Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ARHGEF16	27237	broad.mit.edu	37	1	3390163	3390163	+	Intron	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3390163C>A	uc001akg.3	+						ARHGEF16_uc001aki.2_Intron|ARHGEF16_uc001akj.2_Intron|ARHGEF16_uc009vli.1_Missense_Mutation_p.A165E|ARHGEF16_uc010nzh.1_Intron	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16						activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CCGGATGGAGCATTACGTGCT	0.567													3	54	---	---	---	---	PASS
SLC45A1	50651	broad.mit.edu	37	1	8395589	8395589	+	Silent	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8395589C>G	uc001apb.2	+	5	1536	c.1536C>G	c.(1534-1536)CTC>CTG	p.L512L	SLC45A1_uc001apc.2_Silent_p.L210L	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	512					carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TGGGGCGCCTCTGCTCCACCA	0.652													17	97	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16907361	16907361	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16907361G>A	uc009vos.1	-	16	2358	c.1470C>T	c.(1468-1470)GAC>GAT	p.D490D	NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Silent_p.D219D	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	490	NBPF 2.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GCTGGTTGGAGTCACAAGGGC	0.493													36	509	---	---	---	---	PASS
CD164L2	388611	broad.mit.edu	37	1	27708287	27708287	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27708287G>A	uc001boc.2	-	4	432	c.356C>T	c.(355-357)CCG>CTG	p.P119L		NM_207397	NP_997280	Q6UWJ8	C16L2_HUMAN	CD164 sialomucin-like 2	119	Extracellular (Potential).					integral to membrane					0		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GACTGTCTTCGGTTCATAGGT	0.398													5	33	---	---	---	---	PASS
RSPO1	284654	broad.mit.edu	37	1	38095342	38095342	+	5'UTR	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38095342G>A	uc001cbl.1	-	4					RSPO1_uc001cbm.1_5'UTR|RSPO1_uc009vvf.1_Intron|RSPO1_uc009vvg.1_5'UTR	NM_001038633	NP_001033722	Q2MKA7	RSPO1_HUMAN	R-spondin1 precursor						positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ATAGTCACGCGCCAGCTCCAG	0.662													4	28	---	---	---	---	PASS
PTGFR	5737	broad.mit.edu	37	1	78958974	78958974	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78958974G>A	uc001din.2	+	2	812	c.546G>A	c.(544-546)TCG>TCA	p.S182S	PTGFR_uc001dim.2_Silent_p.S182S	NM_000959	NP_000950	P43088	PF2R_HUMAN	prostaglandin F receptor isoform a precursor	182	Extracellular (Potential).				parturition	extracellular region|integral to plasma membrane	prostaglandin F receptor activity			ovary(3)|breast(2)|skin(1)	6				Colorectal(170;0.248)	Bimatoprost(DB00905)|Latanoprost(DB00654)|Travoprost(DB00287)	TTCAGGCGTCGAGGACCTGGT	0.413													49	65	---	---	---	---	PASS
PYGO2	90780	broad.mit.edu	37	1	154932319	154932319	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154932319G>A	uc001fft.2	-	3	363	c.157C>T	c.(157-159)CCT>TCT	p.P53S		NM_138300	NP_612157	Q9BRQ0	PYGO2_HUMAN	pygopus homolog 2	53	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding			skin(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GAGTATGCAGGGCCCTAGTGA	0.507													8	30	---	---	---	---	PASS
RHBG	57127	broad.mit.edu	37	1	156347203	156347203	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156347203C>T	uc010pho.1	+	2	337	c.299C>T	c.(298-300)GCC>GTC	p.A100V	RHBG_uc010phm.1_Intron|RHBG_uc010phn.1_RNA|RHBG_uc001fos.2_Missense_Mutation_p.A31V|RHBG_uc009wrz.2_Missense_Mutation_p.A31V|RHBG_uc001for.2_Missense_Mutation_p.A70V	NM_020407	NP_065140	Q9H310	RHBG_HUMAN	Rhesus blood group, B glycoprotein	100	Helical; (Potential).				transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			ovary(2)	2	Hepatocellular(266;0.158)					GCCGCCTTTGCCCTGCAGTGG	0.627													4	174	---	---	---	---	PASS
CD1D	912	broad.mit.edu	37	1	158152875	158152875	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158152875G>T	uc001frr.2	+	5	1314	c.815G>T	c.(814-816)GGG>GTG	p.G272V	CD1D_uc009wss.2_Intron	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	272	Ig-like.|Extracellular (Potential).				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					GTGGTGGCTGGGGAGGCAGCT	0.612													51	36	---	---	---	---	PASS
RXRG	6258	broad.mit.edu	37	1	165378870	165378870	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165378870C>A	uc001gda.2	-	7	1271	c.971G>T	c.(970-972)GGC>GTC	p.G324V		NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a	324	Ligand-binding (By similarity).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	CAGAAGGATGCCATCCTGCAC	0.532													6	16	---	---	---	---	PASS
RC3H1	149041	broad.mit.edu	37	1	173941653	173941653	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173941653C>A	uc001gju.3	-	7	1302	c.1215G>T	c.(1213-1215)CAG>CAT	p.Q405H	RC3H1_uc010pms.1_Missense_Mutation_p.Q405H|RC3H1_uc001gjv.2_Missense_Mutation_p.Q405H|RC3H1_uc010pmt.1_Missense_Mutation_p.Q405H	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin	405					cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TTACCTGCTGCTGATCTGCTC	0.443													15	67	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175087873	175087873	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175087873C>A	uc001gkl.1	+	11	2676	c.2563C>A	c.(2563-2565)CTG>ATG	p.L855M		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	855	Fibronectin type-III 7.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CCTGACGGGCCTGAGGCCGGG	0.602													10	51	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175105997	175105997	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175105997G>A	uc001gkl.1	+	17	3581	c.3468G>A	c.(3466-3468)GCG>GCA	p.A1156A		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	1156	Fibrinogen C-terminal.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCACTCCAGCGCGGTATGAGG	0.453													7	40	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186064392	186064392	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186064392A>T	uc001grq.1	+	68	10541	c.10312A>T	c.(10312-10314)AAT>TAT	p.N3438Y		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3438	Ig-like C2-type 33.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAATATGGACAATTCAATGGG	0.383													5	26	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067861	190067861	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067861G>A	uc001gse.1	-	8	1820	c.1588C>T	c.(1588-1590)CGT>TGT	p.R530C	FAM5C_uc010pot.1_Missense_Mutation_p.R428C	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	530						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					ATCCGCTTACGCCAGGAGGGA	0.428													15	77	---	---	---	---	PASS
SLC26A9	115019	broad.mit.edu	37	1	205904909	205904909	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205904909C>T	uc001hdq.2	-	2	154	c.40G>A	c.(40-42)GCA>ACA	p.A14T	SLC26A9_uc001hdp.2_Missense_Mutation_p.A14T	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a	14						integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			AGGGAGTATGCGGCTCTGTCT	0.557													8	98	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213415278	213415278	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213415278G>A	uc010ptr.1	+	11	2618	c.2459G>A	c.(2458-2460)CGT>CAT	p.R820H	RPS6KC1_uc001hkd.2_Missense_Mutation_p.R808H|RPS6KC1_uc010pts.1_Missense_Mutation_p.R608H|RPS6KC1_uc010ptt.1_Missense_Mutation_p.R608H|RPS6KC1_uc010ptu.1_Missense_Mutation_p.R639H|RPS6KC1_uc010ptv.1_Missense_Mutation_p.R355H|RPS6KC1_uc001hke.2_Missense_Mutation_p.R639H	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	820	Protein kinase 2.	ATP (By similarity).			cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		AGCTTATTCCGTATTTGTAGT	0.393													16	70	---	---	---	---	PASS
KCNF1	3754	broad.mit.edu	37	2	11053802	11053802	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11053802G>A	uc002rax.2	+	1	1740	c.1250G>A	c.(1249-1251)CGC>CAC	p.R417H		NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F,	417	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		AACAAGCAGCGCGTCCTGGAG	0.617													9	56	---	---	---	---	PASS
CRIM1	51232	broad.mit.edu	37	2	36774266	36774266	+	Missense_Mutation	SNP	G	C	C	rs13419463		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36774266G>C	uc002rpd.2	+	16	2925	c.2886G>C	c.(2884-2886)CAG>CAC	p.Q962H		NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor	962	Cytoplasmic (Potential).				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TCATCAATCAGAAGAAACAGT	0.393													13	106	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43801788	43801788	+	Silent	SNP	A	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43801788A>G	uc002rsw.3	-	11	1768	c.1416T>C	c.(1414-1416)GCT>GCC	p.A472A	THADA_uc002rsx.3_Silent_p.A472A|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Silent_p.A182A|THADA_uc002rta.2_Silent_p.A182A|THADA_uc002rtb.1_Silent_p.A472A|THADA_uc002rtc.3_Silent_p.A472A|THADA_uc002rtd.2_Silent_p.A472A	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	472							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TTTTATCTATAGCCAAAATAT	0.378													46	79	---	---	---	---	PASS
KIAA1841	84542	broad.mit.edu	37	2	61315572	61315572	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61315572C>T	uc002saw.3	+	10	1360	c.1057C>T	c.(1057-1059)CGA>TGA	p.R353*	KIAA1841_uc002sax.3_Nonsense_Mutation_p.R207*|KIAA1841_uc002say.2_Nonsense_Mutation_p.R353*|KIAA1841_uc002sav.3_Nonsense_Mutation_p.R353*	NM_001129993	NP_001123465	Q6NSI8	K1841_HUMAN	KIAA1841 protein isoform a	353											0			Epithelial(17;0.193)			CAATGTGGATCGACGTGGAAA	0.259													12	33	---	---	---	---	PASS
ZNF638	27332	broad.mit.edu	37	2	71576712	71576712	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71576712G>A	uc002shx.2	+	2	947	c.628G>A	c.(628-630)GAT>AAT	p.D210N	ZNF638_uc010fec.2_Missense_Mutation_p.D316N|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_Missense_Mutation_p.D210N|ZNF638_uc002shy.2_Missense_Mutation_p.D210N|ZNF638_uc002shz.2_Missense_Mutation_p.D210N|ZNF638_uc002sia.2_Missense_Mutation_p.D210N|ZNF638_uc002sib.1_Missense_Mutation_p.D210N	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	210					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						TAATGTGATCGATTATGGGCA	0.383													5	109	---	---	---	---	PASS
SLC20A1	6574	broad.mit.edu	37	2	113414767	113414767	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113414767G>T	uc002tib.2	+	6	1173	c.727G>T	c.(727-729)GCC>TCC	p.A243S	SLC20A1_uc002tic.1_Missense_Mutation_p.A55S	NM_005415	NP_005406	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate	243	Helical; (Potential).				phosphate metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to plasma membrane	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity			ovary(2)	2						AGTTTTCTGTGCCCTTATCGT	0.413													16	64	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136548255	136548255	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136548255G>A	uc002tuu.1	-	15	5319	c.5308C>T	c.(5308-5310)CGG>TGG	p.R1770W		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1770	Extracellular (Potential).|4.|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		ATGTAAGTCCGAAGGTAGTAG	0.507													10	26	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136587248	136587248	+	Splice_Site	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136587248T>C	uc002tuu.1	-	3	732	c.721_splice	c.e3-1	p.D241_splice		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GACCGTGTCCTGAAAATAGTA	0.413													20	40	---	---	---	---	PASS
MYO3B	140469	broad.mit.edu	37	2	171509700	171509700	+	3'UTR	SNP	G	A	A	rs13382220	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171509700G>A	uc002ufy.2	+	35					MYO3B_uc002ufz.2_3'UTR|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA|uc002ugc.1_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						CTGTCATTGCGTAAGAAAGCA	0.423													16	34	---	---	---	---	PASS
RHBDD1	84236	broad.mit.edu	37	2	227771695	227771695	+	Intron	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227771695C>G	uc002voi.2	+						RHBDD1_uc010fxc.2_Intron|RHBDD1_uc002voj.2_Missense_Mutation_p.Q36E	NM_032276	NP_115652	Q8TEB9	RHBD1_HUMAN	rhomboid domain containing 1							integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		TGGTTCAGCTCAAGAATTCCC	0.388													4	8	---	---	---	---	PASS
USP19	10869	broad.mit.edu	37	3	49152979	49152979	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49152979G>A	uc003cwd.1	-	11	1638	c.1477C>T	c.(1477-1479)CTG>TTG	p.L493L	USP19_uc003cwa.2_Silent_p.L301L|USP19_uc003cvz.3_Silent_p.L596L|USP19_uc011bcg.1_Silent_p.L584L|USP19_uc003cwb.2_Silent_p.L579L|USP19_uc003cwc.1_Silent_p.L251L|USP19_uc011bch.1_Silent_p.L594L|USP19_uc011bci.1_Silent_p.L581L	NM_006677	NP_006668	O94966	UBP19_HUMAN	ubiquitin thioesterase 19	493	Cytoplasmic (Potential).				ER-associated protein catabolic process|positive regulation of cell cycle process|protein deubiquitination|regulation of protein stability|response to endoplasmic reticulum stress|skeletal muscle atrophy	endoplasmic reticulum membrane|integral to membrane	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(4)|breast(2)|lung(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AAGCCTGGCAGACACAccttc	0.478													7	14	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52384032	52384032	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52384032C>T	uc011bef.1	+	15	2815	c.2554C>T	c.(2554-2556)CGC>TGC	p.R852C	DNAH1_uc003ddt.1_Missense_Mutation_p.R852C	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	852	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CAGCATCAGCCGCAAGATCTA	0.622													11	8	---	---	---	---	PASS
NISCH	11188	broad.mit.edu	37	3	52491871	52491871	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52491871C>T	uc011beg.1	+	3	178	c.106C>T	c.(106-108)CAG>TAG	p.Q36*	NISCH_uc003ded.3_Nonsense_Mutation_p.Q36*|NISCH_uc003dec.1_Nonsense_Mutation_p.Q36*	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	36	PX.|Necessary for binding to phosphoinositide-3-P; not sufficient for targeting to endosomes.				apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		TTACATCATCCAGGTCACTGA	0.507													60	121	---	---	---	---	PASS
C3orf26	84319	broad.mit.edu	37	3	99891191	99891191	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99891191G>C	uc003dtl.2	+	8	754	c.611G>C	c.(610-612)CGT>CCT	p.R204P		NM_032359	NP_115735	Q9BQ75	CC026_HUMAN	hypothetical protein LOC84319	204							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(1)	1						CTGGAGAAGCGTGTGGTGCAC	0.458													4	53	---	---	---	---	PASS
TAGLN3	29114	broad.mit.edu	37	3	111730620	111730620	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111730620G>A	uc003dym.2	+	4	744	c.366G>A	c.(364-366)ATG>ATA	p.M122I	TAGLN3_uc003dyl.2_Missense_Mutation_p.M122I|TAGLN3_uc003dyn.2_Missense_Mutation_p.M122I|TAGLN3_uc003dyo.2_Missense_Mutation_p.M122I	NM_001008272	NP_001008273	Q9UI15	TAGL3_HUMAN	transgelin 3	122	CH.				central nervous system development|muscle organ development						0						GGAAGGACATGGCAGCTGTGC	0.547													5	49	---	---	---	---	PASS
BOC	91653	broad.mit.edu	37	3	112992056	112992056	+	Missense_Mutation	SNP	C	T	T	rs142142926		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112992056C>T	uc003dzx.2	+	8	1723	c.1102C>T	c.(1102-1104)CGC>TGC	p.R368C	BOC_uc003dzy.2_Missense_Mutation_p.R368C|BOC_uc003dzz.2_Missense_Mutation_p.R368C|BOC_uc003eab.2_Missense_Mutation_p.R69C	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	368	Ig-like C2-type 4.|Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			CTCCAGCCAGCGCCTCCGGCT	0.687													12	46	---	---	---	---	PASS
CD80	941	broad.mit.edu	37	3	119263303	119263303	+	Intron	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119263303C>G	uc003ecq.2	-						CD80_uc010hqt.1_Intron|CD80_uc010hqu.1_Intron|CD80_uc003ecr.1_3'UTR	NM_005191	NP_005182	P33681	CD80_HUMAN	CD80 antigen precursor						interspecies interaction between organisms|intracellular signal transduction|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of signal transduction|positive regulation of T-helper 1 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation	intracellular	coreceptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2					Abatacept(DB01281)	ATACATCCCTCTTTGGTAAAA	0.368													5	19	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121417163	121417163	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121417163T>A	uc003eei.3	-	13	2318	c.2192A>T	c.(2191-2193)AAT>ATT	p.N731I	GOLGB1_uc010hrc.2_Missense_Mutation_p.N736I|GOLGB1_uc003eej.3_Missense_Mutation_p.N697I|GOLGB1_uc011bjm.1_Missense_Mutation_p.N617I|GOLGB1_uc010hrd.1_Missense_Mutation_p.N695I	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	731	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		GTTGTCAGCATTTTTCTTAAA	0.378													18	83	---	---	---	---	PASS
GATA2	2624	broad.mit.edu	37	3	128200720	128200720	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128200720C>T	uc003ekm.3	-	6	1520	c.1085G>A	c.(1084-1086)CGA>CAA	p.R362Q	GATA2_uc003ekn.3_Missense_Mutation_p.R348Q|GATA2_uc003eko.2_Missense_Mutation_p.R362Q	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	362	GATA-type 2.				blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding	p.R362Q(2)		haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		GTTGGCGTTTCGGCGCCATAA	0.652			Mis		AML(CML blast transformation)								4	78	---	---	---	---	PASS
ACAD11	84129	broad.mit.edu	37	3	132360902	132360902	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132360902C>A	uc003eov.3	-	4	831	c.451G>T	c.(451-453)GAA>TAA	p.E151*	ACAD11_uc003eoy.2_Nonsense_Mutation_p.E151*	NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase	151						peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						GCCAATGTTTCTACCGTGGCC	0.443													19	103	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79369461	79369461	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79369461C>T	uc003hlb.2	+	44	6705	c.6265C>T	c.(6265-6267)CTC>TTC	p.L2089F		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2088	CSPG 9.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						AGGCCTACAGCTCTCAGCAGG	0.468													2	4	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16672863	16672863	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16672863G>A	uc003jft.3	-	37	5712	c.5244C>T	c.(5242-5244)AAC>AAT	p.N1748N	MYO10_uc011cnb.1_Silent_p.N377N|MYO10_uc011cnc.1_Silent_p.N627N|MYO10_uc011cnd.1_Silent_p.N1105N|MYO10_uc011cne.1_Silent_p.N1105N|MYO10_uc010itx.2_Silent_p.N1370N	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	1748	FERM.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						CGACGTGGCCGTTGTATTCAA	0.498													4	80	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26889976	26889976	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26889976G>A	uc003jgs.1	-	9	1650	c.1481C>T	c.(1480-1482)ACA>ATA	p.T494I	CDH9_uc011cnv.1_Missense_Mutation_p.T87I	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	494	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						ACAAACAAATGTTTCATAATA	0.328													24	64	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37157947	37157947	+	Intron	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37157947C>T	uc011cpa.1	-						C5orf42_uc003jkp.1_RNA|C5orf42_uc011coy.1_Silent_p.V1112V|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Silent_p.V1687V	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CAATGTCAATCACATTTATAT	0.353													24	28	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262052	45262052	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262052C>T	uc003jok.2	-	8	2669	c.2644G>A	c.(2644-2646)GAA>AAA	p.E882K		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	882	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CGTGGCTTTTCTGCGTCTGGG	0.463													26	277	---	---	---	---	PASS
CHD1	1105	broad.mit.edu	37	5	98228329	98228329	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98228329G>A	uc003knf.2	-	14	2228	c.2080C>T	c.(2080-2082)CTG>TTG	p.L694L		NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	694					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CGGCGTAACAGAAATGGCTCA	0.373													20	47	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140214266	140214266	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140214266G>A	uc003lhq.2	+	1	298	c.298G>A	c.(298-300)GCG>ACG	p.A100T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.A100T	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	100	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCGGAGCGCGGAGTGCAG	0.557													56	184	---	---	---	---	PASS
SYNPO	11346	broad.mit.edu	37	5	150028954	150028954	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150028954C>A	uc003lsn.2	+	3	2223	c.1849C>A	c.(1849-1851)CGC>AGC	p.R617S	SYNPO_uc003lso.3_Missense_Mutation_p.R373S|SYNPO_uc003lsp.2_Missense_Mutation_p.R373S	NM_001109974	NP_001103444	Q8N3V7	SYNPO_HUMAN	synaptopodin isoform B	617					positive regulation of actin filament bundle assembly|regulation of stress fiber assembly	actin cytoskeleton|cytoplasm|dendritic spine|perikaryon|postsynaptic density|postsynaptic membrane|tight junction	actin binding|protein binding			large_intestine(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTCGATGGCCCGCCGGGGCAG	0.577													3	44	---	---	---	---	PASS
TRIM41	90933	broad.mit.edu	37	5	180661677	180661677	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180661677G>A	uc003mne.1	+	6	2489	c.1795G>A	c.(1795-1797)GCC>ACC	p.A599T	TRIM41_uc003mnc.1_3'UTR|TRIM41_uc003mnd.1_Intron|TRIM41_uc003mnf.1_Intron|TRIM41_uc003mng.1_Missense_Mutation_p.A179T	NM_033549	NP_291027	Q8WV44	TRI41_HUMAN	tripartite motif-containing 41 isoform 1	599	B30.2/SPRY.					cytoplasm|nucleus	ligase activity|protein binding|zinc ion binding				0	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGAGACTCTAGCCCACGTGCA	0.587													36	81	---	---	---	---	PASS
STK38	11329	broad.mit.edu	37	6	36489515	36489515	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36489515T>C	uc003omg.2	-	4	974	c.386A>G	c.(385-387)GAG>GGG	p.E129G	STK38_uc003omh.2_Missense_Mutation_p.E129G|STK38_uc003omi.2_Missense_Mutation_p.E129G	NM_007271	NP_009202	Q15208	STK38_HUMAN	serine/threonine kinase 38	129	Protein kinase.				intracellular protein kinase cascade|negative regulation of MAP kinase activity	cytoplasm|MLL5-L complex	ATP binding|magnesium ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6						CTTTACCTGCTCTTTTTCAAG	0.299													20	76	---	---	---	---	PASS
KIF6	221458	broad.mit.edu	37	6	39545902	39545902	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39545902G>T	uc003oot.2	-	10	1206	c.1111C>A	c.(1111-1113)CTG>ATG	p.L371M	KIF6_uc010jxa.1_Missense_Mutation_p.L162M|KIF6_uc011dua.1_Missense_Mutation_p.L371M|KIF6_uc010jxb.1_Missense_Mutation_p.L371M	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	371	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						TCATCCTTCAGTTCCTGGATT	0.443													13	76	---	---	---	---	PASS
SNAP91	9892	broad.mit.edu	37	6	84300945	84300945	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84300945C>A	uc011dze.1	-	21	2316	c.1999G>T	c.(1999-2001)GCA>TCA	p.A667S	SNAP91_uc011dzd.1_Missense_Mutation_p.A170S|SNAP91_uc003pkb.2_Missense_Mutation_p.A576S|SNAP91_uc003pkc.2_Missense_Mutation_p.A637S|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Missense_Mutation_p.A665S	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	667					clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AGTAGGTCTGCCGATGCTGAT	0.343													3	41	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101246710	101246710	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101246710A>G	uc003pqk.2	-	8	1603	c.1274T>C	c.(1273-1275)ATT>ACT	p.I425T	ASCC3_uc011eai.1_Missense_Mutation_p.I327T|ASCC3_uc003pql.2_Missense_Mutation_p.I425T	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	425					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTCTGGCAAAATCATCTATAA	0.338													4	7	---	---	---	---	PASS
TUBE1	51175	broad.mit.edu	37	6	112392596	112392596	+	3'UTR	SNP	A	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112392596A>C	uc003pvq.2	-	12					TUBE1_uc003pvr.2_3'UTR	NM_016262	NP_057346	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1						centrosome cycle|microtubule-based movement|protein polymerization	microtubule|pericentriolar material	GTP binding|GTPase activity|structural constituent of cytoskeleton			ovary(1)	1		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)		TTAAGAAAGTATTTTTGAGGG	0.338													26	35	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136590744	136590744	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136590744T>C	uc003qgx.1	-	9	2303	c.2050A>G	c.(2050-2052)AAA>GAA	p.K684E	BCLAF1_uc011edb.1_5'Flank|BCLAF1_uc003qgw.1_Missense_Mutation_p.K511E|BCLAF1_uc003qgy.1_Missense_Mutation_p.K682E|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.K682E	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	684					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTTAATTTTTTATCTCCCTAT	0.358													7	14	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152639225	152639225	+	Silent	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152639225C>T	uc010kiw.2	-	86	17165	c.16563G>A	c.(16561-16563)AAG>AAA	p.K5521K	SYNE1_uc010kiv.2_Silent_p.K45K|SYNE1_uc003qos.3_Silent_p.K45K|SYNE1_uc003qot.3_Silent_p.K5450K|SYNE1_uc003qou.3_Silent_p.K5521K|SYNE1_uc010kiz.2_Silent_p.K1276K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5521	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTGATTGAGCTTGGAGAGCC	0.418										HNSCC(10;0.0054)			5	64	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152749510	152749510	+	Silent	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152749510C>A	uc010kiw.2	-	37	5408	c.4806G>T	c.(4804-4806)CTG>CTT	p.L1602L	SYNE1_uc003qot.3_Silent_p.L1609L|SYNE1_uc003qou.3_Silent_p.L1602L|SYNE1_uc010kjb.1_Silent_p.L1585L|SYNE1_uc003qow.2_Silent_p.L897L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1602	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCAGTGACTCCAGGGCCTGGC	0.532										HNSCC(10;0.0054)			3	28	---	---	---	---	PASS
PNLDC1	154197	broad.mit.edu	37	6	160221823	160221823	+	Silent	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160221823G>C	uc003qsx.1	+	2	234	c.63G>C	c.(61-63)ACG>ACC	p.T21T	PNLDC1_uc003qsy.1_Silent_p.T32T	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	21	Cytoplasmic (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TAGAGTTCACGGGCCTTCGTT	0.552													70	58	---	---	---	---	PASS
AGPAT4	56895	broad.mit.edu	37	6	161551943	161551943	+	3'UTR	SNP	A	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161551943A>G	uc003qtr.1	-	9					AGPAT4_uc003qts.1_3'UTR|AGPAT4_uc011egb.1_3'UTR	NM_020133	NP_064518	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4						phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding				0		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		AATTCCATGGATGACTTTTCT	0.368													10	42	---	---	---	---	PASS
TMEM184A	202915	broad.mit.edu	37	7	1594929	1594929	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1594929C>T	uc003skv.3	-	2	509	c.192G>A	c.(190-192)TGG>TGA	p.W64*	TMEM184A_uc003skw.3_5'UTR	NM_001097620	NP_001091089	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	64	Helical; (Potential).					integral to membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		CCAGGGCAGTCCACACGAAGA	0.687													16	22	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567282	5567282	+	3'UTR	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567282C>A	uc003sos.3	-	5					ACTB_uc003sor.3_3'UTR|ACTB_uc003sot.3_3'UTR|ACTB_uc003soq.3_3'UTR|ACTB_uc010ksy.2_3'UTR	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		caaaacaaaacaaaaaaaaca	0.378													14	53	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77762250	77762250	+	Silent	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77762250C>T	uc003ugx.2	-	18	3413	c.3159G>A	c.(3157-3159)CAG>CAA	p.Q1053Q	MAGI2_uc003ugy.2_Silent_p.Q1039Q|MAGI2_uc010ldx.1_Silent_p.Q646Q	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	1053	Pro-rich.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GTGGTGCTGGCTGGGCGATGG	0.582													76	264	---	---	---	---	PASS
UBN2	254048	broad.mit.edu	37	7	138943309	138943309	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138943309C>T	uc011kqr.1	+	4	739	c.739C>T	c.(739-741)CGC>TGC	p.R247C	UBN2_uc003vuv.2_5'UTR	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2	247										ovary(1)|skin(1)	2						TCTACAGTTTCGCCAAGCTTC	0.363													13	46	---	---	---	---	PASS
NEFM	4741	broad.mit.edu	37	8	24771630	24771630	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24771630G>A	uc003xed.3	+	1	357	c.324G>A	c.(322-324)CTG>CTA	p.L108L	NEFM_uc011lac.1_Silent_p.L108L|NEFM_uc010lue.2_5'Flank|uc010luc.1_3'UTR	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	108	Rod.|Coil 1A.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TGCAGGGGCTGAACGACCGCT	0.622													14	6	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41573334	41573334	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41573334T>C	uc003xok.2	-	14	1522	c.1438A>G	c.(1438-1440)ATC>GTC	p.I480V	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Missense_Mutation_p.I480V|ANK1_uc003xoj.2_Missense_Mutation_p.I480V|ANK1_uc003xol.2_Missense_Mutation_p.I480V|ANK1_uc003xom.2_Missense_Mutation_p.I513V	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	480	ANK 14.|89 kDa domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GTGTGGCCGATGCGAGCTGCA	0.473													14	58	---	---	---	---	PASS
SLC24A2	25769	broad.mit.edu	37	9	19786892	19786892	+	5'UTR	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19786892C>A	uc003zoa.1	-	1					SLC24A2_uc003zob.1_5'UTR	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN	solute carrier family 24						visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(3)	3				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		ATATGGTGATCTTCCAACTTT	0.433													14	386	---	---	---	---	PASS
MLLT3	4300	broad.mit.edu	37	9	20414346	20414346	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414346G>A	uc003zoe.2	-	5	757	c.498C>T	c.(496-498)AGC>AGT	p.S166S	MLLT3_uc011lne.1_Silent_p.S134S|MLLT3_uc011lnf.1_Silent_p.S163S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Missense_Mutation_p.A128V	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	166	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.134			T	MLL	ALL								6	281	---	---	---	---	PASS
IFNA4	3441	broad.mit.edu	37	9	21187362	21187362	+	Missense_Mutation	SNP	G	A	A	rs144166492	byFrequency	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21187362G>A	uc003zon.2	-	1	237	c.169C>T	c.(169-171)CAT>TAT	p.H57Y		NM_021068	NP_066546	P05014	IFNA4_HUMAN	interferon, alpha 4 precursor	57					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CCGAAATCATGTCTGTCCTTC	0.517													5	171	---	---	---	---	PASS
IFNA10	3446	broad.mit.edu	37	9	21206465	21206465	+	3'UTR	SNP	A	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21206465A>T	uc003zoq.1	-	1					IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor						blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		AAATGGAAGAACTCATGAAAG	0.363													37	60	---	---	---	---	PASS
STOML2	30968	broad.mit.edu	37	9	35099981	35099981	+	3'UTR	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35099981C>T	uc003zwi.2	-	10					STOML2_uc003zwh.2_3'UTR|STOML2_uc003zwj.2_3'UTR|STOML2_uc011lou.1_3'UTR|STOML2_uc003zwk.2_3'UTR	NM_013442	NP_038470	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2							cytoskeleton	receptor binding				0			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GAGCCAGAATCAGGAAAATCT	0.433													29	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	69067929	69067929	+	Splice_Site	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69067929G>A	uc004afe.1	+	3		c.744_splice	c.e3+1		uc010mnq.1_Splice_Site					Homo sapiens cDNA, FLJ18209.																		TGATATGTTGGTGAGTCAGTT	0.209													7	17	---	---	---	---	PASS
IKBKAP	8518	broad.mit.edu	37	9	111685159	111685159	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111685159C>T	uc004bdm.3	-	6	1035	c.515G>A	c.(514-516)GGA>GAA	p.G172E	IKBKAP_uc011lwc.1_Missense_Mutation_p.G58E|IKBKAP_uc010mtq.2_Intron	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	172					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						GCCTTCTGATCCATGGAACTG	0.413													29	50	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139413982	139413982	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139413982C>A	uc004chz.2	-	5	778	c.778G>T	c.(778-780)GAT>TAT	p.D260Y		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	260	Extracellular (Potential).|EGF-like 7; calcium-binding (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CCTGGACAATCGTCGATATTT	0.632			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			86	117	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17083212	17083212	+	Silent	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17083212C>T	uc001ioo.2	-	27	3889	c.3837G>A	c.(3835-3837)GAG>GAA	p.E1279E		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1279	CUB 8.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTACCACATTCTCACATGCTG	0.343													36	42	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26492008	26492008	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26492008C>T	uc001isn.2	+	34	5062	c.4702C>T	c.(4702-4704)CAG>TAG	p.Q1568*	MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1568					protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GCAAGAACTCCAGAATCAATG	0.333													16	55	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37438756	37438756	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37438756A>T	uc001iza.1	+	11	1555	c.1456A>T	c.(1456-1458)AAT>TAT	p.N486Y		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	542						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TGAATTGAAGAATGAACAAAC	0.323													8	48	---	---	---	---	PASS
PPAPDC1A	196051	broad.mit.edu	37	10	122334734	122334734	+	Silent	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122334734C>G	uc001lev.1	+	6	889	c.537C>G	c.(535-537)CTC>CTG	p.L179L	PPAPDC1A_uc010qtd.1_Silent_p.L179L|PPAPDC1A_uc009xzl.1_Silent_p.L116L|PPAPDC1A_uc001lew.1_Missense_Mutation_p.S86C|PPAPDC1A_uc001lex.1_Intron|PPAPDC1A_uc001ley.1_Silent_p.L58L	NM_001030059	NP_001025230	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain	179	Helical; (Potential).				phospholipid dephosphorylation	integral to membrane	phosphatidate phosphatase activity			breast(1)	1		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		GCTGGCGGCTCTGTGCTGCCA	0.607													20	89	---	---	---	---	PASS
LOC653544	653544	broad.mit.edu	37	10	135491113	135491113	+	Missense_Mutation	SNP	G	T	T	rs150899513	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135491113G>T	uc010qvi.1	+	1	835	c.724G>T	c.(724-726)GCC>TCC	p.A242S		NM_001127389	NP_001120861	F5GZ66	F5GZ66_HUMAN	double homeobox, 4-like	242						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGTCGCCTTCGCCCACACCGG	0.776													3	15	---	---	---	---	PASS
PHRF1	57661	broad.mit.edu	37	11	609398	609398	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:609398G>A	uc001lqe.2	+	14	4073	c.3942G>A	c.(3940-3942)CTG>CTA	p.L1314L	PHRF1_uc010qwc.1_Silent_p.L1313L|PHRF1_uc010qwd.1_Silent_p.L1312L|PHRF1_uc010qwe.1_Silent_p.L1310L|PHRF1_uc009ybz.1_Silent_p.L1104L|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1314							RNA polymerase binding|zinc ion binding				0						CAGCCAGCCTGGCCGTGGCCG	0.632													3	20	---	---	---	---	PASS
KRTAP5-4	387267	broad.mit.edu	37	11	1643335	1643335	+	5'UTR	SNP	A	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1643335A>G	uc009ycy.1	-	1						NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4							keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GTTCTGGTGGATTGAGGGTGG	0.403													5	121	---	---	---	---	PASS
PPFIBP2	8495	broad.mit.edu	37	11	7652173	7652173	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7652173C>T	uc001mfj.3	+	11	1370	c.982C>T	c.(982-984)CTC>TTC	p.L328F	PPFIBP2_uc010rbb.1_Missense_Mutation_p.L251F|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Missense_Mutation_p.L251F|PPFIBP2_uc010rbd.1_Missense_Mutation_p.L170F|PPFIBP2_uc010rbe.1_Missense_Mutation_p.L216F|PPFIBP2_uc001mfl.3_Missense_Mutation_p.L185F|PPFIBP2_uc009yfj.1_5'UTR	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2	328					cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGAGAGAACTCTCTCAATCAA	0.393													17	68	---	---	---	---	PASS
E2F8	79733	broad.mit.edu	37	11	19252338	19252338	+	Silent	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19252338C>G	uc001mpm.2	-	8	1632	c.1110G>C	c.(1108-1110)GTG>GTC	p.V370V	E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Silent_p.V370V	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	370					cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						AAGACCGTCTCACCTCCAAAT	0.433													14	26	---	---	---	---	PASS
HTATIP2	10553	broad.mit.edu	37	11	20385976	20385976	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20385976G>T	uc009yia.1	+	2	259	c.193G>T	c.(193-195)GTG>TTG	p.V65L	HTATIP2_uc009yib.1_Missense_Mutation_p.V65L|HTATIP2_uc001mpx.2_Missense_Mutation_p.V99L|HTATIP2_uc001mpz.2_Missense_Mutation_p.V65L|HTATIP2_uc001mpy.3_Missense_Mutation_p.V65L	NM_006410	NP_006401	Q9BUP3	HTAI2_HUMAN	HIV-1 Tat interactive protein 2, 30kDa isoform	65					angiogenesis|anti-apoptosis|apoptosis|cell differentiation|cellular amino acid metabolic process|induction of apoptosis|interspecies interaction between organisms|nuclear import|regulation of angiogenesis|regulation of transcription from RNA polymerase II promoter	cytoplasm|nuclear envelope	NAD binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor|protein binding|transcription coactivator activity				0						TTATAAAAATGTGGTGGGTAT	0.512													6	17	---	---	---	---	PASS
OR8K1	390157	broad.mit.edu	37	11	56113882	56113882	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56113882C>T	uc010rjg.1	+	1	368	c.368C>T	c.(367-369)GCA>GTA	p.A123V		NM_001002907	NP_001002907	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K,	123	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					ATTCTATCAGCAATGGCCTAT	0.403										HNSCC(65;0.19)			15	110	---	---	---	---	PASS
FLRT1	23769	broad.mit.edu	37	11	63884475	63884475	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63884475C>T	uc001nyi.1	+	2	1077	c.736C>T	c.(736-738)CGC>TGC	p.R246C	MACROD1_uc001nyh.2_Intron	NM_013280	NP_037412	Q9NZU1	FLRT1_HUMAN	fibronectin leucine rich transmembrane protein	218	Extracellular (Potential).|LRR 7.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity				0						CACCTTCAGCCGCCTACAGAA	0.657													3	9	---	---	---	---	PASS
OR6M1	390261	broad.mit.edu	37	11	123676993	123676993	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123676993C>T	uc010rzz.1	-	1	65	c.65G>A	c.(64-66)CGA>CAA	p.R22Q		NM_001005325	NP_001005325	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GAGAGATATTCGAATCTCCAG	0.458													12	25	---	---	---	---	PASS
ADAMTS15	170689	broad.mit.edu	37	11	130318901	130318901	+	Silent	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130318901C>T	uc010scd.1	+	1	33	c.33C>T	c.(31-33)TTC>TTT	p.F11F		NM_139055	NP_620686	Q8TE58	ATS15_HUMAN	a disintegrin-like and metalloprotease	11					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CCCTGGCTTTCGCCGGGCGAA	0.711													6	33	---	---	---	---	PASS
ENO2	2026	broad.mit.edu	37	12	7024917	7024917	+	Intron	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7024917C>T	uc001qru.1	+						ENO2_uc009zfi.1_Intron|ENO2_uc010sfq.1_Intron|ENO2_uc001qrv.1_5'UTR	NM_001975	NP_001966	P09104	ENOG_HUMAN	enolase 2						gluconeogenesis|glycolysis	phosphopyruvate hydratase complex|plasma membrane	magnesium ion binding|phosphopyruvate hydratase activity				0						CCCGCCCCGCCCATTGATCTC	0.592													287	105	---	---	---	---	PASS
ATN1	1822	broad.mit.edu	37	12	7051130	7051130	+	3'UTR	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7051130C>G	uc001qrw.1	+	10					ATN1_uc001qrx.1_3'UTR|C12orf57_uc009zfj.1_5'Flank|C12orf57_uc001qrz.2_5'Flank	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1						cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						ATGTGGTGTGCAGAGGTGGGG	0.627													3	22	---	---	---	---	PASS
CLEC4C	170482	broad.mit.edu	37	12	7883442	7883442	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7883442G>A	uc001qtg.1	-	5	622	c.448C>T	c.(448-450)CGG>TGG	p.R150W	CLEC4C_uc001qth.1_Missense_Mutation_p.R150W|CLEC4C_uc001qti.1_Missense_Mutation_p.R119W	NM_130441	NP_569708	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C isoform	150	Extracellular (Potential).|C-type lectin.				innate immune response	integral to membrane	sugar binding			ovary(2)|skin(1)	3				Kidney(36;0.0915)		CAATGTCGCCGACCCCCTGGA	0.428													18	361	---	---	---	---	PASS
NECAP1	25977	broad.mit.edu	37	12	8245543	8245543	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8245543C>A	uc001qtx.2	+	6	646	c.568C>A	c.(568-570)CCG>ACG	p.P190T	NECAP1_uc001qty.2_Missense_Mutation_p.P48T	NM_015509	NP_056324	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	190					endocytosis|protein transport	clathrin coated vesicle membrane|plasma membrane				ovary(1)	1				Kidney(36;0.0915)		ACTCCCACCCCCGCCAGGAGG	0.512													7	470	---	---	---	---	PASS
LOC653113	653113	broad.mit.edu	37	12	8384397	8384397	+	RNA	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8384397C>T	uc010sgk.1	-	5		c.1391G>A				NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						CCCCAGGGCCCCTGCTGTCCT	0.587													4	102	---	---	---	---	PASS
CLEC4D	338339	broad.mit.edu	37	12	8672931	8672931	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8672931G>A	uc001qun.2	+	5	687	c.494G>A	c.(493-495)CGC>CAC	p.R165H		NM_080387	NP_525126	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	165	C-type lectin.|Extracellular (Potential).				innate immune response	integral to membrane	sugar binding				0	Lung SC(5;0.184)					TTTAACCCACGCAGAGTGTAA	0.418													10	87	---	---	---	---	PASS
RERGL	79785	broad.mit.edu	37	12	18234161	18234161	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18234161G>C	uc001rdq.2	-	6	776	c.582C>G	c.(580-582)ATC>ATG	p.I194M	RERGL_uc001rdr.2_Missense_Mutation_p.I193M	NM_024730	NP_079006	Q9H628	RERGL_HUMAN	RERG/RAS-like	194	Small GTPase-like.				signal transduction	membrane	GTP binding|GTPase activity				0						ATACATTATTGATCAATTTGG	0.333													8	79	---	---	---	---	PASS
KIAA0528	9847	broad.mit.edu	37	12	22688194	22688194	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22688194C>G	uc001rfq.2	-	3	403	c.175G>C	c.(175-177)GAG>CAG	p.E59Q	KIAA0528_uc010sir.1_5'UTR|KIAA0528_uc010sis.1_Missense_Mutation_p.E59Q|KIAA0528_uc010sit.1_Missense_Mutation_p.E59Q|KIAA0528_uc010siu.1_Missense_Mutation_p.E59Q|KIAA0528_uc001rfr.2_Missense_Mutation_p.E59Q|KIAA0528_uc009ziy.1_Missense_Mutation_p.E59Q	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	59	C2.						protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						AAACTTACCTCAAATTTAAAC	0.333													7	29	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32949047	32949047	+	Missense_Mutation	SNP	C	T	T	rs151264959	byFrequency	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32949047C>T	uc001rlj.3	-	12	2600	c.2485G>A	c.(2485-2487)GAT>AAT	p.D829N	PKP2_uc001rlk.3_Missense_Mutation_p.D785N|PKP2_uc010skj.1_Missense_Mutation_p.D782N	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	829	ARM 8.				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					ACTTACGCATCGCCTGCACTA	0.488													45	54	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46320096	46320096	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46320096C>G	uc001rox.2	-	11	3675	c.3388G>C	c.(3388-3390)GAG>CAG	p.E1130Q	SFRS2IP_uc001row.2_Missense_Mutation_p.E815Q|SFRS2IP_uc001roy.1_Missense_Mutation_p.E1204Q	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	1130					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		AATGAGAACTCCTGTTCACTT	0.443													25	99	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46345474	46345474	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46345474G>C	uc001rox.2	-	4	543	c.256C>G	c.(256-258)CAG>GAG	p.Q86E	SFRS2IP_uc001roy.1_Missense_Mutation_p.Q160E|SFRS2IP_uc009zki.1_RNA	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	86					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		AACACTGCCTGAAAAGGTTTA	0.279													16	63	---	---	---	---	PASS
SP7	121340	broad.mit.edu	37	12	53722482	53722482	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53722482G>A	uc001sct.2	-	2	851	c.744C>T	c.(742-744)CCC>CCT	p.P248P	SP7_uc001scu.2_Silent_p.P230P|SP7_uc001scv.2_Silent_p.P248P	NM_152860	NP_690599	Q8TDD2	SP7_HUMAN	osterix	248					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACCCCGTGGGGGTTTGGCTC	0.612													23	40	---	---	---	---	PASS
DNAJC14	85406	broad.mit.edu	37	12	56189844	56189844	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56189844C>T	uc001shu.1	-	10	2373	c.2317G>A	c.(2317-2319)GTG>ATG	p.V773M	SARNP_uc009zoa.2_RNA|SARNP_uc001shs.3_RNA|SARNP_uc001sht.2_Missense_Mutation_p.V90M|SARNP_uc001shv.3_Missense_Mutation_p.V90M	NM_032364	NP_115740	Q6Y2X3	DJC14_HUMAN	dopamine receptor interacting protein	Error:Variant_position_missing_in_Q6Y2X3_after_alignment					protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding			ovary(3)|large_intestine(1)	4						ATTTTCACCACTTTCTTCTCT	0.368													6	53	---	---	---	---	PASS
LGR5	8549	broad.mit.edu	37	12	71960661	71960661	+	Missense_Mutation	SNP	G	C	C	rs148862507	byFrequency	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71960661G>C	uc001swl.2	+	11	1087	c.1039G>C	c.(1039-1041)GTC>CTC	p.V347L	LGR5_uc001swm.2_Missense_Mutation_p.V323L|LGR5_uc001swn.1_RNA	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	347	Extracellular (Potential).|LRR 12.					integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						TCCTCAAACCGTCTGCAATCA	0.403													14	43	---	---	---	---	PASS
CHPT1	56994	broad.mit.edu	37	12	102108412	102108412	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102108412G>C	uc001tin.2	+	3	775	c.552G>C	c.(550-552)TTG>TTC	p.L184F	CHPT1_uc001tio.2_RNA|CHPT1_uc001tip.1_Missense_Mutation_p.L184F	NM_020244	NP_064629	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1	184					platelet activating factor biosynthetic process|regulation of cell growth	Golgi membrane|integral to membrane|microsome	diacylglycerol binding|diacylglycerol cholinephosphotransferase activity|metal ion binding				0						CAGGCATGTTGAGATTTGGAA	0.328													17	73	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105535024	105535024	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105535024G>C	uc001tld.2	+	18	1874	c.1787G>C	c.(1786-1788)CGA>CCA	p.R596P	KIAA1033_uc010swr.1_Missense_Mutation_p.R597P|KIAA1033_uc010sws.1_Missense_Mutation_p.R408P	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	596					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						CTTAGAGAACGGTAAGTAGGA	0.338													9	89	---	---	---	---	PASS
OAS1	4938	broad.mit.edu	37	12	113355534	113355534	+	Intron	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113355534T>C	uc001tud.2	+						OAS1_uc001tub.2_Missense_Mutation_p.F356S|OAS1_uc001tuc.2_Intron|OAS1_uc009zwf.2_Intron	NM_016816	NP_058132	P00973	OAS1_HUMAN	2',5'-oligoadenylate synthetase 1 isoform 1						interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(2)	2						TCCCTGCCATTCATCCCTGCC	0.493													17	60	---	---	---	---	PASS
ULK1	8408	broad.mit.edu	37	12	132405682	132405682	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132405682G>A	uc001uje.2	+	27	3267	c.2999G>A	c.(2998-3000)CGT>CAT	p.R1000H		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	1000					autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		TTCCAGCACCGTGAGGGCTGC	0.667													8	38	---	---	---	---	PASS
ARHGAP5	394	broad.mit.edu	37	14	32561433	32561433	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32561433A>G	uc001wrl.2	+	2	1797	c.1558A>G	c.(1558-1560)ACA>GCA	p.T520A	ARHGAP5_uc001wrm.2_Missense_Mutation_p.T520A|ARHGAP5_uc001wrn.2_Missense_Mutation_p.T520A|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	520	FF 4.				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TGAAATTCATACAGTTCTGAG	0.333													3	33	---	---	---	---	PASS
C15orf21	283651	broad.mit.edu	37	15	45848135	45848135	+	RNA	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45848135T>C	uc010beg.1	+	6		c.1130T>C			C15orf21_uc010beh.1_RNA|C15orf21_uc010bei.1_RNA|C15orf21_uc010bej.1_RNA|C15orf21_uc001zvm.1_RNA|C15orf21_uc001zvn.1_RNA					Homo sapiens cDNA FLJ39426 fis, clone PROST2000505.												0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;3.03e-17)|GBM - Glioblastoma multiforme(94;7.36e-07)		CCAAGTGAAGTGTGTGCATTT	0.378			T	ETV1	prostate								15	45	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53907975	53907975	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53907975C>A	uc002acj.2	-	15	2470	c.2428G>T	c.(2428-2430)GAT>TAT	p.D810Y	WDR72_uc010bfi.1_Missense_Mutation_p.D810Y	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	810										lung(1)|skin(1)	2				all cancers(107;0.0511)		TAATCTAAATCTTTATCCACT	0.358													18	79	---	---	---	---	PASS
SPESP1	246777	broad.mit.edu	37	15	69238675	69238675	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69238675G>A	uc002arn.1	+	2	930	c.802G>A	c.(802-804)GCA>ACA	p.A268T	NOX5_uc002arp.1_Intron|NOX5_uc002arq.1_Intron|NOX5_uc010bid.1_Intron|NOX5_uc002aro.2_Intron	NM_145658	NP_663633	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1 precursor	268	Poly-Ala.				multicellular organismal development	acrosomal vesicle					0						CCTTGCTCTAGCAGCAGCAGC	0.383													11	38	---	---	---	---	PASS
MIR630	693215	broad.mit.edu	37	15	72879610	72879610	+	RNA	SNP	A	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72879610A>T	hsa-mir-630|MI0003644	+			c.53A>T																				0						CTGGTCACAGAATGACCTAGT	0.284													11	17	---	---	---	---	PASS
SOX8	30812	broad.mit.edu	37	16	1035417	1035417	+	3'UTR	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1035417G>A	uc002ckn.2	+	3						NM_014587	NP_055402	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8						adipose tissue development|enteric nervous system development|fat cell differentiation|in utero embryonic development|metanephric nephron tubule formation|morphogenesis of a branching epithelium|negative regulation of apoptosis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|neural crest cell migration|oligodendrocyte differentiation|osteoblast differentiation|peripheral nervous system development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of gliogenesis|positive regulation of osteoblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone levels|renal vesicle induction|retinal rod cell differentiation|Sertoli cell development|signal transduction|spermatogenesis|ureter morphogenesis	cytoplasm|nucleus				central_nervous_system(1)|skin(1)	2		Hepatocellular(780;0.00308)				ACTCGCAGGCGTCAGGGGGCA	0.711													3	0	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2806515	2806515	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2806515G>A	uc002crk.2	+	2	699	c.150G>A	c.(148-150)GTG>GTA	p.V50V	SRRM2_uc002crj.1_Intron|SRRM2_uc002crl.1_Silent_p.V50V|SRRM2_uc010bsu.1_Intron	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	50						Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CTGCCCTGGTGAAGCGGCCTA	0.672													17	50	---	---	---	---	PASS
ZNF205	7755	broad.mit.edu	37	16	3169745	3169745	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3169745A>G	uc002cub.2	+	7	1219	c.1084A>G	c.(1084-1086)AAG>GAG	p.K362E	ZNF205_uc002cua.2_Missense_Mutation_p.K362E	NM_001042428	NP_001035893	O95201	ZN205_HUMAN	zinc finger protein 205	362					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0						CACGGGCGAGAAGCCCTACAC	0.652													27	117	---	---	---	---	PASS
RBBP6	5930	broad.mit.edu	37	16	24580584	24580584	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24580584A>G	uc002dmh.2	+	17	3613	c.2573A>G	c.(2572-2574)GAG>GGG	p.E858G	RBBP6_uc010vcb.1_Missense_Mutation_p.E725G|RBBP6_uc002dmi.2_Missense_Mutation_p.E824G|RBBP6_uc010bxr.2_Intron|RBBP6_uc002dmk.2_Missense_Mutation_p.E691G	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	858					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		GCAAATAGAGAGAACTTTTCT	0.428													34	60	---	---	---	---	PASS
TBC1D10B	26000	broad.mit.edu	37	16	30376495	30376495	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30376495G>A	uc002dxu.2	-	3	1113	c.1095C>T	c.(1093-1095)CTC>CTT	p.L365L		NM_015527	NP_056342	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	365	Rab-GAP TBC.					cytoplasm	Rab GTPase activator activity				0			Colorectal(24;0.193)			CTTTGGCTCTGAGAGAGGAGG	0.582													10	54	---	---	---	---	PASS
BCKDK	10295	broad.mit.edu	37	16	31122038	31122038	+	Silent	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31122038T>C	uc002eaw.3	+	8	988	c.672T>C	c.(670-672)CGT>CGC	p.R224R	BCKDK_uc002eav.3_Silent_p.R224R|BCKDK_uc010cah.2_Intron|BCKDK_uc010cai.2_Silent_p.R224R	NM_005881	NP_005872	O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	224	Histidine kinase.				branched chain family amino acid catabolic process|peptidyl-histidine phosphorylation	mitochondrial alpha-ketoglutarate dehydrogenase complex	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity|ATP binding|protein binding|protein serine/threonine kinase activity|two-component sensor activity			stomach(1)|breast(1)	2						TCTGTACTCGTCTCTCACCAA	0.577													5	211	---	---	---	---	PASS
UBE2MP1	606551	broad.mit.edu	37	16	34404559	34404559	+	RNA	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34404559C>T	uc002edv.1	-	1		c.204G>A				NR_002837				full-length cDNA clone CS0DH003YB23 of T cells (Jurkat cell line) of Homo sapiens (human).												0						CGCTTGGTGCCTCCCGCCGAC	0.473													12	29	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46694417	46694417	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46694417G>A	uc002eef.3	-	17	2457	c.2358C>T	c.(2356-2358)TCC>TCT	p.S786S	VPS35_uc002eed.2_3'UTR|VPS35_uc002eee.2_Silent_p.S747S	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	786					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TTGGCCCCTCGGATTCTGGTG	0.438													15	52	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	64984769	64984769	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64984769C>T	uc002eoi.2	-	12	2229	c.1795G>A	c.(1795-1797)GGG>AGG	p.G599R	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Missense_Mutation_p.G599R|CDH11_uc010vin.1_Missense_Mutation_p.G473R	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	599	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		AGCAGTGCCCCGTTCACGTCG	0.612			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			10	26	---	---	---	---	PASS
IL34	146433	broad.mit.edu	37	16	70694047	70694047	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70694047C>T	uc002ezh.1	+	6	1069	c.686C>T	c.(685-687)TCG>TTG	p.S229L	IL34_uc002ezi.1_Missense_Mutation_p.S228L	NM_152456	NP_689669	Q6ZMJ4	IL34_HUMAN	interleukin 34 precursor	229					positive regulation of cell proliferation|positive regulation of protein phosphorylation	extracellular space	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding			central_nervous_system(1)|skin(1)	2						TCCACGGGCTCGGTGAGGCCG	0.682													16	104	---	---	---	---	PASS
AMAC1L3	643664	broad.mit.edu	37	17	7386366	7386366	+	3'UTR	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7386366G>A	uc010cmj.1	+	2					ZBTB4_uc002ghd.3_Intron|POLR2A_uc002ghe.2_5'Flank|POLR2A_uc002ghf.3_5'Flank	NM_001102614	NP_001096084	P0C7Q6	AMCL3_HUMAN	acyl-malonyl condensing enzyme 1-like 3							integral to membrane					0		Prostate(122;0.173)				GGGATAAATAGAGGCAAAGAC	0.537													3	32	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12666707	12666707	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12666707G>A	uc002gnn.2	+	13	2862	c.2563G>A	c.(2563-2565)GAG>AAG	p.E855K	MYOCD_uc002gno.2_Missense_Mutation_p.E903K|MYOCD_uc002gnq.2_Missense_Mutation_p.E579K	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	855					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CAATGCACATGAGATCTTGCC	0.498													21	23	---	---	---	---	PASS
KRT35	3886	broad.mit.edu	37	17	39633148	39633148	+	3'UTR	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39633148G>C	uc002hws.2	-	8						NM_002280	NP_002271	Q92764	KRT35_HUMAN	keratin 35						anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)				GACAGGCTCTGAGAAACTTTA	0.552													8	4	---	---	---	---	PASS
EFTUD2	9343	broad.mit.edu	37	17	42928692	42928692	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42928692T>C	uc002ihn.2	-	28	3130	c.2869A>G	c.(2869-2871)ATG>GTG	p.M957V	EFTUD2_uc010wje.1_Missense_Mutation_p.M922V|EFTUD2_uc010wjf.1_Missense_Mutation_p.M947V	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain	957						Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				TCCAGCAACATAGGATCATCG	0.522													94	52	---	---	---	---	PASS
DGKE	8526	broad.mit.edu	37	17	54912463	54912463	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54912463G>C	uc002iur.2	+	2	487	c.307G>C	c.(307-309)GAC>CAC	p.D103H	DGKE_uc002ius.1_Missense_Mutation_p.D103H|C17orf67_uc002iuq.2_5'Flank	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	103	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)					CAGGAAGGCCGACAAGCGCTT	0.647													11	38	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75212491	75212491	+	3'UTR	SNP	C	A	A	rs1130549	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75212491C>A	uc002jto.2	+	17					SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_3'UTR|SEC14L1_uc002jtm.2_3'UTR|SEC14L1_uc010wti.1_3'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						aggtagggttcgtaggtaggg	0.169													7	13	---	---	---	---	PASS
L3MBTL4	91133	broad.mit.edu	37	18	6237978	6237978	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6237978G>C	uc002kmz.3	-	10	929	c.769C>G	c.(769-771)CTG>GTG	p.L257V	L3MBTL4_uc010dkt.2_Missense_Mutation_p.L257V|L3MBTL4_uc002kmy.3_Missense_Mutation_p.L95V	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4	257	MBT 2.				chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				GGTGCTATCAGAGTTCTTCCA	0.433													18	102	---	---	---	---	PASS
CEP76	79959	broad.mit.edu	37	18	12673363	12673363	+	3'UTR	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12673363C>A	uc002kri.2	-	12					PSMG2_uc002krg.2_Intron|CEP76_uc002krh.3_Intron|CEP76_uc010wzz.1_3'UTR	NM_024899	NP_079175	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa						G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0						AAATATTGGCCCTATAATACC	0.343													5	162	---	---	---	---	PASS
FAM59A	64762	broad.mit.edu	37	18	29867362	29867362	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29867362C>T	uc002kxl.2	-	4	1254	c.1198G>A	c.(1198-1200)GAG>AAG	p.E400K	FAM59A_uc002kxk.1_Missense_Mutation_p.E400K	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A	400										ovary(1)|skin(1)	2						AGGTTCACCTCACTGTTGCCA	0.572													9	68	---	---	---	---	PASS
CREB3L3	84699	broad.mit.edu	37	19	4159760	4159760	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4159760C>T	uc002lzl.2	+	4	673	c.557C>T	c.(556-558)TCG>TTG	p.S186L	CREB3L3_uc002lzm.2_Missense_Mutation_p.S176L|CREB3L3_uc010xib.1_Missense_Mutation_p.S177L|CREB3L3_uc010xic.1_Missense_Mutation_p.S177L	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	186	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCTCCTTTCGGGCAGCAGT	0.433													20	32	---	---	---	---	PASS
GPR108	56927	broad.mit.edu	37	19	6730391	6730391	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6730391T>G	uc002mfp.2	-	18	1610	c.1564A>C	c.(1564-1566)ACG>CCG	p.T522P	GPR108_uc010duv.2_Missense_Mutation_p.T73P|GPR108_uc002mfn.2_Missense_Mutation_p.T177P|GPR108_uc002mfo.3_Missense_Mutation_p.T280P|GPR108_uc010duw.2_RNA	NM_001080452	NP_001073921	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108 isoform 1	522						integral to membrane					0						CCAGAGTCCGTCATTCTGGGG	0.627													18	38	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10089567	10089567	+	Silent	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10089567C>T	uc002mmq.1	-	40	3050	c.2964G>A	c.(2962-2964)CCG>CCA	p.P988P		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	988	Triple-helical region.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			AGATACTCACCGGGTCCCCAG	0.617													4	10	---	---	---	---	PASS
MAN2B1	4125	broad.mit.edu	37	19	12760960	12760960	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12760960C>T	uc002mub.2	-	17	2199	c.2123G>A	c.(2122-2124)CGG>CAG	p.R708Q	MAN2B1_uc010dyv.1_Missense_Mutation_p.R707Q	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	708					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						CTCCAGGTGCCGCTGTCCTGG	0.627													29	62	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941065	22941065	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941065G>T	uc010xrh.1	-	5	1373	c.1373C>A	c.(1372-1374)TCC>TAC	p.S458Y		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AAGGGTTGAGGAATTGTTAAA	0.333													11	18	---	---	---	---	PASS
CCDC123	84902	broad.mit.edu	37	19	33444638	33444638	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33444638G>A	uc002nty.2	-	4	464	c.375C>T	c.(373-375)GAC>GAT	p.D125D	CCDC123_uc002ntx.2_Translation_Start_Site|CCDC123_uc010edg.2_RNA|CCDC123_uc002ntz.1_Silent_p.D125D|CCDC123_uc002nua.2_Silent_p.D125D|CCDC123_uc002nub.1_Silent_p.D17D	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN	coiled-coil domain containing 123	125						centrosome|spindle pole					0	Esophageal squamous(110;0.137)					TGTCCTCTTCGTCCCCATAGT	0.498													22	123	---	---	---	---	PASS
KCTD15	79047	broad.mit.edu	37	19	34297838	34297838	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34297838C>T	uc002nuy.3	+	5	581	c.313C>T	c.(313-315)CGG>TGG	p.R105W	KCTD15_uc002nuv.2_Missense_Mutation_p.R105W|KCTD15_uc002nuw.3_Missense_Mutation_p.R105W|KCTD15_uc010xrt.1_Missense_Mutation_p.R105W|KCTD15_uc002nux.3_Missense_Mutation_p.R105W	NM_001129994	NP_001123466	Q96SI1	KCD15_HUMAN	potassium channel tetramerisation domain	105	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	Esophageal squamous(110;0.162)					TTTCATTGACCGGGATGGGGA	0.552													21	80	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533104	41533104	+	Intron	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533104G>A	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CATCATGTCCGCACAGCACCA	0.632													4	36	---	---	---	---	PASS
ZNF404	342908	broad.mit.edu	37	19	44378000	44378000	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44378000C>G	uc002oxs.3	-	2	366	c.357G>C	c.(355-357)AAG>AAC	p.K119N		NM_001033719	NP_001028891	Q494X3	ZN404_HUMAN	zinc finger protein 404	122					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				TGTTATTTCTCTTATGTAGAG	0.353													23	116	---	---	---	---	PASS
PNKP	11284	broad.mit.edu	37	19	50370414	50370414	+	Silent	SNP	A	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50370414A>G	uc002pqh.2	-	1	100	c.48T>C	c.(46-48)CCT>CCC	p.P16P	PNKP_uc002pqg.2_5'Flank|PNKP_uc002pqi.2_5'UTR|PNKP_uc002pqj.2_Silent_p.P16P|PNKP_uc010enm.2_Silent_p.P16P|PNKP_uc002pqk.2_Silent_p.P16P	NM_007254	NP_009185	Q96T60	PNKP_HUMAN	polynucleotide kinase 3' phosphatase	16					DNA damage response, detection of DNA damage|DNA-dependent DNA replication|nucleotide-excision repair, DNA damage removal|response to oxidative stress|response to radiation	nucleolus	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|damaged DNA binding|double-stranded DNA binding|endonuclease activity|nucleotide kinase activity|polynucleotide 3'-phosphatase activity|protein binding			ovary(1)|kidney(1)	2		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		GCGCTCCCCCAGGGGGGCTCT	0.721								Other_BER_factors					5	13	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58597677	58597677	+	Intron	SNP	G	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58597677G>T	uc002qri.2	-						ZSCAN18_uc002qrj.3_Intron|ZSCAN18_uc010yhs.1_Intron|ZSCAN18_uc002qrh.2_Intron|ZSCAN18_uc010yht.1_Intron|ZSCAN18_uc002qrk.1_3'UTR|ZSCAN18_uc002qrl.2_3'UTR	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CATCAACACAGAGTGGCTGAT	0.577													3	18	---	---	---	---	PASS
SNRPB	6628	broad.mit.edu	37	20	2446424	2446424	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2446424A>C	uc002wfz.1	-	3	360	c.197T>G	c.(196-198)GTC>GGC	p.V66G	SNRPB_uc002wga.1_Missense_Mutation_p.V66G|SNRPB_uc010zpv.1_5'UTR|SNRPB_uc002wgb.2_Missense_Mutation_p.V66G|SNORD119_uc010gam.1_5'Flank	NM_198216	NP_937859	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptide B/B'	66					histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|protein binding|RNA binding			ovary(1)	1						CAGACCGAGGACTCGCTTCTC	0.498													21	66	---	---	---	---	PASS
SMOX	54498	broad.mit.edu	37	20	4162941	4162941	+	Missense_Mutation	SNP	G	A	A	rs145030123		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4162941G>A	uc002wkm.1	+	5	1016	c.815G>A	c.(814-816)CGC>CAC	p.R272H	SMOX_uc002wkk.1_Missense_Mutation_p.R272H|SMOX_uc002wkl.1_Missense_Mutation_p.R272H|SMOX_uc002wkn.1_Intron|SMOX_uc002wkp.2_Missense_Mutation_p.R272H|SMOX_uc010zqo.1_Missense_Mutation_p.R249H|SMOX_uc002wko.1_Missense_Mutation_p.R272H	NM_175839	NP_787033	Q9NWM0	SMOX_HUMAN	spermine oxidase isoform 1	272					polyamine biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	polyamine oxidase activity			breast(1)	1					Spermine(DB00127)	GCCTCAGCCCGCCCCAGAGGC	0.682													9	11	---	---	---	---	PASS
TASP1	55617	broad.mit.edu	37	20	13610642	13610642	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13610642T>A	uc002woi.2	-	2	201	c.84A>T	c.(82-84)AAA>AAT	p.K28N	TASP1_uc010zri.1_RNA|TASP1_uc002woh.2_Missense_Mutation_p.K28N|TASP1_uc010zrj.1_RNA|TASP1_uc010zrk.1_Missense_Mutation_p.K28N	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN	taspase 1 precursor	28					asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0						TTTCCAACTCTTTGGCTGTTA	0.458													33	424	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29624081	29624081	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29624081A>T	uc010ztl.1	+	1	47	c.15A>T	c.(13-15)TTA>TTT	p.L5F	FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						CTGTCAAATTATCTGATTCCA	0.279													4	19	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32378876	32378876	+	Silent	SNP	G	A	A	rs141469797	byFrequency	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32378876G>A	uc002wzy.2	+	15	2138	c.2118G>A	c.(2116-2118)ACG>ACA	p.T706T	ZNF341_uc002wzx.2_Silent_p.T699T|ZNF341_uc010geq.2_Silent_p.T616T|ZNF341_uc010ger.2_RNA|ZNF341_uc002wzz.2_Silent_p.T133T	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	706				T -> M (in Ref. 4; BAB55193).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GCGCCCACACGGGCAACTACA	0.617													13	111	---	---	---	---	PASS
MATN4	8785	broad.mit.edu	37	20	43927067	43927067	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43927067G>A	uc002xnn.2	-	7	1356	c.1169C>T	c.(1168-1170)TCG>TTG	p.S390L	MATN4_uc002xno.2_Missense_Mutation_p.S349L|MATN4_uc002xnp.2_Missense_Mutation_p.S308L|MATN4_uc010zwr.1_Missense_Mutation_p.S338L|MATN4_uc002xnr.1_Missense_Mutation_p.S390L	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	431	VWFA 2.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				CACGCGGCTCGAGAACTGCAC	0.637													4	50	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41447093	41447093	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41447093G>A	uc002yyq.1	-	27	5211	c.4759C>T	c.(4759-4761)CTG>TTG	p.L1587L	DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1587	Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TTGGTCGTCAGCCCTTCTTCG	0.542													11	22	---	---	---	---	PASS
SIK1	150094	broad.mit.edu	37	21	44839282	44839282	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44839282G>A	uc002zdf.2	-	10	1323	c.1196C>T	c.(1195-1197)TCC>TTC	p.S399F		NM_173354	NP_775490	P57059	SIK1_HUMAN	salt-inducible kinase 1	399					anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7						CTGGAGGACGGACTGCACCAA	0.667													4	29	---	---	---	---	PASS
CYTSA	23384	broad.mit.edu	37	22	24717698	24717698	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24717698T>A	uc002zzw.2	+	5	1057	c.750T>A	c.(748-750)AAT>AAA	p.N250K	CYTSA_uc002zzv.3_Missense_Mutation_p.N250K|CYTSA_uc011ajq.1_Missense_Mutation_p.N250K	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A	250	Potential.				cell cycle|cell division						0						AGGAACAGAATACTGCCATCC	0.433													40	140	---	---	---	---	PASS
MCHR1	2847	broad.mit.edu	37	22	41077528	41077528	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41077528C>A	uc003ayz.2	+	2	1133	c.865C>A	c.(865-867)CCT>ACT	p.P289T	MCHR1_uc003aza.2_Missense_Mutation_p.P178T	NM_005297	NP_005288	Q99705	MCHR1_HUMAN	G protein-coupled receptor 24	289	Helical; Name=5; (Potential).				elevation of cytosolic calcium ion concentration|feeding behavior|generation of precursor metabolites and energy|inhibition of adenylate cyclase activity by G-protein signaling pathway	integral to plasma membrane|nonmotile primary cilium	neuropeptide receptor activity				0						CTTTGCCCTGCCTTTTGTGGT	0.617													19	41	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	44107434	44107434	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44107434A>C	uc003bdy.1	-	10	1167	c.952T>G	c.(952-954)TCT>GCT	p.S318A	EFCAB6_uc003bdz.1_Missense_Mutation_p.S166A|EFCAB6_uc010gzi.1_Missense_Mutation_p.S166A|EFCAB6_uc010gzk.1_RNA|EFCAB6_uc011aqa.1_Missense_Mutation_p.S212A|EFCAB6_uc003bea.1_Missense_Mutation_p.S315A	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	318	EF-hand 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				TAATTAAAAGACACGTAGCCA	0.378													3	19	---	---	---	---	PASS
ARSF	416	broad.mit.edu	37	X	3030588	3030588	+	Silent	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3030588G>A	uc004cre.1	+	11	1985	c.1764G>A	c.(1762-1764)GAG>GAA	p.E588E	ARSF_uc004crf.1_Silent_p.E588E	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	588						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GTCCTAACGAGAAGAGATAAT	0.483													8	12	---	---	---	---	PASS
RBM10	8241	broad.mit.edu	37	X	47041570	47041570	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47041570A>C	uc004dhf.2	+	17	2174	c.1795A>C	c.(1795-1797)AAT>CAT	p.N599H	RBM10_uc004dhg.2_Missense_Mutation_p.N521H|RBM10_uc004dhh.2_Missense_Mutation_p.N598H|RBM10_uc010nhq.2_Missense_Mutation_p.N522H|RBM10_uc004dhi.2_Missense_Mutation_p.N664H	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1	599	Tyr-rich.				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						GTATTACTACAATGCTCAGAG	0.597													8	63	---	---	---	---	PASS
PORCN	64840	broad.mit.edu	37	X	48378882	48378882	+	3'UTR	SNP	T	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48378882T>C	uc010nie.1	+	15					PORCN_uc004djr.1_3'UTR|PORCN_uc004djs.1_3'UTR|PORCN_uc004djt.1_3'UTR|PORCN_uc011mlx.1_3'UTR|PORCN_uc004dju.1_3'UTR|PORCN_uc004djv.1_3'UTR|PORCN_uc004djw.1_3'UTR|EBP_uc004djx.3_5'Flank|EBP_uc004djy.3_5'Flank|EBP_uc004djz.2_5'Flank	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D						Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3						CTGTGGACCCTCATAACCCTC	0.572													11	55	---	---	---	---	PASS
MAGIX	79917	broad.mit.edu	37	X	49020950	49020950	+	Intron	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49020950G>C	uc010nin.1	+						MAGIX_uc010nio.1_Intron|MAGIX_uc004dmt.2_Intron|MAGIX_uc004dmu.2_Intron|MAGIX_uc004dmw.2_5'UTR	NM_024859	NP_079135	Q9H6Y5	MAGIX_HUMAN	MAGI family member, X-linked isoform a												0						GGCAAGACAAGTAGATGAGGC	0.473													5	215	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63445139	63445139	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63445139G>A	uc011mou.1	-	10	1585	c.1517C>T	c.(1516-1518)TCT>TTT	p.S506F	ASB12_uc004dvp.1_Missense_Mutation_p.S122F|ASB12_uc004dvq.1_Missense_Mutation_p.S131F|ASB12_uc004dvr.1_Missense_Mutation_p.S131F	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						ACCACCAGGAGAGGCACCAGC	0.542													4	16	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70340915	70340915	+	Silent	SNP	T	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70340915T>G	uc004dyy.2	+	5	847	c.648T>G	c.(646-648)GGT>GGG	p.G216G	MED12_uc011mpq.1_Silent_p.G216G|MED12_uc004dyz.2_Silent_p.G216G|MED12_uc004dza.2_Silent_p.G63G	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	216					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GGGGCTGTGGTTCCACGATAG	0.542													24	44	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76776904	76776904	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76776904G>C	uc004ecp.3	-	33	7280	c.7048C>G	c.(7048-7050)CTT>GTT	p.L2350V	ATRX_uc004ecq.3_Missense_Mutation_p.L2312V|ATRX_uc004eco.3_Missense_Mutation_p.L2135V	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	2350					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	ATATCCTCAAGAGGTTGAATC	0.363			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						9	57	---	---	---	---	PASS
ARMCX1	51309	broad.mit.edu	37	X	100807941	100807941	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100807941G>A	uc004ehv.2	+	4	399	c.28G>A	c.(28-30)GTG>ATG	p.V10M	ARMCX1_uc004ehw.2_Missense_Mutation_p.V10M	NM_016608	NP_057692	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	10	Helical; (Potential).					integral to membrane	binding			ovary(3)|pancreas(1)	4						AGCTGGCTGCGTGGCCGCTGG	0.582													9	52	---	---	---	---	PASS
ZNF275	10838	broad.mit.edu	37	X	152612888	152612888	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152612888C>T	uc004fhg.1	+	4	922	c.745C>T	c.(745-747)CGC>TGC	p.R249C	ZNF275_uc011mym.1_Missense_Mutation_p.R249C|ZNF275_uc011myn.1_Missense_Mutation_p.R186C			A6NFS0	A6NFS0_HUMAN	SubName: Full=cDNA FLJ16723 fis, clone UTERU3004418, highly similar to Zinc finger protein 275; SubName: Full=Putative uncharacterized protein ZNF275;	249						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TTTCCTGGATCGCCAGGAGCT	0.597													11	76	---	---	---	---	PASS
PLXNB3	5365	broad.mit.edu	37	X	153035386	153035386	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153035386C>T	uc004fii.2	+	7	1795	c.1621C>T	c.(1621-1623)CAG>TAG	p.Q541*	PLXNB3_uc011mzb.1_Nonsense_Mutation_p.Q77*|PLXNB3_uc011mzc.1_Nonsense_Mutation_p.Q223*|PLXNB3_uc010nuk.2_Nonsense_Mutation_p.Q564*|PLXNB3_uc011mzd.1_Nonsense_Mutation_p.Q180*	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	541	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGCCAGGAGCAGGGCCAGGT	0.682													14	18	---	---	---	---	PASS
TKTL1	8277	broad.mit.edu	37	X	153543532	153543532	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153543532C>T	uc004fkg.2	+	7	1060	c.874C>T	c.(874-876)CGG>TGG	p.R292W	TKTL1_uc011mzl.1_Missense_Mutation_p.R286W|TKTL1_uc011mzm.1_Missense_Mutation_p.R88W|TKTL1_uc004fkh.2_Missense_Mutation_p.R236W	NM_012253	NP_036385	P51854	TKTL1_HUMAN	transketolase-like 1 isoform a	292					glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity			ovary(3)|skin(1)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GATAGCTACTCGGAAAGCATG	0.458													21	92	---	---	---	---	PASS
GBP5	115362	broad.mit.edu	37	1	89732536	89732537	+	Intron	DEL	AT	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89732536_89732537delAT	uc001dnc.2	-						GBP5_uc001dnd.2_Intron|GBP5_uc001dne.1_Intron	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN	guanylate-binding protein 5							plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)		AGCTGGGTGAATATATATATAT	0.218													4	4	---	---	---	---	
KIAA1324	57535	broad.mit.edu	37	1	109737054	109737055	+	In_Frame_Ins	INS	-	TGC	TGC			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109737054_109737055insTGC	uc001dwq.2	+	16	2095_2096	c.1959_1960insTGC	c.(1957-1962)insTGC	p.654_655insC	KIAA1324_uc009wex.1_In_Frame_Ins_p.604_605insC|KIAA1324_uc009wey.2_In_Frame_Ins_p.567_568insC|KIAA1324_uc010ovg.1_In_Frame_Ins_p.552_553insC|KIAA1324_uc001dwr.2_In_Frame_Ins_p.304_305insC	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor	654_655	Extracellular (Potential).				macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		TCCACTCTCTGTGCTACAACGA	0.579													68	18	---	---	---	---	
TDRKH	11022	broad.mit.edu	37	1	151743871	151743871	+	Intron	DEL	A	-	-	rs3833528		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151743871delA	uc001eyy.2	-									Q9Y2W6	TDRKH_HUMAN	SubName: Full=cDNA FLJ54003, highly similar to Tudor and KH domain-containing protein;								RNA binding			ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TATACACCTTAACAGAGCTAA	0.458													3	6	---	---	---	---	
CKS1B	1163	broad.mit.edu	37	1	154950727	154950727	+	Intron	DEL	A	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154950727delA	uc001fgb.2	+						CKS1B_uc001fga.2_Intron	NM_001826	NP_001817	P61024	CKS1_HUMAN	CDC28 protein kinase 1B						cell division|cell proliferation|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle	nucleoplasm	cyclin-dependent protein kinase regulator activity|protein binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGATTTTTTTAAAAAAAAACT	0.378													6	3	---	---	---	---	
WDR26	80232	broad.mit.edu	37	1	224599406	224599407	+	Intron	INS	-	T	T	rs67168562		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224599406_224599407insT	uc001hop.3	-						WDR26_uc001hoq.3_Intron|WDR26_uc010pvh.1_5'Flank	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a							cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		ATTTGTAAATCttttttttttt	0.119													4	2	---	---	---	---	
ZNF512	84450	broad.mit.edu	37	2	27824511	27824512	+	Intron	INS	-	TTTTG	TTTTG	rs143396334	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27824511_27824512insTTTTG	uc002rla.2	+						ZNF512_uc010ylv.1_Intron|ZNF512_uc010ylw.1_Intron|ZNF512_uc002rlb.2_Intron|ZNF512_uc010ylx.1_Intron|ZNF512_uc002rlc.2_Intron|ZNF512_uc010yly.1_Intron|ZNF512_uc010ylz.1_Intron	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					tggctaattttttttgttttgt	0.000													4	2	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61546218	61546218	+	Intron	DEL	A	-	-	rs35281857		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61546218delA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			AAAAACTGTCAAAAAAAAAAA	0.299													8	4	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	88091357	88091357	+	Intron	DEL	A	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88091357delA	uc010fhc.1	-						RGPD1_uc002ssm.1_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						accctgtcttaaaaaaaaaaa	0.194													4	3	---	---	---	---	
LONRF2	164832	broad.mit.edu	37	2	100916481	100916482	+	Intron	INS	-	GG	GG	rs139033934	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100916481_100916482insGG	uc002tal.3	-						LONRF2_uc010yvs.1_Intron	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						GGAAAAAAAAAGGGGGGGGCAT	0.337													5	4	---	---	---	---	
ANKAR	150709	broad.mit.edu	37	2	190541843	190541843	+	Intron	DEL	T	-	-	rs67184798		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190541843delT	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqv.1_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ACTTCTTAAATtttttttttt	0.169													4	2	---	---	---	---	
GIGYF2	26058	broad.mit.edu	37	2	233620907	233620908	+	Intron	INS	-	T	T	rs143619456		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233620907_233620908insT	uc002vti.3	+						GIGYF2_uc010zmj.1_Intron|GIGYF2_uc002vtg.2_Intron|GIGYF2_uc002vtj.3_Intron|GIGYF2_uc002vtk.3_Intron|GIGYF2_uc002vth.3_Intron|GIGYF2_uc010zmk.1_Intron	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b						cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		tcctttttctcttttttttttt	0.337													12	7	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10088533	10088536	+	Intron	DEL	AATC	-	-	rs148201951		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10088533_10088536delAATC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		tttttgcattaatcattttaattg	0.005			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52692429	52692429	+	Intron	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52692429delT	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AAACAGCAACttttttttttt	0.144			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								4	2	---	---	---	---	
OSTalpha	200931	broad.mit.edu	37	3	195955100	195955102	+	In_Frame_Del	DEL	CTG	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195955100_195955102delCTG	uc003fwd.2	+	5	678_680	c.477_479delCTG	c.(475-480)CCCTGC>CCC	p.C164del	OSTalpha_uc010iac.1_In_Frame_Del_p.C48del|OSTalpha_uc003fwe.2_In_Frame_Del_p.C31del	NM_152672	NP_689885	Q86UW1	OSTA_HUMAN	organic solute transporter alpha	164	Poly-Cys.					integral to membrane|plasma membrane	transporter activity			ovary(1)	1	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;8.83e-25)|all cancers(36;8.38e-23)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;7.51e-07)|Lung(62;1.06e-06)	GBM - Glioblastoma multiforme(46;0.00202)		ACACAGGCCCctgctgctgctgc	0.532													247	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	64217040	64217041	+	IGR	INS	-	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:64217040_64217041insA								None (None upstream) : TECRL (927144 downstream)																							CACCTTATGTGAAAAAACATCC	0.332													23	10	---	---	---	---	
ZNF131	7690	broad.mit.edu	37	5	43175298	43175301	+	3'UTR	DEL	TGAC	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43175298_43175301delTGAC	uc011cpw.1	+	7					ZNF131_uc003jnj.3_3'UTR|ZNF131_uc003jnk.2_3'UTR|ZNF131_uc003jnn.3_3'UTR|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	NM_003432	NP_003423	P52739	ZN131_HUMAN	zinc finger protein 131							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ATGGGCAGTTTGACTGTCCTTAAT	0.382													10	8	---	---	---	---	
RBM27	54439	broad.mit.edu	37	5	145647320	145647320	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145647320delA	uc003lnz.3	+	15	2606	c.2440delA	c.(2440-2442)AAAfs	p.K814fs	RBM27_uc003lny.2_Frame_Shift_Del_p.K759fs	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	814	Potential.				mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGAAGTGCTTAAAAAAAAACA	0.348													26	20	---	---	---	---	
TMEM14B	81853	broad.mit.edu	37	6	10756863	10756864	+	3'UTR	INS	-	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10756863_10756864insA	uc003mzk.3	+	6					SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jor.2_3'UTR|TMEM14B_uc010jos.1_Intron	NM_030969	NP_112231	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B isoform a							integral to membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				ACATTTTACCTAAAAAAAAAAA	0.366													5	3	---	---	---	---	
HLA-A	3105	broad.mit.edu	37	6	29911457	29911458	+	Intron	INS	-	T	T	rs140855897	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911457_29911458insT	uc003nol.2	+						HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc010jrq.2_Intron|HLA-A_uc003nok.2_Intron|HLA-A_uc003non.2_Intron|HLA-A_uc003noo.2_Intron|HLA-A_uc010jrr.2_Intron|HLA-A_uc003nom.2_Intron|HLA-A_uc010klp.2_Intron|HLA-A_uc011dmc.1_Intron|HLA-A_uc011dmd.1_Intron	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						ATCCTCCTGGGTTCCAGATCCT	0.545									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			1	7	---	---	---	---	
SMAP1	60682	broad.mit.edu	37	6	71508370	71508370	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71508370delA	uc003pfr.2	+	6	754	c.506delA	c.(505-507)GAAfs	p.E169fs	SMAP1_uc011dxy.1_RNA|SMAP1_uc003pfs.2_Frame_Shift_Del_p.E142fs|SMAP1_uc010kao.2_Frame_Shift_Del_p.E142fs|SMAP1_uc010kap.2_Frame_Shift_Del_p.E159fs	NM_001044305	NP_001037770	Q8IYB5	SMAP1_HUMAN	stromal membrane-associated GTPase-activating	169					regulation of ARF GTPase activity	plasma membrane	ARF GTPase activator activity|zinc ion binding				0						aaagaaaaggaaaaaaaaaag	0.234													3	3	---	---	---	---	
GPRC6A	222545	broad.mit.edu	37	6	117117012	117117013	+	Intron	INS	-	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117117012_117117013insA	uc003pxj.1	-						GPRC6A_uc003pxk.1_Intron|GPRC6A_uc003pxl.1_Intron	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,						response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TATTAAAAGTGAAAAAAAAAAT	0.282													4	2	---	---	---	---	
ECT2L	345930	broad.mit.edu	37	6	139164379	139164379	+	Intron	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139164379delT	uc003qif.1	+						ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						GTAAGTAGCATTTTAAACCTT	0.388													17	24	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152527300	152527301	+	Splice_Site	INS	-	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152527300_152527301insA	uc010kiw.2	-	126	23621	c.23019_splice	c.e126+1	p.K7673_splice	SYNE1_uc010kiv.2_Splice_Site_p.K2197_splice|SYNE1_uc003qos.3_Splice_Site_p.K2197_splice|SYNE1_uc003qot.3_Splice_Site_p.K7602_splice|SYNE1_uc003qou.3_Splice_Site_p.K7673_splice|SYNE1_uc003qor.3_Splice_Site_p.K573_splice	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TAACTGAACTTACTTTCAACAA	0.396										HNSCC(10;0.0054)			14	18	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5430010	5430011	+	Intron	DEL	AG	-	-	rs11295332		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5430010_5430011delAG	uc003soi.3	-						TNRC18_uc010ksx.1_Intron|TNRC18_uc003sok.1_Frame_Shift_Del_p.L124fs	NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aaaaaaaaaaaGCCAGCATCCT	0.332													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57929445	57929445	+	IGR	DEL	A	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57929445delA								ZNF716 (396180 upstream) : None (None downstream)																							ACAAGAGACTAGGGGGATAAG	0.403													4	2	---	---	---	---	
ANKIB1	54467	broad.mit.edu	37	7	92000723	92000724	+	Intron	INS	-	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92000723_92000724insT	uc003ulw.2	+						ANKIB1_uc010lew.1_5'Flank	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1								protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGTGTGGAGGGTTTTTTTTTCC	0.361													4	2	---	---	---	---	
FEZF1	389549	broad.mit.edu	37	7	121943607	121943610	+	Intron	DEL	GGAG	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121943607_121943610delGGAG	uc003vkd.2	-						FEZF1_uc003vkc.2_Intron|uc010lko.1_5'Flank|uc003vkf.1_5'Flank	NM_001024613	NP_001019784	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1 isoform 1						cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)	3						agggaaggaaggagggaaggaggg	0.108													12	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	145280423	145280423	+	IGR	DEL	G	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145280423delG								TPK1 (747277 upstream) : CNTNAP2 (533030 downstream)																							AAACGAGCTTGAACGGGGAAT	0.393													34	11	---	---	---	---	
PXDNL	137902	broad.mit.edu	37	8	52359454	52359455	+	Intron	INS	-	TA	TA	rs151149131	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52359454_52359455insTA	uc003xqu.3	-							NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GATCATATGACTATATATATAT	0.287													4	2	---	---	---	---	
ENPP2	5168	broad.mit.edu	37	8	120613133	120613134	+	Intron	INS	-	TT	TT			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120613133_120613134insTT	uc003yot.1	-						ENPP2_uc003yos.1_Intron|ENPP2_uc010mdd.1_Intron	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein						cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GCATGAAAAACTTTTTTTTTTT	0.307													3	3	---	---	---	---	
MLLT3	4300	broad.mit.edu	37	9	20346377	20346378	+	3'UTR	INS	-	A	A			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20346377_20346378insA	uc003zoe.2	-	11					MLLT3_uc011lne.1_3'UTR|MLLT3_uc011lnf.1_3'UTR	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		AAATCACAACCaaaaaaaaaaa	0.282			T	MLL	ALL								153	23	---	---	---	---	
MLLT3	4300	broad.mit.edu	37	9	20413952	20413952	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20413952delT	uc003zoe.2	-	5	1151	c.892delA	c.(892-894)AGGfs	p.R298fs	MLLT3_uc011lne.1_Frame_Shift_Del_p.R266fs|MLLT3_uc011lnf.1_Frame_Shift_Del_p.R295fs|MLLT3_uc003zof.2_Frame_Shift_Del_p.R99fs	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	298	Nuclear localization signal (Potential).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		CTCTTTTTCCTTTTTTTGGCT	0.393			T	MLL	ALL								970	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90460182	90460183	+	IGR	INS	-	GACT	GACT			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90460182_90460183insGACT								CTSL3 (58383 upstream) : C9orf79 (37558 downstream)																							AGAATCTGGTAGCTCTGGTCCT	0.480													3	3	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137709530	137709531	+	Intron	DEL	CA	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137709530_137709531delCA	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCCTGCAGGCCACACACACACA	0.688													4	2	---	---	---	---	
AKR1C1	1645	broad.mit.edu	37	10	5008988	5008991	+	Intron	DEL	AAGA	-	-	rs10562538		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5008988_5008991delAAGA	uc001iho.2	+						AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc009xhx.2_Intron|AKR1C1_uc001ihq.2_Intron	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	GCATCACAAGAAGAGAGAGAATAA	0.299													5	3	---	---	---	---	
CREM	1390	broad.mit.edu	37	10	35437572	35437573	+	Intron	INS	-	TAAT	TAAT	rs146013089	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35437572_35437573insTAAT	uc001iyb.2	+						CREM_uc001ixx.2_Intron|CREM_uc001ixy.2_Intron|CREM_uc001ixz.2_Intron|CREM_uc001iya.2_Intron|CREM_uc001iyc.2_Intron|CREM_uc001iyd.2_Intron|CREM_uc001iye.2_Intron	NM_181571	NP_853549	Q03060	CREM_HUMAN	cAMP responsive element modulator isoform a						cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GATACGTGTTGTAATTAGCCTT	0.391													3	3	---	---	---	---	
COL17A1	1308	broad.mit.edu	37	10	105800328	105800329	+	Intron	INS	-	TGGA	TGGA			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105800328_105800329insTGGA	uc001kxr.2	-							NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen						cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		gggcgggtgggtggatggatgg	0.010													5	4	---	---	---	---	
KRTAP5-5	439915	broad.mit.edu	37	11	1651191	1651199	+	In_Frame_Del	DEL	GGCTGTGGA	-	-	rs144216147		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651191_1651199delGGCTGTGGA	uc001lty.2	+	1	159_167	c.121_129delGGCTGTGGA	c.(121-129)GGCTGTGGAdel	p.GCG47del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47_49						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggctccggctgtggaggctgtgggg	0.129													50	11	---	---	---	---	
STIM1	6786	broad.mit.edu	37	11	3982408	3982409	+	Intron	INS	-	G	G	rs142903419	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3982408_3982409insG	uc001lyv.2	+						STIM1_uc009yef.2_Intron	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor						activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		tttatagagatggggtctcact	0.000													4	4	---	---	---	---	
WEE1	7465	broad.mit.edu	37	11	9597610	9597612	+	In_Frame_Del	DEL	GTC	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9597610_9597612delGTC	uc001mhs.2	+	2	1005_1007	c.752_754delGTC	c.(751-756)TGTCGT>TGT	p.R254del	WEE1_uc001mht.2_In_Frame_Del_p.R40del|WEE1_uc001mhu.2_In_Frame_Del_p.R40del	NM_003390	NP_003381	P30291	WEE1_HUMAN	WEE1 tyrosine kinase isoform 1	254					blood coagulation|cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|S phase of mitotic cell cycle	nucleoplasm	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	5				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		TCAGGACAGTGTCGTCGTAGAAA	0.360													67	24	---	---	---	---	
ARHGEF12	23365	broad.mit.edu	37	11	120348771	120348772	+	Intron	INS	-	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120348771_120348772insT	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TTTATGGATTGTTTTTTTTTTT	0.322			T	MLL	AML								5	3	---	---	---	---	
PRMT8	56341	broad.mit.edu	37	12	3497200	3497201	+	Intron	INS	-	TCCTTCTTTCCTTCCT	TCCTTCTTTCCTTCCT	rs72227513		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3497200_3497201insTCCTTCTTTCCTTCCT	uc009zed.2	+							NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4						regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			cccttcctttctccttctttcc	0.000													3	3	---	---	---	---	
CHD4	1108	broad.mit.edu	37	12	6690171	6690174	+	Intron	DEL	AAAC	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6690171_6690174delAAAC	uc001qpo.2	-						CHD4_uc001qpn.2_Intron|CHD4_uc001qpp.2_Intron|uc001qpq.1_Intron	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						cactgtctcaaaacaaacaaacaa	0.191													523	8	---	---	---	---	
C1S	716	broad.mit.edu	37	12	7175097	7175098	+	Intron	DEL	AG	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7175097_7175098delAG	uc001qsj.2	+						C1S_uc001qsk.2_Intron|C1S_uc001qsl.2_Intron|C1S_uc009zfr.2_Intron|C1S_uc009zfs.2_Intron	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent						complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	CTACTGGAGAAGAGAGAGAGAG	0.460													250	7	---	---	---	---	
DDX12	440081	broad.mit.edu	37	12	9571386	9571386	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9571386delA	uc010sgs.1	-	26	2871	c.2676delT	c.(2674-2676)ATTfs	p.I892fs	DDX12_uc001qvx.3_Frame_Shift_Del_p.I114fs|DDX12_uc001qvy.1_3'UTR	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						GCACAGCAGCAATGGCGGGGC	0.612													146	14	---	---	---	---	
SYT10	341359	broad.mit.edu	37	12	33579285	33579286	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33579285_33579286insT	uc001rll.1	-	2	593_594	c.296_297insA	c.(295-297)AGCfs	p.S99fs	SYT10_uc009zju.1_5'UTR	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	99	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					CACTTGAAATGCTCTGTGGAAG	0.416													80	11	---	---	---	---	
TMPO	7112	broad.mit.edu	37	12	98925326	98925326	+	Intron	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98925326delT	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						TTATATGGTATTTTTTTTTTT	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	113492284	113492285	+	IGR	INS	-	A	A	rs34462445		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113492284_113492285insA								OAS2 (42757 upstream) : DTX1 (3377 downstream)																							CTCAATGGACCAAAAAAAAAAA	0.381													6	5	---	---	---	---	
LOC374491	374491	broad.mit.edu	37	13	25157747	25157748	+	Intron	INS	-	T	T	rs144668552	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25157747_25157748insT	uc001upm.2	+						LOC374491_uc001upn.2_Intron|LOC374491_uc001upo.2_5'Flank					Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0						AAAATGGGAGGTTTTTTTAGGG	0.411													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	25481201	25481201	+	5'Flank	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25481201delT	uc001zae.2	+						SNORD115-11_uc001zad.1_5'Flank|SNORD115-37_uc001zaf.1_5'Flank					Homo sapiens clone Rt-16 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		CCACTGGAAGTTTTTTTTGCG	0.512													884	9	---	---	---	---	
PRC1	9055	broad.mit.edu	37	15	91513733	91513734	+	In_Frame_Ins	INS	-	GTA	GTA			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91513733_91513734insGTA	uc002bqm.2	-	12	1629_1630	c.1472_1473insTAC	c.(1471-1473)ACC>ACTACC	p.491_491T>TT	PRC1_uc002bqn.2_In_Frame_Ins_p.491_491T>TT|PRC1_uc002bqo.2_In_Frame_Ins_p.491_491T>TT|PRC1_uc010uqs.1_In_Frame_Ins_p.450_450T>TT	NM_003981	NP_003972	O43663	PRC1_HUMAN	protein regulator of cytokinesis 1 isoform 1	491	Unstructured, Arg/Lys rich.				cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding			ovary(1)|skin(1)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)					TGGACATGGTGGTAGTGTTCAG	0.515													61	68	---	---	---	---	
ATF7IP2	80063	broad.mit.edu	37	16	10532277	10532277	+	Intron	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10532277delT	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						aatttttgggttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16457708	16457709	+	IGR	DEL	GT	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16457708_16457709delGT								LOC339047 (13271 upstream) : XYLT1 (738474 downstream)																							GAGGCTGTGGGTGTGAGTGACG	0.668													7	4	---	---	---	---	
ERN2	10595	broad.mit.edu	37	16	23713313	23713314	+	Intron	INS	-	AAA	AAA	rs147321051	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23713313_23713314insAAA	uc002dma.3	-						ERN2_uc010bxp.2_Intron|ERN2_uc010bxq.1_Intron	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2						apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		acaacaacaacaaGTTGTGTTG	0.238													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	24844951	24844962	+	IGR	DEL	ATGGACGGATGC	-	-	rs3050340	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24844951_24844962delATGGACGGATGC								TNRC6A (7406 upstream) : SLC5A11 (12354 downstream)																							ggatggatggatggacggatgcatggatggac	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	31186173	31186173	+	IGR	DEL	C	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31186173delC								PRSS36 (24758 upstream) : FUS (5280 downstream)																							GGAGGACCCTCCCATGGCTCC	0.443													4	2	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8395967	8395967	+	Intron	DEL	G	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8395967delG	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						ttttttttttgctttcccttt	0.284													4	3	---	---	---	---	
MYH4	4622	broad.mit.edu	37	17	10367971	10367974	+	Intron	DEL	AGAA	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10367971_10367974delAGAA	uc002gmn.2	-						uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TGATCAAAACAGAAAGAAAGTAAC	0.358													39	12	---	---	---	---	
RPL23	9349	broad.mit.edu	37	17	37006922	37006923	+	Intron	DEL	TT	-	-	rs34258429		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37006922_37006923delTT	uc002hqx.1	-						RPL23_uc002hqw.1_Intron|RPL23_uc002hqy.1_3'UTR	NM_000978	NP_000969	P62829	RL23_HUMAN	ribosomal protein L23						endocrine pancreas development|ribosomal protein import into nucleus|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0						catgcccagatttttttttttt	0.129													1	5	---	---	---	---	
NPEPPS	9520	broad.mit.edu	37	17	45623439	45623440	+	Intron	INS	-	GAGAGA	GAGAGA	rs148357525	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45623439_45623440insGAGAGA	uc002ilr.3	+						NPEPPS_uc010wkt.1_Intron|NPEPPS_uc010wku.1_Intron|NPEPPS_uc010dba.1_Intron	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						tgtgtgtgtgtgagagagagag	0.223													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	58050857	58050857	+	Intron	DEL	G	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58050857delG	uc002iye.1	+											Homo sapiens cDNA FLJ40339 fis, clone TESTI2032079.																		TTTTTTTTTTGGCAGTTTTTA	0.224													9	4	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59465981	59465981	+	Intron	DEL	A	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59465981delA	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Frame_Shift_Del_p.K884fs|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron|BCAS3_uc002izd.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TTCAAAAGGGAAAAAAAAAGG	0.443													4	2	---	---	---	---	
TTYH2	94015	broad.mit.edu	37	17	72218928	72218928	+	Intron	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72218928delT	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron	NM_032646	NP_116035	Q9BSA4	TTYH2_HUMAN	tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4						ATGTTGTCCCTTTTTTTTTTT	0.522													4	2	---	---	---	---	
TMC6	11322	broad.mit.edu	37	17	76127849	76127850	+	Intron	INS	-	G	G	rs146880338	by1000genomes	TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76127849_76127850insG	uc002jul.1	-						TMC6_uc010dhf.1_5'Flank|TMC6_uc002juk.2_5'Flank|TMC6_uc010dhg.1_5'Flank|TMC6_uc002jun.3_5'Flank|TMC6_uc002juo.2_5'Flank|TMC6_uc010wtq.1_5'Flank|TMC8_uc010dhh.1_Intron|TMC8_uc002jup.2_Intron|TMC8_uc002juq.2_Intron|TMC8_uc010wtr.1_5'Flank	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6							endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AGACGGTGCGTGGGGGGGGTGC	0.743									Epidermodysplasia_Verruciformis_Familial_Clustering_of				4	2	---	---	---	---	
ZNF534	147658	broad.mit.edu	37	19	52955324	52955324	+	3'UTR	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52955324delT	uc002pzj.1	+	5					ZNF534_uc010epo.1_3'UTR|ZNF578_uc002pzm.2_5'Flank|ZNF578_uc002pzn.2_5'Flank|ZNF578_uc002pzp.3_5'Flank|ZNF578_uc002pzo.1_5'Flank|ZNF578_uc010epp.1_5'Flank			Q76KX8	ZN534_HUMAN	SubName: Full=Putative uncharacterized protein;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAGTACTGCATTTTTTTTTTA	0.279													4	3	---	---	---	---	
LILRB5	10990	broad.mit.edu	37	19	54758539	54758540	+	Intron	INS	-	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54758539_54758540insG	uc002qex.2	-						LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Intron|LILRB5_uc002qey.2_Intron|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_Frame_Shift_Ins_p.P328fs	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGAGCTCTCCTGGGGGCAGGGC	0.668													35	7	---	---	---	---	
ZNF587	84914	broad.mit.edu	37	19	58367778	58367778	+	Intron	DEL	T	-	-	rs113480202		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58367778delT	uc002qql.2	+						ZNF587_uc002qqb.2_Intron|ZNF587_uc010yhh.1_Intron|ZNF587_uc002qqi.1_Intron|ZNF587_uc002qqj.1_Intron|ZNF814_uc002qqk.2_Intron|ZNF587_uc010yhk.1_Intron	NM_032828	NP_116217	Q96SQ5	ZN587_HUMAN	zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		TCCTCTCCTGttttttttttt	0.244													2	4	---	---	---	---	
C20orf7	79133	broad.mit.edu	37	20	13769224	13769224	+	Intron	DEL	T	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13769224delT	uc002wom.2	+						C20orf7_uc002wol.1_Intron|C20orf7_uc002won.2_Intron|C20orf7_uc002woo.2_Intron	NM_024120	NP_077025	Q5TEU4	CT007_HUMAN	hypothetical protein LOC79133 isoform 1						mitochondrial respiratory chain complex I assembly	extrinsic to mitochondrial inner membrane	methyltransferase activity				0		Myeloproliferative disorder(85;0.00878)				CCTCTGTGTCTTTTTTTTTAG	0.313													244	14	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31302451	31302452	+	3'UTR	INS	-	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31302451_31302452insT	uc003aiy.1	+	14					OSBP2_uc011ala.1_3'UTR|OSBP2_uc010gwc.1_3'UTR|OSBP2_uc011alb.1_3'UTR|OSBP2_uc003aiz.1_3'UTR|OSBP2_uc003aja.1_3'UTR|OSBP2_uc011alc.1_3'UTR|OSBP2_uc003ajb.2_3'UTR|OSBP2_uc011ald.1_3'UTR|OSBP2_uc010gwd.1_3'UTR	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						TTCCTTTCCTATTTTTTTTTTC	0.550													5	3	---	---	---	---	
PPP2R3B	28227	broad.mit.edu	37	X	299280	299280	+	Intron	DEL	C	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:299280delC	uc004cpg.2	-						PPP2R3B_uc004cpf.2_Intron	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				cacccgtcctccccactcacc	0.363													4	2	---	---	---	---	
GNL3L	54552	broad.mit.edu	37	X	54585146	54585147	+	Intron	INS	-	T	T			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54585146_54585147insT	uc004dth.1	+						GNL3L_uc004dti.2_Intron	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3						ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						ATCTTTTTTTGTTTTTTTTTTC	0.262													4	3	---	---	---	---	
OPHN1	4983	broad.mit.edu	37	X	67331931	67331932	+	Intron	DEL	AG	-	-	rs59924749		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67331931_67331932delAG	uc004dww.3	-						OPHN1_uc011mpg.1_Intron	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1						axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						acacacacacagagagagattc	0.074													3	3	---	---	---	---	
STAG2	10735	broad.mit.edu	37	X	123159642	123159642	+	Intron	DEL	A	-	-			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123159642delA	uc004etz.3	+						STAG2_uc004eua.2_Intron|STAG2_uc004eub.2_Intron|STAG2_uc004euc.2_Intron|STAG2_uc004eud.2_Intron|STAG2_uc004eue.2_Intron	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TTAGAAACTCAATATAAATTT	0.294													78	27	---	---	---	---	
PNMA3	29944	broad.mit.edu	37	X	152225996	152225997	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152225996_152225997insG	uc004fhc.2	+	2	920_921	c.584_585insG	c.(583-585)CAGfs	p.Q195fs	PNMA5_uc004fha.3_5'Flank|PNMA3_uc004fhd.2_5'Flank	NM_013364	NP_037496	Q9UL41	PNMA3_HUMAN	paraneoplastic cancer-testis-brain antigen	195					apoptosis	nucleolus	nucleic acid binding|zinc ion binding			skin(2)|large_intestine(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					cagatgtggcaggtgcccgagg	0.000													192	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	153124950	153124950	+	IGR	DEL	G	-	-	rs113386245		TCGA-BT-A20V-01A-11D-A14W-08	TCGA-BT-A20V-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153124950delG								PDZD4 (28947 upstream) : L1CAM (2024 downstream)																							aaggaaggaagggaaggaagg	0.194													1	5	---	---	---	---	
