Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TAS1R1	80835	broad.mit.edu	37	1	6639446	6639446	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6639446C>G	uc001ant.2	+	6	2328	c.2328C>G	c.(2326-2328)TTC>TTG	p.F776L	TAS1R1_uc001anu.2_Missense_Mutation_p.F522L|TAS1R1_uc001anv.2_Missense_Mutation_p.S308C|TAS1R1_uc001anw.2_3'UTR|ZBTB48_uc009vmc.1_5'Flank|ZBTB48_uc001anx.2_5'Flank|ZBTB48_uc009vmd.1_5'Flank	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	776	Helical; Name=6; (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GGATCGCCTTCTTCACCACGG	0.577													23	78	---	---	---	---	PASS
DNAJC11	55735	broad.mit.edu	37	1	6697333	6697333	+	Silent	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6697333C>A	uc001aof.2	-	14	1555	c.1449G>T	c.(1447-1449)GTG>GTT	p.V483V	DNAJC11_uc010nzt.1_Intron|DNAJC11_uc001aog.2_Silent_p.V431V|DNAJC11_uc010nzu.1_Silent_p.V393V	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	483					protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CAATCACCTTCACCTTCTCGC	0.562													91	117	---	---	---	---	PASS
FBXO42	54455	broad.mit.edu	37	1	16577092	16577092	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16577092C>G	uc001ayg.2	-	10					FBXO42_uc001aye.3_3'UTR|FBXO42_uc001ayf.2_3'UTR	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42											upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		TTTCCCAATTCTCAGTCCAAA	0.368													66	62	---	---	---	---	PASS
FBXO42	54455	broad.mit.edu	37	1	16577222	16577222	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16577222C>G	uc001ayg.2	-	10	2313	c.2097G>C	c.(2095-2097)CAG>CAC	p.Q699H	FBXO42_uc001aye.3_Missense_Mutation_p.Q417H|FBXO42_uc001ayf.2_Missense_Mutation_p.Q606H	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42	699										upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		ACTTCACATTCTGTTTCTTGT	0.428													143	177	---	---	---	---	PASS
FBXO42	54455	broad.mit.edu	37	1	16577397	16577397	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16577397C>T	uc001ayg.2	-	10	2138	c.1922G>A	c.(1921-1923)TGC>TAC	p.C641Y	FBXO42_uc001aye.3_Missense_Mutation_p.C359Y|FBXO42_uc001ayf.2_Missense_Mutation_p.C548Y	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42	641										upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		CATGGGCTTGCAGTTCATACT	0.512													165	188	---	---	---	---	PASS
ZBTB40	9923	broad.mit.edu	37	1	22828779	22828779	+	Intron	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22828779C>G	uc001bft.2	+						ZBTB40_uc001bfu.2_Intron|ZBTB40_uc009vqi.1_Intron|ZBTB40_uc001bfv.1_5'UTR	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40						bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GTCTCTAACTCTTTCTCCCCC	0.413													4	14	---	---	---	---	PASS
ZBTB40	9923	broad.mit.edu	37	1	22828819	22828819	+	Missense_Mutation	SNP	C	G	G	rs147907060	byFrequency	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22828819C>G	uc001bft.2	+	6	1563	c.1052C>G	c.(1051-1053)TCT>TGT	p.S351C	ZBTB40_uc001bfu.2_Missense_Mutation_p.S351C|ZBTB40_uc009vqi.1_Intron|ZBTB40_uc001bfv.1_5'UTR	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	351					bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		AAGACCTTGTCTGTTCTGTTA	0.453													11	17	---	---	---	---	PASS
ZBTB40	9923	broad.mit.edu	37	1	22828866	22828866	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22828866C>T	uc001bft.2	+	6	1610	c.1099C>T	c.(1099-1101)CAG>TAG	p.Q367*	ZBTB40_uc001bfu.2_Nonsense_Mutation_p.Q367*|ZBTB40_uc009vqi.1_Intron|ZBTB40_uc001bfv.1_5'UTR	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	367					bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GTGTGTAACACAGCTGAGACC	0.488													20	20	---	---	---	---	PASS
DHDDS	79947	broad.mit.edu	37	1	26772917	26772917	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26772917A>T	uc001bml.2	+	5	555	c.434A>T	c.(433-435)TAC>TTC	p.Y145F	DHDDS_uc001bmk.2_Missense_Mutation_p.Y145F|DHDDS_uc001bmm.2_Missense_Mutation_p.Y52F|DHDDS_uc001bmn.2_Intron|DHDDS_uc010ofd.1_Missense_Mutation_p.Y145F	NM_205861	NP_995583	Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase isoform b	145							protein binding|transferase activity, transferring alkyl or aryl (other than methyl) groups			breast(3)	3		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		ACGAAGAACTACAACAAGTAA	0.512													69	90	---	---	---	---	PASS
EPB41	2035	broad.mit.edu	37	1	29438918	29438918	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29438918G>C	uc001brm.1	+	18	2461	c.2454G>C	c.(2452-2454)AAG>AAC	p.K818N	EPB41_uc001brg.1_Missense_Mutation_p.K595N|EPB41_uc001brh.1_Missense_Mutation_p.K542N|EPB41_uc001bri.1_Missense_Mutation_p.K729N|EPB41_uc001brj.1_Missense_Mutation_p.K555N|EPB41_uc001brl.1_Missense_Mutation_p.K785N|EPB41_uc009vtl.1_Missense_Mutation_p.K512N|EPB41_uc009vtm.1_Missense_Mutation_p.K397N|EPB41_uc009vtn.1_RNA	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	818	Carboxyl-terminal (CTD).				blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GTATTGAAAAGAGAATTGTGA	0.428													31	106	---	---	---	---	PASS
HMGB4	127540	broad.mit.edu	37	1	34329950	34329950	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34329950C>G	uc001bxp.2	+	2	1901	c.158C>G	c.(157-159)TCA>TGA	p.S53*	CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxn.1_Intron|HMGB4_uc001bxq.2_5'UTR	NM_145205	NP_660206	Q8WW32	HMGB4_HUMAN	HMG2 like isoform 1	53						nucleus	DNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AGATCCATCTCAAAGCATGAA	0.413													24	115	---	---	---	---	PASS
KDM4A	9682	broad.mit.edu	37	1	44169940	44169940	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44169940G>A	uc001cjx.2	+	22	3260	c.3094G>A	c.(3094-3096)GAG>AAG	p.E1032K	uc001cjy.2_Intron|ST3GAL3_uc009vwu.1_5'Flank|KDM4A_uc010oki.1_3'UTR	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A	1032					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						GATTTTCACAGAGAAAGAGGT	0.438													144	172	---	---	---	---	PASS
ELAVL4	1996	broad.mit.edu	37	1	50610766	50610766	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50610766C>T	uc001csb.2	+	2	415	c.147C>T	c.(145-147)ATC>ATT	p.I49I	ELAVL4_uc001cry.3_Silent_p.I52I|ELAVL4_uc001crz.3_Silent_p.I49I|ELAVL4_uc001csa.3_Silent_p.I66I|ELAVL4_uc001csc.3_Silent_p.I49I|ELAVL4_uc009vyu.2_Silent_p.I54I|ELAVL4_uc010omz.1_Silent_p.I54I	NM_021952	NP_068771	P26378	ELAV4_HUMAN	ELAV-like 4 isoform 1	49	RRM 1.				mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2						CCAACCTCATCGTCAACTATT	0.448													8	31	---	---	---	---	PASS
ORC1L	4998	broad.mit.edu	37	1	52863536	52863536	+	Splice_Site	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52863536C>T	uc001ctt.2	-	4	443	c.224_splice	c.e4-1	p.D75_splice	ORC1L_uc010oni.1_Splice_Site_p.D75_splice|ORC1L_uc001ctu.2_Splice_Site_p.D75_splice|ORC1L_uc009vzd.2_Splice_Site	NM_004153	NP_004144	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1						cell cycle checkpoint|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nuclear origin of replication recognition complex|nucleolus|nucleoplasm|plasma membrane	ATP binding|DNA binding|nucleoside-triphosphatase activity|protein binding				0						GGATCAGAGTCTAGAAAGAAT	0.363													34	98	---	---	---	---	PASS
GLIS1	148979	broad.mit.edu	37	1	54060249	54060249	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54060249C>T	uc001cvr.1	-	3	894	c.327G>A	c.(325-327)CTG>CTA	p.L109L		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	109					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						GATCTCCCGTCAGAGGGGGGC	0.657													19	56	---	---	---	---	PASS
PCSK9	255738	broad.mit.edu	37	1	55523842	55523842	+	Silent	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55523842C>G	uc001cyf.1	+	8	1605	c.1314C>G	c.(1312-1314)CCC>CCG	p.P438P	PCSK9_uc010oom.1_Intron	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	438					cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						TACTGACCCCCAACCTGGTGG	0.627													15	71	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94476481	94476481	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94476481C>T	uc001dqh.2	-	40	5693	c.5589G>A	c.(5587-5589)GAG>GAA	p.E1863E	ABCA4_uc001dqi.1_5'UTR|ABCA4_uc009wdp.1_Silent_p.E131E	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1863					phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CAGAGTGCTCCTCACCTGGGC	0.592													8	30	---	---	---	---	PASS
ARHGAP29	9411	broad.mit.edu	37	1	94674863	94674863	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94674863G>A	uc001dqj.3	-	4	753	c.384C>T	c.(382-384)CTC>CTT	p.L128L	ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dql.2_Silent_p.L128L	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	128					Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CTTCCTGGAAGAGATCGTTTT	0.323													15	31	---	---	---	---	PASS
AGL	178	broad.mit.edu	37	1	100379088	100379088	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100379088G>C	uc001dsi.1	+	30	4355	c.3955G>C	c.(3955-3957)GCT>CCT	p.A1319P	AGL_uc001dsj.1_Missense_Mutation_p.A1319P|AGL_uc001dsk.1_Missense_Mutation_p.A1319P|AGL_uc001dsl.1_Missense_Mutation_p.A1319P|AGL_uc001dsm.1_Missense_Mutation_p.A1303P|AGL_uc001dsn.1_Missense_Mutation_p.A1302P	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	1319	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TTCAGGAAAGGCTATAAAGGT	0.294													8	25	---	---	---	---	PASS
AMY2A	279	broad.mit.edu	37	1	104160582	104160582	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104160582C>T	uc001dut.2	+	2	239	c.175C>T	c.(175-177)CCA>TCA	p.P59S	AMY2A_uc010ouq.1_Missense_Mutation_p.P59S	NM_000699	NP_000690	P04746	AMYP_HUMAN	pancreatic amylase alpha 2A precursor	59					carbohydrate catabolic process|polysaccharide digestion	extracellular space	alpha-amylase activity|calcium ion binding|chloride ion binding			ovary(1)|skin(1)	2		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Bentiromide(DB00522)|Icodextrin(DB00702)|Miglitol(DB00491)|Pancrelipase(DB00085)	GTAGGTCTCTCCACCAAATGA	0.333													10	45	---	---	---	---	PASS
PTGFRN	5738	broad.mit.edu	37	1	117529679	117529679	+	3'UTR	SNP	A	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117529679A>C	uc001egv.1	+	9						NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator							endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		AGTGTGTTACACTAAAAACCA	0.498													10	28	---	---	---	---	PASS
NUDT17	200035	broad.mit.edu	37	1	145586854	145586854	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145586854G>A	uc001eoe.2	-	7	842	c.834C>T	c.(832-834)GTC>GTT	p.V278V	NBPF10_uc001emp.3_Intron	NM_001012758	NP_001012776	P0C025	NUD17_HUMAN	nudix (nucleoside diphosphate linked moiety	278							hydrolase activity|metal ion binding				0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTCCAGTGCTGACTCTCTCTT	0.547													294	465	---	---	---	---	PASS
SV2A	9900	broad.mit.edu	37	1	149885327	149885327	+	Silent	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149885327G>T	uc001etg.2	-	2	557	c.66C>A	c.(64-66)GTC>GTA	p.V22V	SV2A_uc001eth.2_Silent_p.V22V	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2	22	Cytoplasmic (Potential).|Interaction with SYT1 (By similarity).				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CATGCTTTTTGACTTCCTTAG	0.552													130	181	---	---	---	---	PASS
RPRD2	23248	broad.mit.edu	37	1	150443912	150443912	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150443912G>T	uc009wlr.2	+	11	2689	c.2488G>T	c.(2488-2490)GAT>TAT	p.D830Y	RPRD2_uc010pcc.1_Missense_Mutation_p.D804Y|RPRD2_uc001eup.3_Missense_Mutation_p.D804Y	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing	830	Ser-rich.						protein binding			ovary(1)	1						TTTCCAAGAAGATGAGGATTA	0.448													4	125	---	---	---	---	PASS
SCNM1	79005	broad.mit.edu	37	1	151138954	151138954	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151138954G>A	uc001ewz.2	+	2	171	c.59G>A	c.(58-60)AGA>AAA	p.R20K	LYSMD1_uc001ewy.2_5'Flank|LYSMD1_uc010pcr.1_5'Flank|SCNM1_uc010pcs.1_Missense_Mutation_p.R20K|SCNM1_uc009wmn.2_RNA	NM_024041	NP_076946	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1	20	Bipartite nuclear localization signal (Potential).				mRNA processing|RNA splicing	nucleus	metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGAAAAGAAGAGTCGGGGAC	0.527													9	61	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152188121	152188121	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152188121G>T	uc001ezt.1	-	3	6060	c.5984C>A	c.(5983-5985)TCT>TAT	p.S1995Y		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1995	22.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTGAGCGAGACTCTCGGTG	0.572													22	404	---	---	---	---	PASS
GATAD2B	57459	broad.mit.edu	37	1	153800712	153800712	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800712C>T	uc001fdb.3	-	2	356	c.112G>A	c.(112-114)GAG>AAG	p.E38K		NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	38						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCCATGGCCTCATGCCCCTCC	0.502													200	330	---	---	---	---	PASS
DCST1	149095	broad.mit.edu	37	1	155020372	155020372	+	Silent	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155020372C>G	uc001fgn.1	+	15	1818	c.1722C>G	c.(1720-1722)CTC>CTG	p.L574L	DCST1_uc010pes.1_Silent_p.L549L|uc001fgo.2_Intron	NM_152494	NP_689707	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1 isoform 1	574	Helical; (Potential).					integral to membrane	zinc ion binding			ovary(1)|skin(1)	2	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GCTACCGACTCCGGAGGGTCA	0.607													8	76	---	---	---	---	PASS
TRIM46	80128	broad.mit.edu	37	1	155152267	155152267	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155152267G>A	uc001fhs.1	+	8	1528	c.1445G>A	c.(1444-1446)CGG>CAG	p.R482Q	RAG1AP1_uc010pey.1_Intron|TRIM46_uc009wpe.1_RNA|TRIM46_uc001fhq.2_RNA|TRIM46_uc001fhr.2_Missense_Mutation_p.R482Q|TRIM46_uc001fht.1_RNA|TRIM46_uc010pfa.1_Missense_Mutation_p.R356Q|TRIM46_uc001fhu.1_Missense_Mutation_p.R459Q|TRIM46_uc009wpg.1_Missense_Mutation_p.R469Q|TRIM46_uc001fhv.3_Missense_Mutation_p.R469Q|TRIM46_uc001fhw.1_RNA	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	tripartite motif-containing 46	482	Fibronectin type-III.					intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CGCTGGCAGCGGCGGGAGGAG	0.687													6	18	---	---	---	---	PASS
C1orf104	284618	broad.mit.edu	37	1	155290466	155290466	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155290466C>G	uc001fki.2	-	2					RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fkh.1_Intron|RUSC1_uc001fkj.2_5'Flank|RUSC1_uc001fkk.2_5'Flank|RUSC1_uc009wqn.1_5'Flank|RUSC1_uc009wqo.1_5'Flank	NM_001039517	NP_001034606	Q66K80	RUAS1_HUMAN	hypothetical protein LOC284618												0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.32e-10)|all cancers(21;3.51e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			TCTTGTGGTTCTGTTCTTGCT	0.557													29	20	---	---	---	---	PASS
C1orf104	284618	broad.mit.edu	37	1	155290498	155290498	+	3'UTR	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155290498C>A	uc001fki.2	-	2					RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fkh.1_Intron|RUSC1_uc001fkj.2_5'Flank|RUSC1_uc001fkk.2_5'Flank|RUSC1_uc009wqn.1_5'Flank|RUSC1_uc009wqo.1_5'Flank	NM_001039517	NP_001034606	Q66K80	RUAS1_HUMAN	hypothetical protein LOC284618												0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.32e-10)|all cancers(21;3.51e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			GAGTCTGGCTCTTTCCAGAAT	0.547													32	18	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156497752	156497752	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156497752G>A	uc001fpf.2	-	37	4849	c.4774C>T	c.(4774-4776)CAC>TAC	p.H1592Y		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1592					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ACCTGATAGTGAAGCTGAAAT	0.527													50	51	---	---	---	---	PASS
DDR2	4921	broad.mit.edu	37	1	162725538	162725538	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162725538A>G	uc001gcf.2	+	8	1115	c.650A>G	c.(649-651)TAT>TGT	p.Y217C	DDR2_uc001gcg.2_Missense_Mutation_p.Y217C	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	217	Extracellular (Potential).				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			GATTCTGTCTATGATGGAGCT	0.403													35	28	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186304579	186304579	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186304579G>A	uc001grv.2	-	34	5099	c.4802C>T	c.(4801-4803)GCG>GTG	p.A1601V		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1601	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GGACTTTAGCGCAGTAATGCG	0.423			T	NTRK1	papillary thyroid								6	31	---	---	---	---	PASS
SYT2	127833	broad.mit.edu	37	1	202571539	202571539	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202571539C>T	uc001gye.2	-	5	793	c.600G>A	c.(598-600)CTG>CTA	p.L200L	SYT2_uc010pqb.1_Silent_p.L200L|SYT2_uc009xaf.2_Silent_p.L30L	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II	200	Phospholipid binding (By similarity).|C2 1.|Cytoplasmic (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	AGGCAGGGTTCAGTGTCTTCC	0.517													159	79	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214794110	214794110	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214794110C>T	uc001hkm.2	+	6	860	c.686C>T	c.(685-687)TCA>TTA	p.S229L		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	229	Interaction with SNAP25 and required for localization to the cytoplasm (By similarity).				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGTCATCTTTCATCTAATTCT	0.458													67	36	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222713588	222713588	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222713588G>T	uc001hnh.1	-	4	1272	c.1214C>A	c.(1213-1215)TCT>TAT	p.S405Y		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	405					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		CCCTGGCTCAGAAACAAATGG	0.587													77	35	---	---	---	---	PASS
ZP4	57829	broad.mit.edu	37	1	238048519	238048519	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238048519G>A	uc001hym.2	-	9	1257	c.1257C>T	c.(1255-1257)ATC>ATT	p.I419I	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	419	ZP.|Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TGAAGGTGAAGATGCTGAAGC	0.547													42	18	---	---	---	---	PASS
ZNF670	93474	broad.mit.edu	37	1	247200919	247200919	+	Silent	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247200919C>A	uc001icd.1	-	4	1173	c.1002G>T	c.(1000-1002)GTG>GTT	p.V334V	ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990	Q9BS34	ZN670_HUMAN	zinc finger protein 670	334					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			CATAAGGTTTCACTCCAGTGT	0.408													93	126	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685406	248685406	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685406C>T	uc001ien.1	+	1	459	c.459C>T	c.(457-459)CTC>CTT	p.L153L		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCAGCGGCCTCATCACCTCCC	0.572													23	16	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11773124	11773124	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11773124G>A	uc002rbk.1	+	28	5226	c.4926G>A	c.(4924-4926)GTG>GTA	p.V1642V	GREB1_uc002rbp.1_Silent_p.V640V	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1642						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CTTTCATTGTGATCTCTGATG	0.562													47	74	---	---	---	---	PASS
RAD51AP2	729475	broad.mit.edu	37	2	17698327	17698327	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17698327G>C	uc002rcl.1	-	1	1380	c.1356C>G	c.(1354-1356)ATC>ATG	p.I452M	RAD51AP2_uc010exn.1_Missense_Mutation_p.I443M	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	452										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CATATGCATTGATGACTTTTG	0.313													27	41	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20511319	20511319	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20511319C>A	uc002rds.1	-	4	477	c.454G>T	c.(454-456)GAT>TAT	p.D152Y	PUM2_uc002rdt.1_Missense_Mutation_p.D152Y|PUM2_uc002rdr.2_Missense_Mutation_p.D91Y|PUM2_uc010yjy.1_Missense_Mutation_p.D152Y|PUM2_uc002rdu.1_Missense_Mutation_p.D152Y|PUM2_uc010yjz.1_Missense_Mutation_p.D91Y	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	152	Interaction with SNAPIN.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTAGAATCATCATCATCTCCT	0.378													33	65	---	---	---	---	PASS
CRIM1	51232	broad.mit.edu	37	2	36744610	36744610	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36744610G>C	uc002rpd.2	+	12	2170	c.2131G>C	c.(2131-2133)GAG>CAG	p.E711Q		NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor	711	VWFC 4.|Extracellular (Potential).				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GGTGCTGTGTGAGACAGAGGT	0.582													9	95	---	---	---	---	PASS
HAAO	23498	broad.mit.edu	37	2	42995022	42995022	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42995022A>T	uc002rst.3	-	8	752	c.677T>A	c.(676-678)GTG>GAG	p.V226E		NM_012205	NP_036337	P46952	3HAO_HUMAN	3-hydroxyanthranilate 3,4-dioxygenase	226	Domain B (By similarity).				neuron homeostasis|pyridine nucleotide biosynthetic process|quinolinate biosynthetic process|response to cadmium ion|response to zinc ion|tryptophan catabolic process	cytosol|soluble fraction	3-hydroxyanthranilate 3,4-dioxygenase activity|electron carrier activity|ferrous iron binding			ovary(1)	1						CCACACGTCCACATTCTGTCT	0.632													50	58	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43939476	43939476	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43939476C>T	uc010yny.1	+	15	2497	c.2414C>T	c.(2413-2415)TCC>TTC	p.S805F	PLEKHH2_uc002rte.3_3'UTR|PLEKHH2_uc002rtf.3_Missense_Mutation_p.S804F	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	805						cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AACCCACTTTCCCTGCAGCCT	0.478													51	49	---	---	---	---	PASS
EPAS1	2034	broad.mit.edu	37	2	46608758	46608758	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46608758G>A	uc002ruv.2	+	13	2557	c.2069G>A	c.(2068-2070)CGA>CAA	p.R690Q	EPAS1_uc002ruw.2_Missense_Mutation_p.R156Q	NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	690					angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TTTGGGGCTCGAGGCCCAGAC	0.597													24	62	---	---	---	---	PASS
RPS27A	6233	broad.mit.edu	37	2	55461976	55461976	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55461976C>G	uc010yow.1	+	5	396	c.199C>G	c.(199-201)CTT>GTT	p.L67V	C2orf63_uc002ryh.2_5'Flank|C2orf63_uc002ryi.2_5'Flank|C2orf63_uc002ryj.2_5'Flank|RPS27A_uc002ryk.2_Missense_Mutation_p.L67V|RPS27A_uc002ryl.2_RNA|RPS27A_uc002rym.2_RNA	NM_001135592	NP_001129064	P62979	RS27A_HUMAN	ubiquitin and ribosomal protein S27a precursor	67	Ubiquitin-like.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endocrine pancreas development|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	metal ion binding|structural constituent of ribosome			ovary(1)	1						GGAGTCTACTCTTCATCTTGT	0.398													17	81	---	---	---	---	PASS
C1D	10438	broad.mit.edu	37	2	68273488	68273488	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68273488A>T	uc002sea.3	-	3	275	c.193T>A	c.(193-195)TCA>ACA	p.S65T	C1D_uc002seb.2_Missense_Mutation_p.S65T|C1D_uc002sec.2_Missense_Mutation_p.S65T|C1D_uc010fdc.2_Missense_Mutation_p.S65T	NM_173177	NP_775269	Q13901	C1D_HUMAN	nuclear DNA-binding protein	65	Required for transcriptional repression (By similarity).|Interaction with NR1D1 (By similarity).				apoptosis|maturation of 5.8S rRNA|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear exosome (RNase complex)|nucleolus	DNA binding|RNA binding				0						CAAAACATTGAATTTAATGTG	0.224													13	25	---	---	---	---	PASS
ARID5A	10865	broad.mit.edu	37	2	97216890	97216890	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97216890C>T	uc002swe.2	+	7	725	c.625C>T	c.(625-627)CAG>TAG	p.Q209*	ARID5A_uc010yuq.1_Nonsense_Mutation_p.Q157*|ARID5A_uc002swf.2_Nonsense_Mutation_p.Q45*|ARID5A_uc002swg.2_Nonsense_Mutation_p.Q157*	NM_212481	NP_997646	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A	209					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding				0						ACTTCCCAGCCAGGAGCCCCC	0.597													73	117	---	---	---	---	PASS
EDAR	10913	broad.mit.edu	37	2	109513298	109513298	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109513298C>T	uc002teq.3	-	12					EDAR_uc010fjn.2_3'UTR|EDAR_uc010yws.1_3'UTR	NM_022336	NP_071731	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor precursor						apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity			skin(1)	1						TGGCACCACTCACAGCTCCAG	0.542													13	2	---	---	---	---	PASS
POLR1B	84172	broad.mit.edu	37	2	113333340	113333340	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113333340C>G	uc002thw.2	+	15					POLR1B_uc010fkn.2_3'UTR|POLR1B_uc002thx.2_3'UTR|POLR1B_uc010fko.2_3'UTR|POLR1B_uc010fkp.2_3'UTR|POLR1B_uc010yxn.1_3'UTR|POLR1B_uc002thy.2_3'UTR|POLR1B_uc010yxo.1_3'UTR	NM_019014	NP_061887	Q9H9Y6	RPA2_HUMAN	RNA polymerase I polypeptide B isoform 1						termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(1)	1						AGAGGACTATCAGATTAAAGC	0.338													33	93	---	---	---	---	PASS
MARCO	8685	broad.mit.edu	37	2	119750864	119750864	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119750864A>G	uc002tln.1	+	16	1549	c.1417A>G	c.(1417-1419)AAA>GAA	p.K473E	MARCO_uc010yyf.1_Missense_Mutation_p.K395E	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	473	SRCR.|Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						GGCCCTGTACAAAGTGGGAGC	0.557													53	78	---	---	---	---	PASS
GLI2	2736	broad.mit.edu	37	2	121732608	121732608	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121732608G>C	uc010flp.2	+	8	1321	c.1291G>C	c.(1291-1293)GAG>CAG	p.E431Q	GLI2_uc002tmq.1_Missense_Mutation_p.E103Q|GLI2_uc002tmr.1_Missense_Mutation_p.E86Q|GLI2_uc002tmt.3_Missense_Mutation_p.E103Q|GLI2_uc002tmu.3_Missense_Mutation_p.E86Q|GLI2_uc010flo.1_Missense_Mutation_p.E289Q|GLI2_uc002tmw.1_Missense_Mutation_p.E414Q	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	431					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				GCAGGAGGCTGAGGTGGTCAT	0.577													34	59	---	---	---	---	PASS
MKI67IP	84365	broad.mit.edu	37	2	122485562	122485562	+	Intron	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122485562C>T	uc002tnk.2	-						uc002tnj.1_RNA	NM_032390	NP_115766	Q9BYG3	MK67I_HUMAN	MKI67 interacting nucleolar phosphoprotein						protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding				0						AATATCATCTCTCCTCTATTT	0.328													7	28	---	---	---	---	PASS
MKI67IP	84365	broad.mit.edu	37	2	122485567	122485567	+	Intron	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122485567C>G	uc002tnk.2	-						uc002tnj.1_RNA	NM_032390	NP_115766	Q9BYG3	MK67I_HUMAN	MKI67 interacting nucleolar phosphoprotein						protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding				0						CATCTCTCCTCTATTTTTACA	0.333													8	26	---	---	---	---	PASS
MKI67IP	84365	broad.mit.edu	37	2	122485957	122485957	+	Intron	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122485957C>G	uc002tnk.2	-						uc002tnj.1_RNA	NM_032390	NP_115766	Q9BYG3	MK67I_HUMAN	MKI67 interacting nucleolar phosphoprotein						protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding				0						TAAAACACATCAATTTGAATA	0.303													20	70	---	---	---	---	PASS
MKI67IP	84365	broad.mit.edu	37	2	122486097	122486097	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122486097C>T	uc002tnk.2	-	5	657	c.580G>A	c.(580-582)GAA>AAA	p.E194K	uc002tnj.1_RNA	NM_032390	NP_115766	Q9BYG3	MK67I_HUMAN	MKI67 interacting nucleolar phosphoprotein	194					protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding				0						GAAATACTTTCCGTTTTCTGT	0.274													14	58	---	---	---	---	PASS
NMI	9111	broad.mit.edu	37	2	152135221	152135221	+	Intron	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152135221C>T	uc002txi.2	-						NMI_uc010zbx.1_Intron|NMI_uc002txj.2_3'UTR	NM_004688	NP_004679	Q13287	NMI_HUMAN	N-myc and STAT interactor						inflammatory response|JAK-STAT cascade|transcription from RNA polymerase II promoter	cytoplasm|nucleus	nucleotide binding|protein binding|transcription cofactor activity				0				BRCA - Breast invasive adenocarcinoma(221;0.0571)		atacctgcctcagaacgtcac	0.090													6	6	---	---	---	---	PASS
PRPF40A	55660	broad.mit.edu	37	2	153519641	153519641	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153519641C>T	uc002tyh.3	-	20	2156	c.2134G>A	c.(2134-2136)GAG>AAG	p.E712K	PRPF40A_uc002tyg.3_Missense_Mutation_p.E168K|PRPF40A_uc010zcd.1_Missense_Mutation_p.E663K	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	739					mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TTCCGAGCCTCTTCTTTTTCT	0.348													10	16	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170127522	170127522	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170127522C>T	uc002ues.2	-	16	2425	c.2212G>A	c.(2212-2214)GGG>AGG	p.G738R	LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	738	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GAAGGATTCCCCGAAACTGGA	0.408													6	27	---	---	---	---	PASS
GPR155	151556	broad.mit.edu	37	2	175335161	175335161	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175335161C>G	uc002uit.2	-	5	1374	c.983G>C	c.(982-984)GGA>GCA	p.G328A	GPR155_uc002uiu.2_Missense_Mutation_p.G328A|GPR155_uc002uiv.2_Missense_Mutation_p.G328A|GPR155_uc010fqs.2_Missense_Mutation_p.G328A	NM_001033045	NP_001028217	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155 isoform 9	328	Helical; (Potential).				intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1						GATAGCCACTCCTGGTGCTAC	0.358													15	21	---	---	---	---	PASS
CHRNA1	1134	broad.mit.edu	37	2	175618052	175618052	+	Intron	SNP	A	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175618052A>G	uc002ujd.2	-						uc002uiw.2_Intron|CHRNA1_uc002uje.2_Intron|CHRNA1_uc002ujf.3_3'UTR	NM_001039523	NP_001034612	P02708	ACHA_HUMAN	nicotinic cholinergic receptor alpha 1 isoform a						muscle cell homeostasis|neuromuscular junction development|neuromuscular process|neuromuscular synaptic transmission|neuron homeostasis|regulation of action potential in neuron|skeletal muscle contraction|skeletal muscle tissue growth	cell junction|cell surface|neuromuscular junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CCCAGCTGTGAGCTCCACTCA	0.532													15	16	---	---	---	---	PASS
TTC30A	92104	broad.mit.edu	37	2	178483399	178483399	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178483399C>T	uc002ulo.2	-	1	296	c.31G>A	c.(31-33)GAC>AAC	p.D11N		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	11	TPR 1.				cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			AACTCCCCGTCGGGGATCTGC	0.667													3	8	---	---	---	---	PASS
TTC30A	92104	broad.mit.edu	37	2	178483504	178483504	+	5'UTR	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178483504G>A	uc002ulo.2	-	1						NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A						cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			AAGACGACGGGTTACTTTGCC	0.532													3	8	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196605504	196605504	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196605504C>G	uc002utj.3	-	64	11955	c.11854G>C	c.(11854-11856)GAT>CAT	p.D3952H	DNAH7_uc002uti.3_Missense_Mutation_p.D435H	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3952					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						GGCACTGTATCATAAAGAATT	0.284													18	55	---	---	---	---	PASS
INO80D	54891	broad.mit.edu	37	2	206872011	206872011	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206872011C>T	uc002vaz.3	-	10	2320	c.1915G>A	c.(1915-1917)GAA>AAA	p.E639K		NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	639					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						ACTATACCTTCAAAAAAATCA	0.348													19	41	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218678601	218678601	+	Intron	SNP	T	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218678601T>C	uc002vgt.2	-						TNS1_uc002vgr.2_Intron|TNS1_uc002vgs.2_Intron|TNS1_uc002vgq.2_5'UTR	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TAGTTTTACTTAAGTCTCATT	0.498													8	18	---	---	---	---	PASS
CYP27A1	1593	broad.mit.edu	37	2	219679423	219679423	+	Silent	SNP	C	G	G	rs138596741		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219679423C>G	uc002viz.3	+	8	1853	c.1419C>G	c.(1417-1419)GTC>GTG	p.V473V		NM_000784	NP_000775	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A,	473					bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Cholecalciferol(DB00169)	GCTATGGGGTCCGGGCCTGCC	0.637													13	32	---	---	---	---	PASS
INHA	3623	broad.mit.edu	37	2	220439960	220439960	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220439960C>T	uc002vmk.1	+	2	957	c.813C>T	c.(811-813)TTC>TTT	p.F271F		NM_002191	NP_002182	P05111	INHA_HUMAN	inhibin alpha subunit precursor	271					cell cycle arrest|cell surface receptor linked signaling pathway|cell-cell signaling|erythrocyte differentiation|hemoglobin biosynthetic process|induction of apoptosis|negative regulation of B cell differentiation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|ovarian follicle development|positive regulation of follicle-stimulating hormone secretion|regulation of cell proliferation|response to external stimulus|skeletal system development	inhibin A complex|inhibin-betaglycan-ActRII complex	cytokine activity|growth factor activity|hormone activity|signal transducer activity			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		ACATCTCCTTCCAGGAGCTGG	0.607													27	66	---	---	---	---	PASS
STK11IP	114790	broad.mit.edu	37	2	220466159	220466159	+	Silent	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220466159C>G	uc002vml.2	+	3	340	c.297C>G	c.(295-297)CTC>CTG	p.L99L	STK11IP_uc010zlj.1_Silent_p.L88L|STK11IP_uc010zlk.1_Silent_p.L88L|STK11IP_uc010zll.1_Silent_p.L88L|STK11IP_uc002vmm.1_Silent_p.L88L	NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN	LKB1 interacting protein	99					protein localization	cytoplasm	protein kinase binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACTTTCACTCAAGGTTCTGG	0.542													14	31	---	---	---	---	PASS
EDEM1	9695	broad.mit.edu	37	3	5243458	5243458	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5243458C>T	uc003bqi.2	+	4	839	c.707C>T	c.(706-708)TCT>TTT	p.S236F	EDEM1_uc011asz.1_Missense_Mutation_p.S14F|EDEM1_uc003bqh.2_Missense_Mutation_p.S236F	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like	236	Lumenal (Potential).				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		AGCCTCCTTTCTGCTCACAGA	0.408													27	106	---	---	---	---	PASS
IL17RC	84818	broad.mit.edu	37	3	9965627	9965627	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9965627G>T	uc003bua.2	+	8	1134	c.898G>T	c.(898-900)GAG>TAG	p.E300*	CIDEC_uc003bto.2_Intron|IL17RC_uc010hcr.2_RNA|IL17RC_uc011ato.1_RNA|IL17RC_uc010hcs.2_Nonsense_Mutation_p.E204*|IL17RC_uc003btz.2_Nonsense_Mutation_p.E229*|IL17RC_uc011atp.1_Nonsense_Mutation_p.E85*|IL17RC_uc003bud.2_5'UTR|IL17RC_uc003bub.2_Nonsense_Mutation_p.E214*|IL17RC_uc010hct.2_Nonsense_Mutation_p.E229*|IL17RC_uc010hcu.2_Nonsense_Mutation_p.E229*|IL17RC_uc010hcv.2_Nonsense_Mutation_p.E214*|IL17RC_uc011atq.1_Nonsense_Mutation_p.E214*|IL17RC_uc003buc.2_5'UTR	NM_153461	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C isoform 1 precursor	300	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)|pancreas(1)	2						GAATGTCTCTGAGGAGCAGCA	0.592													96	79	---	---	---	---	PASS
FANCD2	2177	broad.mit.edu	37	3	10078013	10078013	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10078013T>G	uc003buw.2	+	7	559	c.481T>G	c.(481-483)TTT>GTT	p.F161V	FANCD2_uc003bux.1_Missense_Mutation_p.F161V|FANCD2_uc003buy.1_Missense_Mutation_p.F161V|FANCD2_uc003buv.2_Missense_Mutation_p.F161V	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	161	Interaction with FANCE.				DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GCCAGAATATTTTTTTGAAAA	0.333			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				20	93	---	---	---	---	PASS
PLCL2	23228	broad.mit.edu	37	3	17053637	17053637	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17053637G>A	uc011awc.1	+	5	2880	c.2775G>A	c.(2773-2775)CTG>CTA	p.L925L	PLCL2_uc011awd.1_Silent_p.L807L	NM_001144382	NP_001137854	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2 isoform 1	933					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4						CCACAGATCTGAGAGAAAACA	0.383													5	25	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36872833	36872833	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36872833G>C	uc003cgj.2	-	12	6761	c.6459C>G	c.(6457-6459)GTC>GTG	p.V2153V		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	2703					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						CCTCCTCCCTGACACGCTCCA	0.592													21	8	---	---	---	---	PASS
GOLGA4	2803	broad.mit.edu	37	3	37376609	37376609	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37376609G>A	uc003cgv.2	+	17	6562	c.6258G>A	c.(6256-6258)AAG>AAA	p.K2086K	GOLGA4_uc003cgw.2_Silent_p.K2108K|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Silent_p.K1967K	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	2086	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						AGCTGCAGAAGAAATACCAGC	0.378													4	10	---	---	---	---	PASS
ENTPD3	956	broad.mit.edu	37	3	40457435	40457435	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40457435G>A	uc003ckd.3	+	7	794	c.702G>A	c.(700-702)AAG>AAA	p.K234K	ENTPD3_uc010hhy.2_Silent_p.K234K|uc003cke.3_Intron	NM_001248	NP_001239	O75355	ENTP3_HUMAN	ectonucleoside triphosphate diphosphohydrolase	234	Extracellular (Potential).					integral to membrane	ATP binding|hydrolase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0605)|Kidney(284;0.0758)		CAGGAGAGAAGATGGATCTGA	0.562													9	22	---	---	---	---	PASS
PTH1R	5745	broad.mit.edu	37	3	46940250	46940250	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46940250C>G	uc003cqm.2	+	9	940	c.737C>G	c.(736-738)TCT>TGT	p.S246C	PTH1R_uc003cqn.2_Missense_Mutation_p.S246C	NM_000316	NP_000307	Q03431	PTH1R_HUMAN	parathyroid hormone receptor 1 precursor	246	Extracellular (Potential).					cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association			breast(1)	1						GTGCTCTACTCTGGCGCCACG	0.677									Ollier_disease_/_Maffuci_syndrome				24	21	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47144868	47144868	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47144868G>A	uc003cqs.2	-	7	4938	c.4885C>T	c.(4885-4887)CAC>TAC	p.H1629Y	SETD2_uc003cqv.2_Missense_Mutation_p.H1696Y	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1629	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	p.R1629fs*15(1)		kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCACAGCTGTGATTCATGAAA	0.333			N|F|S|Mis		clear cell renal carcinoma								33	125	---	---	---	---	PASS
GNAI2	2771	broad.mit.edu	37	3	50289085	50289085	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50289085G>A	uc003cyq.1	+						GNAI2_uc003cyo.1_5'UTR|GNAI2_uc003cyp.1_Intron|GNAI2_uc010hlg.1_Intron|GNAI2_uc011bdn.1_Intron|GNAI2_uc003cyr.1_5'UTR	NM_002070	NP_002061	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein),						adenosine receptor signaling pathway|cell cycle|cell division|gamma-aminobutyric acid signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|platelet activation|response to nutrient|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GTGGGGAGAAGAAGGGCTGCT	0.602													5	24	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52442604	52442604	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52442604G>C	uc003ddx.2	-	4	256	c.141C>G	c.(139-141)ATC>ATG	p.I47M	PHF7_uc003ddy.2_5'Flank|PHF7_uc003ddz.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	47					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TGAACAGGAAGATAAATCCAT	0.473			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								3	23	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62423823	62423823	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62423823G>A	uc003dll.2	-	28	4093	c.3733C>T	c.(3733-3735)CGT>TGT	p.R1245C	CADPS_uc003dlj.1_Missense_Mutation_p.R200C|CADPS_uc003dlk.1_Missense_Mutation_p.R693C|CADPS_uc003dlm.2_Missense_Mutation_p.R1206C|CADPS_uc003dln.2_Missense_Mutation_p.R1166C	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1245	Mediates targeting and association with DCVs (By similarity).				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ACCTTATCACGCAGGACATCC	0.448													4	32	---	---	---	---	PASS
CD86	942	broad.mit.edu	37	3	121825321	121825321	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121825321G>A	uc003eet.2	+	4	793	c.677G>A	c.(676-678)CGG>CAG	p.R226Q	CD86_uc011bjo.1_Missense_Mutation_p.R144Q|CD86_uc011bjp.1_Missense_Mutation_p.R114Q|CD86_uc003eeu.2_Missense_Mutation_p.R220Q	NM_175862	NP_787058	P42081	CD86_HUMAN	CD86 antigen isoform 1	226	Extracellular (Potential).				interspecies interaction between organisms|positive regulation of cell proliferation|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of lymphotoxin A biosynthetic process|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation		coreceptor activity|protein binding			pancreas(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)	GACAAGACGCGGCTTTTATCT	0.403													55	66	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124380748	124380748	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124380748G>A	uc003ehg.2	+	45	6442	c.6315G>A	c.(6313-6315)ATG>ATA	p.M2105I	KALRN_uc003ehi.2_Missense_Mutation_p.M446I|KALRN_uc003ehk.2_Missense_Mutation_p.M408I|KALRN_uc011bjz.1_Missense_Mutation_p.M197I	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2104					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						ATGACATGATGAATCTAGGAC	0.507													89	116	---	---	---	---	PASS
COPB2	9276	broad.mit.edu	37	3	139085601	139085601	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139085601C>T	uc003etf.3	-	15	1823	c.1693G>A	c.(1693-1695)GGC>AGC	p.G565S	COPB2_uc011bmv.1_Missense_Mutation_p.G536S|COPB2_uc010hui.2_Missense_Mutation_p.G536S	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta	565					COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						GGAATGTAGCCTAGGAGATAC	0.413													5	26	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154139250	154139250	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154139250G>A	uc003faa.2	-	3	1301	c.1201C>T	c.(1201-1203)CTA>TTA	p.L401L		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	401	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TGGAATGATAGATTGAATTCA	0.284													5	10	---	---	---	---	PASS
TRIM59	286827	broad.mit.edu	37	3	160156351	160156351	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160156351G>A	uc003fdm.2	-	3	816	c.621C>T	c.(619-621)CTC>CTT	p.L207L	IFT80_uc003fda.2_RNA	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	207	Potential.					integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CAACATCACAGAGAGCCGTTA	0.353													38	161	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178942564	178942564	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178942564G>C	uc003fjk.2	+	16	2528	c.2371G>C	c.(2371-2373)GAG>CAG	p.E791Q		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	791					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			CATCATGTCAGAGTTACTGTT	0.353		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			7	23	---	---	---	---	PASS
CTBP1	1487	broad.mit.edu	37	4	1206715	1206715	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1206715A>C	uc003gcv.1	-	8	1290	c.1125T>G	c.(1123-1125)AAT>AAG	p.N375K	uc003gcs.1_Intron|CTBP1_uc003gct.1_Missense_Mutation_p.N356K|CTBP1_uc003gcu.1_Missense_Mutation_p.N364K|CTBP1_uc003gcw.2_Missense_Mutation_p.N49K	NM_001328	NP_001319	Q13363	CTBP1_HUMAN	C-terminal binding protein 1 isoform 1	375					interspecies interaction between organisms|negative regulation of cell proliferation|negative regulation of histone H4 acetylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|protein phosphorylation|regulation of cell cycle|regulation of transcription by chromatin organization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|viral genome replication|white fat cell differentiation	cytoplasm|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein C-terminus binding|protein domain specific binding|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		AGGCAGCCCCATTGAGCTCAG	0.667													7	46	---	---	---	---	PASS
POLN	353497	broad.mit.edu	37	4	2130935	2130935	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2130935G>A	uc003ger.2	-	16	1838	c.1838C>T	c.(1837-1839)TCA>TTA	p.S613L	POLN_uc010icg.1_Missense_Mutation_p.S61L|POLN_uc010ich.1_Missense_Mutation_p.S145L	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu	613					DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			GCCTTTGGATGAAACAAACAT	0.398								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					22	63	---	---	---	---	PASS
ABLIM2	84448	broad.mit.edu	37	4	7985051	7985051	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7985051G>C	uc003gko.2	-	19	1805	c.1662C>G	c.(1660-1662)CTC>CTG	p.L554L	ABLIM2_uc003gkk.2_Silent_p.L179L|ABLIM2_uc003gkl.2_Silent_p.L282L|ABLIM2_uc003gkj.3_Silent_p.L588L|ABLIM2_uc003gkm.3_Silent_p.L502L|ABLIM2_uc003gkp.2_Silent_p.L474L|ABLIM2_uc003gkq.2_Silent_p.L515L|ABLIM2_uc003gkr.2_Silent_p.L464L|ABLIM2_uc003gki.2_RNA	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	554	HP.				axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						TTGTGACGATGAGGGAGTCAT	0.562													6	25	---	---	---	---	PASS
GPR125	166647	broad.mit.edu	37	4	22449100	22449100	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22449100G>A	uc003gqm.1	-	5	773	c.508C>T	c.(508-510)CAA>TAA	p.Q170*	GPR125_uc010ieo.1_Nonsense_Mutation_p.Q44*|GPR125_uc003gqo.2_Nonsense_Mutation_p.Q170*	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor	170	Extracellular (Potential).|LRR 4.				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				AAAGTTCCTTGAGATAATGAA	0.249													12	30	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48517148	48517148	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48517148C>T	uc003gyh.1	-	56	8439	c.7834G>A	c.(7834-7836)GAA>AAA	p.E2612K	FRYL_uc003gyf.1_Missense_Mutation_p.E8K|FRYL_uc003gyg.1_Missense_Mutation_p.E1308K|FRYL_uc003gyi.1_Missense_Mutation_p.E1500K	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2612					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						GGGTAACTTTCAGGAGCTAGA	0.423													23	29	---	---	---	---	PASS
NPFFR2	10886	broad.mit.edu	37	4	73013407	73013407	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73013407C>T	uc003hgg.2	+	4	1545	c.1447C>T	c.(1447-1449)CAG>TAG	p.Q483*	NPFFR2_uc010iig.1_Nonsense_Mutation_p.Q265*|NPFFR2_uc003hgi.2_Nonsense_Mutation_p.Q384*|NPFFR2_uc003hgh.2_Nonsense_Mutation_p.Q381*|NPFFR2_uc003hgj.2_RNA	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	483	Cytoplasmic (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TCAGCTTGTCCAGGAATCTAC	0.403													14	31	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76794444	76794444	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76794444C>T	uc003hix.2	-	12	1699	c.1342G>A	c.(1342-1344)GAT>AAT	p.D448N	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.D448N	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	448	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GCCATGGGATCACTCCACAGG	0.433													49	81	---	---	---	---	PASS
ADH6	130	broad.mit.edu	37	4	100125297	100125297	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100125297C>G	uc003huo.2	-	9					uc003hum.1_Intron|ADH6_uc011cef.1_3'UTR	NM_001102470	NP_001095940	P28332	ADH6_HUMAN	class V alcohol dehydrogenase isoform 1						ethanol oxidation|response to ethanol|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|electron carrier activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)|NADH(DB00157)	GTGAATAATTCTTCTAAATCA	0.363													3	16	---	---	---	---	PASS
ADH1B	125	broad.mit.edu	37	4	100235073	100235073	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100235073G>C	uc003hus.3	-	6	817	c.733C>G	c.(733-735)CAA>GAA	p.Q245E	ADH1A_uc011ceg.1_Intron|ADH1B_uc003hut.3_Missense_Mutation_p.Q205E|ADH1B_uc011ceh.1_Missense_Mutation_p.Q90E|ADH1B_uc011cei.1_Missense_Mutation_p.Q205E	NM_000668	NP_000659	P00325	ADH1B_HUMAN	class I alcohol dehydrogenase, beta subunit	245					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|zinc ion binding			ovary(1)|breast(1)	2				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Fomepizole(DB01213)|NADH(DB00157)	TTGTAGTCTTGAGGGTTGATG	0.468													79	93	---	---	---	---	PASS
H2AFZ	3015	broad.mit.edu	37	4	100869906	100869906	+	Intron	SNP	T	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100869906T>C	uc003hvo.1	-						DNAJB14_uc003hvl.2_5'Flank|DNAJB14_uc010ili.2_5'Flank|DNAJB14_uc003hvm.2_5'Flank|H2AFZ_uc003hvn.1_3'UTR|LOC256880_uc003hvp.1_5'Flank	NM_002106	NP_002097	P0C0S5	H2AZ_HUMAN	H2A histone family, member Z						nucleosome assembly	nucleosome|nucleus	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(123;2.32e-08)		AAAAACTAATTAAAAGCAGCA	0.284													33	27	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126337752	126337752	+	Silent	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126337752C>A	uc003ifj.3	+	6	6993	c.6993C>A	c.(6991-6993)GTC>GTA	p.V2331V	FAT4_uc011cgp.1_Silent_p.V629V	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2331	Extracellular (Potential).|Cadherin 22.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						AGCGCTTTGTCTTAATGATTA	0.328													8	33	---	---	---	---	PASS
MAML3	55534	broad.mit.edu	37	4	140810713	140810713	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140810713T>G	uc003ihz.1	-	3	2617	c.1865A>C	c.(1864-1866)AAC>ACC	p.N622T	MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	622	Gln-rich.				Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					CATCAAGGGGTTTTTGTTGGG	0.393													21	246	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175897020	175897020	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175897020C>T	uc003iuc.2	+	5	1014	c.344C>T	c.(343-345)TCC>TTC	p.S115F	ADAM29_uc003iud.2_Missense_Mutation_p.S115F|ADAM29_uc010irr.2_Missense_Mutation_p.S115F|ADAM29_uc011cki.1_Missense_Mutation_p.S115F	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	115					proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TCCCTGGTTTCCCTCAGTACC	0.443													9	31	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10391786	10391786	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10391786G>C	uc003jet.1	+	7	892	c.709G>C	c.(709-711)GAG>CAG	p.E237Q	MARCH6_uc011cmu.1_Missense_Mutation_p.E189Q|MARCH6_uc003jeu.1_5'UTR|MARCH6_uc011cmv.1_Missense_Mutation_p.E132Q	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	237	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						ggaggacaatgaggaggaaga	0.433													23	24	---	---	---	---	PASS
C1QTNF3	114899	broad.mit.edu	37	5	34043213	34043213	+	Silent	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34043213G>T	uc003jin.2	-	1	105	c.18C>A	c.(16-18)CTC>CTA	p.L6L	C1QTNF3_uc003jio.2_Silent_p.L6L	NM_030945	NP_112207	Q9BXJ4	C1QT3_HUMAN	C1q and tumor necrosis factor related protein 3	6						collagen					0	all_lung(31;0.0207)					GCCAATAGATGAGCTGCCTCC	0.507													11	36	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37020905	37020905	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37020905G>A	uc003jkl.3	+	27	5753	c.5254G>A	c.(5254-5256)GAT>AAT	p.D1752N	NIPBL_uc003jkk.3_Missense_Mutation_p.D1752N	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1752					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GGACTATGATGATGCTTGCTT	0.348													56	208	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43650630	43650630	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43650630C>A	uc003joe.2	+	12	1913	c.1658C>A	c.(1657-1659)TCC>TAC	p.S553Y	NNT_uc003jof.2_Missense_Mutation_p.S553Y	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	553					tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	TTGTATCCTTCCACAACTTCT	0.443													19	53	---	---	---	---	PASS
ISL1	3670	broad.mit.edu	37	5	50679448	50679448	+	5'UTR	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50679448G>C	uc003jor.2	+	1					uc003joq.1_5'Flank	NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1						generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				CTCTCTGTGGGCTGTTCACCA	0.537													20	40	---	---	---	---	PASS
F2RL1	2150	broad.mit.edu	37	5	76128897	76128897	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76128897C>G	uc003keo.2	+	2	640	c.465C>G	c.(463-465)TTC>TTG	p.F155L		NM_005242	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	155	Helical; Name=3; (Potential).				blood coagulation|elevation of cytosolic calcium ion concentration|positive regulation of leukocyte chemotaxis|positive regulation of positive chemotaxis|regulation of blood coagulation	Golgi apparatus|integral to plasma membrane	receptor binding|thrombin receptor activity			central_nervous_system(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		TTGGCTTTTTCTATGGCAACA	0.468													115	294	---	---	---	---	PASS
LYSMD3	116068	broad.mit.edu	37	5	89815090	89815090	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89815090G>A	uc003kjr.2	-	3	615	c.467C>T	c.(466-468)TCA>TTA	p.S156L	LYSMD3_uc010jaz.1_Intron|LYSMD3_uc003kjs.1_3'UTR	NM_198273	NP_938014	Q7Z3D4	LYSM3_HUMAN	LysM, putative peptidoglycan-binding, domain	156	Extracellular (Potential).				cell wall macromolecule catabolic process	integral to membrane					0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-31)|Epithelial(54;5.22e-26)|all cancers(79;2.42e-22)		GCTACCAGCTGAGTCACTGTA	0.398													14	41	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140558048	140558048	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140558048G>A	uc011dai.1	+	1	619	c.433G>A	c.(433-435)GAG>AAG	p.E145K	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	145	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAAGTATCAGAGAGCAGTCC	0.418													49	267	---	---	---	---	PASS
SLC25A2	83884	broad.mit.edu	37	5	140683343	140683343	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140683343G>A	uc003ljf.2	-	1	270	c.90C>T	c.(88-90)TTC>TTT	p.F30F		NM_031947	NP_114153	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 member 2	30	Solcar 1.				mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity			ovary(1)	1		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	TTATTGTGTCGAAGGGCTGCC	0.597													17	40	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140769192	140769192	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140769192G>C	uc003lkc.1	+	1	1741	c.1741G>C	c.(1741-1743)GAG>CAG	p.E581Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.E581Q	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	581	Extracellular (Potential).|Cadherin 6.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACGCTGCAGAGCCTGGCTA	0.652													12	39	---	---	---	---	PASS
SLC36A3	285641	broad.mit.edu	37	5	150666828	150666828	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150666828C>T	uc003ltw.2	-	6	1106	c.687G>A	c.(685-687)CTG>CTA	p.L229L	GM2A_uc011dcs.1_Intron|SLC36A3_uc003ltv.2_Silent_p.L214L|SLC36A3_uc003ltx.2_Silent_p.L270L	NM_181774	NP_861439	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3 isoform 2	229	Helical; (Potential).					integral to membrane				ovary(2)|skin(1)	3		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTCAAAGATCAGAGCCATGC	0.517													17	40	---	---	---	---	PASS
G3BP1	10146	broad.mit.edu	37	5	151179852	151179852	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151179852C>T	uc003lun.2	+	10	1200	c.1029C>T	c.(1027-1029)TTC>TTT	p.F343F	G3BP1_uc003lum.2_Silent_p.F343F|G3BP1_uc011dcu.1_Silent_p.F161F|G3BP1_uc010jhz.2_Silent_p.F161F|G3BP1_uc003luq.2_Silent_p.F11F	NM_005754	NP_005745	Q13283	G3BP1_HUMAN	Ras-GTPase-activating protein SH3-domain-binding	343	RRM.				Ras protein signal transduction|transport	cytosol|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|endonuclease activity|protein binding|RNA binding			skin(3)|ovary(1)	4		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			ACCAACTCTTCATTGGCAACC	0.418													26	53	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153085718	153085718	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153085718G>A	uc003lva.3	+						GRIA1_uc003luy.3_Intron|GRIA1_uc003luz.3_Intron|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Intron|GRIA1_uc011dcx.1_Intron|GRIA1_uc011dcy.1_Intron|GRIA1_uc011dcz.1_Intron|GRIA1_uc010jia.1_3'UTR	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAAGTAAAGAGATGAATTATT	0.338													3	8	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161116651	161116651	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161116651C>A	uc003lyu.2	+	6	877	c.539C>A	c.(538-540)CCC>CAC	p.P180H	GABRA6_uc003lyv.2_5'UTR	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	180	Extracellular (Probable).		P -> H (in a colorectal cancer sample; somatic mutation).		gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	p.P180H(1)		ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GATGCTTATCCCAAAAGTGAA	0.328										TCGA Ovarian(5;0.080)			6	15	---	---	---	---	PASS
SLC34A1	6569	broad.mit.edu	37	5	176815096	176815096	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176815096G>A	uc003mgk.3	+	7	847	c.746G>A	c.(745-747)CGA>CAA	p.R249Q		NM_003052	NP_003043	Q06495	NPT2A_HUMAN	solute carrier family 34 (sodium phosphate),	249	Extracellular (Potential).				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACATCACTCGACTTGTGGTG	0.592													17	47	---	---	---	---	PASS
RUFY1	80230	broad.mit.edu	37	5	179023597	179023597	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179023597G>A	uc003mka.1	+	13	1546	c.1546G>A	c.(1546-1548)GAG>AAG	p.E516K	RUFY1_uc003mkb.1_Missense_Mutation_p.E408K|RUFY1_uc003mkc.1_Missense_Mutation_p.E408K|RUFY1_uc003mkd.1_Missense_Mutation_p.E118K	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a	516	Potential.				endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGGGGGCTGAGGAGCGGAG	0.617										HNSCC(44;0.11)			48	123	---	---	---	---	PASS
RPP40	10799	broad.mit.edu	37	6	4996532	4996532	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4996532C>T	uc003mwl.2	-	6	717	c.682G>A	c.(682-684)GAG>AAG	p.E228K	RPP40_uc003mwm.2_Missense_Mutation_p.E205K	NM_006638	NP_006629	O75818	RPP40_HUMAN	ribonuclease P 40kDa subunit	228					tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0895)				GGCGTTCCCTCCAGCTCGCTG	0.557													43	84	---	---	---	---	PASS
RREB1	6239	broad.mit.edu	37	6	7231959	7231959	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7231959C>T	uc003mxc.2	+	10	4017	c.3627C>T	c.(3625-3627)GCC>GCT	p.A1209A	RREB1_uc003mxb.2_Silent_p.A1209A|RREB1_uc010jnx.2_Silent_p.A1209A	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	1209					multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				ATGAGGTGGCCGGAGCCCCTG	0.602													18	28	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12122972	12122972	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12122972T>A	uc003nac.2	+	4	3123	c.2944T>A	c.(2944-2946)TGT>AGT	p.C982S	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	982	C2H2-type 3.				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GAAATTTTACTGTTCTGAGTT	0.428													37	78	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25773814	25773814	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25773814C>G	uc003nfe.2	+	8	1018	c.899C>G	c.(898-900)TCT>TGT	p.S300C	SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Missense_Mutation_p.S61C|SLC17A4_uc003nfg.2_Missense_Mutation_p.S237C|SLC17A4_uc010jqa.2_Missense_Mutation_p.S13C	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),	300	Helical; (Potential).				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						ATTTTAGTCTCTTATTTCTGT	0.448													3	32	---	---	---	---	PASS
HIST1H1C	3006	broad.mit.edu	37	6	26056012	26056012	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26056012C>T	uc003nfw.2	-	1						NM_005319	NP_005310	P16403	H12_HUMAN	histone cluster 1, H1c						nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)|skin(2)	5						AGTAGGCGTTCGCCTATTTCT	0.473													40	82	---	---	---	---	PASS
BTN2A1	11120	broad.mit.edu	37	6	26459787	26459787	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26459787C>T	uc003nib.1	+	3	373	c.161C>T	c.(160-162)TCA>TTA	p.S54L	BTN2A1_uc003nic.1_Missense_Mutation_p.S54L|BTN2A1_uc003nid.1_5'UTR|BTN2A1_uc011dko.1_5'UTR	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1	54	Extracellular (Potential).|Ig-like V-type.				lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						TGCCATCTGTCACCCGAGAAA	0.532													13	65	---	---	---	---	PASS
HIST1H2AG	8969	broad.mit.edu	37	6	27100942	27100942	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27100942T>G	uc003niw.2	+	1	126	c.92T>G	c.(91-93)GTG>GGG	p.V31G	HIST1H2BJ_uc003niu.1_5'Flank|HIST1H2BJ_uc003niv.2_5'Flank	NM_021064	NP_066408	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	31					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding				0						GTGGGCCGAGTGCACCGCCTG	0.677													10	56	---	---	---	---	PASS
VARS2	57176	broad.mit.edu	37	6	30882669	30882669	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30882669C>T	uc003nsc.1	+	1	688	c.56C>T	c.(55-57)TCA>TTA	p.S19L	GTF2H4_uc003nsb.1_3'UTR|VARS2_uc003nsd.2_Missense_Mutation_p.S19L|VARS2_uc011dmx.1_Missense_Mutation_p.S19L|VARS2_uc011dmy.1_Intron|VARS2_uc011dmz.1_Missense_Mutation_p.S49L|VARS2_uc011dna.1_Missense_Mutation_p.S19L|VARS2_uc011dnb.1_RNA|VARS2_uc011dnc.1_RNA	NM_020442	NP_065175	Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	19					valyl-tRNA aminoacylation	mitochondrion	ATP binding|valine-tRNA ligase activity			ovary(3)|central_nervous_system(1)	4						CTGAGGCACTCACGGGGCCTC	0.572													55	101	---	---	---	---	PASS
RNF5	6048	broad.mit.edu	37	6	32147331	32147331	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32147331C>T	uc003oaj.3	+	2	281	c.154C>T	c.(154-156)CAT>TAT	p.H52Y	AGPAT1_uc003oaf.2_5'Flank|AGPAT1_uc003oag.2_5'Flank|AGPAT1_uc003oah.2_5'Flank	NM_006913	NP_008844	Q99942	RNF5_HUMAN	ring finger protein 5	52	RING-type.				ER-associated misfolded protein catabolic process|protein K48-linked ubiquitination|protein K63-linked ubiquitination	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						GCCATGTCTTCATCAGGTGCG	0.473													285	511	---	---	---	---	PASS
B3GALT4	8705	broad.mit.edu	37	6	33246064	33246064	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33246064G>C	uc003odr.2	+	1	1148	c.868G>C	c.(868-870)GAG>CAG	p.E290Q		NM_003782	NP_003773	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta	290	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	ganglioside galactosyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)|breast(1)	2						TCTCCCATTAGAGGATGTCTT	0.622													27	156	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38810631	38810631	+	Silent	SNP	T	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38810631T>C	uc003ooe.1	+	33	4746	c.4146T>C	c.(4144-4146)CTT>CTC	p.L1382L		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CTTTTTGCCTTAGAAATATCA	0.373													6	52	---	---	---	---	PASS
TBCC	6903	broad.mit.edu	37	6	42712930	42712930	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42712930C>G	uc003osl.2	-	1	955	c.882G>C	c.(880-882)TGG>TGC	p.W294C		NM_003192	NP_003183	Q15814	TBCC_HUMAN	beta-tubulin cofactor C	294	C-CAP/cofactor C-like.				'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|photoreceptor connecting cilium	chaperone binding|GTPase activity				0	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			CCGGGTAGCTCCAGGTGTAAG	0.537													48	126	---	---	---	---	PASS
TBCC	6903	broad.mit.edu	37	6	42713073	42713073	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42713073C>G	uc003osl.2	-	1	812	c.739G>C	c.(739-741)GAG>CAG	p.E247Q		NM_003192	NP_003183	Q15814	TBCC_HUMAN	beta-tubulin cofactor C	247	C-CAP/cofactor C-like.				'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|photoreceptor connecting cilium	chaperone binding|GTPase activity				0	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			CTGCAGTCCTCCAGGAAAACA	0.592													35	85	---	---	---	---	PASS
TBCC	6903	broad.mit.edu	37	6	42713214	42713214	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42713214C>G	uc003osl.2	-	1	671	c.598G>C	c.(598-600)GAG>CAG	p.E200Q		NM_003192	NP_003183	Q15814	TBCC_HUMAN	beta-tubulin cofactor C	200	C-CAP/cofactor C-like.				'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|photoreceptor connecting cilium	chaperone binding|GTPase activity				0	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			TGGTGCAACTCGCTGGCTCTC	0.602													23	34	---	---	---	---	PASS
C6orf226	441150	broad.mit.edu	37	6	42858210	42858210	+	3'UTR	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42858210G>C	uc003osw.2	-	1						NM_001008739	NP_001008739	Q5I0X4	CF226_HUMAN	hypothetical protein LOC441150												0						CGCCGCAAAGGACCTGGAACC	0.597													17	37	---	---	---	---	PASS
RCAN2	10231	broad.mit.edu	37	6	46214588	46214588	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46214588G>C	uc003oyb.1	-	3	645	c.330C>G	c.(328-330)CTC>CTG	p.L110L	RCAN2_uc003oyc.1_Silent_p.L156L|RCAN2_uc003oyd.1_Silent_p.L156L	NM_005822	NP_005813	Q14206	RCAN2_HUMAN	Down syndrome critical region gene 1-like 1	110					calcium-mediated signaling|central nervous system development		nucleotide binding|protein phosphatase 2B binding				0						GGGGCGAGATGAGAAACTGTT	0.522													5	23	---	---	---	---	PASS
CASP8AP2	9994	broad.mit.edu	37	6	90576496	90576496	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90576496G>A	uc003pnr.2	+	8	3683	c.3487G>A	c.(3487-3489)GAA>AAA	p.E1163K	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.E1163K|CASP8AP2_uc011dzz.1_Missense_Mutation_p.E1163K	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	1163					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AGATAGTGATGAAGGCAAACT	0.328													5	24	---	---	---	---	PASS
MICAL1	64780	broad.mit.edu	37	6	109766413	109766413	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109766413C>G	uc003ptj.2	-	21	3122	c.2868G>C	c.(2866-2868)TTG>TTC	p.L956F	MICAL1_uc003ptk.2_Missense_Mutation_p.L956F|MICAL1_uc010kdr.2_Missense_Mutation_p.L870F|MICAL1_uc011eaq.1_Missense_Mutation_p.L975F	NM_022765	NP_073602	Q8TDZ2	MICA1_HUMAN	microtubule associated monoxygenase, calponin	956	Potential.				cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		TCTGGCGCCTCAAGGCCAGCT	0.592													14	74	---	---	---	---	PASS
MICAL1	64780	broad.mit.edu	37	6	109766439	109766439	+	Missense_Mutation	SNP	C	T	T	rs147968137	byFrequency	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109766439C>T	uc003ptj.2	-	21	3096	c.2842G>A	c.(2842-2844)GAG>AAG	p.E948K	MICAL1_uc003ptk.2_Missense_Mutation_p.E948K|MICAL1_uc010kdr.2_Missense_Mutation_p.E862K|MICAL1_uc011eaq.1_Missense_Mutation_p.E967K	NM_022765	NP_073602	Q8TDZ2	MICA1_HUMAN	microtubule associated monoxygenase, calponin	948	Potential.				cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		TTCACGCCCTCGGCCTCTAGC	0.567													14	66	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117746802	117746802	+	Silent	SNP	A	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117746802A>G	uc003pxp.1	-	1	217	c.18T>C	c.(16-18)TGT>TGC	p.C6C	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	6					transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TCGGAATAAGACAGTAAATGT	0.383			T	GOPC|ROS1	glioblastoma|NSCLC								12	54	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	137041602	137041602	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137041602G>C	uc003qhc.2	-	2	935	c.574C>G	c.(574-576)CTG>GTG	p.L192V	MAP3K5_uc011edk.1_Missense_Mutation_p.L37V|MAP3K5_uc010kgw.1_Missense_Mutation_p.L192V	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	192					activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AGTGACTGCAGAGAGTCCGAG	0.443													15	13	---	---	---	---	PASS
PLEKHG1	57480	broad.mit.edu	37	6	151152717	151152717	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151152717C>G	uc003qny.1	+	16	2782	c.2470C>G	c.(2470-2472)CAT>GAT	p.H824D	PLEKHG1_uc011eel.1_Missense_Mutation_p.H864D|PLEKHG1_uc011eem.1_Missense_Mutation_p.H883D|PLEKHG1_uc003qnz.2_Missense_Mutation_p.H824D	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G	824					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GTCTATGCCTCATAAGCCTGT	0.458													123	155	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152583252	152583252	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152583252C>T	uc010kiw.2	-	101	19489	c.18887G>A	c.(18886-18888)AGA>AAA	p.R6296K	SYNE1_uc010kiv.2_Missense_Mutation_p.R820K|SYNE1_uc003qos.3_Missense_Mutation_p.R820K|SYNE1_uc003qot.3_Missense_Mutation_p.R6225K|SYNE1_uc003qou.3_Missense_Mutation_p.R6296K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6296	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCATTTCATTCTCATCTGGTC	0.378										HNSCC(10;0.0054)			23	61	---	---	---	---	PASS
IQCE	23288	broad.mit.edu	37	7	2632715	2632715	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2632715C>T	uc003smo.3	+	15	1488	c.1304C>T	c.(1303-1305)GCG>GTG	p.A435V	IQCE_uc010ksm.1_Missense_Mutation_p.A435V|IQCE_uc003sml.1_Missense_Mutation_p.A435V|IQCE_uc011jvy.1_Missense_Mutation_p.A419V|IQCE_uc011jvz.1_Missense_Mutation_p.A370V|IQCE_uc003smk.3_Missense_Mutation_p.A419V|IQCE_uc003smn.3_Missense_Mutation_p.A370V	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1	435	Potential.										0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		ctggagtgcgcgagggagggc	0.413													34	159	---	---	---	---	PASS
RNF216	54476	broad.mit.edu	37	7	5781044	5781044	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5781044C>T	uc003soy.1	-	4	623	c.433G>A	c.(433-435)GAA>AAA	p.E145K	RNF216_uc010ksz.1_5'UTR|RNF216_uc010kta.1_Intron|RNF216_uc011jwj.1_Intron|RNF216_uc003sox.1_Missense_Mutation_p.E202K	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	145					apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TCTGAGTCTTCGGATGACTGG	0.453													76	373	---	---	---	---	PASS
DAGLB	221955	broad.mit.edu	37	7	6476128	6476128	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6476128G>C	uc003sqa.2	-	3	454	c.284C>G	c.(283-285)TCT>TGT	p.S95C	DAGLB_uc011jwt.1_5'Flank|DAGLB_uc011jwu.1_Missense_Mutation_p.S95C|DAGLB_uc003sqb.2_Intron|DAGLB_uc003sqc.2_Intron|DAGLB_uc011jwv.1_Intron|DAGLB_uc003sqd.3_Missense_Mutation_p.S54C|DAGLB_uc011jww.1_Intron	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1	95	Cytoplasmic (Potential).				lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		AAGCAGCTTAGACATAGACTT	0.517													104	90	---	---	---	---	PASS
ITGB8	3696	broad.mit.edu	37	7	20438615	20438615	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20438615G>A	uc003suu.2	+	9	1984	c.1279G>A	c.(1279-1281)GAA>AAA	p.E427K	ITGB8_uc011jyh.1_Missense_Mutation_p.E292K|ITGB8_uc003sut.2_Missense_Mutation_p.E427K	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	427	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						GAGCAATGATGAAGTATGTGG	0.388													11	27	---	---	---	---	PASS
KLHL7	55975	broad.mit.edu	37	7	23180423	23180423	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23180423G>A	uc003svs.3	+	5	771	c.478G>A	c.(478-480)GAA>AAA	p.E160K	KLHL7_uc003svr.3_Missense_Mutation_p.E138K|KLHL7_uc011jys.1_Missense_Mutation_p.E84K|KLHL7_uc011jyt.1_5'UTR|KLHL7_uc003svt.2_Missense_Mutation_p.E112K|KLHL7_uc011jyv.1_5'UTR	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1	160						Golgi apparatus|nucleolus|plasma membrane					0						AGATTGTCCTGAATTGAAAGC	0.328													67	57	---	---	---	---	PASS
BMPER	168667	broad.mit.edu	37	7	34192756	34192756	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34192756C>G	uc011kap.1	+	15	2043	c.1929C>G	c.(1927-1929)ATC>ATG	p.I643M		NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor	643	TIL.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						CGGGATGTATCAAGACGTGTG	0.507													55	83	---	---	---	---	PASS
CDK13	8621	broad.mit.edu	37	7	40134032	40134032	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40134032C>G	uc003thh.3	+	14	4274	c.3992C>G	c.(3991-3993)TCC>TGC	p.S1331C	CDK13_uc003thi.3_Missense_Mutation_p.S1271C|CDK13_uc003thj.2_Missense_Mutation_p.S382C|CDK13_uc003thk.2_Missense_Mutation_p.S264C	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1331					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						ACTTACGTGTCCACTTCAGAC	0.483													73	52	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43484701	43484701	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43484701G>A	uc003tid.1	+	11	2535	c.1930G>A	c.(1930-1932)GCG>ACG	p.A644T	HECW1_uc011kbi.1_Missense_Mutation_p.A644T	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	644					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GGCCAATGGCGCGGCCCAGGA	0.711													10	13	---	---	---	---	PASS
PPIA	5478	broad.mit.edu	37	7	44839364	44839364	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44839364G>A	uc003tlw.2	+	4	336	c.253G>A	c.(253-255)GAT>AAT	p.D85N	PPIA_uc003tlx.2_RNA|PPIA_uc010kyl.2_RNA	NM_021130	NP_066953	P62937	PPIA_HUMAN	peptidylprolyl isomerase A	85	PPIase cyclophilin-type.				entry into host cell|leukocyte migration|platelet activation|platelet degranulation|protein folding|provirus integration|regulation of viral genome replication|RNA-dependent DNA replication|uncoating of virus	cytosol|extracellular region|nucleus	peptide binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding|virion binding				0					Cyclosporine(DB00091)|L-Proline(DB00172)	GAAATTTGAAGATGAGAACTT	0.458													9	252	---	---	---	---	PASS
NSUN5	55695	broad.mit.edu	37	7	72721626	72721626	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72721626C>T	uc003txw.2	-	3	381	c.345G>A	c.(343-345)GTG>GTA	p.V115V	FKBP6_uc003twz.2_Intron|NSUN5_uc003txv.2_Silent_p.V115V|NSUN5_uc003txx.2_Silent_p.V77V|NSUN5_uc011kev.1_Silent_p.V115V	NM_018044	NP_060514	Q96P11	NSUN5_HUMAN	NOL1/NOP2/Sun domain family, member 5 isoform 2	115							methyltransferase activity				0		Lung NSC(55;0.163)				CATTCCGGCTCACACCCCGAT	0.642													10	29	---	---	---	---	PASS
POM121C	100101267	broad.mit.edu	37	7	75048154	75048154	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75048154G>C	uc003udk.3	-	15	3774	c.2889C>G	c.(2887-2889)TCC>TCG	p.S963S		NM_001099415	NP_001092885	A8CG34	P121C_HUMAN	POM121 membrane glycoprotein (rat)-like	1205	Pore side (Potential).				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						CCGCACCAATGGAAAATGAAG	0.592													6	26	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81388061	81388061	+	Nonsense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81388061G>C	uc003uhl.2	-	3	479	c.314C>G	c.(313-315)TCA>TGA	p.S105*	HGF_uc003uhm.2_Nonsense_Mutation_p.S105*|HGF_uc003uhn.1_Nonsense_Mutation_p.S105*|HGF_uc003uho.1_Nonsense_Mutation_p.S105*|HGF_uc003uhp.2_Nonsense_Mutation_p.S105*	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	105	PAN.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						CACTCCACTTGACATGCTATT	0.318													11	54	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91603155	91603155	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91603155C>T	uc003ulg.2	+	2	404	c.179C>T	c.(178-180)TCA>TTA	p.S60L	AKAP9_uc003uld.3_Missense_Mutation_p.S60L|AKAP9_uc003ule.2_Missense_Mutation_p.S72L|AKAP9_uc003ulf.2_Missense_Mutation_p.S60L	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	72					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATTGATCAATCACAGTGTAAT	0.363			T	BRAF	papillary thyroid								21	35	---	---	---	---	PASS
TFPI2	7980	broad.mit.edu	37	7	93516176	93516176	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93516176G>A	uc003umy.1	-	5	739	c.664C>T	c.(664-666)CGC>TGC	p.R222C	GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_3'UTR|TFPI2_uc003una.1_Missense_Mutation_p.R211C|TFPI2_uc003unb.1_Missense_Mutation_p.R228C|TFPI2_uc010lfg.1_Missense_Mutation_p.R98C	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2 precursor	222					blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CTGGCAAAGCGAAGCTTTGGC	0.328													33	85	---	---	---	---	PASS
ACN9	57001	broad.mit.edu	37	7	96747140	96747140	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96747140G>A	uc003uoo.3	+	1	1236	c.105G>A	c.(103-105)GTG>GTA	p.V35V		NM_020186	NP_064571	Q9NRP4	ACN9_HUMAN	ACN9 homolog precursor	35					regulation of gluconeogenesis	mitochondrial intermembrane space					0	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					ACCAGTACGTGAAAGACGAAT	0.567													20	55	---	---	---	---	PASS
TAF6	6878	broad.mit.edu	37	7	99710524	99710524	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99710524C>T	uc003uti.2	-	6	552	c.471G>A	c.(469-471)CAG>CAA	p.Q157Q	TAF6_uc003utg.2_Silent_p.Q79Q|TAF6_uc003uth.2_Silent_p.Q214Q|TAF6_uc003utk.2_Silent_p.Q157Q|TAF6_uc011kji.1_Silent_p.Q194Q|TAF6_uc003utj.2_Silent_p.Q147Q|TAF6_uc003utl.2_Silent_p.Q157Q|TAF6_uc003utm.2_Silent_p.Q157Q|TAF6_uc003utn.1_RNA	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha	157					negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTTCAGCCTTCTGTTGCTCTT	0.532													93	227	---	---	---	---	PASS
RASA4	10156	broad.mit.edu	37	7	102246348	102246348	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102246348C>T	uc003vae.2	-	5	454	c.385G>A	c.(385-387)GGG>AGG	p.G129R	UPK3BL_uc003uzy.2_Intron|RASA4_uc011kla.1_Missense_Mutation_p.G57R|RASA4_uc010lig.2_Missense_Mutation_p.G57R|RASA4_uc003vaf.2_Missense_Mutation_p.G129R|RASA4_uc011klb.1_Missense_Mutation_p.G57R|RASA4_uc010lih.2_5'UTR|RASA4_uc011kld.1_Intron	NM_006989	NP_008920	O43374	RASL2_HUMAN	RAS p21 protein activator 4 isoform 1	129	C2 2.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0						GCCCGGGCCCCTGGCCACACT	0.687													3	4	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103183210	103183210	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103183210C>G	uc003vca.2	-	43	6799	c.6639G>C	c.(6637-6639)TTG>TTC	p.L2213F	RELN_uc010liz.2_Missense_Mutation_p.L2213F	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2213					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTCGTGTCATCAACATGCGCA	0.363													22	70	---	---	---	---	PASS
LRRN3	54674	broad.mit.edu	37	7	110764984	110764984	+	3'UTR	SNP	T	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110764984T>A	uc003vft.3	+	4					IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_3'UTR|LRRN3_uc003vfs.3_3'UTR	NM_001099660	NP_001093130	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3 precursor							integral to membrane				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		ACTCCAAAAATGAACAAAAAA	0.269													4	2	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135261759	135261759	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135261759G>C	uc003vsw.2	+	5	562	c.531G>C	c.(529-531)CTG>CTC	p.L177L	NUP205_uc011kqa.1_RNA	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	177					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						CAGATGAGCTGATGGAGCAAG	0.388													12	23	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135263632	135263632	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135263632G>A	uc003vsw.2	+	7	1042	c.1011G>A	c.(1009-1011)TTG>TTA	p.L337L	NUP205_uc011kqa.1_RNA	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	337					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						CGCTGGCATTGAGGGGAATAT	0.448													12	32	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135302356	135302356	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135302356C>T	uc003vsw.2	+	27	3728	c.3697C>T	c.(3697-3699)CAT>TAT	p.H1233Y	NUP205_uc003vsx.2_5'Flank	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1233					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						CCAGCTTCTTCATAGGGTTCT	0.403													14	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142494712	142494712	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142494712G>A	uc011ksh.1	+						uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_5'Flank|uc003wbe.3_Intron|uc003wbf.3_Intron|uc003wbg.3_Intron|uc003wbh.3_Intron|uc003wbi.3_Intron|uc003wbj.3_RNA|uc003wbm.3_5'Flank|uc003wbn.3_5'Flank|uc010los.2_5'Flank					Homo sapiens mRNA for T-cell receptor beta chain, partial cds, clone:TCRVB.3.																		TCGGCGCCGGGACCCGGCTCT	0.711													3	6	---	---	---	---	PASS
ZNF786	136051	broad.mit.edu	37	7	148769075	148769075	+	Silent	SNP	C	T	T	rs35396902		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148769075C>T	uc003wfh.2	-	4	926	c.789G>A	c.(787-789)ACG>ACA	p.T263T	ZNF786_uc011kuk.1_Silent_p.T226T|ZNF786_uc003wfi.2_Silent_p.T177T	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	263					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GGCCCCTCCCCGTGTGGGCCG	0.682													12	27	---	---	---	---	PASS
GIMAP2	26157	broad.mit.edu	37	7	150390122	150390122	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150390122C>T	uc003who.2	+	3	836	c.748C>T	c.(748-750)CAA>TAA	p.Q250*	GIMAP1_uc003whp.2_Intron	NM_015660	NP_056475	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	250						integral to membrane	GTP binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CATGGAAACTCAAAGAAGTTA	0.383													28	30	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10468223	10468223	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10468223C>G	uc003wtc.2	-	4	3614	c.3385G>C	c.(3385-3387)GAG>CAG	p.E1129Q		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1129					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		AGGTCTTCCTCAAATAACTGC	0.602													56	41	---	---	---	---	PASS
PDLIM2	64236	broad.mit.edu	37	8	22442667	22442667	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22442667C>T	uc003xby.2	+	5	853	c.453C>T	c.(451-453)ATC>ATT	p.I151I	PDLIM2_uc003xbx.1_Silent_p.I151I|PDLIM2_uc003xbz.2_Silent_p.I151I|PDLIM2_uc003xca.2_Silent_p.I151I|PDLIM2_uc003xcb.2_Silent_p.I151I|PDLIM2_uc003xcc.1_Silent_p.I151I	NM_021630	NP_067643	Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 isoform 2	151	Ser-rich.					actin cytoskeleton|cell surface|cytoplasm|focal adhesion|nucleus	zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		AGGCAGCCATCAGCCGCAGGT	0.662													26	21	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53084883	53084883	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53084883C>T	uc003xqz.2	-	5	694	c.538G>A	c.(538-540)GAT>AAT	p.D180N	ST18_uc011ldq.1_5'UTR|ST18_uc011ldr.1_Missense_Mutation_p.D145N|ST18_uc011lds.1_Missense_Mutation_p.D85N|ST18_uc003xra.2_Missense_Mutation_p.D180N|ST18_uc003xrb.2_Missense_Mutation_p.D180N	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	180						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGAGAATCATCAATCTTGTCT	0.428													55	100	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53084982	53084982	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53084982C>T	uc003xqz.2	-	5	595	c.439G>A	c.(439-441)GAA>AAA	p.E147K	ST18_uc011ldq.1_5'UTR|ST18_uc011ldr.1_Missense_Mutation_p.E112K|ST18_uc011lds.1_Missense_Mutation_p.E52K|ST18_uc003xra.2_Missense_Mutation_p.E147K|ST18_uc003xrb.2_Missense_Mutation_p.E147K	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	147						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTTAAATTTTCACTTACAGTC	0.378													64	103	---	---	---	---	PASS
PDE7A	5150	broad.mit.edu	37	8	66659966	66659966	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66659966C>G	uc003xvq.2	-	4	368	c.356G>C	c.(355-357)AGA>ACA	p.R119T	PDE7A_uc003xvr.2_Missense_Mutation_p.R119T|PDE7A_uc003xvp.2_Missense_Mutation_p.R93T	NM_002604	NP_002595	Q13946	PDE7A_HUMAN	phosphodiesterase 7A isoform b	119						cell fraction|cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding				0			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Dyphylline(DB00651)|Ketotifen(DB00920)	GCGTGAAGATCTAAGATATCG	0.343													15	33	---	---	---	---	PASS
TRIM55	84675	broad.mit.edu	37	8	67086866	67086866	+	3'UTR	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67086866G>A	uc003xvv.2	+	10					TRIM55_uc003xvu.2_3'UTR|TRIM55_uc003xvw.2_3'UTR|TRIM55_uc003xvx.2_3'UTR	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1							cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			CTGCCTGGCTGAGATGCATGT	0.468													22	86	---	---	---	---	PASS
SGK3	23678	broad.mit.edu	37	8	67705962	67705962	+	5'UTR	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67705962G>C	uc003xwr.2	+	2					SGK3_uc003xwp.2_5'UTR|SGK3_uc003xwt.2_5'UTR|SGK3_uc003xwu.2_5'UTR	NM_001033578	NP_001028750	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform						cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GTGTGCTCTTGAGGGATTAAA	0.408													6	15	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68981310	68981310	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68981310G>C	uc003xxv.1	+	12	1409	c.1382G>C	c.(1381-1383)AGA>ACA	p.R461T	PREX2_uc003xxu.1_Missense_Mutation_p.R461T|PREX2_uc011lez.1_Missense_Mutation_p.R396T	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	461	DEP 1.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						ATGTTATATAGATTTCGCTAT	0.348													24	46	---	---	---	---	PASS
WWP1	11059	broad.mit.edu	37	8	87439902	87439902	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87439902A>T	uc003ydt.2	+	11	1468	c.1188A>T	c.(1186-1188)AGA>AGT	p.R396S	WWP1_uc010mai.2_Missense_Mutation_p.R172S	NM_007013	NP_008944	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase	396	WW 2.				central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			lung(1)|liver(1)	2						ATCGTAGAAGAGTTTATTATG	0.373													55	125	---	---	---	---	PASS
FZD6	8323	broad.mit.edu	37	8	104337581	104337581	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104337581G>A	uc003ylh.2	+	4	1531	c.1247G>A	c.(1246-1248)CGA>CAA	p.R416Q	FZD6_uc003yli.2_Missense_Mutation_p.R416Q|FZD6_uc003ylj.2_Missense_Mutation_p.R416Q|FZD6_uc011lhn.1_Missense_Mutation_p.R382Q|FZD6_uc011lho.1_Missense_Mutation_p.R111Q|FZD6_uc011lhp.1_Missense_Mutation_p.R361Q	NM_003506	NP_003497	O60353	FZD6_HUMAN	frizzled 6 isoform a precursor	416	Cytoplasmic (Potential).				angiogenesis|axonogenesis|cell proliferation in midbrain|establishment of planar polarity|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|neural tube closure|non-canonical Wnt receptor signaling pathway	apical part of cell|apicolateral plasma membrane|cytoplasm|integral to plasma membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			TTTATGATTCGAATTGGAGTC	0.403													18	88	---	---	---	---	PASS
ZHX2	22882	broad.mit.edu	37	8	123964977	123964977	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123964977G>C	uc003ypk.1	+	3	1794	c.1227G>C	c.(1225-1227)TTG>TTC	p.L409F		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	409	Required for interaction with NFYA.|Required for repressor activity.|Required for nuclear localization.					cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			AGAGACCCTTGGTGACTCCCC	0.637													3	54	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124335198	124335198	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124335198C>A	uc003yqh.3	-	27	4219	c.4111G>T	c.(4111-4113)GAT>TAT	p.D1371Y	ATAD2_uc011lii.1_Missense_Mutation_p.D1162Y|ATAD2_uc003yqi.3_RNA	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1371					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GATGTTTTATCATGGTCCTTG	0.333													61	116	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124346190	124346190	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124346190C>T	uc003yqh.3	-	24	3514	c.3406G>A	c.(3406-3408)GAT>AAT	p.D1136N	ATAD2_uc011lii.1_Missense_Mutation_p.D927N|ATAD2_uc003yqi.3_RNA	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1136					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GATCTTTTATCACCAACAAGA	0.413													25	113	---	---	---	---	PASS
MTSS1	9788	broad.mit.edu	37	8	125568500	125568500	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125568500C>T	uc003yrk.2	-	12	1911	c.1377G>A	c.(1375-1377)CGG>CGA	p.R459R	NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_5'UTR|MTSS1_uc011lin.1_Silent_p.R233R|MTSS1_uc011lio.1_Silent_p.R349R|MTSS1_uc003yri.2_Silent_p.R177R|MTSS1_uc003yrj.2_Silent_p.R434R|MTSS1_uc003yrl.2_Silent_p.R463R	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	459					actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CAGTCATGCTCCGTGGTCTCT	0.632													9	22	---	---	---	---	PASS
NSMCE2	286053	broad.mit.edu	37	8	126114679	126114679	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126114679C>G	uc003yrw.2	+	3	335	c.107C>G	c.(106-108)TCT>TGT	p.S36C	NSMCE2_uc003yrv.2_Missense_Mutation_p.S36C	NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog	36					DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			TGTATCAACTCTGGTATGGAC	0.418													20	138	---	---	---	---	PASS
NSMCE2	286053	broad.mit.edu	37	8	126114697	126114697	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126114697C>T	uc003yrw.2	+	3	353	c.125C>T	c.(124-126)TCT>TTT	p.S42F	NSMCE2_uc003yrv.2_Missense_Mutation_p.S42F	NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog	42					DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			GACACAGCTTCTAGTGTTGCT	0.423													22	141	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139380150	139380150	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139380150C>T	uc003yuy.2	-	2	248	c.77G>A	c.(76-78)GGG>GAG	p.G26E	FAM135B_uc003yux.2_5'UTR|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	26										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GCATACTTACCCTCTCTGAAA	0.328										HNSCC(54;0.14)			7	88	---	---	---	---	PASS
ARHGAP39	80728	broad.mit.edu	37	8	145806415	145806415	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145806415C>T	uc003zdt.1	-	4	882	c.327G>A	c.(325-327)CTG>CTA	p.L109L	ARHGAP39_uc011llk.1_Silent_p.L109L|ARHGAP39_uc003zds.1_Silent_p.L109L	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	109					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						TGTTCTGCTTCAGCGTCTGCA	0.701													8	3	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2110409	2110409	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2110409C>T	uc003zhc.2	+	24	3547	c.3448C>T	c.(3448-3450)CCT>TCT	p.P1150S	SMARCA2_uc003zhd.2_Missense_Mutation_p.P1150S|SMARCA2_uc010mha.2_Missense_Mutation_p.P1083S	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	1150	Helicase C-terminal.				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CGACTGGAATCCTCATCAGGT	0.478													20	8	---	---	---	---	PASS
KIAA1797	54914	broad.mit.edu	37	9	20874759	20874759	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20874759C>G	uc003zog.1	+	21	2633	c.2270C>G	c.(2269-2271)TCT>TGT	p.S757C	KIAA1797_uc003zoh.1_Missense_Mutation_p.S193C	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	757						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		GTTCCTGGCTCTTGCTATCTC	0.408													23	22	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35386232	35386232	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35386232C>T	uc003zwq.2	+	23	3081	c.2789C>T	c.(2788-2790)TCC>TTC	p.S930F	UNC13B_uc003zwr.2_Missense_Mutation_p.S930F	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	930					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TGTTTGAACTCCACATATGAA	0.493													27	16	---	---	---	---	PASS
GDA	9615	broad.mit.edu	37	9	74764526	74764526	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74764526C>T	uc004aiq.2	+	1	234	c.51C>T	c.(49-51)TTC>TTT	p.F17F	GDA_uc011lse.1_Intron|GDA_uc011lsf.1_5'UTR|GDA_uc004air.2_Silent_p.F17F|GDA_uc010mow.1_RNA|GDA_uc004ais.2_5'UTR	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase	17					nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		GAGGGACGTTCGTCCACTCCA	0.697													6	8	---	---	---	---	PASS
STOM	2040	broad.mit.edu	37	9	124110421	124110421	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124110421G>C	uc004blh.2	-	6	612	c.532C>G	c.(532-534)CTG>GTG	p.L178V	STOM_uc011lyk.1_Missense_Mutation_p.L127V|STOM_uc004bli.2_Intron	NM_004099	NP_004090	P27105	STOM_HUMAN	stomatin isoform a	178	Cytoplasmic (Potential).				protein homooligomerization	cytoskeleton|integral to plasma membrane|melanosome|membrane raft	protein binding				0				OV - Ovarian serous cystadenocarcinoma(323;0.00107)|GBM - Glioblastoma multiforme(294;0.0137)		GCATCATCCAGAGTAGACTGT	0.502													39	21	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136804249	136804249	+	Silent	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136804249G>T	uc004ces.2	-	2	343	c.297C>A	c.(295-297)CTC>CTA	p.L99L	VAV2_uc004cer.2_Silent_p.L99L	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	99	CH.				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GCACATCGAAGAGGTCAAAGG	0.532													30	107	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137593102	137593102	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137593102C>T	uc004cfe.2	+	4	959	c.577C>T	c.(577-579)CGC>TGC	p.R193C		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	193	TSP N-terminal.|Laminin G-like.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ATTCCTCGACCGCAGCGACCA	0.517													25	28	---	---	---	---	PASS
KCNT1	57582	broad.mit.edu	37	9	138645821	138645821	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138645821C>T	uc011mdq.1	+	5	547	c.473C>T	c.(472-474)TCG>TTG	p.S158L	KCNT1_uc011mdr.1_5'UTR|KCNT1_uc010nbf.2_Missense_Mutation_p.S110L|KCNT1_uc004cgo.1_5'UTR	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	158						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		TTCAATGACTCGTCCTCCGAG	0.622													29	66	---	---	---	---	PASS
ARRDC1	92714	broad.mit.edu	37	9	140507904	140507904	+	Intron	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140507904C>G	uc004cns.2	+						ARRDC1_uc004cnt.2_Intron|ARRDC1_uc004cnu.2_RNA|ARRDC1_uc004cnv.2_Intron|ARRDC1_uc004cnw.2_Intron|ARRDC1_uc004cnp.1_Intron|ARRDC1_uc004cnq.1_Intron|ARRDC1_uc011mfb.1_Intron|ARRDC1_uc004cnx.1_5'UTR|ARRDC1_uc004cny.2_5'Flank	NM_152285	NP_689498	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1												0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)		TCCCTCCTGTCTCTGCAGGGA	0.652													8	7	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140707937	140707937	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140707937C>T	uc011mfc.1	+	21	3172	c.3135C>T	c.(3133-3135)TGC>TGT	p.C1045C	EHMT1_uc004coe.2_5'Flank	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1045					DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CTCAGAACTGCGTGACGTCCC	0.582													10	30	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141070139	141070139	+	Missense_Mutation	SNP	C	T	T	rs143443709	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141070139C>T	uc004com.2	+	3	298	c.37C>T	c.(37-39)CTC>TTC	p.L13F	TUBBP5_uc010ncq.2_Missense_Mutation_p.L127F					RecName: Full=Putative tubulin beta-4q chain;												0						CGGGCAGGTCCTCAGGCCAGA	0.667													6	38	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1405328	1405328	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1405328C>G	uc009xhq.2	-	3	1346	c.972G>C	c.(970-972)AAG>AAC	p.K324N		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	324	DRBM 2.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GGGCCAGCTTCTTGCTGCGCC	0.721													9	12	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24833013	24833013	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24833013A>C	uc001iru.3	+	19	5217	c.4814A>C	c.(4813-4815)TAT>TCT	p.Y1605S	KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irw.2_Intron|KIAA1217_uc001irz.2_Intron|KIAA1217_uc001irx.2_Missense_Mutation_p.Y1288S|KIAA1217_uc001iry.2_Intron|KIAA1217_uc001isa.1_Missense_Mutation_p.Y441S	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	1605					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						GTGGTAGTCTATGAAGAAGAG	0.468													40	80	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25886754	25886754	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25886754G>T	uc001isj.2	+	11	2259	c.2199G>T	c.(2197-2199)ATG>ATT	p.M733I	GPR158_uc001isk.2_Missense_Mutation_p.M108I	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	733	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						GAAAGAAGATGATCACAAACA	0.448													14	31	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29756815	29756815	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29756815G>A	uc001iut.1	-						LOC387647_uc001iuo.1_RNA|LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Intron|SVIL_uc001iuu.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				CTGCAAGGGAGAAACTCCAAG	0.398													29	197	---	---	---	---	PASS
EPC1	80314	broad.mit.edu	37	10	32635714	32635714	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32635714C>T	uc001iwg.1	-	1	400	c.130G>A	c.(130-132)GGA>AGA	p.G44R	EPC1_uc001iwi.3_Intron|EPC1_uc009xlt.2_Intron|EPC1_uc001iwh.1_Missense_Mutation_p.G44R	NM_025209	NP_079485	Q9H2F5	EPC1_HUMAN	enhancer of polycomb 1	44					histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)				TTCTCCATTCCGGTGGGCATC	0.647											OREG0020115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	38	79	---	---	---	---	PASS
FAM21C	253725	broad.mit.edu	37	10	46250443	46250443	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46250443G>C	uc001jcu.2	+	15	1399	c.1300G>C	c.(1300-1302)GAG>CAG	p.E434Q	FAM21C_uc001jcs.1_Missense_Mutation_p.E379Q|FAM21C_uc001jct.2_Missense_Mutation_p.E434Q|FAM21C_uc010qfi.1_Missense_Mutation_p.E410Q|FAM21C_uc010qfj.1_5'UTR|FAM21C_uc010qfk.1_5'Flank	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725	434										ovary(1)	1						ACAGAAGCCTGAGCAGCCCAC	0.493													8	25	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55755336	55755336	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55755336G>A	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_3'UTR	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				GCTGTCTTGTGATTCGGTCAT	0.338										HNSCC(58;0.16)			28	26	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61830487	61830487	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61830487C>G	uc001jky.2	-	37	10344	c.10152G>C	c.(10150-10152)CAG>CAC	p.Q3384H	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	3384					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TGTTCCCATTCTGGGCAATTT	0.463													13	41	---	---	---	---	PASS
ZNF518A	9849	broad.mit.edu	37	10	97919969	97919969	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97919969G>C	uc001klp.2	+	6	4747	c.3890G>C	c.(3889-3891)AGA>ACA	p.R1297T	ZNF518A_uc001klo.1_Missense_Mutation_p.R767T|ZNF518A_uc001klq.2_Missense_Mutation_p.R1297T|ZNF518A_uc001klr.2_Missense_Mutation_p.R1297T	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	1297					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		ACATTGCATAGAAAGTGTAAA	0.383													3	6	---	---	---	---	PASS
KIAA1598	57698	broad.mit.edu	37	10	118646210	118646210	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118646210G>A	uc009xyw.2	-						KIAA1598_uc001lcz.3_Intron|KIAA1598_uc010qso.1_Intron|KIAA1598_uc001lcy.3_Intron|KIAA1598_uc001lda.1_RNA	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN	shootin1 isoform a						axon guidance	axon					0				all cancers(201;0.00494)		AGTAGTCTTTGAGATGCCAGC	0.363													5	10	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1155713	1155713	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1155713G>C	uc009ycr.1	+	5	527	c.401G>C	c.(400-402)AGC>ACC	p.S134T		NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCACGCTGAGCAGGGTCCTC	0.637													12	14	---	---	---	---	PASS
OR56A5	390084	broad.mit.edu	37	11	5988888	5988888	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5988888G>C	uc010qzu.1	-	1	837	c.837C>G	c.(835-837)CTC>CTG	p.L279L		NM_001146033	NP_001139505	P0C7T3	O56A5_HUMAN	olfactory receptor, family 56, subfamily A,	279	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	olfactory receptor activity				0						GCAGGATGTTGAGCAGGATGG	0.527													4	11	---	---	---	---	PASS
CSNK2A1P	283106	broad.mit.edu	37	11	11373695	11373695	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11373695G>C	uc001mjp.2	-	1	1210	c.972C>G	c.(970-972)TTC>TTG	p.F324L	GALNTL4_uc001mjo.2_Intron	NM_177559	NP_808227			casein kinase II alpha 1 subunit isoform a												0						CAACAGTGTAGAAATAGGGGT	0.547													25	58	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14891224	14891224	+	3'UTR	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14891224G>C	uc001mln.2	+	16					PDE3B_uc010rcr.1_3'UTR	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TTGAGTAAAAGAAAAGTCATA	0.463													5	0	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32624470	32624470	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32624470G>C	uc001mtv.2	-	18	3171	c.3127C>G	c.(3127-3129)CTC>GTC	p.L1043V		NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	1043										ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					TTCGTAATGAGGCTCTGCCAG	0.368													48	38	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47806511	47806511	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47806511C>G	uc001ngm.2	-	33	4038	c.3953G>C	c.(3952-3954)GGA>GCA	p.G1318A	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	1318					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						CAGAGGCACTCCATGAGACAA	0.398													75	54	---	---	---	---	PASS
OR4A47	403253	broad.mit.edu	37	11	48511051	48511051	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48511051C>G	uc010rhx.1	+	1	707	c.707C>G	c.(706-708)TCA>TGA	p.S236*		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	236	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						AAAGCCCTCTCAACCTGCAGT	0.433													14	27	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49176030	49176030	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49176030G>A	uc001ngy.2	-	16	1899	c.1638C>T	c.(1636-1638)TTC>TTT	p.F546F	FOLH1_uc001ngx.2_5'UTR|FOLH1_uc001ngz.2_Silent_p.F546F|FOLH1_uc009yly.2_Silent_p.F531F|FOLH1_uc009ylz.2_Silent_p.F531F|FOLH1_uc009yma.2_Silent_p.F238F	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	546	NAALADase.|Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	GATAGCCGCTGAATTTGTTTG	0.333													3	21	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433450	55433450	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433450G>T	uc001nht.3	+	3	1073	c.808G>T	c.(808-810)GCT>TCT	p.A270S	OR4C6_uc010rik.1_Missense_Mutation_p.A270S	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	270	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						CAAGGCAATGGCTGTGTCAGA	0.463													15	9	---	---	---	---	PASS
SLC43A3	29015	broad.mit.edu	37	11	57193532	57193532	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57193532C>T	uc001nkg.2	-	3	524	c.114G>A	c.(112-114)AAG>AAA	p.K38K	PRG2_uc001nke.2_5'Flank|SLC43A3_uc001nkh.2_Silent_p.K38K|SLC43A3_uc010rjr.1_Silent_p.K38K|SLC43A3_uc009yme.2_Silent_p.K38K|SLC43A3_uc001nki.2_Silent_p.K38K|SLC43A3_uc009ymf.1_Silent_p.K38K|SLC43A3_uc010rjs.1_Silent_p.K38K|SLC43A3_uc009ymg.1_Silent_p.K38K	NM_014096	NP_054815	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	38					transmembrane transport	integral to membrane		p.K38K(1)		central_nervous_system(1)	1						AATCTTCATTCTTGAAGACAA	0.552													61	56	---	---	---	---	PASS
OR4D6	219983	broad.mit.edu	37	11	59224919	59224919	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59224919G>A	uc010rku.1	+	1	486	c.486G>A	c.(484-486)CTG>CTA	p.L162L		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	162	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AGGTAATTCTGATGCTTCCAT	0.517													44	78	---	---	---	---	PASS
SLC22A10	387775	broad.mit.edu	37	11	63129871	63129871	+	RNA	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63129871C>A	uc010rmo.1	+	9		c.993C>A						Q63ZE4	S22AA_HUMAN	Homo sapiens mRNA for putative protein product of HMFN2567, complete cds.							integral to membrane	transmembrane transporter activity			ovary(2)	2						AGCACCTGCTCAATGTCTGCT	0.433													8	1	---	---	---	---	PASS
C11orf85	283129	broad.mit.edu	37	11	64708119	64708119	+	Splice_Site	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64708119C>G	uc001ocb.1	-	8	548	c.474_splice	c.e8-1	p.R158_splice	C11orf85_uc001occ.1_Splice_Site|C11orf85_uc001ocd.1_Splice_Site_p.N102_splice	NM_001037225	NP_001032302	Q3KP22	CK085_HUMAN	hypothetical protein LOC283129												0						TTTCCCTATTCTGTTAAAAAG	0.413													64	59	---	---	---	---	PASS
SUV420H1	51111	broad.mit.edu	37	11	67926623	67926623	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67926623G>T	uc001onm.1	-	11	1446	c.1190C>A	c.(1189-1191)TCT>TAT	p.S397Y	SUV420H1_uc009yse.1_5'UTR|SUV420H1_uc001onn.1_Missense_Mutation_p.S225Y|SUV420H1_uc009ysf.2_Missense_Mutation_p.S157Y	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform	397					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						GCCAACTGAAGATTTTCGGTT	0.403													21	51	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70220944	70220944	+	Intron	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70220944C>G	uc001opo.2	+						PPFIA1_uc001opn.1_Intron|PPFIA1_uc001opp.2_Intron|PPFIA1_uc001opr.2_Intron|PPFIA1_uc001ops.2_Intron|uc001opt.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b						cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TGGTAGGAATCTTTCTCCTGC	0.433													216	17	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89424064	89424064	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89424064C>T	uc001pda.2	+	11	1240	c.714C>T	c.(712-714)TTC>TTT	p.F238F		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	238					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						CAAACAAATTCAGCGGCTATC	0.328													3	31	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93845207	93845207	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93845207C>G	uc001pep.2	+	20					uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor						copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				AAACATCATCCAAAGCAATTT	0.423													2	3	---	---	---	---	PASS
AMOTL1	154810	broad.mit.edu	37	11	94533316	94533316	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94533316G>A	uc001pfb.2	+	3	1130	c.960G>A	c.(958-960)ATG>ATA	p.M320I	AMOTL1_uc001pfc.2_Missense_Mutation_p.M270I	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	320						cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CCAAGCAAATGATGTCCCCAG	0.602													45	106	---	---	---	---	PASS
TRPC6	7225	broad.mit.edu	37	11	101375138	101375138	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101375138C>G	uc001pgk.3	-	2	987	c.562G>C	c.(562-564)GAA>CAA	p.E188Q	TRPC6_uc009ywy.2_Missense_Mutation_p.E188Q|TRPC6_uc009ywz.1_Missense_Mutation_p.E188Q	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	188	Cytoplasmic (Potential).|ANK 3.				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CTCTTGCCTTCAGCAAAAGCC	0.458													16	11	---	---	---	---	PASS
PVRL1	5818	broad.mit.edu	37	11	119548477	119548477	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119548477G>A	uc001pwv.2	-	3	693	c.521C>T	c.(520-522)TCA>TTA	p.S174L	PVRL1_uc001pwu.1_Missense_Mutation_p.S174L|PVRL1_uc001pww.2_Missense_Mutation_p.S174L	NM_002855	NP_002846	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 1	174	Extracellular (Potential).|Ig-like C2-type 1.				adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		CCCATTGGCTGAGGTGCAGGT	0.577													36	28	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128839644	128839644	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128839644C>T	uc009zcp.2	-	22	5422	c.5422G>A	c.(5422-5424)GAA>AAA	p.E1808K	ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Missense_Mutation_p.E767K|ARHGAP32_uc001qez.2_Missense_Mutation_p.E1459K	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	1808	Interaction with FYN.				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						TCCTTTCCTTCTGCCACTGAG	0.567													61	32	---	---	---	---	PASS
ERC1	23085	broad.mit.edu	37	12	1213916	1213916	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1213916G>A	uc001qjb.2	+	4	1328	c.1087G>A	c.(1087-1089)GAG>AAG	p.E363K	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.E363K|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Missense_Mutation_p.E363K|ERC1_uc010sdv.1_Missense_Mutation_p.E139K|ERC1_uc009zdp.2_5'UTR	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	363	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			TTTTCTACAGGAGATGCATCG	0.413													26	111	---	---	---	---	PASS
FBXL14	144699	broad.mit.edu	37	12	1675835	1675835	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1675835C>T	uc001qjh.2	-	2						NM_152441	NP_689654	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14							cytoplasm				ovary(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			gagctgtcatcaccagagtgc	0.000													15	69	---	---	---	---	PASS
FOXM1	2305	broad.mit.edu	37	12	2975580	2975580	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2975580C>G	uc001qlf.2	-	5	1219	c.954G>C	c.(952-954)TTG>TTC	p.L318F	FOXM1_uc001qle.2_Missense_Mutation_p.L318F|FOXM1_uc001qlg.2_Missense_Mutation_p.L318F|FOXM1_uc009zea.2_Missense_Mutation_p.L317F|FOXM1_uc009zeb.2_Missense_Mutation_p.L317F	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	forkhead box M1 isoform 2	318	Fork-head.				cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GGTCCAATGTCAAGTAGCGGT	0.507													25	76	---	---	---	---	PASS
CD163L1	283316	broad.mit.edu	37	12	7556186	7556186	+	Silent	SNP	A	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7556186A>G	uc001qsy.2	-	6	1379	c.1353T>C	c.(1351-1353)GAT>GAC	p.D451D	CD163L1_uc010sge.1_Silent_p.D461D	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	451	SRCR 4.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						TTGCTTTTCCATCATATGTGC	0.413													4	24	---	---	---	---	PASS
NANOG	79923	broad.mit.edu	37	12	7945759	7945759	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7945759T>A	uc009zfy.1	+	2	581	c.365T>A	c.(364-366)CTC>CAC	p.L122H		NM_024865	NP_079141	Q9H9S0	NANOG_HUMAN	Nanog homeobox	122	Homeobox.				cell proliferation|embryo development|somatic stem cell maintenance	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				Kidney(36;0.0872)		TACCTCAGCCTCCAGCAGATG	0.443													30	28	---	---	---	---	PASS
GPRC5D	55507	broad.mit.edu	37	12	13103173	13103173	+	Missense_Mutation	SNP	C	T	T	rs141265402		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13103173C>T	uc010shp.1	-	1	146	c.146G>A	c.(145-147)CGA>CAA	p.R49Q		NM_018654	NP_061124	Q9NZD1	GPC5D_HUMAN	G protein-coupled receptor, family C, group 5,	49	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		TTGGATCTTTCGCATGAGGAA	0.552													37	34	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26875357	26875357	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26875357G>A	uc001rhg.2	-	5	915	c.498C>T	c.(496-498)TTC>TTT	p.F166F	ITPR2_uc001rhh.1_Silent_p.F104F|ITPR2_uc001rhi.1_Silent_p.F166F	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	166	MIR 1.|Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TCAGTTTCCAGAACGGATGAA	0.388													10	21	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39711890	39711890	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39711890G>A	uc001rly.2	-	29	4039	c.3893C>T	c.(3892-3894)TCA>TTA	p.S1298L	KIF21A_uc001rlv.2_Intron|KIF21A_uc001rlw.2_Intron|KIF21A_uc001rlx.2_Missense_Mutation_p.S1285L|KIF21A_uc001rlz.2_Missense_Mutation_p.S1262L|KIF21A_uc010skl.1_Missense_Mutation_p.S1278L|KIF21A_uc001rlu.2_5'UTR	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1298					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				CTGCTGAACTGATGTGTTTCC	0.398													16	96	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49723705	49723705	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49723705A>C	uc001rtx.3	+	12	1397	c.1230A>C	c.(1228-1230)AAA>AAC	p.K410N	TROAP_uc009zlh.2_Missense_Mutation_p.K410N|TROAP_uc001rty.2_Missense_Mutation_p.K118N	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1	410					cell adhesion	cytoplasm				ovary(1)	1						GTTCTGGGAAACCACCGGTGG	0.552													11	263	---	---	---	---	PASS
KRT71	112802	broad.mit.edu	37	12	52940119	52940119	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52940119C>G	uc001sao.2	-	7	1346	c.1276G>C	c.(1276-1278)GAC>CAC	p.D426H		NM_033448	NP_258259	Q3SY84	K2C71_HUMAN	keratin 71	426	Coil 2.|Rod.						structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.194)		ATCTCCATGTCCAGGGCCAGC	0.667													12	86	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53457754	53457754	+	3'UTR	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53457754G>C	uc001sbp.2	+	29					TENC1_uc001sbl.2_3'UTR|TENC1_uc001sbn.2_3'UTR|TENC1_uc001sbq.2_3'UTR|TENC1_uc001sbr.2_RNA|TENC1_uc009zmr.2_3'UTR|TENC1_uc001sbs.2_3'UTR	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase						intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						GGACCCAGGAGACCCAGGAGA	0.612													11	18	---	---	---	---	PASS
OR6C6	283365	broad.mit.edu	37	12	55688666	55688666	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55688666G>A	uc010sph.1	-	1	351	c.351C>T	c.(349-351)TCC>TCT	p.S117S		NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C,	117	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|skin(1)	2						AGCGGTCATAGGACATGGCAG	0.403													6	11	---	---	---	---	PASS
DNAJC14	85406	broad.mit.edu	37	12	56188642	56188642	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56188642C>T	uc001shu.1	-	11	2431	c.2375G>A	c.(2374-2376)CGA>CAA	p.R792Q	SARNP_uc009zoa.2_RNA|SARNP_uc001shs.3_RNA|SARNP_uc001sht.2_Missense_Mutation_p.R109Q|SARNP_uc001shv.3_Missense_Mutation_p.R109Q	NM_032364	NP_115740	Q6Y2X3	DJC14_HUMAN	dopamine receptor interacting protein	Error:Variant_position_missing_in_Q6Y2X3_after_alignment					protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding			ovary(3)|large_intestine(1)	4						TACATTGAATCGTTCAGCCCT	0.428													11	20	---	---	---	---	PASS
IRAK3	11213	broad.mit.edu	37	12	66642122	66642122	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66642122C>G	uc001sth.2	+	12					IRAK3_uc010ssy.1_3'UTR	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3						interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		CCCAAACCCTCAAACAGAGTG	0.368													4	12	---	---	---	---	PASS
LGR5	8549	broad.mit.edu	37	12	71833917	71833917	+	Silent	SNP	G	A	A	rs147257938		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71833917G>A	uc001swl.2	+	1	105	c.57G>A	c.(55-57)GCG>GCA	p.A19A	TSPAN8_uc001swk.1_Intron|LGR5_uc001swm.2_Silent_p.A19A|LGR5_uc001swn.1_RNA	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	19						integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						TGCAGCTGGCGACCGGGGGCA	0.682													20	42	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99129230	99129230	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99129230C>G	uc001tge.1	-	26					ANKS1B_uc001tgf.1_3'UTR|ANKS1B_uc010svd.1_3'UTR|ANKS1B_uc001tgd.1_3'UTR	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TTGTTTCATTCTTTGCTTGTC	0.234													2	5	---	---	---	---	PASS
C12orf48	55010	broad.mit.edu	37	12	102591222	102591222	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102591222C>G	uc001tjf.2	+	11					C12orf48_uc001tjg.2_3'UTR|C12orf48_uc010swa.1_3'UTR|C12orf48_uc001tjh.2_3'UTR|C12orf48_uc010swb.1_3'UTR|C12orf48_uc009zuc.2_3'UTR|C12orf48_uc001tjj.2_3'UTR|C12orf48_uc001tjk.2_3'UTR|C12orf48_uc009zud.2_3'UTR|PMCH_uc001tjl.2_Intron	NM_017915	NP_060385	Q9NWS1	PR1BP_HUMAN	hypothetical protein LOC55010						response to DNA damage stimulus	cytoplasm|nucleus	DNA binding				0						ATAAAAGTATCAGTTTTACTT	0.328													4	16	---	---	---	---	PASS
BTBD11	121551	broad.mit.edu	37	12	108011968	108011968	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108011968G>A	uc001tmk.1	+	10	2786	c.2265G>A	c.(2263-2265)GAG>GAA	p.E755E	BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Silent_p.E755E|BTBD11_uc001tml.1_Silent_p.E292E	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	755	ANK 4.					integral to membrane	DNA binding			skin(2)|ovary(1)	3						CCCAGCCAGAGAAGGAGAAGA	0.597													9	64	---	---	---	---	PASS
UBE3B	89910	broad.mit.edu	37	12	109971290	109971290	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109971290G>A	uc001top.2	+	27	3545	c.2942G>A	c.(2941-2943)AGA>AAA	p.R981K	UBE3B_uc001toq.2_Missense_Mutation_p.R981K|UBE3B_uc001tos.2_Missense_Mutation_p.R408K|UBE3B_uc001tot.2_Missense_Mutation_p.R99K|UBE3B_uc010sxp.1_Missense_Mutation_p.R99K	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	981	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						AGCTGCTCCAGACCCCCGCTC	0.642													58	142	---	---	---	---	PASS
HSPB8	26353	broad.mit.edu	37	12	119617098	119617098	+	5'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119617098C>T	uc001txb.2	+	1					HSPB8_uc001txc.2_5'UTR	NM_014365	NP_055180	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8						cell death|response to heat	cytoplasm|nucleus	identical protein binding|protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ctctgtttctctctgagctga	0.358													54	95	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120263155	120263155	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120263155C>T	uc001txi.1	-	8	824	c.771G>A	c.(769-771)CCG>CCA	p.P257P	CIT_uc001txj.1_Silent_p.P257P	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	257	Protein kinase.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GGGTCCCAATCGGGAGTTTGG	0.493													40	64	---	---	---	---	PASS
VPS37B	79720	broad.mit.edu	37	12	123351840	123351840	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123351840C>T	uc001udl.2	-	4	784	c.681G>A	c.(679-681)ATG>ATA	p.M227I		NM_024667	NP_078943	Q9H9H4	VP37B_HUMAN	vacuolar protein sorting 37B	227	Pro-rich.				cellular membrane organization|endosome transport|protein transport	late endosome membrane					0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)		GTCCCGAACTCATGGCCGCAG	0.692													6	12	---	---	---	---	PASS
BRI3BP	140707	broad.mit.edu	37	12	125509985	125509985	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125509985C>T	uc001uha.1	+	3						NM_080626	NP_542193	Q8WY22	BRI3B_HUMAN	BRI3-binding protein							integral to membrane|mitochondrial outer membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.35e-05)|Epithelial(86;0.000426)|all cancers(50;0.00576)		GAAGGTCAGCCGGCCGGGCGG	0.547													6	12	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	130184379	130184379	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130184379G>C	uc009zyl.1	-	2	1272	c.944C>G	c.(943-945)TCC>TGC	p.S315C		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	315	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		ATCTTCAGTGGAATTTCTGGA	0.493													23	80	---	---	---	---	PASS
PSPC1	55269	broad.mit.edu	37	13	20357001	20357001	+	5'UTR	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20357001G>C	uc001uml.2	-	1					PSPC1_uc001umj.1_RNA|PSPC1_uc001umk.1_RNA	NM_001042414	NP_001035879	Q8WXF1	PSPC1_HUMAN	paraspeckle protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding			breast(1)	1		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		ACAAAATATCGACAATCAAGA	0.498													24	34	---	---	---	---	PASS
FLT3	2322	broad.mit.edu	37	13	28589746	28589746	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28589746C>T	uc001urw.2	-	21	2716	c.2634G>A	c.(2632-2634)CTG>CTA	p.L878L	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Silent_p.L837L	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	878	Protein kinase.|Cytoplasmic (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	AGATTTCCCACAGTAATATTC	0.552			Mis|O		AML|ALL								14	93	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32914733	32914733	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32914733G>C	uc001uub.1	+	11	6468	c.6241G>C	c.(6241-6243)GAG>CAG	p.E2081Q		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2081	BRCA2 8.				cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GGGAGTGTTAGAGGAATTTGA	0.353			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			56	71	---	---	---	---	PASS
SLC25A15	10166	broad.mit.edu	37	13	41379289	41379289	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41379289C>A	uc001uxn.2	+	4	672	c.350C>A	c.(349-351)TCT>TAT	p.S117Y	SUGT1L1_uc001uxp.1_Intron|SLC25A15_uc010tfb.1_Missense_Mutation_p.S23Y|SUGT1L1_uc001uxo.1_RNA	NM_014252	NP_055067	Q9Y619	ORNT1_HUMAN	mitochondrial ornithine transporter 1	117	Helical; Name=3; (Potential).|Solcar 2.				cellular amino acid metabolic process|mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity				0		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.48e-08)|Epithelial(112;7.51e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000191)|GBM - Glioblastoma multiforme(144;0.00231)|BRCA - Breast invasive adenocarcinoma(63;0.0704)	L-Ornithine(DB00129)	TCCTTCGCCTCTGCCTTTGCT	0.552													31	36	---	---	---	---	PASS
PIBF1	10464	broad.mit.edu	37	13	73590051	73590051	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73590051G>C	uc001vjc.2	+	18	2573	c.2268G>C	c.(2266-2268)AAG>AAC	p.K756N	PIBF1_uc010aep.2_Missense_Mutation_p.K215N	NM_006346	NP_006337	Q8WXW3	PIBF1_HUMAN	progesterone-induced blocking factor 1	756						centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		AAAAGATGAAGACCTAGTGTT	0.348													11	45	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110829360	110829360	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110829360G>A	uc001vqw.3	-	34	2863	c.2741C>T	c.(2740-2742)TCA>TTA	p.S914L	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	914	Triple-helical region.			S -> K (in Ref. 8; AA sequence).	angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCTGGGTCCTGAGGAGCCCGG	0.587													18	58	---	---	---	---	PASS
RPGRIP1	57096	broad.mit.edu	37	14	21762864	21762864	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21762864G>C	uc001wag.2	+	2	114	c.114G>C	c.(112-114)TTG>TTC	p.L38F		NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator	38					response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		AACCACCCTTGAGCAGGATGA	0.413													25	38	---	---	---	---	PASS
HECTD1	25831	broad.mit.edu	37	14	31614067	31614067	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31614067G>C	uc001wrc.1	-	16	3066	c.2577C>G	c.(2575-2577)CTC>CTG	p.L859L	HECTD1_uc001wrd.1_Silent_p.L374L	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	859					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CTATGTTTCTGAGTGTTACCA	0.358													24	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	38311413	38311413	+	Intron	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38311413C>T	uc001wug.2	+						uc001wuh.2_Missense_Mutation_p.R493C|uc001wui.2_RNA|uc001wuj.2_Missense_Mutation_p.R590C					Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																		AGCAAAAGTTCGTGGTAAAAT	0.348													22	36	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52535556	52535556	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52535556C>G	uc001wzo.2	-	1	391	c.157G>C	c.(157-159)GAC>CAC	p.D53H	NID2_uc010tqs.1_Missense_Mutation_p.D53H|NID2_uc010tqt.1_Missense_Mutation_p.D53H|NID2_uc001wzp.2_Missense_Mutation_p.D53H	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	53						basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					GAGCTTTCGTCGTCGCCTTCC	0.627													26	21	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	58949408	58949408	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58949408C>G	uc001xdv.3	+	20	3167	c.2894C>G	c.(2893-2895)TCA>TGA	p.S965*	KIAA0586_uc010trr.1_Nonsense_Mutation_p.S1082*|KIAA0586_uc001xdt.3_Nonsense_Mutation_p.S997*|KIAA0586_uc001xdu.3_Nonsense_Mutation_p.S1026*|KIAA0586_uc010trs.1_Nonsense_Mutation_p.S956*|KIAA0586_uc010trt.1_Nonsense_Mutation_p.S901*|KIAA0586_uc010tru.1_Nonsense_Mutation_p.S901*	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein	965										ovary(1)	1						GGGGATGCTTCAACAAATGAA	0.388													19	39	---	---	---	---	PASS
SIX4	51804	broad.mit.edu	37	14	61190738	61190738	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61190738C>G	uc001xfc.2	-	1	55	c.55G>C	c.(55-57)GAG>CAG	p.E19Q	SIX4_uc010app.1_Missense_Mutation_p.E11Q	NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4	19						nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		ATCCCATTCTCTTGCTTGATG	0.532													41	62	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63269243	63269243	+	Silent	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63269243C>G	uc001xfx.2	-	9	1677	c.1626G>C	c.(1624-1626)CGG>CGC	p.R542R	KCNH5_uc001xfy.2_Silent_p.R542R|KCNH5_uc001xfz.1_Silent_p.R484R	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	542	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TAAAAACCTTCCGGTTTAGAT	0.493													4	11	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64586261	64586261	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64586261G>A	uc001xgm.2	+	67	13187	c.12957G>A	c.(12955-12957)CTG>CTA	p.L4319L	SYNE2_uc001xgl.2_Silent_p.L4319L|SYNE2_uc010apy.2_Silent_p.L704L|SYNE2_uc010apz.1_Silent_p.L211L	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4319	Cytoplasmic (Potential).|Potential.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CCCTGAAACTGAAAACAGTGA	0.428													32	21	---	---	---	---	PASS
PLEKHH1	57475	broad.mit.edu	37	14	68043123	68043123	+	Silent	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68043123C>G	uc001xjl.1	+	17	2506	c.2364C>G	c.(2362-2364)CTC>CTG	p.L788L	PLEKHH1_uc010tsw.1_Silent_p.L356L|PLEKHH1_uc001xjn.1_Silent_p.L303L|PLEKHH1_uc010tsx.1_5'Flank	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	788	PH 2.					cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		ATACGTGGCTCTACCACCTCA	0.582													9	27	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	79270112	79270112	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79270112G>T	uc001xun.2	+	6	1566	c.1075G>T	c.(1075-1077)GAC>TAC	p.D359Y	NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.D493Y	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	732	Laminin G-like 4.|Extracellular (Potential).				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GGACTCTGCCGACACCCTGCG	0.572													12	21	---	---	---	---	PASS
ASB2	51676	broad.mit.edu	37	14	94405833	94405833	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94405833G>A	uc001ycc.1	-	6	1583	c.1094C>T	c.(1093-1095)TCC>TTC	p.S365F	ASB2_uc001ycb.1_Missense_Mutation_p.S59F|ASB2_uc001ycd.2_Missense_Mutation_p.S413F|ASB2_uc001yce.1_Missense_Mutation_p.S311F	NM_016150	NP_057234	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box-containing protein	365	ANK 10.				intracellular signal transduction					ovary(1)|pancreas(1)	2		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GTACAGCGCGGAGCTGCGCCG	0.687													6	22	---	---	---	---	PASS
ASPG	374569	broad.mit.edu	37	14	104570652	104570652	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104570652C>G	uc001yoq.1	+	8	825	c.765C>G	c.(763-765)TTC>TTG	p.F255L	ASPG_uc001yoo.1_Missense_Mutation_p.F283L|ASPG_uc001yop.1_Missense_Mutation_p.F255L|ASPG_uc001yor.1_Missense_Mutation_p.F255L	NM_001080464	NP_001073933	Q86U10	LPP60_HUMAN	60 kDa lysophospholipase	255	Asparaginase.				lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0						TTCGGGCCTTCTTGCAGCCTC	0.677													8	23	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106109966	106109966	+	RNA	SNP	T	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106109966T>C	uc010tyt.1	-	3642		c.61285A>G			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_RNA					Parts of antibodies, mostly variable regions.												0						CCACCTTTGGTTTTGGAGATG	0.622													5	321	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106134808	106134808	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106134808G>A	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001ysb.1_RNA					Parts of antibodies, mostly variable regions.												0						TGTCGCTGGGGTAGAAGCCTT	0.602													6	252	---	---	---	---	PASS
LOC646214	646214	broad.mit.edu	37	15	21936850	21936850	+	RNA	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21936850G>C	uc010tzj.1	-	1		c.3890C>G				NR_027053				Homo sapiens mRNA for p21-activated kinase 2 variant protein.												0						ATGATACCCAGAGACCATACA	0.493													23	115	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22440232	22440232	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22440232C>T	uc001yug.2	-	1										full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																		ATTTGCCCTTCCGGGCCTTGA	0.418													10	25	---	---	---	---	PASS
TUBGCP5	114791	broad.mit.edu	37	15	22864348	22864348	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22864348G>A	uc001yur.3	+	16	2436	c.2306G>A	c.(2305-2307)CGT>CAT	p.R769H	TUBGCP5_uc001yuq.2_Missense_Mutation_p.R769H	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	769					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		GTAGGACAGCGTTATCCTGAA	0.289													6	156	---	---	---	---	PASS
SNORD116-12	100033424	broad.mit.edu	37	15	25322078	25322078	+	5'Flank	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25322078G>A	uc001yxv.1	+						SNORD116-4_uc001yxh.1_RNA|SNORD116-4_uc001yxm.1_RNA|IPW_uc001yxn.3_RNA|SNORD116-13_uc001yxw.2_5'Flank	NR_003327				Homo sapiens small nucleolar RNA, C/D box 116-12 (SNORD116-12), non-coding RNA.												0						GGAGATGCCAGGAAGCCCCTT	0.527													12	18	---	---	---	---	PASS
LPCAT4	254531	broad.mit.edu	37	15	34656380	34656380	+	Intron	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34656380G>C	uc001zig.2	-						LPCAT4_uc010bav.1_Silent_p.L202L	NM_153613	NP_705841	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding				0						AGATGGTCTTGAGACCCTTAC	0.562													62	326	---	---	---	---	PASS
C15orf52	388115	broad.mit.edu	37	15	40627333	40627333	+	3'UTR	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40627333G>A	uc001zlh.3	-	11					C15orf52_uc010ucn.1_3'UTR	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115											large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		TCTCCCCGGGGACTCCCCAGC	0.632													63	232	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43783886	43783886	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43783886G>T	uc001zrs.2	-	4	485	c.337C>A	c.(337-339)CAG>AAG	p.Q113K	TP53BP1_uc010udp.1_Missense_Mutation_p.Q113K|TP53BP1_uc001zrq.3_Missense_Mutation_p.Q118K|TP53BP1_uc001zrr.3_Missense_Mutation_p.Q118K|TP53BP1_uc010udq.1_Missense_Mutation_p.Q118K	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	113					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTGTTTGGCTGAGGTAACTGC	0.393								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					169	335	---	---	---	---	PASS
B2M	567	broad.mit.edu	37	15	45007713	45007713	+	Missense_Mutation	SNP	G	A	A	rs148494241		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45007713G>A	uc001zuc.2	+	2	220	c.160G>A	c.(160-162)GAC>AAC	p.D54N	B2M_uc010uek.1_Missense_Mutation_p.D54N|B2M_uc010bdx.1_Missense_Mutation_p.D54N	NM_004048	NP_004039	P61769	B2MG_HUMAN	beta-2-microglobulin precursor	54	Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of defense response to virus by virus|viral reproduction	early endosome membrane|Golgi membrane|MHC class I protein complex	protein binding			ovary(2)|skin(1)	3		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCATCCATCCGACATTGAAGT	0.408													65	252	---	---	---	---	PASS
PLDN	26258	broad.mit.edu	37	15	45898737	45898737	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45898737C>T	uc001zvq.2	+	5					PLDN_uc001zvr.2_RNA|PLDN_uc001zvs.2_RNA	NM_012388	NP_036520	Q9UL45	PLDN_HUMAN	pallidin						post-Golgi vesicle-mediated transport|synaptic vesicle docking involved in exocytosis	BLOC-1 complex|endomembrane system|membrane	identical protein binding|syntaxin-13 binding			skin(1)	1		Lung NSC(122;1.6e-06)|all_lung(180;1.13e-05)|Melanoma(134;0.027)		all cancers(107;6.58e-18)|GBM - Glioblastoma multiforme(94;5.91e-07)		GTGTTTTCTTCTCCTGTCCCA	0.413													15	63	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59502740	59502740	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59502740G>A	uc002aga.2	-	13	1707	c.1335C>T	c.(1333-1335)ATC>ATT	p.I445I		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	445	Myosin head-like.				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		GGTCACATACGATTTTATTAT	0.348													19	128	---	---	---	---	PASS
C15orf59	388135	broad.mit.edu	37	15	74032895	74032895	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74032895G>C	uc002avy.2	-	2	590	c.245C>G	c.(244-246)TCT>TGT	p.S82C		NM_001039614	NP_001034703	Q2T9L4	CO059_HUMAN	hypothetical protein LOC388135	82										pancreas(1)	1						GTCACTGCTAGAGGTGCTGCT	0.587													84	385	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74290639	74290639	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74290639G>C	uc002awv.2	+	2	564	c.424G>C	c.(424-426)GAG>CAG	p.E142Q	PML_uc002awm.2_Missense_Mutation_p.E142Q|PML_uc002awl.2_Missense_Mutation_p.E142Q|PML_uc002awj.1_Missense_Mutation_p.E142Q|PML_uc002awk.2_Missense_Mutation_p.E142Q|PML_uc002awn.2_Missense_Mutation_p.E142Q|PML_uc002awo.2_Missense_Mutation_p.E142Q|PML_uc002awp.2_Missense_Mutation_p.E142Q|PML_uc002awq.2_Missense_Mutation_p.E142Q|PML_uc002awr.2_Missense_Mutation_p.E142Q|PML_uc002aws.2_Missense_Mutation_p.E142Q|PML_uc002awt.2_Missense_Mutation_p.E142Q|PML_uc002awu.2_Missense_Mutation_p.E142Q|PML_uc010ule.1_Intron|PML_uc002aww.1_Missense_Mutation_p.E57Q	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	142	B box-type 1; atypical.				cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						CTGGTGCTTTGAGTGCGAGCA	0.637			T	RARA|PAX5	APL|ALL								11	46	---	---	---	---	PASS
PTPN9	5780	broad.mit.edu	37	15	75798059	75798059	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75798059C>G	uc002bal.2	-	7	1433	c.925G>C	c.(925-927)GAC>CAC	p.D309H		NM_002833	NP_002824	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type	309	Tyrosine-protein phosphatase.					cytoplasmic part	non-membrane spanning protein tyrosine phosphatase activity|protein binding			lung(1)|skin(1)	2						CGACGAATGTCTTCATATTCC	0.473													110	209	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79296180	79296180	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79296180C>T	uc002beq.2	-	16	2836	c.2461G>A	c.(2461-2463)GAG>AAG	p.E821K	RASGRF1_uc002bep.2_Missense_Mutation_p.E805K|RASGRF1_uc010blm.1_Missense_Mutation_p.E730K|RASGRF1_uc002ber.3_Missense_Mutation_p.E805K|RASGRF1_uc010unh.1_Missense_Mutation_p.E216K|RASGRF1_uc002beo.2_Missense_Mutation_p.E37K	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	823					activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						TCGGGCTTCTCAGGGGTCGTA	0.627													34	43	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	82635117	82635117	+	RNA	SNP	T	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82635117T>C	uc002bgx.2	-	5		c.463A>G						A6NI86	GG6LA_HUMAN	Homo sapiens cDNA FLJ40113 fis, clone TESTI2008621.												0						TTTTTCAATTTCTTGACCCGC	0.383													3	44	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85401089	85401089	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85401089C>T	uc002ble.2	+	6	3893	c.3726C>T	c.(3724-3726)CTC>CTT	p.L1242L		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1242					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCCGCCGCCTCACCGGCCTCC	0.692													8	17	---	---	---	---	PASS
SYNM	23336	broad.mit.edu	37	15	99671728	99671728	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99671728G>A	uc002bup.2	+	6	3283	c.3163G>A	c.(3163-3165)GGA>AGA	p.G1055R	SYNM_uc002buo.2_Missense_Mutation_p.G1055R|SYNM_uc002buq.2_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	1055	Tail.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						TGAGGAAGGTGGAGCGGAGGC	0.652													12	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102292797	102292797	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102292797C>G	uc010usj.1	+	4	444	c.385C>G	c.(385-387)CCA>GCA	p.P129A	uc002bxo.2_RNA|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		GAGCTGCTGTCCAACCTGCAC	0.597													3	32	---	---	---	---	PASS
LOC100134368	100134368	broad.mit.edu	37	16	436837	436837	+	Intron	SNP	G	C	C	rs369360		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:436837G>C	uc002cgw.1	+						uc002cgx.3_Missense_Mutation_p.K49N	NR_024453				Homo sapiens cDNA clone IMAGE:3636396, partial cds.												0						TAAAGGCCAAGAAGGCAGCGT	0.532													29	118	---	---	---	---	PASS
LOC100134368	100134368	broad.mit.edu	37	16	437153	437153	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:437153G>A	uc002cgw.1	+						uc002cgx.3_Missense_Mutation_p.D155N	NR_024453				Homo sapiens cDNA clone IMAGE:3636396, partial cds.												0						GATTCCGCCTGATGGAGAGAA	0.493													22	94	---	---	---	---	PASS
LOC100134368	100134368	broad.mit.edu	37	16	437161	437161	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:437161G>A	uc002cgw.1	+						uc002cgx.3_Silent_p.E157E	NR_024453				Homo sapiens cDNA clone IMAGE:3636396, partial cds.												0						CTGATGGAGAGAAGAAGGCAT	0.478													22	92	---	---	---	---	PASS
WDR90	197335	broad.mit.edu	37	16	703802	703802	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:703802C>T	uc002cii.1	+	13	1490	c.1436C>T	c.(1435-1437)ACG>ATG	p.T479M	WDR90_uc002cig.1_Missense_Mutation_p.T479M|WDR90_uc002cih.1_Missense_Mutation_p.T480M|WDR90_uc002cij.1_RNA|WDR90_uc002cik.1_5'Flank|WDR90_uc002cil.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	479	WD 2.									ovary(1)	1		Hepatocellular(780;0.0218)				CACGGGAGGACGGTAACAGGG	0.627													9	41	---	---	---	---	PASS
CCDC78	124093	broad.mit.edu	37	16	773990	773990	+	Intron	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:773990C>T	uc002cjg.2	-						CCDC78_uc002cjf.2_Intron|CCDC78_uc002cji.3_3'UTR|CCDC78_uc002cjj.3_3'UTR|CCDC78_uc002cjh.2_Intron|HAGHL_uc002cjl.1_5'Flank|HAGHL_uc002cjm.1_5'Flank	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78											central_nervous_system(1)	1		Hepatocellular(780;0.0218)				GCAAGCCCCTCAGAGGCCCGG	0.662													11	18	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4945714	4945714	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4945714G>A	uc002cyd.1	-	10	1066	c.976C>T	c.(976-978)CAC>TAC	p.H326Y		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	326	Potential.|Spectrin 2.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						ACGTCTTCGTGAAACTAGGGG	0.582													75	98	---	---	---	---	PASS
ZC3H7A	29066	broad.mit.edu	37	16	11868313	11868313	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11868313G>A	uc002dbk.2	-	8	880	c.682C>T	c.(682-684)CAT>TAT	p.H228Y	ZC3H7A_uc002dbl.2_Missense_Mutation_p.H228Y|ZC3H7A_uc002dbm.1_Missense_Mutation_p.H228Y	NM_014153	NP_054872	Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	228						nucleus	nucleic acid binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						CCAACTTCATGAGAAAAACTG	0.458													48	69	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15198590	15198590	+	Intron	SNP	C	T	T	rs113675370		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198590C>T	uc002ddc.2	+						uc010uzr.1_Missense_Mutation_p.R100H|uc010uzs.1_RNA|uc002ddh.2_3'UTR|uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGAAGAATGACGATGCTCCGC	0.488													13	95	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20410611	20410611	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20410611G>A	uc002dhc.1	-	2	235	c.12C>T	c.(10-12)CTC>CTT	p.L4L		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	4					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						GGGGCATCCAGAGTAGGTCCA	0.592													21	82	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20430712	20430712	+	Nonsense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20430712C>G	uc002dhe.2	+	4	725	c.578C>G	c.(577-579)TCA>TGA	p.S193*	ACSM5_uc002dhd.1_Nonsense_Mutation_p.S193*	NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	193					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						CTGCTGGTGTCAGACAGCAGT	0.557													19	27	---	---	---	---	PASS
PRKCB	5579	broad.mit.edu	37	16	24202490	24202490	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24202490G>A	uc002dmd.2	+	16	1999	c.1802G>A	c.(1801-1803)CGG>CAG	p.R601Q	PRKCB_uc002dme.2_Missense_Mutation_p.R601Q	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	601	AGC-kinase C-terminal.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	GCATTTTTCCGGTATATTGAT	0.463													3	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	29115398	29115398	+	Intron	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29115398C>G	uc010vct.1	-						RRN3P2_uc002dsf.3_RNA|RRN3P2_uc002dsg.3_RNA|RRN3P2_uc010vdn.1_RNA|uc002dsh.1_RNA					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GTTGACAGGTCAAAGAAATTC	0.363													34	120	---	---	---	---	PASS
TAOK2	9344	broad.mit.edu	37	16	29999180	29999180	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29999180G>A	uc002dva.1	+	16	4370	c.3587G>A	c.(3586-3588)CGG>CAG	p.R1196Q	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Intron|TAOK2_uc002dvc.1_Intron|TAOK2_uc010bzm.1_Missense_Mutation_p.R1203Q|TAOK2_uc002dvd.1_Missense_Mutation_p.R1023Q	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN	TAO kinase 2 isoform 2	1196					actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						CGAATCCCCCGGCTACTACCA	0.721													3	15	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56906612	56906612	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56906612G>C	uc010ccm.2	+	8	1038	c.1009G>C	c.(1009-1011)GAT>CAT	p.D337H	SLC12A3_uc002ekd.3_Missense_Mutation_p.D337H|SLC12A3_uc010ccn.2_Missense_Mutation_p.D336H	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	337					sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	GCGGGGTCCAGATGGCACCTT	0.562													41	40	---	---	---	---	PASS
MMP15	4324	broad.mit.edu	37	16	58071406	58071406	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58071406C>G	uc002ena.2	+	2	1166	c.193C>G	c.(193-195)CAG>GAG	p.Q65E		NM_002428	NP_002419	P51511	MMP15_HUMAN	matrix metalloproteinase 15 preproprotein	65					protein modification process|proteolysis	extracellular matrix|integral to plasma membrane	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|protein binding|zinc ion binding			central_nervous_system(2)|breast(1)	3						CTACCTGCCTCAGCCCAGCCG	0.453													7	15	---	---	---	---	PASS
NDRG4	65009	broad.mit.edu	37	16	58537754	58537754	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58537754C>G	uc002eno.2	+	2	180	c.74C>G	c.(73-75)TCC>TGC	p.S25C	NDRG4_uc002enk.2_Missense_Mutation_p.S57C|NDRG4_uc002enm.2_Missense_Mutation_p.S77C|NDRG4_uc010vif.1_Missense_Mutation_p.S57C|NDRG4_uc010cdk.2_Missense_Mutation_p.S25C|NDRG4_uc010vig.1_Missense_Mutation_p.S55C|NDRG4_uc010vih.1_5'UTR|NDRG4_uc010vii.1_Missense_Mutation_p.S43C|NDRG4_uc002enp.2_Missense_Mutation_p.S25C|NDRG4_uc002enq.1_5'Flank	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1	25					cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						ATCCGGGGCTCCCCCAAGGGG	0.622													10	71	---	---	---	---	PASS
TK2	7084	broad.mit.edu	37	16	66584022	66584022	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66584022G>C	uc002eos.2	-	1	294	c.69C>G	c.(67-69)GTC>GTG	p.V23V	TK2_uc010vip.1_5'Flank|TK2_uc002eor.2_Intron|TK2_uc010cdq.2_Intron|TK2_uc010cdr.2_5'UTR|TK2_uc010viq.1_Silent_p.V23V|TK2_uc010vir.1_Silent_p.V23V	NM_004614	NP_004605	O00142	KITM_HUMAN	thymidine kinase 2, mitochondrial	Error:Variant_position_missing_in_O00142_after_alignment					pyrimidine base metabolic process|pyrimidine nucleoside salvage	mitochondrial matrix	ATP binding|phosphotransferase activity, alcohol group as acceptor|thymidine kinase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0736)|Epithelial(162;0.237)		CGGCGCGGACGACTGCTAGTC	0.682													17	16	---	---	---	---	PASS
KIAA0895L	653319	broad.mit.edu	37	16	67210678	67210678	+	3'UTR	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67210678C>A	uc002ert.2	-	7					KIAA0895L_uc002err.2_RNA|KIAA0895L_uc002ers.2_3'UTR|KIAA0895L_uc002eru.2_3'UTR	NM_001040715	NP_001035805	Q68EN5	K895L_HUMAN	hypothetical protein LOC653319												0						TCTGGAGCTTCTGTCCAGGGC	0.602													46	336	---	---	---	---	PASS
EDC4	23644	broad.mit.edu	37	16	67915727	67915727	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67915727G>C	uc002eur.2	+	22	3149	c.2983G>C	c.(2983-2985)GAG>CAG	p.E995Q	EDC4_uc010cer.2_Missense_Mutation_p.E614Q|EDC4_uc002eus.2_Missense_Mutation_p.E725Q|EDC4_uc002eut.1_5'Flank	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	995	Potential.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		ACGTGCCCTTGAGACTCGGCA	0.602													33	101	---	---	---	---	PASS
CTRL	1506	broad.mit.edu	37	16	67963754	67963754	+	3'UTR	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67963754G>C	uc002euw.2	-	7						NM_001907	NP_001898	P40313	CTRL_HUMAN	chymotrypsin-like precursor						digestion|proteolysis	extracellular space	serine-type endopeptidase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		TCTTTCTCCTGAGCCAGGAAG	0.547													24	134	---	---	---	---	PASS
CTRL	1506	broad.mit.edu	37	16	67964633	67964633	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67964633G>A	uc002euw.2	-	4	324	c.314C>T	c.(313-315)TCT>TTT	p.S105F		NM_001907	NP_001898	P40313	CTRL_HUMAN	chymotrypsin-like precursor	105	Peptidase S1.				digestion|proteolysis	extracellular space	serine-type endopeptidase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		ACTCACCCGAGAGACGGACAG	0.607													38	147	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72923775	72923775	+	Silent	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72923775G>C	uc002fck.2	-	4	3976	c.3303C>G	c.(3301-3303)CTC>CTG	p.L1101L	ZFHX3_uc002fcl.2_Silent_p.L187L	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	1101	C2H2-type 9; atypical.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GGATGAGGTTGAGCTTGGCCT	0.572													12	119	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81194452	81194452	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81194452C>A	uc002fgh.1	-	22	3536	c.3536G>T	c.(3535-3537)AGT>ATT	p.S1179I	PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	1179	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						AGCTTCAGGACTGGTCAGGTT	0.552													9	32	---	---	---	---	PASS
KIAA0182	23199	broad.mit.edu	37	16	85701811	85701811	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85701811C>G	uc002fix.2	+	14	3270	c.3196C>G	c.(3196-3198)CCT>GCT	p.P1066A	KIAA0182_uc002fiw.2_Missense_Mutation_p.P962A|KIAA0182_uc002fiy.2_Missense_Mutation_p.P993A|KIAA0182_uc002fiz.2_Missense_Mutation_p.P208A|KIAA0182_uc010cho.2_Missense_Mutation_p.P246A	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1	1066							protein binding			large_intestine(3)|ovary(1)|skin(1)	5						CTACAACATTCCTGAGCTGCA	0.637													43	109	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89805349	89805349	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89805349G>C	uc002fou.1	-	42	4243	c.4201C>G	c.(4201-4203)CTT>GTT	p.L1401V	ZNF276_uc010ciq.2_3'UTR|ZNF276_uc002foq.3_3'UTR|ZNF276_uc010cir.2_RNA|ZNF276_uc002for.3_3'UTR|ZNF276_uc010cis.2_3'UTR|ZNF276_uc002fos.3_3'UTR|ZNF276_uc002fot.3_RNA|ZNF276_uc010vpm.1_3'UTR|FANCA_uc010vpn.1_Missense_Mutation_p.S1402C	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	1401					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		AGCAGAAAAAGACGAGCTTTT	0.512			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				70	63	---	---	---	---	PASS
C17orf85	55421	broad.mit.edu	37	17	3721711	3721711	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3721711G>A	uc010ckl.1	-	10	1179	c.1156C>T	c.(1156-1158)CGG>TGG	p.R386W	C17orf85_uc002fwr.2_Missense_Mutation_p.R96W|C17orf85_uc002fwq.2_Missense_Mutation_p.R106W	NM_001114118	NP_001107590	Q53F19	CQ085_HUMAN	ELG protein isoform a	386							nucleotide binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		GACGCGCTCCGCTCCCGGGGC	0.473													33	93	---	---	---	---	PASS
ZNF594	84622	broad.mit.edu	37	17	5085754	5085754	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5085754C>G	uc010cla.1	-	2	1954	c.1798G>C	c.(1798-1800)GAA>CAA	p.E600Q		NM_032530	NP_115919	Q96JF6	ZN594_HUMAN	zinc finger protein 594	600	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3						TTCCCACATTCTTTGCATTCA	0.408													175	136	---	---	---	---	PASS
MPDU1	9526	broad.mit.edu	37	17	7486993	7486993	+	5'UTR	SNP	A	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7486993A>G	uc002ghw.2	+	1					MPDU1_uc010vub.1_5'UTR|MPDU1_uc002ghx.2_5'UTR|MPDU1_uc010vuc.1_5'UTR	NM_004870	NP_004861	O75352	MPU1_HUMAN	mannose-P-dolichol utilization defect 1						dolichol-linked oligosaccharide biosynthetic process|protein folding	endoplasmic reticulum membrane|integral to membrane|mitochondrion	protein binding			central_nervous_system(1)	1						AGCGCGTCCAAAACGTGGTCC	0.577													12	7	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578449	7578449	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578449C>T	uc002gim.2	-	5	675	c.481G>A	c.(481-483)GCC>ACC	p.A161T	TP53_uc002gig.1_Missense_Mutation_p.A161T|TP53_uc002gih.2_Missense_Mutation_p.A161T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.A29T|TP53_uc010cng.1_Missense_Mutation_p.A29T|TP53_uc002gii.1_Missense_Mutation_p.A29T|TP53_uc010cnh.1_Missense_Mutation_p.A161T|TP53_uc010cni.1_Missense_Mutation_p.A161T|TP53_uc002gij.2_Missense_Mutation_p.A161T|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.A68T|TP53_uc002gio.2_Missense_Mutation_p.A29T|TP53_uc010vug.1_Missense_Mutation_p.A122T	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	161	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		MA -> IP (in a sporadic cancer; somatic mutation).|MA -> IS (in sporadic cancers; somatic mutation).|MA -> IT (in a sporadic cancer; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).|A -> D (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> T (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.A161T(44)|p.A161D(8)|p.0?(7)|p.A161V(7)|p.A161A(5)|p.A161fs*9(3)|p.R156_I162delRVRAMAI(2)|p.M160fs*10(2)|p.V157_C176del20(1)|p.A161fs*19(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.A161fs*10(1)|p.R156_A161del(1)|p.V157fs*9(1)|p.A161fs*20(1)|p.M160_A161>IS(1)|p.A161fs*8(1)|p.A161G(1)|p.S149fs*72(1)|p.A161fs*7(1)|p.T155_A161delTRVRAMA(1)|p.R156fs*20(1)|p.A161S(1)|p.A161P(1)|p.V157_I162delVRAMAI(1)|p.A161F(1)|p.A159_Q167delAMAIYKQSQ(1)|p.R158fs*8(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTGTAGATGGCCATGGCGCGG	0.632		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			40	39	---	---	---	---	PASS
UBB	7314	broad.mit.edu	37	17	16285788	16285788	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16285788C>T	uc002gpx.2	+	2	705	c.567C>T	c.(565-567)CCC>CCT	p.P189P	UBB_uc010vwe.1_Silent_p.P113P	NM_018955	NP_061828	P0CG47	UBB_HUMAN	ubiquitin B precursor	189	Ubiquitin-like 3.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		AAGGCATCCCCCCCGACCAGC	0.552													3	65	---	---	---	---	PASS
CCDC144A	9720	broad.mit.edu	37	17	16623915	16623915	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16623915C>T	uc002gqk.1	+	8	1910	c.1834C>T	c.(1834-1836)CAC>TAC	p.H612Y	CCDC144A_uc002gql.1_Missense_Mutation_p.H82Y|LOC162632_uc010cpj.1_RNA	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	612											0						TGAATTGTCTCACTCTGTTTA	0.373													5	40	---	---	---	---	PASS
DRG2	1819	broad.mit.edu	37	17	18004839	18004839	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18004839G>C	uc002gsh.1	+	8	719	c.664G>C	c.(664-666)GAC>CAC	p.D222H	DRG2_uc002gsi.1_RNA|DRG2_uc002gsj.1_Missense_Mutation_p.D222H	NM_001388	NP_001379	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	222					signal transduction		GTP binding			ovary(1)	1	all_neural(463;0.228)					TTTCCGAGAAGACTGCTCCCC	0.607													31	45	---	---	---	---	PASS
DRG2	1819	broad.mit.edu	37	17	18005268	18005268	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18005268G>A	uc002gsh.1	+	9	818	c.763G>A	c.(763-765)GAG>AAG	p.E255K	DRG2_uc002gsi.1_RNA|DRG2_uc002gsj.1_Missense_Mutation_p.E255K	NM_001388	NP_001379	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	255					signal transduction		GTP binding			ovary(1)	1	all_neural(463;0.228)					CTCCATGGAAGAGGTGGACCG	0.567													16	8	---	---	---	---	PASS
CCDC144B	284047	broad.mit.edu	37	17	18498091	18498091	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18498091G>A	uc002gub.1	-	8	1919	c.1834C>T	c.(1834-1836)CAC>TAC	p.H612Y	CCDC144B_uc002gua.3_RNA|CCDC144B_uc010vyc.1_RNA	NM_182568	NP_872374			coiled-coil domain containing 144B											ovary(1)|skin(1)	2						TAAACAGAGTGAGACAATTCA	0.373													6	50	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27975200	27975200	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27975200C>G	uc002heo.1	-	13	1308	c.1308G>C	c.(1306-1308)ATG>ATC	p.M436I	SSH2_uc010wbh.1_Missense_Mutation_p.M463I|SSH2_uc002hep.1_Missense_Mutation_p.M436I	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	436	Tyrosine-protein phosphatase.				actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						CCAGTTGTCTCATGAAGCTTG	0.458													70	151	---	---	---	---	PASS
AMAC1	146861	broad.mit.edu	37	17	33520323	33520323	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33520323C>T	uc002hjd.2	-	1	1090	c.1004G>A	c.(1003-1005)AGG>AAG	p.R335K		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	335						integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		CTCCTCCACCCTCCCTGTCCT	0.557													3	80	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37868216	37868216	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37868216C>G	uc002hso.2	+	8	1175	c.937C>G	c.(937-939)CTC>GTC	p.L313V	ERBB2_uc002hsm.2_Missense_Mutation_p.L283V|ERBB2_uc010cwa.2_Missense_Mutation_p.L298V|ERBB2_uc002hsp.2_Missense_Mutation_p.L116V|ERBB2_uc010cwb.2_Missense_Mutation_p.L313V|ERBB2_uc010wek.1_Missense_Mutation_p.L37V|ERBB2_uc002hsl.2_Missense_Mutation_p.L283V|ERBB2_uc002hsn.1_Missense_Mutation_p.L313V	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	313	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	ATCCTGCACCCTCGTCTGCCC	0.572		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			837	31	---	---	---	---	PASS
GRB7	2886	broad.mit.edu	37	17	37903176	37903176	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37903176C>T	uc002hsr.2	+	15					GRB7_uc002hss.2_3'UTR|GRB7_uc010cwc.2_3'UTR|GRB7_uc002hst.2_3'UTR	NM_005310	NP_005301	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7						blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCTCATGCCTCAGCCCGCCTT	0.706													620	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	39296555	39296555	+	RNA	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39296555C>T	uc010cxk.1	-	1		c.149G>A								Homo sapiens partial mRNA for keratin associated protein 4.6 (KRTAP4.6 gene).																		gcagctgggacggcagcAGGT	0.552													13	49	---	---	---	---	PASS
TMEM101	84336	broad.mit.edu	37	17	42092411	42092411	+	5'Flank	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42092411C>G	uc002ieu.2	-						TMEM101_uc010wis.1_5'UTR	NM_032376	NP_115752	Q96IK0	TM101_HUMAN	transmembrane protein 101						positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		AGCGCTTTTTCTTTTTCCTCC	0.587													13	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	45127393	45127393	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45127393G>A	uc010wkj.1	+	2	945	c.591G>A	c.(589-591)CTG>CTA	p.L197L	uc010wkl.1_RNA					SubName: Full=Putative uncharacterized protein LRRC37A3;																		AAAGTTATCTGAGTAGACTGA	0.463													22	251	---	---	---	---	PASS
ANKRD40	91369	broad.mit.edu	37	17	48776867	48776867	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48776867G>C	uc002iso.2	-	3	926	c.671C>G	c.(670-672)CCG>CGG	p.P224R		NM_052855	NP_443087	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	224	Pro-rich.										0			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			TGGCTTGGACGGGACAGAAGA	0.527													27	94	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56671019	56671019	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56671019G>A	uc010dcz.1	-	15	2609	c.2491C>T	c.(2491-2493)CCG>TCG	p.P831S	TEX14_uc002iwr.1_Missense_Mutation_p.P825S|TEX14_uc002iws.1_Missense_Mutation_p.P825S|TEX14_uc010dda.1_Missense_Mutation_p.P605S	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a	831						cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAAAGAGTCGGCAGCTTAAAA	0.408													4	81	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61611504	61611504	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61611504C>T	uc002jay.2	+	5	1013	c.933C>T	c.(931-933)TTC>TTT	p.F311F	KCNH6_uc002jax.1_Silent_p.F311F|KCNH6_uc010wpl.1_Silent_p.F188F|KCNH6_uc010wpm.1_Silent_p.F311F|KCNH6_uc002jaz.1_Silent_p.F311F	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	311	Helical; Name=Segment S2; (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	ACATCATGTTCGTCGTGGACA	0.587													24	353	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67178946	67178946	+	Nonsense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67178946G>C	uc010dfa.1	-	22	3380	c.2501C>G	c.(2500-2502)TCA>TGA	p.S834*	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Nonsense_Mutation_p.S435*	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	834					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TTCAATATTTGATCCTAACAT	0.333													8	47	---	---	---	---	PASS
DNAI2	64446	broad.mit.edu	37	17	72297252	72297252	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72297252A>G	uc002jkf.2	+	8	1031	c.932A>G	c.(931-933)AAG>AGG	p.K311R	DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate polypeptide 2	311					cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3						ATCACCAAGAAGGAACAGTTG	0.547									Kartagener_syndrome				103	172	---	---	---	---	PASS
EIF4A3	9775	broad.mit.edu	37	17	78118038	78118038	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78118038C>G	uc010wuc.1	-	3	248	c.175G>C	c.(175-177)GAA>CAA	p.E59Q	EIF4A3_uc002jxs.2_Missense_Mutation_p.E59Q	NM_014740	NP_055555	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A,	59	Q motif.				mRNA transport|negative regulation of translation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			GATGGTTTTTCAAAACCTGCA	0.378													7	70	---	---	---	---	PASS
AZI1	22994	broad.mit.edu	37	17	79164797	79164797	+	Silent	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79164797C>G	uc002jzp.1	-	23	3062	c.2862G>C	c.(2860-2862)CTG>CTC	p.L954L	AZI1_uc002jzm.1_Silent_p.L386L|AZI1_uc002jzn.1_Silent_p.L951L|AZI1_uc002jzo.1_Silent_p.L915L|AZI1_uc010wum.1_Silent_p.L918L|AZI1_uc002jzq.2_Silent_p.L102L	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	954					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GCTGGCCCTTCAGCTCCGAGC	0.677													13	55	---	---	---	---	PASS
AZI1	22994	broad.mit.edu	37	17	79164838	79164838	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79164838C>G	uc002jzp.1	-	23	3021	c.2821G>C	c.(2821-2823)GAG>CAG	p.E941Q	AZI1_uc002jzm.1_Missense_Mutation_p.E373Q|AZI1_uc002jzn.1_Missense_Mutation_p.E938Q|AZI1_uc002jzo.1_Missense_Mutation_p.E902Q|AZI1_uc010wum.1_Missense_Mutation_p.E905Q|AZI1_uc002jzq.2_Missense_Mutation_p.E89Q	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	941					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCCGACTGCTCCAGCTCGGAG	0.662													20	76	---	---	---	---	PASS
AZI1	22994	broad.mit.edu	37	17	79165108	79165108	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79165108C>T	uc002jzp.1	-	22	2859	c.2659G>A	c.(2659-2661)GAG>AAG	p.E887K	AZI1_uc002jzm.1_Missense_Mutation_p.E319K|AZI1_uc002jzn.1_Missense_Mutation_p.E884K|AZI1_uc002jzo.1_Missense_Mutation_p.E848K|AZI1_uc010wum.1_Missense_Mutation_p.E851K|AZI1_uc002jzq.2_Missense_Mutation_p.E35K	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	887					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCCCTCAGCTCCTGTTCCCGG	0.677													33	94	---	---	---	---	PASS
AZI1	22994	broad.mit.edu	37	17	79165121	79165121	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79165121C>T	uc002jzp.1	-	22	2846	c.2646G>A	c.(2644-2646)CTG>CTA	p.L882L	AZI1_uc002jzm.1_Silent_p.L314L|AZI1_uc002jzn.1_Silent_p.L879L|AZI1_uc002jzo.1_Silent_p.L843L|AZI1_uc010wum.1_Silent_p.L846L|AZI1_uc002jzq.2_Silent_p.L30L	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	882					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GTTCCCGGTTCAGCAGCCACG	0.701													23	77	---	---	---	---	PASS
FASN	2194	broad.mit.edu	37	17	80053331	80053331	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80053331G>A	uc002kdu.2	-	3	262	c.145C>T	c.(145-147)CGG>TGG	p.R49W		NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	49	Beta-ketoacyl synthase (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	CCGGACCGCCGGGGCAGGCCG	0.652													32	29	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6898615	6898615	+	Intron	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6898615G>T	uc010wzi.1	+						ARHGAP28_uc002knc.2_3'UTR|ARHGAP28_uc002knd.2_3'UTR|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_3'UTR			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				AGGGATTTGGGTATCCAGTAG	0.363													6	30	---	---	---	---	PASS
ZNF519	162655	broad.mit.edu	37	18	14105771	14105771	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14105771C>G	uc002kst.1	-	3	921	c.768G>C	c.(766-768)AAG>AAC	p.K256N	ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519	256					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGTTAATTATCTTATGTCCCT	0.328													15	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	14188220	14188220	+	3'UTR	SNP	T	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14188220T>A	uc002ksv.1	+	3										Homo sapiens cDNA FLJ34795 fis, clone NT2NE2005921.																		TGGCATATAGTGAAAAATATC	0.269													2	1	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	14188221	14188221	+	3'UTR	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14188221G>A	uc002ksv.1	+	3										Homo sapiens cDNA FLJ34795 fis, clone NT2NE2005921.																		GGCATATAGTGAAAAATATCA	0.274													2	1	---	---	---	---	PASS
ELP2	55250	broad.mit.edu	37	18	33722264	33722264	+	Silent	SNP	C	G	G	rs142567516		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33722264C>G	uc002kzk.1	+	7	619	c.609C>G	c.(607-609)CTC>CTG	p.L203L	ELP2_uc010xcg.1_Silent_p.L268L|ELP2_uc002kzl.1_RNA|ELP2_uc002kzm.1_Silent_p.L177L|ELP2_uc010xch.1_Silent_p.L242L|ELP2_uc002kzn.1_Silent_p.L177L|ELP2_uc002kzo.1_Intron	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2	203					regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						TGCTTTCTCTCTGTGGACATG	0.373													16	85	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43450556	43450556	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43450556C>G	uc002lbm.2	-	36	6301	c.6201G>C	c.(6199-6201)CAG>CAC	p.Q2067H	KIAA1632_uc010xcq.1_Missense_Mutation_p.Q621H|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Missense_Mutation_p.Q942H	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	2067					autophagy						0						CCATGAGCATCTGGTCAGGGT	0.517													9	30	---	---	---	---	PASS
TXNL1	9352	broad.mit.edu	37	18	54291545	54291545	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54291545C>G	uc002lgg.2	-	3	592	c.343G>C	c.(343-345)GAG>CAG	p.E115Q	TXNL1_uc010xdz.1_RNA|TXNL1_uc002lgh.2_RNA|TXNL1_uc002lgi.2_Missense_Mutation_p.E115Q|TXNL1_uc002lgj.1_Missense_Mutation_p.E115Q	NM_004786	NP_004777	O43396	TXNL1_HUMAN	thioredoxin-like 1	115	PITH.				cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	cytoplasm	electron carrier activity|protein disulfide oxidoreductase activity				0				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		TCTGTGTCCTCATTGCTTCCA	0.333													34	143	---	---	---	---	PASS
ATP8B3	148229	broad.mit.edu	37	19	1811504	1811504	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1811504C>A	uc002ltw.2	-	2	466	c.232G>T	c.(232-234)GAA>TAA	p.E78*	ATP8B3_uc002ltv.2_Nonsense_Mutation_p.E25*|ATP8B3_uc002ltx.2_Intron|ATP8B3_uc002ltz.1_Nonsense_Mutation_p.E25*	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	78	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCTCCATTCATACTTCCTA	0.667													3	16	---	---	---	---	PASS
ZNF555	148254	broad.mit.edu	37	19	2853300	2853300	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2853300G>A	uc002lwo.2	+	4	1326	c.1237G>A	c.(1237-1239)GGA>AGA	p.G413R	ZNF555_uc002lwn.3_Missense_Mutation_p.G412R	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	413	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCTTTCGAGGACACATGAG	0.473													4	62	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9067796	9067796	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9067796C>T	uc002mkp.2	-	3	19854	c.19650G>A	c.(19648-19650)GTG>GTA	p.V6550V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6552	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTGTGGTCTTCACTAGGCCAG	0.483													20	15	---	---	---	---	PASS
ICAM1	3383	broad.mit.edu	37	19	10394842	10394842	+	Missense_Mutation	SNP	G	C	C	rs139628843		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10394842G>C	uc002mnq.2	+	4	1090	c.771G>C	c.(769-771)CAG>CAC	p.Q257H	ICAM1_uc010xle.1_Missense_Mutation_p.Q35H|ICAM4_uc002mnr.1_5'Flank|ICAM4_uc002mns.1_5'Flank|ICAM4_uc002mnt.1_5'Flank	NM_000201	NP_000192	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1 precursor	257	Ig-like C2-type 3.|Extracellular (Potential).				adhesion to symbiont|heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking|positive regulation of cellular extravasation|regulation of immune response|regulation of leukocyte mediated cytotoxicity|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell|virion attachment, binding of host cell surface receptor	extracellular space|integral to plasma membrane	integrin binding|transmembrane receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Natalizumab(DB00108)|Simvastatin(DB00641)	TGGGGGACCAGAGGTTGAACC	0.657													6	75	---	---	---	---	PASS
SMARCA4	6597	broad.mit.edu	37	19	11123726	11123726	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11123726C>T	uc002mqf.3	+	16	2660	c.2376C>T	c.(2374-2376)CTC>CTT	p.L792L	SMARCA4_uc010dxp.2_Silent_p.L792L|SMARCA4_uc010dxo.2_Silent_p.L792L|SMARCA4_uc002mqg.1_Silent_p.L792L|SMARCA4_uc010dxq.2_Silent_p.L792L|SMARCA4_uc010dxr.2_Silent_p.L792L|SMARCA4_uc002mqj.3_Silent_p.L792L|SMARCA4_uc010dxs.2_Silent_p.L792L|SMARCA4_uc010dxt.1_Silent_p.L12L	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	792	Helicase ATP-binding.				chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CCATCGCGCTCATCACGTACC	0.582			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				31	31	---	---	---	---	PASS
CYP4F12	66002	broad.mit.edu	37	19	15794481	15794481	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15794481C>T	uc002nbl.2	+	7	887	c.826C>T	c.(826-828)CGC>TGC	p.R276C		NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					GGAGCGGCGTCGCACCCTCCC	0.532													54	118	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	16001184	16001184	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16001184G>A	uc002nbs.1	-	6	635	c.585C>T	c.(583-585)ATC>ATT	p.I195I	CYP4F2_uc010xot.1_Silent_p.I46I|CYP4F2_uc010xou.1_Silent_p.I46I	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	195					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						TCATGAGGCTGATGTGCTCAA	0.542													68	69	---	---	---	---	PASS
GMIP	51291	broad.mit.edu	37	19	19741332	19741332	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19741332C>G	uc002nnd.2	-	20	2604	c.2487G>C	c.(2485-2487)CAG>CAC	p.Q829H	LPAR2_uc002nnb.3_5'Flank|LPAR2_uc002nna.3_5'Flank|LPAR2_uc002nnc.3_5'Flank|GMIP_uc010xrb.1_Missense_Mutation_p.Q803H|GMIP_uc010xrc.1_Missense_Mutation_p.Q800H	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	829					negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1						TCTGGTCACTCTGTGGAGTTG	0.542													71	46	---	---	---	---	PASS
WDR62	284403	broad.mit.edu	37	19	36562497	36562497	+	Missense_Mutation	SNP	A	G	G	rs146229976	byFrequency	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36562497A>G	uc002odc.2	+	8	1013	c.922A>G	c.(922-924)ATC>GTC	p.I308V	WDR62_uc002odd.2_Missense_Mutation_p.I308V|WDR62_uc002odb.2_Missense_Mutation_p.I308V	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2	308	WD 4.				cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCAGGAGCTCATCTTCTGTGG	0.592													7	168	---	---	---	---	PASS
WDR62	284403	broad.mit.edu	37	19	36574043	36574043	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36574043G>A	uc002odc.2	+	11	1541	c.1450G>A	c.(1450-1452)GAG>AAG	p.E484K	WDR62_uc002odd.2_Missense_Mutation_p.E484K	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2	484					cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCGGGGGAGCGAGAATGGGAC	0.597													3	36	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39220017	39220017	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39220017G>A	uc002oja.1	+	21	2740	c.2681G>A	c.(2680-2682)GGT>GAT	p.G894D	ACTN4_uc002ojb.1_Missense_Mutation_p.G216D	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	894					platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCCGTGCCCGGTGCCCTCGAC	0.672													10	39	---	---	---	---	PASS
SARS2	54938	broad.mit.edu	37	19	39421110	39421110	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39421110G>A	uc002oka.2	-	1	427	c.267C>T	c.(265-267)ATC>ATT	p.I89I	SARS2_uc002ojz.2_5'Flank|SARS2_uc010xup.1_Silent_p.I89I|SARS2_uc002okb.2_Silent_p.I89I|SARS2_uc010xuq.1_Intron|SARS2_uc010xur.1_RNA|SARS2_uc010xus.1_Silent_p.I89I|MRPS12_uc002okc.2_5'Flank|MRPS12_uc002okd.2_5'Flank|MRPS12_uc002oke.2_5'Flank	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor	89					seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCGCACTCACGATCGCGGGCA	0.662											OREG0032101|OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)	39	175	---	---	---	---	PASS
BLVRB	645	broad.mit.edu	37	19	40971640	40971640	+	5'UTR	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40971640G>A	uc002onw.2	-	1					SPTBN4_uc002onx.2_5'Flank|SPTBN4_uc002ony.2_5'Flank|SPTBN4_uc002onz.2_5'Flank|BLVRB_uc010egw.1_RNA	NM_000713	NP_000704	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase						heme catabolic process	cytosol	biliverdin reductase activity|binding|flavin reductase activity				0			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		NADH(DB00157)|Riboflavin(DB00140)	CTCGGCACGCGCGGGAACCCA	0.677													3	11	---	---	---	---	PASS
RTN2	6253	broad.mit.edu	37	19	45997499	45997499	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45997499C>G	uc002pcb.2	-	4	967	c.739G>C	c.(739-741)GAG>CAG	p.E247Q	RTN2_uc002pcc.2_Missense_Mutation_p.E247Q|RTN2_uc002pcd.2_RNA	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A	247						integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GGCTCTCGCTCCAGTGGCCCC	0.577													154	78	---	---	---	---	PASS
DHDH	27294	broad.mit.edu	37	19	49436959	49436959	+	5'UTR	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49436959G>C	uc002ple.1	+	1						NM_014475	NP_055290	Q9UQ10	DHDH_HUMAN	dimeric dihydrodiol dehydrogenase						carbohydrate metabolic process		binding|D-xylose 1-dehydrogenase (NADP+) activity|electron carrier activity|NAD(P)+ transhydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		CGAAGGTGCCGAGGGCTCCGC	0.682													16	67	---	---	---	---	PASS
CGB7	94027	broad.mit.edu	37	19	49558233	49558233	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49558233G>A	uc002pmd.2	-	2	413	c.48C>T	c.(46-48)GGC>GGT	p.G16G	CGB_uc010yad.1_Intron|CGB8_uc002pmc.2_Intron|CGB7_uc002pme.2_Silent_p.G16G	NM_033142	NP_149133	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 7	16					apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	CCCATGTCCCGCCCATGCTCA	0.667													61	25	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49814617	49814617	+	5'UTR	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49814617C>G	uc002pmz.2	-	2					SLC6A16_uc002pna.2_5'UTR|hsa-mir-4324|MI0015854_5'Flank	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16							integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		CACACAGACTCTCTGGGGCAG	0.502													15	50	---	---	---	---	PASS
POLD1	5424	broad.mit.edu	37	19	50921177	50921177	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50921177C>G	uc002psb.3	+	27	3353	c.3297C>G	c.(3295-3297)TTC>TTG	p.F1099L	POLD1_uc002psc.3_Missense_Mutation_p.F1099L|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Missense_Mutation_p.F1125L|SPIB_uc002psd.2_5'Flank|SPIB_uc002pse.2_5'Flank|SPIB_uc010ycc.1_5'Flank	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	1099					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		TGCGGCGCTTCGGACCCCCTG	0.622								DNA_polymerases_(catalytic_subunits)					8	11	---	---	---	---	PASS
SIGLEC8	27181	broad.mit.edu	37	19	51957508	51957508	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51957508C>G	uc002pwt.2	-	6	1277	c.1210G>C	c.(1210-1212)GAA>CAA	p.E404Q	SIGLEC8_uc010yda.1_Missense_Mutation_p.E295Q|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Missense_Mutation_p.E311Q	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	404	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TTTGCATCTTCCATGCCTGTA	0.597													21	143	---	---	---	---	PASS
ZNF28	7576	broad.mit.edu	37	19	53303274	53303274	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53303274C>T	uc002qad.2	-	4	1944	c.1824G>A	c.(1822-1824)AAG>AAA	p.K608K	ZNF28_uc002qac.2_Silent_p.K555K|ZNF28_uc010eqe.2_Silent_p.K554K	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	608	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		ACTCATTACACTTGTAAGGTT	0.448													196	98	---	---	---	---	PASS
ZNF419	79744	broad.mit.edu	37	19	58005550	58005550	+	3'UTR	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58005550G>T	uc002qov.2	+	5					ZNF547_uc002qpm.3_Intron|ZNF419_uc010ety.1_3'UTR|ZNF419_uc010etz.1_3'UTR|ZNF419_uc010eua.1_3'UTR|ZNF419_uc002qow.2_3'UTR|ZNF419_uc010eub.1_3'UTR|ZNF419_uc010euc.1_3'UTR	NM_024691	NP_078967	Q96HQ0	ZN419_HUMAN	zinc finger protein 419 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		ATGGAAATCCGTTAGCCACAC	0.413													7	16	---	---	---	---	PASS
MAVS	57506	broad.mit.edu	37	20	3846809	3846809	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3846809C>T	uc002wjw.3	+	7					MAVS_uc002wjx.3_3'UTR|MAVS_uc002wjy.3_3'UTR	NM_020746	NP_065797	Q7Z434	MAVS_HUMAN	virus-induced signaling adapter						activation of innate immune response|cellular response to exogenous dsRNA|defense response to bacterium|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of chemokine (C-C motif) ligand 5 production|positive regulation of defense response to virus by host|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interleukin-8 production|positive regulation of IP-10 production|positive regulation of protein import into nucleus, translocation|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|response to virus	integral to membrane|mitochondrial outer membrane	CARD domain binding|protein kinase binding|signal transducer activity				0						GCCCTGGGCTCTTCCCACCAC	0.632													16	41	---	---	---	---	PASS
C20orf71	128861	broad.mit.edu	37	20	31805357	31805357	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31805357C>T	uc002wyr.2	+	1	223	c.15C>T	c.(13-15)CTC>CTT	p.L5L	C20orf71_uc002wys.2_Silent_p.L5L	NM_178466	NP_848561	Q9BQP9	SPLC3_HUMAN	short long palate, lung and nasal epithelium	5						extracellular region	lipid binding			ovary(1)|skin(1)	2						TGTGTCCACTCTGGAGGCTCC	0.592													25	86	---	---	---	---	PASS
HMGB3L1	128872	broad.mit.edu	37	20	33421737	33421737	+	RNA	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33421737C>G	uc002xax.2	-	1		c.529G>C				NR_002165				Homo sapiens high-mobility group (nonhistone chromosomal) protein 4-like, mRNA (cDNA clone IMAGE:40002762).												0						TCCTTCATTTCTCTATCACAG	0.363													5	10	---	---	---	---	PASS
EPB41L1	2036	broad.mit.edu	37	20	34797659	34797659	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34797659C>G	uc002xfb.2	+	15	2089	c.1918C>G	c.(1918-1920)CTG>GTG	p.L640V	EPB41L1_uc002xeu.2_Missense_Mutation_p.L566V|EPB41L1_uc010zvo.1_Missense_Mutation_p.L640V|EPB41L1_uc002xev.2_Missense_Mutation_p.L640V|EPB41L1_uc002xew.2_Missense_Mutation_p.L531V|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Missense_Mutation_p.L566V|EPB41L1_uc010gfq.2_Missense_Mutation_p.L739V	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	640					cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)					CTCCCGCAGCCTGCCTGAGCT	0.612													31	64	---	---	---	---	PASS
SAMHD1	25939	broad.mit.edu	37	20	35521386	35521386	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35521386G>A	uc002xgh.1	-	16	1960	c.1830C>T	c.(1828-1830)CTC>CTT	p.L610L	C20orf118_uc002xgg.1_3'UTR|SAMHD1_uc010gft.1_RNA	NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1	610					defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)				ATGCTTCTCGGAGGCGAGTTG	0.428													93	163	---	---	---	---	PASS
YWHAB	7529	broad.mit.edu	37	20	43535062	43535062	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43535062G>A	uc002xmt.2	+	7	1006	c.724G>A	c.(724-726)GGG>AGG	p.G242R	YWHAB_uc002xmu.2_Missense_Mutation_p.G242R	NM_003404	NP_003395	P31946	1433B_HUMAN	tyrosine 3-monooxygenase/tryptophan	242					activation of MAPKK activity|activation of pro-apoptotic gene products|axon guidance|cytoplasmic sequestering of protein|epidermal growth factor receptor signaling pathway|induction of apoptosis by intracellular signals|insulin receptor signaling pathway|mRNA metabolic process|negative regulation of protein dephosphorylation|nerve growth factor receptor signaling pathway|Ras protein signal transduction	centrosome|cytosol|melanosome|perinuclear region of cytoplasm	histone deacetylase binding|phosphoserine binding|protein domain specific binding			kidney(2)|ovary(1)|breast(1)	4		Myeloproliferative disorder(115;0.0122)				AGGAGACGCTGGGGAGGGAGA	0.438													34	82	---	---	---	---	PASS
STAU1	6780	broad.mit.edu	37	20	47734529	47734529	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47734529G>C	uc002xud.2	-	11	1705	c.1294C>G	c.(1294-1296)CAA>GAA	p.Q432E	STAU1_uc002xua.2_Missense_Mutation_p.Q351E|STAU1_uc002xub.2_Missense_Mutation_p.Q357E|STAU1_uc002xuc.2_Missense_Mutation_p.Q351E|STAU1_uc002xue.2_Missense_Mutation_p.Q351E|STAU1_uc002xuf.2_Missense_Mutation_p.Q357E|STAU1_uc002xug.2_Missense_Mutation_p.Q432E	NM_017453	NP_059347	O95793	STAU1_HUMAN	staufen isoform b	432						microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding			ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			TGATGTCCTTGACTAACTCCT	0.532													55	142	---	---	---	---	PASS
NFATC2	4773	broad.mit.edu	37	20	50049280	50049280	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50049280C>T	uc002xwd.2	-	9	2266	c.2046G>A	c.(2044-2046)AAG>AAA	p.K682K	NFATC2_uc002xwc.2_Silent_p.K682K|NFATC2_uc010zyv.1_Silent_p.K463K|NFATC2_uc010zyw.1_Silent_p.K463K|NFATC2_uc010zyx.1_Silent_p.K662K|NFATC2_uc010zyy.1_Silent_p.K463K|NFATC2_uc010zyz.1_Silent_p.K463K|NFATC2_uc002xwe.2_Silent_p.K662K	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	682					B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					TGGGCTCCGTCTTGATGGCTG	0.612													18	93	---	---	---	---	PASS
CASS4	57091	broad.mit.edu	37	20	55027048	55027048	+	Silent	SNP	C	G	G	rs143746875		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55027048C>G	uc002xxp.2	+	6	1041	c.816C>G	c.(814-816)CTC>CTG	p.L272L	CASS4_uc002xxq.3_Silent_p.L272L|CASS4_uc002xxr.2_Silent_p.L272L|CASS4_uc010zze.1_Silent_p.L218L|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	272					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						CCCACGCTCTCCCCAGTTCCA	0.517													33	49	---	---	---	---	PASS
RTEL1	51750	broad.mit.edu	37	20	62324319	62324319	+	Silent	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62324319C>G	uc002yfu.1	+	29	3157	c.2814C>G	c.(2812-2814)CTC>CTG	p.L938L	RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Silent_p.L938L|RTEL1_uc011abd.1_Silent_p.L962L|RTEL1_uc011abe.1_Silent_p.L715L|RTEL1_uc002yfw.2_RNA|RTEL1_uc002yfx.1_Silent_p.L183L|TNFRSF6B_uc002yfy.2_5'Flank	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1	938					DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			TCGGCCCCCTCTTTGCTGAGG	0.657													58	186	---	---	---	---	PASS
KRTAP13-1	140258	broad.mit.edu	37	21	31768802	31768802	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768802G>A	uc002yoa.2	+	1	411	c.398G>A	c.(397-399)GGA>GAA	p.G133E		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	133						intermediate filament				ovary(1)	1						CTGGGTTATGGAGGCTGTGGC	0.582													23	12	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33641251	33641251	+	3'UTR	SNP	C	T	T	rs11557587		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641251C>T	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						ttttttttttctttttttttt	0.154													8	33	---	---	---	---	PASS
SYNJ1	8867	broad.mit.edu	37	21	34012014	34012014	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34012014C>T	uc002yqh.2	-	30	3781	c.3781G>A	c.(3781-3783)GAA>AAA	p.E1261K	SYNJ1_uc011ads.1_Missense_Mutation_p.E1175K|SYNJ1_uc002yqf.2_Missense_Mutation_p.E1206K|SYNJ1_uc002yqg.2_Missense_Mutation_p.E1175K|SYNJ1_uc002yqi.2_Missense_Mutation_p.E1261K|SYNJ1_uc002yqe.3_5'UTR	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	1222	Pro-rich.						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5						CTTTGGCTTTCAGGAGTCAGT	0.363													21	54	---	---	---	---	PASS
IL10RB	3588	broad.mit.edu	37	21	34640751	34640751	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34640751C>G	uc002yrk.1	+	2	201	c.102C>G	c.(100-102)TTC>TTG	p.F34L	IL10RB_uc002yrh.1_Missense_Mutation_p.F104L|IL10RB_uc002yri.1_Intron|uc002yrj.1_5'Flank|IL10RB_uc002yrl.1_Missense_Mutation_p.F36L	NM_000628	NP_000619	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta precursor	34	Extracellular (Potential).				immune response|inflammatory response	interleukin-28 receptor complex	protein binding|receptor activity				0						CTGTTAATTTCAAGAACATTC	0.418													26	129	---	---	---	---	PASS
CLIC6	54102	broad.mit.edu	37	21	36079652	36079652	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36079652C>T	uc010gmt.1	+	3	1503	c.1503C>T	c.(1501-1503)GGC>GGT	p.G501G	CLIC6_uc002yuf.1_Silent_p.G483G	NM_053277	NP_444507	Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	501	Helical; Note=After insertion into the membrane; (Potential).					chloride channel complex|cytoplasm|plasma membrane	voltage-gated chloride channel activity			ovary(1)|central_nervous_system(1)	2						GGCTGAAAGGCGTTATATTTA	0.393													52	64	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38538204	38538204	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38538204C>T	uc002yvz.2	+	33	3793	c.3688C>T	c.(3688-3690)CCA>TCA	p.P1230S	TTC3_uc011aee.1_Missense_Mutation_p.P920S|TTC3_uc002ywa.2_Missense_Mutation_p.P1230S|TTC3_uc002ywb.2_Missense_Mutation_p.P1230S|TTC3_uc010gnf.2_Missense_Mutation_p.P995S|TTC3_uc002ywc.2_Missense_Mutation_p.P920S|TTC3_uc002ywd.1_Missense_Mutation_p.P294S	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1230					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				ATCTTCAGCACCAGCTTTTGA	0.428													7	38	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41459119	41459119	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41459119C>T	uc002yyq.1	-	22	4398	c.3946G>A	c.(3946-3948)GCA>ACA	p.A1316T	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1316	Extracellular (Potential).|Ig-like C2-type 10.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CATTTGACTGCAGGAGAAGGG	0.473													23	67	---	---	---	---	PASS
SUMO3	6612	broad.mit.edu	37	21	46228946	46228946	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46228946G>A	uc002zfz.1	-						SUMO3_uc011afi.1_Intron|SUMO3_uc002zga.1_Missense_Mutation_p.R80C	NM_006936	NP_008867	P55854	SUMO3_HUMAN	small ubiquitin-like modifier protein 3						protein sumoylation	cytoplasm|kinetochore	protein binding				0				Colorectal(79;0.058)		GGAACCACGCGAAGCCAGCTC	0.502													31	19	---	---	---	---	PASS
GGT3P	2679	broad.mit.edu	37	22	18769145	18769145	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18769145G>A	uc010gri.1	-						GGT3P_uc011ago.1_Intron|GGT3P_uc011agp.1_RNA|GGT3P_uc002zob.1_RNA					Homo sapiens cDNA clone IMAGE:5761295, **** WARNING: chimeric clone ****.												0						TGAGGCTGCCGTTGTAGAAGG	0.612													4	34	---	---	---	---	PASS
LZTR1	8216	broad.mit.edu	37	22	21334411	21334411	+	5'Flank	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21334411G>A	uc002zto.2	+						AIFM3_uc002ztk.2_Silent_p.V585V|AIFM3_uc002ztj.2_Silent_p.V585V|AIFM3_uc002ztl.2_Silent_p.V591V|AIFM3_uc011ahx.1_Silent_p.V573V|AIFM3_uc002ztm.1_Silent_p.V397V|LZTR1_uc002ztn.2_Silent_p.V25V|LZTR1_uc011ahy.1_5'Flank	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1						anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AGCGGGAGGTGGAGTGAGTGT	0.642													16	21	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22661721	22661721	+	Intron	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22661721G>T	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						TTTTAGCTTTGTGCTTTTCCT	0.378													3	21	---	---	---	---	PASS
MIF	4282	broad.mit.edu	37	22	24236667	24236667	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24236667G>A	uc002zyr.1	+	1	103	c.6G>A	c.(4-6)CCG>CCA	p.P2P	MIF_uc011aje.1_Silent_p.P2P|uc002zys.1_3'UTR	NM_002415	NP_002406	P14174	MIF_HUMAN	macrophage migration inhibitory factor	2		Proton acceptor; via imino nitrogen.			cell proliferation|cell surface receptor linked signaling pathway|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of cell aging|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of gene expression|positive regulation of B cell proliferation|positive regulation of cytokine secretion|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase A signaling cascade|prostaglandin biosynthetic process|protein homotrimerization|regulation of macrophage activation	cell surface|cytoplasm|extracellular space	cell surface binding|chemoattractant activity|cytokine activity|cytokine receptor binding|dopachrome isomerase activity|phenylpyruvate tautomerase activity				0						CCATCATGCCGATGTTCATCG	0.687													30	29	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26422680	26422680	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26422680C>T	uc003abz.1	+	43	6990	c.6740C>T	c.(6739-6741)TCA>TTA	p.S2247L	MYO18B_uc003aca.1_Missense_Mutation_p.S2128L|MYO18B_uc010guy.1_Missense_Mutation_p.S2129L|MYO18B_uc010guz.1_Missense_Mutation_p.S2127L|MYO18B_uc011aka.1_Missense_Mutation_p.S1401L|MYO18B_uc011akb.1_Missense_Mutation_p.S1760L|MYO18B_uc010gva.1_Missense_Mutation_p.S230L|MYO18B_uc010gvb.1_RNA	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2247						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CCCAGTCCTTCAGCGGCCCTC	0.602													4	27	---	---	---	---	PASS
NF2	4771	broad.mit.edu	37	22	30079015	30079015	+	Intron	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30079015G>A	uc003age.3	+						NF2_uc003afy.3_Missense_Mutation_p.A582T|NF2_uc003afz.3_Missense_Mutation_p.A499T|NF2_uc003agf.3_Missense_Mutation_p.A582T|NF2_uc003agb.3_Missense_Mutation_p.A505T|NF2_uc003agc.3_Missense_Mutation_p.A544T|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Missense_Mutation_p.A582T|NF2_uc003aga.3_Missense_Mutation_p.A540T|NF2_uc003agh.3_Missense_Mutation_p.A541T|NF2_uc003agi.3_Missense_Mutation_p.A499T|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Missense_Mutation_p.A544T|NF2_uc010gvp.2_Missense_Mutation_p.A246T|NF2_uc011akq.1_Silent_p.K221K	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						TTAGCCTCAAGCCCAAGGCAG	0.443			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				105	177	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32480979	32480979	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32480979C>T	uc003amc.2	+	9	1210	c.978C>T	c.(976-978)TTC>TTT	p.F326F	SLC5A1_uc011alz.1_Silent_p.F199F	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	326	Helical; (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						TGCCCATGTTCATCATGGTGA	0.502													25	86	---	---	---	---	PASS
SYN3	8224	broad.mit.edu	37	22	32924939	32924939	+	Silent	SNP	C	T	T	rs138034081		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32924939C>T	uc003amx.2	-	10	1311	c.1152G>A	c.(1150-1152)CTG>CTA	p.L384L	SYN3_uc003amy.2_Silent_p.L384L|SYN3_uc003amz.2_Silent_p.L383L|SYN3_uc011amc.1_Silent_p.L18L	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa	384	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						GGTCGGCCATCAGCTGTCTGT	0.592											OREG0026488	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	83	---	---	---	---	PASS
APOL2	23780	broad.mit.edu	37	22	36624218	36624218	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36624218C>G	uc003aoz.2	-	5	582	c.246G>C	c.(244-246)TTG>TTC	p.L82F	APOL2_uc011amm.1_Missense_Mutation_p.L194F|APOL2_uc003apa.2_Missense_Mutation_p.L82F	NM_030882	NP_112092	Q9BQE5	APOL2_HUMAN	apolipoprotein L2	82					acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding				0						GAAACTCTTTCAAAAACCACT	0.507													41	139	---	---	---	---	PASS
APOL2	23780	broad.mit.edu	37	22	36624296	36624296	+	Silent	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36624296C>G	uc003aoz.2	-	5	504	c.168G>C	c.(166-168)CTG>CTC	p.L56L	APOL2_uc011amm.1_Silent_p.L168L|APOL2_uc003apa.2_Silent_p.L56L	NM_030882	NP_112092	Q9BQE5	APOL2_HUMAN	apolipoprotein L2	56					acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding				0						CAAGCTTGTTCAGAGCTTTAC	0.453													55	150	---	---	---	---	PASS
GGA1	26088	broad.mit.edu	37	22	38010268	38010268	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38010268G>A	uc003atc.2	+	2	480	c.115G>A	c.(115-117)GAG>AAG	p.E39K	GGA1_uc003atb.2_Missense_Mutation_p.E39K|GGA1_uc003atd.2_Missense_Mutation_p.E39K|GGA1_uc003ate.2_Missense_Mutation_p.E39K|GGA1_uc003atf.2_5'UTR	NM_013365	NP_037497	Q9UJY5	GGA1_HUMAN	golgi associated, gamma adaptin ear containing,	39	VHS.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|Golgi apparatus part	protein binding			breast(2)|ovary(1)	3	Melanoma(58;0.0574)					GCAGCTCAACGAGGACTTTGA	0.607													13	42	---	---	---	---	PASS
XPNPEP3	63929	broad.mit.edu	37	22	41322359	41322359	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41322359C>G	uc003azh.2	+	10	1536	c.1444C>G	c.(1444-1446)CAG>GAG	p.Q482E	XPNPEP3_uc003azi.2_Missense_Mutation_p.Q403E|XPNPEP3_uc011aoy.1_RNA	NM_022098	NP_071381	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3,	482					cellular process	mitochondrion	aminopeptidase activity|manganese ion binding|metallopeptidase activity				0						AGTGGTGACTCAGGACTCACC	0.473													59	120	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41565561	41565561	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41565561G>C	uc003azl.3	+	26	4622	c.4227G>C	c.(4225-4227)TTG>TTC	p.L1409F		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1409					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						CTAAATGCTTGAGGACTGCAG	0.323			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				8	119	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50546633	50546633	+	Missense_Mutation	SNP	G	A	A	rs147590689		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50546633G>A	uc003bjj.2	+	4	594	c.511G>A	c.(511-513)GAA>AAA	p.E171K	MOV10L1_uc003bjk.3_Missense_Mutation_p.E171K|MOV10L1_uc011arp.1_Missense_Mutation_p.E151K|MOV10L1_uc010han.2_Missense_Mutation_p.E151K	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	171					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GTGGAGCAGCGAAGCCACCTC	0.602													8	17	---	---	---	---	PASS
ATXN3L	92552	broad.mit.edu	37	X	13337636	13337636	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13337636G>T	uc010ned.2	-	1	883	c.418C>A	c.(418-420)CCA>ACA	p.P140T		NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	140	Josephin.				protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity			lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						ATTAATTCTGGACCCGCCAAG	0.333													14	7	---	---	---	---	PASS
CXorf23	256643	broad.mit.edu	37	X	19947930	19947930	+	Silent	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19947930G>A	uc004czp.2	-	10	1992	c.1992C>T	c.(1990-1992)TTC>TTT	p.F664F	CXorf23_uc010nfn.2_RNA|CXorf23_uc011mjg.1_Intron|CXorf23_uc004czo.2_Silent_p.F643F	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643	693						mitochondrion				lung(1)|skin(1)	2						ATCTTTCTCTGAACTTATGAG	0.333													76	17	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50121635	50121635	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50121635C>A	uc010njr.1	-	21	2977	c.2917G>T	c.(2917-2919)GGT>TGT	p.G973C		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	973					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					TGCACAGAACCAAAGATTGCC	0.537													3	2	---	---	---	---	PASS
MAGED2	10916	broad.mit.edu	37	X	54841756	54841756	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54841756G>T	uc004dtk.1	+	12	1556	c.1462G>T	c.(1462-1464)GAG>TAG	p.E488*	MAGED2_uc004dtl.1_Nonsense_Mutation_p.E488*|MAGED2_uc004dtm.1_Nonsense_Mutation_p.E403*|MAGED2_uc010nkc.1_Intron|MAGED2_uc004dtn.1_Nonsense_Mutation_p.E488*|MAGED2_uc004dto.1_Nonsense_Mutation_p.E462*	NM_177433	NP_803182	Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	488										ovary(2)|breast(1)	3						ggctgcagctgaggctgcagc	0.478													36	11	---	---	---	---	PASS
ZC4H2	55906	broad.mit.edu	37	X	64139077	64139077	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64139077C>T	uc004dvu.2	-	4	494	c.406G>A	c.(406-408)GAG>AAG	p.E136K	ZC4H2_uc004dvv.2_Missense_Mutation_p.E113K|ZC4H2_uc011mov.1_Missense_Mutation_p.E113K|ZC4H2_uc011mow.1_Intron|ZC4H2_uc004dvw.1_3'UTR	NM_018684	NP_061154	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	136							metal ion binding|protein binding			ovary(1)	1						TTCTGCTTCTCAAAGTAACTT	0.532													22	9	---	---	---	---	PASS
PCDH19	57526	broad.mit.edu	37	X	99663458	99663458	+	Silent	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99663458C>T	uc010nmz.2	-	1	1814	c.138G>A	c.(136-138)GCG>GCA	p.A46A	PCDH19_uc004efw.3_Silent_p.A46A|PCDH19_uc004efx.3_Silent_p.A46A	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	46	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						CCGCCTCTCGCGCGTCTTTGG	0.632													8	8	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106082551	106082551	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106082551C>T	uc004emo.2	+	8	1382	c.1217C>T	c.(1216-1218)TCT>TTT	p.S406F	MORC4_uc004emp.3_Intron|TBC1D8B_uc004emn.2_Missense_Mutation_p.S406F	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	406						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GCTATTAGTTCTGAGTCTACA	0.348													18	22	---	---	---	---	PASS
ABCD1	215	broad.mit.edu	37	X	152991184	152991184	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152991184G>A	uc004fif.2	+	1	862	c.463G>A	c.(463-465)GAG>AAG	p.E155K	BCAP31_uc004fid.2_5'Flank|BCAP31_uc011myz.1_5'Flank|BCAP31_uc011mza.1_5'Flank|BCAP31_uc004fie.2_5'Flank	NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	155	ABC transmembrane type-1.|Interaction with PEX19.				fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGTTACCTGGAGGGCCAACT	0.642													31	7	---	---	---	---	PASS
PDZD4	57595	broad.mit.edu	37	X	153095777	153095777	+	5'UTR	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153095777G>A	uc004fiz.1	-	1					PDZD4_uc004fiy.1_5'Flank|PDZD4_uc004fix.2_5'UTR|PDZD4_uc004fja.1_5'UTR|PDZD4_uc011mze.1_5'UTR	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4							cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GAGAGGAGGCGGAGGGCGGGA	0.642													39	42	---	---	---	---	PASS
PDZD4	57595	broad.mit.edu	37	X	153095778	153095778	+	5'UTR	SNP	G	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153095778G>A	uc004fiz.1	-	1					PDZD4_uc004fiy.1_5'Flank|PDZD4_uc004fix.2_5'UTR|PDZD4_uc004fja.1_5'UTR|PDZD4_uc011mze.1_5'UTR	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4							cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGAGGAGGCGGAGGGCGGGAA	0.647													39	42	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39770237	39770238	+	Intron	INS	-	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39770237_39770238insT	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc009vvq.1_Intron|MACF1_uc001cdb.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			tcttttctttcttttttttttt	0.158													6	3	---	---	---	---	
ATP1A1	476	broad.mit.edu	37	1	116933158	116933159	+	Intron	INS	-	T	T	rs71766078		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116933158_116933159insT	uc001ege.2	+						ATP1A1_uc010owv.1_Intron|ATP1A1_uc010oww.1_Intron|ATP1A1_uc010owx.1_Intron	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a						ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)	tttcttttttgttttttttttt	0.297													5	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145109312	145109313	+	Intron	INS	-	A	A	rs142440425		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109312_145109313insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						aaaccaaaaacaaaAAAAAAAG	0.163													4	2	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													8	6	---	---	---	---	
UFC1	51506	broad.mit.edu	37	1	161127696	161127696	+	Intron	DEL	A	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161127696delA	uc001fyd.3	+						USP21_uc010pkc.1_5'Flank|USP21_uc010pkd.1_5'Flank|USP21_uc010pke.1_5'Flank|USP21_uc010pkf.1_5'Flank	NM_016406	NP_057490	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1						protein ufmylation		protein binding|UFM1 conjugating enzyme activity				0	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			agatgtaaggaaaaaaaaaaa	0.244													4	2	---	---	---	---	
CR1	1378	broad.mit.edu	37	1	207679451	207679451	+	Intron	DEL	C	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207679451delC	uc001hfy.2	+						CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Intron|CR1_uc010psg.1_Intron|CR1_uc009xcj.1_Intron|CR1_uc009xck.1_Intron	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor						complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						GGAGTGGGAACCCCCCTGTTA	0.413													16	14	---	---	---	---	
CR1L	1379	broad.mit.edu	37	1	207842739	207842756	+	Intron	DEL	ATTTCAGTTTTCTTCGAG	-	-	rs139825875		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207842739_207842756delATTTCAGTTTTCTTCGAG	uc001hga.3	+						CR1L_uc001hfz.2_Intron	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like							cytoplasm|extracellular region|membrane					0						TTTTCCTCTTATTTCAGTTTTCTTCGAGATCAAATCTG	0.573													4	6	---	---	---	---	
KLF11	8462	broad.mit.edu	37	2	10187765	10187765	+	Intron	DEL	T	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10187765delT	uc002raf.1	+						KLF11_uc010yjc.1_Intron	NM_003597	NP_003588	O14901	KLF11_HUMAN	Kruppel-like factor 11						apoptosis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|regulation of transcription involved in S phase of mitotic cell cycle	nucleus	sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		AACATGGTACTTTTTTTTTTA	0.398													127	10	---	---	---	---	
MIR1285-2	100302268	broad.mit.edu	37	2	70481272	70481272	+	5'Flank	DEL	T	-	-	rs112545635		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70481272delT	hsa-mir-1285-2|MI0006347	-																							0						TATAGACCCAttttttttttt	0.189													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	175585079	175585079	+	Intron	DEL	A	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175585079delA	uc002uiw.2	+											Homo sapiens cDNA FLJ11228 fis, clone PLACE1008329.																		TTTCATTCTCAAAAAAAAAAA	0.368											OREG0015078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
NEU2	4759	broad.mit.edu	37	2	233899698	233899698	+	Frame_Shift_Del	DEL	T	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233899698delT	uc010zmn.1	+	2	1074	c.1074delT	c.(1072-1074)GATfs	p.D358fs		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	358							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		AAGCCAATGATTACGAGGAGA	0.577													285	92	---	---	---	---	
SMARCC1	6599	broad.mit.edu	37	3	47777371	47777371	+	Intron	DEL	A	-	-	rs111950490		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47777371delA	uc003crq.2	-						SMARCC1_uc011bbd.1_Intron	NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		ctctaaaaagaaaaaaaaaaa	0.109													4	2	---	---	---	---	
RRP9	9136	broad.mit.edu	37	3	51967805	51967805	+	Intron	DEL	G	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51967805delG	uc003dbw.1	-							NM_004704	NP_004695	O43818	U3IP2_HUMAN	RNA, U3 small nucleolar interacting protein 2						rRNA processing	nucleolus|small nuclear ribonucleoprotein complex|small nucleolar ribonucleoprotein complex	RNA binding			breast(2)|ovary(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CACCTGAGCAGAAAGACAACA	0.438													220	50	---	---	---	---	
CASR	846	broad.mit.edu	37	3	121973379	121973380	+	Intron	INS	-	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121973379_121973380insT	uc003eev.3	+						CASR_uc003eew.3_Intron	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor						anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CACAACCTGCCTTTTTTTTCCT	0.356													4	2	---	---	---	---	
N4BP2	55728	broad.mit.edu	37	4	40143745	40143750	+	Intron	DEL	AGGGAG	-	-	rs794004		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40143745_40143750delAGGGAG	uc003guy.3	+						N4BP2_uc010ifq.2_Intron|N4BP2_uc010ifr.2_Intron	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2							cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						gggagaccatagggagagggggaggg	0.126													4	3	---	---	---	---	
UNC5C	8633	broad.mit.edu	37	4	96128053	96128053	+	Intron	DEL	C	-	-	rs71583693		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96128053delC	uc003htp.1	-						UNC5C_uc010ilc.1_Intron	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TCCTGGAATTCTTTTTTTTTT	0.408													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2585448	2585449	+	IGR	INS	-	GATG	GATG	rs28742164	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2585448_2585449insGATG								IRX4 (702568 upstream) : IRX2 (160832 downstream)																							atggatggatagatggatggat	0.000													3	7	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70840707	70840707	+	Intron	DEL	A	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70840707delA	uc003kbp.1	+						BDP1_uc003kbo.2_Intron|BDP1_uc003kbq.1_Intron|BDP1_uc003kbr.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		actctgtctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
MYOT	9499	broad.mit.edu	37	5	137222941	137222941	+	Frame_Shift_Del	DEL	G	-	-	rs141801816	byFrequency	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137222941delG	uc011cye.1	+	10	1381	c.1364delG	c.(1363-1365)CGGfs	p.R455fs	PKD2L2_uc010jep.1_5'Flank|PKD2L2_uc003lbw.1_5'Flank|PKD2L2_uc003lbx.2_5'Flank|PKD2L2_uc003lby.2_5'Flank|MYOT_uc003lbv.2_Frame_Shift_Del_p.R455fs|MYOT_uc011cyg.1_Frame_Shift_Del_p.R271fs|MYOT_uc011cyh.1_Frame_Shift_Del_p.R340fs	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b	455	Necessary for interaction with ACTA1.|Necessary for interaction with FLNC.				muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AAGCAGTTACGGGTTCGACCA	0.393													133	42	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167644115	167644116	+	Intron	DEL	GA	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167644115_167644116delGA	uc010jjd.2	+						ODZ2_uc003lzr.3_Intron|ODZ2_uc003lzt.3_Intron|ODZ2_uc010jje.2_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		AGATAGGTATgagagagagaga	0.391													4	2	---	---	---	---	
GCM2	9247	broad.mit.edu	37	6	10881788	10881805	+	Intron	DEL	TGTGTGTGTGTGTGTGTG	-	-	rs35911329		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10881788_10881805delTGTGTGTGTGTGTGTGTG	uc003mzn.3	-						SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2						cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				TTTGCGGgtatgtgtgtgtgtgtgtgtgtgtgtgtgtg	0.349													4	4	---	---	---	---	
GLP1R	2740	broad.mit.edu	37	6	39053973	39053982	+	3'UTR	DEL	ACACACACAT	-	-	rs58609195	byFrequency	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39053973_39053982delACACACACAT	uc003ooj.3	+	13					GLP1R_uc003ooh.2_Intron|GLP1R_uc003ooi.2_Intron	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor						activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	acacacacacacacacacatacaTCCTGCT	0.462													12	6	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44149228	44149229	+	Intron	DEL	CA	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149228_44149229delCA	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			acaaccacaccacacacacaca	0.163													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	45923555	45923558	+	IGR	DEL	TCTT	-	-	rs71935217		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45923555_45923558delTCTT								SEPT7P2 (114938 upstream) : IGFBP1 (4401 downstream)																							CCAGAACCGAtctttctttctttt	0.235													13	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	80866873	80866884	+	IGR	DEL	TCCTTCCTTCCT	-	-	rs151120340	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80866873_80866884delTCCTTCCTTCCT								SEMA3C (315198 upstream) : HGF (464561 downstream)																							tttccttccctccttccttccttccttccttc	0.000													91	28	---	---	---	---	
ZCWPW1	55063	broad.mit.edu	37	7	100017227	100017227	+	Intron	DEL	C	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100017227delC	uc003uut.2	-						ZCWPW1_uc011kjq.1_5'Flank|ZCWPW1_uc003uur.2_5'Flank|ZCWPW1_uc003uus.2_Intron|ZCWPW1_uc011kjr.1_Intron|ZCWPW1_uc003uuu.1_Intron|ZCWPW1_uc011kjs.1_5'Flank|ZCWPW1_uc011kjt.1_Intron|ZCWPW1_uc011kju.1_Intron	NM_017984	NP_060454	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1								zinc ion binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AAATCTCCTACCAGAGCCCAC	0.433													68	17	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48614649	48614660	+	Intron	DEL	TCTCTCTCTCTT	-	-	rs3885622	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48614649_48614660delTCTCTCTCTCTT	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				tctctctctctctctctctctTacacacacac	0.170													4	2	---	---	---	---	
LY96	23643	broad.mit.edu	37	8	74922424	74922424	+	Intron	DEL	G	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74922424delG	uc003yad.2	+							NM_015364	NP_056179	Q9Y6Y9	LY96_HUMAN	MD-2 protein precursor						cellular defense response|detection of lipopolysaccharide|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	extracellular space|lipopolysaccharide receptor complex|plasma membrane	coreceptor activity|lipopolysaccharide receptor activity|protein binding				0	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			AAAATGTTATGAAAATTAAAT	0.274													28	12	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144403663	144403666	+	Intron	DEL	CACG	-	-	rs72210604		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144403663_144403666delCACG	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	gcacgccacacacgcacgccacac	0.137													3	3	---	---	---	---	
SPOCK2	9806	broad.mit.edu	37	10	73822296	73822297	+	3'UTR	DEL	CA	-	-	rs111643095		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73822296_73822297delCA	uc001jso.1	-	11					SPOCK2_uc001jsp.2_3'UTR|uc001jsq.1_RNA	NM_014767	NP_055582	Q92563	TICN2_HUMAN	sparc/osteonectin, cwcv and kazal-like domains						extracellular matrix organization|regulation of cell differentiation|signal transduction|synapse assembly	proteinaceous extracellular matrix	calcium ion binding				0						CAGCGCATGCcacacacacaca	0.426													8	4	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116228181	116228182	+	Intron	INS	-	T	T	rs139090094		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116228181_116228182insT	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc010qsf.1_Intron|ABLIM1_uc009xyn.2_Intron|ABLIM1_uc010qsj.1_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		ctacaggcgccgccaccacccc	0.000													1	6	---	---	---	---	
MICALCL	84953	broad.mit.edu	37	11	12313539	12313552	+	Intron	DEL	CCACGCCTTGGGCA	-	-	rs146984713	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12313539_12313552delCCACGCCTTGGGCA	uc001mkg.1	+							NM_032867	NP_116256	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	mitogen-activated protein kinase binding			skin(1)	1				Epithelial(150;0.00177)		CCTCTGAGTCCCACGCCTTGGGCACCAGGAACCT	0.477													60	15	---	---	---	---	
FGF3	2248	broad.mit.edu	37	11	69628573	69628576	+	Intron	DEL	TGGG	-	-	rs149220036	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69628573_69628576delTGGG	uc001oph.2	-							NM_005247	NP_005238	P11487	FGF3_HUMAN	fibroblast growth factor 3 precursor						fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of cardiac muscle tissue development|positive regulation of cell division|positive regulation of cell proliferation	extracellular region	growth factor activity			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			gatggatggatgggtggatgggtg	0.000													15	20	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69971958	69971959	+	Intron	DEL	AC	-	-	rs10792912		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69971958_69971959delAC	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						tcaaaaaaaaacaaaaaaagag	0.262													64	8	---	---	---	---	
TAS2R50	259296	broad.mit.edu	37	12	11139103	11139106	+	Frame_Shift_Del	DEL	AAGA	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11139103_11139106delAAGA	uc001qzl.2	-	1	406_409	c.354_357delTCTT	c.(352-357)TTTCTTfs	p.F118fs	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176890	NP_795371	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	118_119	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(2)	2						TCTTTAAATGAAGAAAAAGAAGGT	0.392													69	23	---	---	---	---	
LETMD1	25875	broad.mit.edu	37	12	51449448	51449449	+	Intron	INS	-	A	A			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51449448_51449449insA	uc001rxm.2	+						LETMD1_uc010smz.1_Intron|LETMD1_uc010sna.1_Intron|LETMD1_uc001rxl.2_Intron|LETMD1_uc009zlv.2_Intron|LETMD1_uc001rxs.2_Intron|LETMD1_uc009zlw.2_Intron|LETMD1_uc001rxn.2_Intron|LETMD1_uc001rxo.2_Intron|LETMD1_uc001rxp.2_Intron|LETMD1_uc001rxq.2_Intron|LETMD1_uc001rxr.2_Intron|LETMD1_uc001rxt.2_Intron	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1							integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						ccctgtctcttaaaaaaaaaaa	0.139													4	3	---	---	---	---	
TIMELESS	8914	broad.mit.edu	37	12	56822987	56822988	+	Intron	INS	-	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56822987_56822988insT	uc001slf.2	-						TIMELESS_uc001slg.2_Intron	NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog						cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						CACCGTCATAAttttttttttt	0.203													7	4	---	---	---	---	
BAZ2A	11176	broad.mit.edu	37	12	57009177	57009178	+	Frame_Shift_Ins	INS	-	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57009177_57009178insC	uc001slq.1	-	3	550_551	c.356_357insG	c.(355-357)GGAfs	p.G119fs	BAZ2A_uc001slp.1_Frame_Shift_Ins_p.G117fs|BAZ2A_uc010sqr.1_Frame_Shift_Ins_p.G119fs|BAZ2A_uc009zow.1_Frame_Shift_Ins_p.G117fs	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	119					chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0						GTGGGTATTGTCCCCCCGAGAA	0.584													151	76	---	---	---	---	
RABGGTA	5875	broad.mit.edu	37	14	24739363	24739364	+	Intron	INS	-	G	G	rs145834132	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24739363_24739364insG	uc001wof.2	-						RABGGTA_uc001woe.2_5'Flank|RABGGTA_uc001wog.2_Intron|RABGGTA_uc001woh.2_Intron|RABGGTA_uc001woi.2_Intron	NM_004581	NP_004572	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase alpha						visual perception		Rab geranylgeranyltransferase activity|zinc ion binding				0				GBM - Glioblastoma multiforme(265;0.0184)		CCAGAAGGGAAGGGGGGGGTCA	0.589													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	75340955	75340956	+	IGR	DEL	TT	-	-	rs35863744		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75340955_75340956delTT								PROX2 (10418 upstream) : DLST (7638 downstream)																							ATCATACAAGtttttttttttt	0.198													4	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106877447	106877448	+	Intron	INS	-	TGATCT	TGATCT	rs144817208	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106877447_106877448insTGATCT	uc010tyt.1	-						uc010tyu.1_In_Frame_Ins_p.168_169insRS					Parts of antibodies, mostly variable regions.												0						GAGGGAGACGACTGAGAAGATG	0.584													5	6	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27633504	27633515	+	Intron	DEL	AAGGAAGGAAGA	-	-	rs111716322		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27633504_27633515delAAGGAAGGAAGA	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		gagggtaaggaaggaaggaagaaaggaaggaa	0.104													4	2	---	---	---	---	
NUSAP1	51203	broad.mit.edu	37	15	41672441	41672442	+	3'UTR	INS	-	T	T	rs34658531		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41672441_41672442insT	uc001zns.3	+	11					NUSAP1_uc001znq.3_3'UTR|NUSAP1_uc001znr.3_3'UTR|NUSAP1_uc010bce.2_3'UTR|NUSAP1_uc001znt.3_3'UTR|NUSAP1_uc001znv.3_3'UTR|NUSAP1_uc001znu.3_3'UTR|NUSAP1_uc010ucw.1_3'UTR|NUSAP1_uc001znw.3_3'UTR	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1						cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CCTTTTGTAAATTTTTTTTTTT	0.351													3	3	---	---	---	---	
ZNF609	23060	broad.mit.edu	37	15	64973414	64973415	+	Intron	INS	-	T	T			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64973414_64973415insT	uc002ann.2	+							NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						TGAGTATCAGATTTTTTTTTCT	0.396													526	8	---	---	---	---	
GOLGA6C	653641	broad.mit.edu	37	15	75558367	75558367	+	Intron	DEL	T	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75558367delT	uc002azs.1	+						uc002azt.1_5'Flank	NM_001145224	NP_001138696	A6NDK9	GOG6C_HUMAN	golgi autoantigen, golgin subfamily a, 6D											ovary(1)	1						CAAGAGGAGGTTTTTTTTTTT	0.512													61	8	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90617221	90617222	+	Intron	INS	-	A	A	rs35145118		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90617221_90617222insA	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			gagtctgtctcaaaaaaaaaac	0.223													19	8	---	---	---	---	
PRC1	9055	broad.mit.edu	37	15	91523763	91523764	+	Intron	INS	-	G	G	rs28584391		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91523763_91523764insG	uc002bqm.2	-						PRC1_uc002bqn.2_Intron|PRC1_uc002bqo.2_Intron|PRC1_uc010uqs.1_Intron	NM_003981	NP_003972	O43663	PRC1_HUMAN	protein regulator of cytokinesis 1 isoform 1						cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding			ovary(1)|skin(1)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)					ttttttttttttttgagacagg	0.134													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	61089308	61089309	+	IGR	INS	-	C	C			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61089308_61089309insC								None (None upstream) : CDH8 (597926 downstream)																							tcttcttttttttttttttttt	0.218													12	15	---	---	---	---	
NAE1	8883	broad.mit.edu	37	16	66839541	66839541	+	Intron	DEL	A	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66839541delA	uc002eqf.2	-						NAE1_uc002eqe.2_Intron|NAE1_uc002eqg.2_Intron|NAE1_uc010cdv.2_Intron	NM_003905	NP_003896	Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1 isoform a						apoptosis|cell cycle|DNA replication|mitotic cell cycle DNA replication checkpoint|protein neddylation|signal transduction	cytoplasm|insoluble fraction|plasma membrane	catalytic activity|protein heterodimerization activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	actgcgtctcaaaaaaaaaaa	0.124													9	4	---	---	---	---	
VAC14	55697	broad.mit.edu	37	16	70816914	70816915	+	Intron	INS	-	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70816914_70816915insG	uc002ezm.2	-						VAC14_uc010cfw.2_Intron|VAC14_uc002ezn.2_Intron	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog						interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				GCCGTGGCTGTGGGCCCTCCCC	0.554													248	7	---	---	---	---	
C1QL1	10882	broad.mit.edu	37	17	43037495	43037496	+	3'UTR	INS	-	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43037495_43037496insG	uc002ihv.2	-	2						NM_006688	NP_006679	O75973	C1QRF_HUMAN	complement component 1, q subcomponent-like 1						locomotory behavior	collagen					0		Prostate(33;0.155)				AGTCATCGTCTGCCCCGCCCGG	0.708													69	7	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64302446	64302446	+	Intron	DEL	A	-	-	rs141495406		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64302446delA	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	TTCTCATTGGAAAAAAAAAAA	0.323													4	2	---	---	---	---	
LLGL2	3993	broad.mit.edu	37	17	73569700	73569701	+	Frame_Shift_Ins	INS	-	G	G	rs112393371	byFrequency	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73569700_73569701insG	uc002joh.2	+	21	3018_3019	c.2864_2865insG	c.(2863-2865)CCGfs	p.P955fs	LLGL2_uc002joi.2_Frame_Shift_Ins_p.P955fs|LLGL2_uc010dgg.1_Frame_Shift_Ins_p.P955fs|LLGL2_uc002joj.2_Frame_Shift_Ins_p.P944fs|LLGL2_uc010wsd.1_Frame_Shift_Ins_p.P582fs	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c	955					cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			AAGAAGGCCCCGAGCCGAGCCA	0.668													56	7	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544277	80544278	+	Intron	INS	-	A	A	rs149999499	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544277_80544278insA	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gaaaggtgggcgggggggaaag	0.000													7	4	---	---	---	---	
CCDC68	80323	broad.mit.edu	37	18	52610102	52610103	+	Intron	DEL	AC	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52610102_52610103delAC	uc002lfs.2	-						CCDC68_uc002lft.2_Intron	NM_001143829	NP_001137301	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68											skin(1)	1				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		TGGTTCATAAACTGAAATAAGT	0.282													27	8	---	---	---	---	
HOMER3	9454	broad.mit.edu	37	19	19048969	19048970	+	Intron	INS	-	A	A	rs139729656	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19048969_19048970insA	uc002nku.2	-						HOMER3_uc010eby.2_Intron|HOMER3_uc010ebz.2_Intron|HOMER3_uc002nkw.2_Intron|HOMER3_uc002nkv.2_Intron	NM_004838	NP_004829	Q9NSC5	HOME3_HUMAN	Homer, neuronal immediate early gene, 3 isoform						metabotropic glutamate receptor signaling pathway|protein targeting	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	protein binding				0			Epithelial(12;0.0107)			CAGCCTATCTCAAAAAAAAAAC	0.099													5	5	---	---	---	---	
ZNF573	126231	broad.mit.edu	37	19	38229202	38229203	+	3'UTR	DEL	TC	-	-	rs59220620		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38229202_38229203delTC	uc002ohe.2	-	4					ZNF573_uc010efs.2_3'UTR|ZNF573_uc002ohd.2_3'UTR|ZNF573_uc002ohf.2_3'UTR|ZNF573_uc002ohg.2_3'UTR	NM_152360	NP_689573	Q86YE8	ZN573_HUMAN	zinc finger protein 573						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TTTTTTTTTTTCTTAATTTACC	0.272													53	8	---	---	---	---	
CCDC9	26093	broad.mit.edu	37	19	47774947	47774952	+	3'UTR	DEL	TGTGTG	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47774947_47774952delTGTGTG	uc010xym.1	+	12						NM_015603	NP_056418	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9												0		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		GCTGGCTGCCtgtgtgtgtgtgtgtg	0.422													84	8	---	---	---	---	
MEIS3	56917	broad.mit.edu	37	19	47918144	47918145	+	Intron	INS	-	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47918144_47918145insG	uc002pgu.2	-						MEIS3_uc002pgo.2_5'Flank|MEIS3_uc002pgp.2_5'UTR|MEIS3_uc002pgq.2_Intron|MEIS3_uc002pgr.2_Intron|MEIS3_uc002pgt.2_Intron|MEIS3_uc002pgv.2_Intron|MEIS3_uc002pgs.2_Intron|MEIS3_uc010eld.2_Intron	NM_001009813	NP_001009813	Q99687	MEIS3_HUMAN	Meis1, myeloid ecotropic viral integration site							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		ACCGGGGTACTGGGGGGGGCCA	0.673													18	18	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													2	5	---	---	---	---	
MIR1323	100302255	broad.mit.edu	37	19	54172547	54172548	+	5'Flank	INS	-	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54172547_54172548insG	hsa-mir-1323|MI0003786	+																							0						CGGGGGGCTCCAGGAGCCACTG	0.554													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23961025	23961028	+	IGR	DEL	ACAC	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23961025_23961028delACAC								CST5 (100645 upstream) : GGTLC1 (4663 downstream)																							actcacacatacacacacaaacac	0.000													8	4	---	---	---	---	
MMP24	10893	broad.mit.edu	37	20	33862215	33862216	+	Frame_Shift_Ins	INS	-	G	G			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33862215_33862216insG	uc002xbu.2	+	9	1744_1745	c.1741_1742insG	c.(1741-1743)CGGfs	p.R581fs	EDEM2_uc010zuv.1_Intron	NM_006690	NP_006681	Q9Y5R2	MMP24_HUMAN	matrix metalloproteinase 24 preproprotein	581	Extracellular (Potential).				proteolysis	integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GAAGGAGCGGCGGCTGCCCCAG	0.644													221	7	---	---	---	---	
RALGAPB	57148	broad.mit.edu	37	20	37182421	37182421	+	Intron	DEL	A	-	-	rs35371902		TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37182421delA	uc002xiw.2	+						RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						gcccagtctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
BCR	613	broad.mit.edu	37	22	23540616	23540617	+	Intron	INS	-	AG	AG			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23540616_23540617insAG	uc002zww.2	+						BCR_uc002zwx.2_Intron	NM_004327	NP_004318	P11274	BCR_HUMAN	breakpoint cluster region isoform 1						regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity		BCR/JAK2(6)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12						GTGACCCCCAAAGAGAGGTGGC	0.545			T	ABL1| FGFR1|JAK2 	CML|ALL|AML								46	14	---	---	---	---	
GGT1	2678	broad.mit.edu	37	22	25016169	25016170	+	Intron	INS	-	T	T	rs28418841	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016169_25016170insT	uc003aan.1	+						GGT1_uc003aas.1_Intron|GGT1_uc003aat.1_Intron|GGT1_uc003aau.1_Intron|GGT1_uc003aav.1_Intron|GGT1_uc003aaw.1_Intron|GGT1_uc003aax.1_Intron	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	aaaaaaaaaaaaTCTTTCCTCC	0.277													18	7	---	---	---	---	
MN1	4330	broad.mit.edu	37	22	28146768	28146769	+	3'UTR	INS	-	G	G	rs139246561	by1000genomes	TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28146768_28146769insG	uc003adj.2	-	2					MN1_uc010gvg.2_RNA	NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						ACCAACCTAGAGAAAAAAAAAA	0.292			T	ETV6	AML|meningioma								6	3	---	---	---	---	
NEFH	4744	broad.mit.edu	37	22	29879281	29879281	+	Intron	DEL	G	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29879281delG	uc003afo.2	+							NM_021076	NP_066554	P12036	NFH_HUMAN	neurofilament, heavy polypeptide 200kDa						cell death|nervous system development	neurofilament					0						aaaaaaaaaagaaaaagaaca	0.234													197	7	---	---	---	---	
FBLN1	2192	broad.mit.edu	37	22	45970657	45970657	+	Intron	DEL	C	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45970657delC	uc003bgj.1	+							NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D						interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GCAGAACtttctttttttttt	0.289													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	65295379	65295379	+	IGR	DEL	C	-	-			TCGA-DK-A1A5-01A-11D-A13W-08	TCGA-DK-A1A5-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65295379delC								VSIG4 (35412 upstream) : HEPH (87284 downstream)																							TGCCCTTCTGCCACTGCCTAT	0.537													1	8	---	---	---	---	
