	8	---	---	---	---	
RAB3GAP2	25782	broad.mit.edu	37	1	220364227	220364227	+	Intron	DEL	T	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220364227delT	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		GCatttttaattttttttttt	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11060846	11060847	+	IGR	INS	-	TG	TG	rs149638295	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11060846_11060847insTG								KCNF1 (6496 upstream) : C2orf50 (212332 downstream)																							gtgcgtgtgcctgtgtgtgtgt	0.386													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42303348	42303348	+	IGR	DEL	A	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42303348delA								PKDCC (17682 upstream) : EML4 (93142 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58479807	58479808	+	IGR	INS	-	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58479807_58479808insA								FANCL (11292 upstream) : None (None downstream)																							TTTTGtaaattaaaaaaaaaaa	0.233													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122630828	122630828	+	IGR	DEL	T	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122630828delT								TSN (105402 upstream) : None (None downstream)																							ttcttcttccttttttttttt	0.055													4	3	---	---	---	---	
GTDC1	79712	broad.mit.edu	37	2	144728060	144728061	+	Intron	INS	-	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144728060_144728061insT	uc002tvp.2	-						GTDC1_uc002tvo.2_Intron|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		TTACTTAAGTATTTTTTTAATT	0.272													1	7	---	---	---	---	
XYLB	9942	broad.mit.edu	37	3	38390261	38390262	+	Intron	INS	-	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38390261_38390262insT	uc003cic.2	+						XYLB_uc011ayp.1_Intron	NM_005108	NP_005099	O75191	XYLB_HUMAN	xylulokinase						D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		TTTCAAGCATCTTTTTTTCCTA	0.361													5	4	---	---	---	---	
NFKBIZ	64332	broad.mit.edu	37	3	101574770	101574771	+	Intron	INS	-	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101574770_101574771insA	uc003dvp.2	+						NFKBIZ_uc003dvo.2_Intron|NFKBIZ_uc010hpo.2_Intron|NFKBIZ_uc003dvq.2_Intron	NM_031419	NP_113607	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(2)	2						AAAGGTTTAAGATGGGGTAGGG	0.381													45	59	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132438748	132438749	+	Intron	DEL	AT	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132438748_132438749delAT	uc003epe.1	-						NCRNA00119_uc003epg.1_5'Flank|NPHP3_uc003epf.1_Intron|NCRNA00119_uc010htu.1_5'Flank	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						atatatatacatatatatatat	0.248													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196395240	196395241	+	IGR	INS	-	AAGA	AAGA			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196395240_196395241insAAGA								LRRC33 (6368 upstream) : C3orf34 (37908 downstream)																							agagagaaatgaaggaaggaag	0.094													3	3	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39257615	39257616	+	Intron	INS	-	CAGGAATAATTGTAGGAAATATACGTAAATGC	CAGGAATAATTGTAGGAAATATACGTAAATGC	rs150257136	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39257615_39257616insCAGGAATAATTGTAGGAAATATACGTAAATGC	uc003gtv.2	+						WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						CACTGACTCCGCAGGAATAATT	0.317													4	3	---	---	---	---	
YIPF7	285525	broad.mit.edu	37	4	44651969	44651969	+	Intron	DEL	A	-	-	rs35447406		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44651969delA	uc010ifx.1	-						YIPF7_uc010ify.1_Intron	NM_182592	NP_872398	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7							endoplasmic reticulum membrane|integral to membrane					0						agactctgtcaaaaaaaaaaa	0.179													3	4	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	93806086	93806087	+	Intron	INS	-	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93806086_93806087insA	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TTGGTCTCCCCAAAAAAAAAAA	0.342													5	3	---	---	---	---	
ADH1C	126	broad.mit.edu	37	4	100268805	100268806	+	Intron	INS	-	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100268805_100268806insA	uc003huu.2	-							NM_000669	NP_000660	P00326	ADH1G_HUMAN	class I alcohol dehydrogenase, gamma subunit						ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Fomepizole(DB01213)|NADH(DB00157)	GATAATTATATAAAAAATACCT	0.228									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				2	8	---	---	---	---	
LEF1	51176	broad.mit.edu	37	4	108991631	108991632	+	Intron	INS	-	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108991631_108991632insA	uc003hyt.1	-						LEF1_uc011cfj.1_Intron|LEF1_uc011cfk.1_Intron|LEF1_uc003hyu.1_Intron|LEF1_uc003hyv.1_Intron|LEF1_uc010imb.1_Intron|LEF1_uc003hys.1_Intron|LEF1_uc010ima.1_Intron	NM_016269	NP_057353	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1 isoform 1						canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		gcacccatagcaaaaaaaaaaa	0.134													4	2	---	---	---	---	
DDX60L	91351	broad.mit.edu	37	4	169317284	169317285	+	Intron	INS	-	A	A	rs5863929		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169317284_169317285insA	uc003irq.3	-						DDX60L_uc003irr.1_Intron|DDX60L_uc003irs.1_Intron	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TGCTACTATTTAAAAAAAAAAA	0.178													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7372833	7372835	+	IGR	DEL	CCT	-	-	rs143913542		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7372833_7372835delCCT								PAPD7 (615672 upstream) : ADCY2 (23508 downstream)																							accaccaccacctccaccatcac	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38030649	38030652	+	IGR	DEL	TGTA	-	-	rs68102439		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38030649_38030652delTGTA								GDNF (190867 upstream) : EGFLAM (227881 downstream)																							tgtgtgtgtgtgtatatacatgaa	0.000													3	3	---	---	---	---	
SEC24A	10802	broad.mit.edu	37	5	134017933	134017933	+	Intron	DEL	A	-	-	rs79922505		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134017933delA	uc003kzs.2	+						SEC24A_uc011cxu.1_Intron	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			actctgtctcaaaaaaaaaaa	0.109													4	3	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	66044995	66044998	+	Frame_Shift_Del	DEL	CTGA	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66044995_66044998delCTGA	uc011dxu.1	-	11	2179_2182	c.1641_1644delTCAG	c.(1639-1644)AGTCAGfs	p.S547fs	EYS_uc003peq.2_Frame_Shift_Del_p.S547fs|EYS_uc003per.1_Frame_Shift_Del_p.S547fs	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	547_548					response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						ACCGATATTCCTGACTGTCTTCTT	0.353													19	13	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123637682	123637682	+	Intron	DEL	A	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123637682delA	uc003pzj.1	-						TRDN_uc010kem.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		AACAAAAGGGAAAAAAATAAC	0.303													20	10	---	---	---	---	
CCDC28A	25901	broad.mit.edu	37	6	139109706	139109717	+	Intron	DEL	TTTTTTTTTTTT	-	-	rs7349837	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139109706_139109717delTTTTTTTTTTTT	uc003qie.2	+							NM_015439	NP_056254	Q8IWP9	CC28A_HUMAN	coiled-coil domain containing 28A												0				OV - Ovarian serous cystadenocarcinoma(155;0.000201)|GBM - Glioblastoma multiforme(68;0.000306)		ttttcttttctttttttttttttttttttttt	0.132													7	4	---	---	---	---	
POLB	5423	broad.mit.edu	37	8	42228944	42228944	+	Intron	DEL	T	-	-	rs79893094		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42228944delT	uc003xoz.1	+						POLB_uc003xpa.1_Intron|POLB_uc011lcs.1_Intron	NM_002690	NP_002681	P06746	DPOLB_HUMAN	DNA-directed DNA polymerase beta						DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding			ovary(1)|breast(1)	2	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	tccgCCGGTCTTTTTTTTTTT	0.179								DNA_polymerases_(catalytic_subunits)					4	2	---	---	---	---	
TRIM55	84675	broad.mit.edu	37	8	67084303	67084318	+	Intron	DEL	GAAGGAAGGAAGGAAA	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67084303_67084318delGAAGGAAGGAAGGAAA	uc003xvv.2	+						TRIM55_uc003xvu.2_Intron|TRIM55_uc003xvw.2_Intron|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1							cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			gggaagaggggaaggaaggaaggaaagaaggaagga	0.176													3	4	---	---	---	---	
INTS8	55656	broad.mit.edu	37	8	95840274	95840275	+	Intron	DEL	TT	-	-	rs67211071		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95840274_95840275delTT	uc003yhb.2	+						INTS8_uc003yha.1_Intron|INTS8_uc011lgq.1_Intron|INTS8_uc011lgr.1_Intron|INTS8_uc010mba.2_5'Flank	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8						snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					tttttttttgtttttttttttt	0.193													4	2	---	---	---	---	
FER1L6	654463	broad.mit.edu	37	8	125034095	125034096	+	Intron	INS	-	T	T	rs138450142	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125034095_125034096insT	uc003yqw.2	+						uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGCTTTATTCATTTTTTTTTCA	0.386													3	4	---	---	---	---	
KANK1	23189	broad.mit.edu	37	9	710629	710640	+	Intron	DEL	ACAAAAAAAAAC	-	-	rs140737460	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:710629_710640delACAAAAAAAAAC	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		aaaaaaaaaaacaaaaaaaaacaaaaaaaact	0.009													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	77089173	77089173	+	Intron	DEL	T	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77089173delT	uc001jxd.1	+											Homo sapiens cDNA FLJ13383 fis, clone PLACE1001024.																		ccttccttcctttccttcctt	0.000													4	2	---	---	---	---	
INPP5A	3632	broad.mit.edu	37	10	134591314	134591315	+	Intron	DEL	CA	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134591314_134591315delCA	uc001llp.2	+						INPP5A_uc001llo.1_Frame_Shift_Del_p.H373fs|INPP5A_uc001llq.2_Intron	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		CAGCCCTGGGCACAGAGGGATG	0.688													4	2	---	---	---	---	
RTN3	10313	broad.mit.edu	37	11	63523428	63523429	+	Intron	INS	-	A	A	rs112296263		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63523428_63523429insA	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						ggctccgtctcaaaaaaaaaaa	0.158													5	3	---	---	---	---	
NANOG	79923	broad.mit.edu	37	12	7947917	7947917	+	3'UTR	DEL	T	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7947917delT	uc009zfy.1	+	4						NM_024865	NP_079141	Q9H9S0	NANOG_HUMAN	Nanog homeobox						cell proliferation|embryo development|somatic stem cell maintenance	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				Kidney(36;0.0872)		GAGAAAATACttttttttttt	0.204													4	2	---	---	---	---	
ABCC9	10060	broad.mit.edu	37	12	22015991	22015992	+	Intron	INS	-	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22015991_22015992insA	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	TGTTCCTACTGAAAAATGAAAA	0.322													41	18	---	---	---	---	
PLEKHG7	440107	broad.mit.edu	37	12	93155419	93155419	+	Intron	DEL	A	-	-	rs145042614	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93155419delA	uc001tcj.2	+							NM_001004330	NP_001004330	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1						agaaagaaagaaagaaagaaa	0.090													4	3	---	---	---	---	
WSCD2	9671	broad.mit.edu	37	12	108626824	108626825	+	Intron	INS	-	C	C	rs147800475	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108626824_108626825insC	uc001tms.2	+						WSCD2_uc001tmt.2_Intron|WSCD2_uc001tmu.2_Intron	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						CATGCTTGGTACCCCCCCACCT	0.470													3	5	---	---	---	---	
TPTE2P3	220115	broad.mit.edu	37	13	53095258	53095258	+	Intron	DEL	A	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53095258delA	uc001vgw.2	+							NR_002793				Homo sapiens TPTE and PTEN homologous inositol lipid phosphatase pseudogene, mRNA (cDNA clone IMAGE:5298506), with apparent retained intron.												0						TGTGAGACATAGAAAACACCA	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	88542298	88542299	+	IGR	INS	-	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88542298_88542299insT								SLITRK5 (210430 upstream) : None (None downstream)																							TACTCACCTCATTTTTTTTTTA	0.267													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	90149586	90149589	+	IGR	DEL	AGGA	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90149586_90149589delAGGA								None (None upstream) : MIR622 (733847 downstream)																							TAAAACAAACaggaaggaaggaag	0.020													4	2	---	---	---	---	
DOCK9	23348	broad.mit.edu	37	13	99489874	99489875	+	Intron	INS	-	A	A			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99489874_99489875insA	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc001vnq.2_5'UTR|DOCK9_uc001vnr.2_Intron|DOCK9_uc010tin.1_Intron|DOCK9_uc001vns.2_Intron|DOCK9_uc010tio.1_Intron|DOCK9_uc010tip.1_Intron|DOCK9_uc001vnu.1_5'UTR|DOCK9_uc010tiq.1_Intron	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTGCATGAATTACAACACAAGA	0.505													6	13	---	---	---	---	
P704P	641455	broad.mit.edu	37	14	20010424	20010425	+	Intron	INS	-	AA	AA			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20010424_20010425insAA	uc001vwc.3	-						P704P_uc001vwb.3_Intron|uc001vwd.2_RNA	NM_001145442	NP_001138914	A6NI47	POTEM_HUMAN	prostate-specific P704P												0						AAGGAAGGGACAAAAAAAAAAA	0.366													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	43769942	43769943	+	IGR	INS	-	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43769942_43769943insT								None (None upstream) : None (None downstream)																							TTGTGGGTTGATTTTTTTTTCT	0.332													6	3	---	---	---	---	
C15orf56	644809	broad.mit.edu	37	15	40544602	40544602	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40544602delG	uc001zla.1	-	2	391	c.370delC	c.(370-372)CAGfs	p.Q124fs	PAK6_uc010bbl.2_Intron|PAK6_uc010bbm.2_Intron|PAK6_uc001zky.3_Intron|PAK6_uc010bbn.2_Intron|PAK6_uc001zlb.2_5'Flank	NM_001039905	NP_001034994	Q8N910	CO056_HUMAN	hypothetical protein LOC644809	124											0		all_cancers(109;1.62e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;3.4e-09)|all_lung(180;6.88e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.28e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0503)		GGCGGGAACTGGGGCCAAGCA	0.736													4	2	---	---	---	---	
GGA2	23062	broad.mit.edu	37	16	23498305	23498306	+	Intron	INS	-	TTT	TTT	rs116219854		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23498305_23498306insTTT	uc002dlq.2	-						GGA2_uc010bxo.1_Intron	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		cttttctgttgttttttttttt	0.030													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55817734	55817735	+	IGR	INS	-	G	G			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55817734_55817735insG								CES4 (8910 upstream) : CES1 (19031 downstream)																							CTTCCCTCTCCGAGCCACACTC	0.564													9	4	---	---	---	---	
OGFOD1	55239	broad.mit.edu	37	16	56510260	56510261	+	3'UTR	INS	-	A	A	rs138927458	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56510260_56510261insA	uc002ejb.2	+	13					OGFOD1_uc002ejc.2_3'UTR	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase								iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)	CTAGGACTCATAATGATTGTCC	0.366													4	3	---	---	---	---	
CDH5	1003	broad.mit.edu	37	16	66413051	66413051	+	Intron	DEL	G	-	-	rs3837775		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66413051delG	uc002eom.3	+						CDH5_uc002eon.1_5'Flank	NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		cctttcatccgagtgcatgac	0.000													6	6	---	---	---	---	
SF3B3	23450	broad.mit.edu	37	16	70573293	70573294	+	Intron	DEL	AT	-	-	rs72474976		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70573293_70573294delAT	uc002ezf.2	+							NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				tctacctaaaatacaaaaatta	0.000													4	2	---	---	---	---	
GCSH	2653	broad.mit.edu	37	16	81118317	81118317	+	Intron	DEL	T	-	-	rs111388132		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81118317delT	uc002fgd.2	-						GCSH_uc002fge.2_Intron	NM_004483	NP_004474	P23434	GCSH_HUMAN	glycine cleavage system protein H (aminomethyl							glycine cleavage complex|mitochondrion	aminomethyltransferase activity				0					Glycine(DB00145)	TCCAAAtttcttttttttttt	0.119													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22066949	22066949	+	IGR	DEL	T	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22066949delT								FLJ36000 (153879 upstream) : None (None downstream)																							CCAGAAAAAATATGTGAGAGA	0.323													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35210426	35210429	+	IGR	DEL	AAGG	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35210426_35210429delAAGG								MRM1 (245020 upstream) : LHX1 (84070 downstream)																							agaaagaaaaaaggaaggaaggaa	0.191													7	6	---	---	---	---	
CSH2	1443	broad.mit.edu	37	17	61952951	61952952	+	5'Flank	DEL	TC	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61952951_61952952delTC	uc002jch.2	-						CSH2_uc002jcg.2_5'Flank|CSH2_uc002jci.2_5'Flank|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1						female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						tttctttctttctttctttctt	0.000													3	4	---	---	---	---	
SAP30BP	29115	broad.mit.edu	37	17	73698388	73698395	+	Intron	DEL	GCCACCGT	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73698388_73698395delGCCACCGT	uc002jpe.2	+						SAP30BP_uc002jpc.1_Intron|SAP30BP_uc010wsf.1_Intron|SAP30BP_uc010wsg.1_Intron|SAP30BP_uc002jpf.2_Intron	NM_013260	NP_037392	Q9UHR5	S30BP_HUMAN	transcriptional regulator protein						apoptosis|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			acaggcgtgagccaccgtgcctggcTGA	0.216													4	3	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80141908	80141911	+	Intron	DEL	CACA	-	-	rs11650529	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80141908_80141911delCACA	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron|CCDC57_uc010dik.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			CGCGCGCGCGcacacacacacaca	0.382													3	4	---	---	---	---	
DSG3	1830	broad.mit.edu	37	18	29028057	29028058	+	Intron	INS	-	TTTG	TTTG	rs141268501	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29028057_29028058insTTTG	uc002kws.2	+							NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein						cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTTGTTGTTTTTTATGTTGTA	0.243													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45293738	45293739	+	IGR	INS	-	A	A	rs2852944		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45293738_45293739insA								IER3IP1 (590993 upstream) : SMAD2 (65728 downstream)																							aaggaaggaaggagaaagaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	63778788	63778791	+	IGR	DEL	GAAG	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63778788_63778791delGAAG								CDH7 (230614 upstream) : CDH19 (392530 downstream)																							aaggaaggaagaaggaaggaagga	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65042306	65042307	+	IGR	INS	-	T	T	rs75002100		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65042306_65042307insT								CDH19 (771090 upstream) : DSEL (131512 downstream)																							tgtcttcttcattttttttttt	0.183													4	4	---	---	---	---	
APC2	10297	broad.mit.edu	37	19	1461851	1461851	+	Intron	DEL	A	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1461851delA	uc002lsr.1	+						APC2_uc002lss.1_Intron|APC2_uc002lst.1_Intron|APC2_uc002lsu.1_Intron|C19orf25_uc010xgn.1_Intron	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		attccgtctcaaaaaaaaaaa	0.249													5	5	---	---	---	---	
LSM14A	26065	broad.mit.edu	37	19	34706329	34706332	+	Intron	DEL	TGTT	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34706329_34706332delTGTT	uc002nvb.3	+						LSM14A_uc002nva.3_Intron|LSM14A_uc010xru.1_Intron|LSM14A_uc002nvc.3_Intron	NM_001114093	NP_001107565	Q8ND56	LS14A_HUMAN	LSM14 homolog A isoform a						cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule				skin(1)	1	Esophageal squamous(110;0.162)					TATGATAGAATGTTTGGTCTTTCA	0.338													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36913800	36913800	+	IGR	DEL	A	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36913800delA								ZFP82 (4250 upstream) : ZNF566 (22222 downstream)																							CTTTGTCATTAAAAAAAAAAA	0.194													13	8	---	---	---	---	
KCNN4	3783	broad.mit.edu	37	19	44280870	44280870	+	Intron	DEL	T	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44280870delT	uc002oxl.2	-						KCNN4_uc010eiz.2_5'Flank|KCNN4_uc010eja.1_Intron	NM_002250	NP_002241	O15554	KCNN4_HUMAN	intermediate conductance calcium-activated						defense response	voltage-gated potassium channel complex	calcium-activated potassium channel activity|calmodulin binding			ovary(2)	2		Prostate(69;0.0352)			Clotrimazole(DB00257)|Halothane(DB01159)|Quinine(DB00468)	AAAACCACCATTTTTTTTTTT	0.507													9	4	---	---	---	---	
CACNG8	59283	broad.mit.edu	37	19	54483312	54483315	+	Intron	DEL	GTGT	-	-	rs71949256		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54483312_54483315delGTGT	uc002qcs.1	+						MIR935_hsa-mir-935|MI0005757_5'Flank	NM_031895	NP_114101	Q8WXS5	CCG8_HUMAN	voltage-dependent calcium channel gamma-8						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		GGGCGCGCACgtgtgtgtgtgtgt	0.534													6	4	---	---	---	---	
NLRP5	126206	broad.mit.edu	37	19	56569394	56569395	+	Intron	INS	-	A	A	rs113887962		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56569394_56569395insA	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		aatgctatctcaaaaaaaaaaa	0.005													3	3	---	---	---	---	
C20orf194	25943	broad.mit.edu	37	20	3297536	3297537	+	Intron	DEL	TC	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3297536_3297537delTC	uc002wii.2	-						C20orf194_uc002wij.3_Intron|C20orf194_uc002wik.2_Intron	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						GAGCTAGGGttctttttttttt	0.282													9	4	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15843206	15843207	+	Intron	DEL	CA	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15843206_15843207delCA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				Tacacacacgcacacacacaca	0.287													6	3	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37599842	37599843	+	Intron	INS	-	A	A	rs141141432	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37599842_37599843insA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						aagactctgtcaaaaaaaaaga	0.104													4	2	---	---	---	---	
SEC14L3	266629	broad.mit.edu	37	22	30863233	30863234	+	Intron	DEL	CA	-	-	rs112406124	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30863233_30863234delCA	uc003ahy.2	-						SEC14L3_uc003ahz.2_Intron|SEC14L3_uc003aia.2_Intron|SEC14L3_uc003aib.2_Intron	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3							integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	tccatccatccacatccatcca	0.218													4	2	---	---	---	---	
BPIL2	254240	broad.mit.edu	37	22	32853547	32853558	+	5'Flank	DEL	TCCATCCATCCA	-	-	rs71320927	by1000genomes	TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32853547_32853558delTCCATCCATCCA	uc003amn.2	-						BPIL2_uc010gwo.2_5'Flank|BPIL2_uc011amb.1_Intron|BPIL2_uc003amo.3_Intron	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						catccatccgtccatccatccatccatccatc	0.057											OREG0003513	type=REGULATORY REGION|Gene=BPIL2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	41586193	41586193	+	Intron	DEL	A	-	-	rs74853955		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41586193delA	uc003azm.2	-											Homo sapiens, clone IMAGE:5580334, mRNA.																		CTTCAAAGGCaaaaaaaaaaa	0.194													9	5	---	---	---	---	
TOB2	10766	broad.mit.edu	37	22	41829913	41829914	+	3'UTR	INS	-	T	T			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41829913_41829914insT	uc003azz.1	-	2						NM_016272	NP_057356	Q14106	TOB2_HUMAN	transducer of ERBB2, 2						female gamete generation|negative regulation of cell proliferation	cytoplasm|nucleus				ovary(1)	1						TATTTCTCCTCTTTTTTTTTTA	0.292													3	4	---	---	---	---	
DMD	1756	broad.mit.edu	37	X	31838149	31838149	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31838149delG	uc004dda.1	-	50	7496	c.7252delC	c.(7252-7254)CAAfs	p.Q2418fs	DMD_uc004dcr.1_5'UTR|DMD_uc004dcs.1_5'UTR|DMD_uc004dct.1_5'UTR|DMD_uc004dcu.1_5'UTR|DMD_uc004dcv.1_5'UTR|DMD_uc004dcw.2_Frame_Shift_Del_p.Q1074fs|DMD_uc004dcx.2_Frame_Shift_Del_p.Q1077fs|DMD_uc004dcz.2_Frame_Shift_Del_p.Q2295fs|DMD_uc004dcy.1_Frame_Shift_Del_p.Q2414fs|DMD_uc004ddb.1_Frame_Shift_Del_p.Q2410fs|DMD_uc004ddd.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2418					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTCAGCTCTTGAAGTAAACGG	0.433													97	58	---	---	---	---	
TRMT2B	79979	broad.mit.edu	37	X	100291864	100291866	+	Intron	DEL	TCT	-	-			TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100291864_100291866delTCT	uc004egq.2	-						TRMT2B_uc004egp.2_Intron|TRMT2B_uc004egr.2_Intron|TRMT2B_uc004egs.2_Intron|TRMT2B_uc004egt.2_Intron|TRMT2B_uc004egu.2_Intron|TRMT2B_uc004egv.2_Intron	NM_024917	NP_079193	Q96GJ1	TRM2_HUMAN	TRM2 tRNA methyltransferase 2 homolog B								tRNA (uracil-5-)-methyltransferase activity			ovary(1)	1						TCCAATTTAATCTTCTTCTTTAA	0.404													8	9	---	---	---	---	
MAP7D3	79649	broad.mit.edu	37	X	135322368	135322368	+	Intron	DEL	A	-	-	rs34003803		TCGA-EX-A1H5-01	TCGA-EX-A1H5-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135322368delA	uc004ezt.2	-						MAP7D3_uc004ezs.2_Intron|MAP7D3_uc011mwc.1_Intron|MAP7D3_uc010nsa.1_Intron	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3							cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					actctgtctcaaaaaaaaaaa	0.144													5	6	---	---	---	---	
