Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
C1orf86	199990	broad.mit.edu	37	1	2125504	2125504	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2125504A>T	uc001aiy.2	-	2	157	c.131T>A	c.(130-132)CTG>CAG	p.L44Q	C1orf86_uc001aiv.1_RNA|C1orf86_uc001aiw.1_RNA|C1orf86_uc001aix.1_Intron	NM_182533	NP_872339	Q6NZ36	CA086_HUMAN	hypothetical protein LOC199990 isoform 2	44											0	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		CACCGTGCGCAGTAGCTCGGC	0.672													5	27	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10166548	10166548	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10166548C>T	uc001aqs.3	+	7	1816	c.1103C>T	c.(1102-1104)TCC>TTC	p.S368F	UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	368					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GCCAGCAGTTCCAGACAGAGG	0.652													10	43	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12396050	12396050	+	Intron	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12396050G>T	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc001aty.1_3'UTR	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CAGTTTTCTGGCATGAACTAC	0.388													4	8	---	---	---	---	PASS
EPHA2	1969	broad.mit.edu	37	1	16477395	16477395	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16477395T>C	uc001aya.1	-	2	286	c.149A>G	c.(148-150)AAA>AGA	p.K50R	EPHA2_uc010oca.1_Missense_Mutation_p.K50R	NM_004431	NP_004422	P29317	EPHA2_HUMAN	ephrin receptor EphA2 precursor	50	Extracellular (Potential).				activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding			lung(3)|central_nervous_system(3)|stomach(2)|ovary(2)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)	ACATACCCCTTTGCCATACGG	0.473													17	130	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974868	16974868	+	RNA	SNP	G	T	T	rs28715800	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974868G>T	uc010och.1	+	7		c.1328G>T			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						GTGCCAGCGCGGGTCCGCTGA	0.706													3	21	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16976649	16976649	+	RNA	SNP	C	T	T	rs1057333	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16976649C>T	uc010och.1	+	14		c.2370C>T			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						ACCGAGTATGCGCAAGGTCGC	0.567													20	51	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16976681	16976681	+	RNA	SNP	G	T	T	rs3175284	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16976681G>T	uc010och.1	+	14		c.2402G>T			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						GTCTTCACGCGTGTCTCTGTG	0.542													15	40	---	---	---	---	PASS
PADI1	29943	broad.mit.edu	37	1	17552363	17552363	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17552363C>T	uc001bah.1	+	5	558	c.466C>T	c.(466-468)CGG>TGG	p.R156W		NM_013358	NP_037490	Q9ULC6	PADI1_HUMAN	peptidylarginine deiminase type I	156					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity				0		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GAACTGTGACCGGGACAATCA	0.597													20	162	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19449357	19449357	+	Silent	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19449357G>C	uc001bbi.2	-	66	9790	c.9786C>G	c.(9784-9786)TCC>TCG	p.S3262S	UBR4_uc001bbk.1_Silent_p.S909S	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	3262					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ATTGCAAGGCGGAGCCTGAGC	0.562													22	128	---	---	---	---	PASS
PLA2G2E	30814	broad.mit.edu	37	1	20248869	20248869	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20248869C>G	uc001bct.1	-	3	266	c.208G>C	c.(208-210)GGG>CGG	p.G70R		NM_014589	NP_055404	Q9NZK7	PA2GE_HUMAN	phospholipase A2, group IIE precursor	70					inflammatory response|lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|phospholipase A2 activity				0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|GBM - Glioblastoma multiforme(114;0.000146)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCCAGACGCCCGTAGCAGCAG	0.612													5	54	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22903038	22903038	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22903038G>A	uc001bfx.1	+	3	613	c.488G>A	c.(487-489)CGT>CAT	p.R163H	EPHA8_uc001bfw.2_Missense_Mutation_p.R163H	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	163	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGTGTGCGGCGTCTCAAGCTC	0.622													9	87	---	---	---	---	PASS
ASAP3	55616	broad.mit.edu	37	1	23763959	23763959	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23763959C>T	uc001bha.2	-	13	1233	c.1109G>A	c.(1108-1110)CGG>CAG	p.R370Q	ASAP3_uc001bgy.1_5'Flank|ASAP3_uc001bgz.1_5'Flank|ASAP3_uc010odz.1_Missense_Mutation_p.R239Q|ASAP3_uc010oea.1_Missense_Mutation_p.R361Q|ASAP3_uc001bhb.2_5'UTR	NM_017707	NP_060177	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	370	PH.				regulation of ARF GTPase activity	cytoplasm	ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						GTGGTACGTCCGGTTGTCTGT	0.682													7	92	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24392387	24392387	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24392387A>C	uc001bin.3	-	29	3691	c.3528T>G	c.(3526-3528)ATT>ATG	p.I1176M	MYOM3_uc001bil.3_Missense_Mutation_p.I69M|MYOM3_uc001bim.3_Missense_Mutation_p.I833M|MYOM3_uc001bio.2_Missense_Mutation_p.I1176M	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	1176	Ig-like C2-type 3.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		TTGCCTCTTCAATGCAGAGAA	0.547													238	61	---	---	---	---	PASS
C1orf172	126695	broad.mit.edu	37	1	27277225	27277225	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27277225C>T	uc001bni.1	-	3	1151	c.1062G>A	c.(1060-1062)CAG>CAA	p.Q354Q		NM_152365	NP_689578	Q8NAX2	CA172_HUMAN	hypothetical protein LOC126695	354										large_intestine(1)|ovary(1)	2		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		CAGTCGTCTCCTGGGAGATCT	0.567													4	98	---	---	---	---	PASS
PTP4A2	8073	broad.mit.edu	37	1	32381498	32381498	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32381498G>C	uc001bty.1	-	3	1181	c.187C>G	c.(187-189)CTA>GTA	p.L63V	PTP4A2_uc010ogs.1_Intron|PTP4A2_uc001btz.1_Missense_Mutation_p.L63V	NM_080391	NP_536316	Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2	63						early endosome|plasma membrane	prenylated protein tyrosine phosphatase activity|protein binding|protein tyrosine/serine/threonine phosphatase activity				0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				ACACTCACTAGAACGTGGATT	0.254													12	38	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36941192	36941192	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36941192C>T	uc001caw.1	-	4	325	c.147G>A	c.(145-147)AAG>AAA	p.K49K	CSF3R_uc001cav.1_Silent_p.K49K|CSF3R_uc001cax.1_Silent_p.K49K|CSF3R_uc001cay.1_Silent_p.K49K	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a	49	Ig-like C2-type.|Extracellular (Potential).				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TGCAGTTCTGCTTGATGATGC	0.622													20	17	---	---	---	---	PASS
MPL	4352	broad.mit.edu	37	1	43804317	43804317	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43804317C>T	uc001ciw.2	+	3	362	c.317C>T	c.(316-318)CCG>CTG	p.P106L	MPL_uc001civ.2_Missense_Mutation_p.P106L|MPL_uc009vwr.2_Missense_Mutation_p.P99L	NM_005373	NP_005364	P40238	TPOR_HUMAN	myeloproliferative leukemia virus oncogene	106	Extracellular (Potential).				cell proliferation|platelet activation	integral to plasma membrane	cytokine receptor activity			haematopoietic_and_lymphoid_tissue(361)|upper_aerodigestive_tract(1)|pancreas(1)	363	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTCTTCTTTCCGCTGCACCTC	0.562			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia						42	41	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43886915	43886915	+	5'Flank	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43886915C>A	uc001cjk.1	+						KIAA0467_uc009vws.1_Missense_Mutation_p.P523T	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTTCACGCTTCCTGACAGCAC	0.542													13	23	---	---	---	---	PASS
HYI	81888	broad.mit.edu	37	1	43917920	43917920	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43917920C>T	uc001cjo.2	-	3	552	c.382G>A	c.(382-384)GTT>ATT	p.V128I	KIAA0467_uc001cjk.1_3'UTR|KIAA0467_uc001cjl.1_3'UTR|HYI_uc001cjm.2_Missense_Mutation_p.V55I|HYI_uc001cjn.2_Missense_Mutation_p.V128I|HYI_uc001cjp.2_Missense_Mutation_p.V55I	NM_031207	NP_112484	Q5T013	HYI_HUMAN	hydroxypyruvate isomerase homolog	128							hydroxypyruvate isomerase activity			ovary(1)	1	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TCCAGAAAAACGGCCTCCATC	0.562													3	19	---	---	---	---	PASS
PIK3R3	8503	broad.mit.edu	37	1	46509296	46509296	+	3'UTR	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46509296A>G	uc001cpb.3	-	10					PIK3R3_uc009vyb.2_3'UTR|PIK3R3_uc009vyc.2_3'UTR|PIK3R3_uc001cpc.3_3'UTR|PIK3R3_uc010olw.1_3'UTR|PIK3R3_uc010olv.1_3'UTR	NM_003629	NP_003620	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3						insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					AGTCTAATAAAAACTGTAGAA	0.468													5	15	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52704303	52704303	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52704303C>G	uc001cto.2	+	4	1386	c.1214C>G	c.(1213-1215)ACT>AGT	p.T405S	ZFYVE9_uc001ctn.2_Missense_Mutation_p.T405S|ZFYVE9_uc001ctp.2_Missense_Mutation_p.T405S	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	405					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						TGGAAGTTGACTAAACTAAAT	0.373													34	85	---	---	---	---	PASS
LPAR3	23566	broad.mit.edu	37	1	85331472	85331472	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85331472C>T	uc001dkl.2	-	1	371	c.332G>A	c.(331-333)AGT>AAT	p.S111N	LPAR3_uc009wcj.1_Missense_Mutation_p.S111N	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	111	Helical; Name=3; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						AGTCAAGCTACTGTCCAGAAG	0.498													114	104	---	---	---	---	PASS
BTBD8	284697	broad.mit.edu	37	1	92546079	92546079	+	5'UTR	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92546079G>A	uc001doo.2	+	1					BTBD8_uc010otc.1_RNA	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8							nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		CCTGGGCGGGGCAAGTGAGGC	0.632													16	10	---	---	---	---	PASS
ARHGAP29	9411	broad.mit.edu	37	1	94650459	94650459	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94650459G>T	uc001dqj.3	-	18	2447	c.2078C>A	c.(2077-2079)TCA>TAA	p.S693*	ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dqk.2_Nonsense_Mutation_p.S259*	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	693	Rho-GAP.				Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTCAATCTCTGAGGCACATAT	0.333													18	71	---	---	---	---	PASS
KCNA2	3737	broad.mit.edu	37	1	111146201	111146201	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111146201T>A	uc001dzu.2	-	2	1700	c.1204A>T	c.(1204-1206)ATT>TTT	p.I402F	KCNA2_uc009wfv.1_Intron|KCNA2_uc009wfw.2_Missense_Mutation_p.I402F	NM_004974	NP_004965	P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related	402	Helical; Name=Segment S6; (Potential).					juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(1)	1		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)		GGTAAGGCAATAGTTAACACA	0.498													41	46	---	---	---	---	PASS
CTTNBP2NL	55917	broad.mit.edu	37	1	112999502	112999502	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112999502G>A	uc001ebx.2	+	6	1616	c.1388G>A	c.(1387-1389)CGC>CAC	p.R463H	CTTNBP2NL_uc001ebz.2_RNA	NM_018704	NP_061174	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	463						actin cytoskeleton	protein binding			central_nervous_system(2)|ovary(1)	3		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATGCAGCTCGCCACAAATTT	0.542													40	120	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144621638	144621638	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144621638A>C	uc009wig.1	+	9	1046	c.970A>C	c.(970-972)AAC>CAC	p.N324H	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.N324H|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.N255H|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Missense_Mutation_p.N255H|NBPF9_uc010oyg.1_Missense_Mutation_p.N289H|NBPF9_uc009wii.1_Missense_Mutation_p.N53H	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	324						cytoplasm					0						CTTCCTGGCCAACCAGCAGAA	0.438													5	224	---	---	---	---	PASS
PDIA3P	171423	broad.mit.edu	37	1	146650526	146650526	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146650526C>A	uc001epg.1	+	1	1097	c.834C>A	c.(832-834)TAC>TAA	p.Y278*		NR_002305				SubName: Full=cDNA FLJ53558, highly similar to Protein disulfide-isomerase A3 (EC 5.3.4.1);												0						GTTCCAACTACTGGAGAAACA	0.408													41	29	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152187692	152187692	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152187692G>A	uc001ezt.1	-	3	6489	c.6413C>T	c.(6412-6414)TCT>TTT	p.S2138F		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2138					keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTGATCTAGAGCCGTGTTG	0.572													26	673	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154321348	154321348	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154321348G>C	uc001fex.2	+	28	3426	c.3426G>C	c.(3424-3426)CAG>CAC	p.Q1142H		NM_020452	NP_065185	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform a	1128	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGAAGAAGCAGAAGGCCCAGC	0.637													11	7	---	---	---	---	PASS
C1orf104	284618	broad.mit.edu	37	1	155291411	155291411	+	5'UTR	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155291411G>A	uc001fki.2	-	2					RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fkh.1_5'Flank|RUSC1_uc001fkj.2_Intron|RUSC1_uc001fkk.2_Intron|RUSC1_uc009wqn.1_5'Flank|RUSC1_uc009wqo.1_5'Flank|RUSC1_uc001fkl.2_5'Flank|RUSC1_uc001fkp.2_5'Flank|RUSC1_uc001fkq.2_5'Flank|RUSC1_uc010pgb.1_5'Flank|RUSC1_uc009wqp.1_5'Flank|RUSC1_uc001fkn.2_5'Flank|RUSC1_uc001fko.2_5'Flank|RUSC1_uc001fkr.2_5'Flank	NM_001039517	NP_001034606	Q66K80	RUAS1_HUMAN	hypothetical protein LOC284618												0	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.32e-10)|all cancers(21;3.51e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CTGCCGTCAAGTCACCTCGGT	0.542													9	12	---	---	---	---	PASS
RHBG	57127	broad.mit.edu	37	1	156352123	156352123	+	Intron	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156352123A>G	uc010pho.1	+						RHBG_uc010phm.1_3'UTR|RHBG_uc010phn.1_Intron|RHBG_uc001fos.2_Intron|RHBG_uc009wrz.2_Intron|RHBG_uc001for.2_Intron	NM_020407	NP_065140	Q9H310	RHBG_HUMAN	Rhesus blood group, B glycoprotein						transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			ovary(2)	2	Hepatocellular(266;0.158)					agcaaaggaaattggagttaa	0.144													10	13	---	---	---	---	PASS
HDGF	3068	broad.mit.edu	37	1	156713090	156713090	+	3'UTR	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156713090G>A	uc001fpy.3	-	6					MRPL24_uc001fpw.1_5'Flank|MRPL24_uc001fpx.1_5'Flank|HDGF_uc009wsd.2_3'UTR|HDGF_uc001fpz.3_3'UTR|HDGF_uc009wse.2_3'UTR|HDGF_uc010phr.1_3'UTR|HDGF_uc009wsf.2_3'UTR|HDGF_uc009wsg.2_Intron	NM_004494	NP_004485	P51858	HDGF_HUMAN	hepatoma-derived growth factor isoform a						cell proliferation|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	DNA binding|growth factor activity|heparin binding|nucleotide binding			lung(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CAATCTCCATGGGCTGGGCTT	0.567													5	24	---	---	---	---	PASS
CCDC19	25790	broad.mit.edu	37	1	159842832	159842832	+	Silent	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159842832C>G	uc001fui.2	-	11	1497	c.1479G>C	c.(1477-1479)CGG>CGC	p.R493R	CCDC19_uc009wtb.2_RNA|CCDC19_uc001fuj.2_RNA|CCDC19_uc001fuk.2_Silent_p.R408R|CCDC19_uc001ful.2_Silent_p.R408R	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1	493	Potential.					mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			AGGTGGCAATCCGGTTCTGCA	0.592													56	184	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160259698	160259698	+	3'UTR	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160259698C>A	uc009wti.2	-	33					COPA_uc001fvv.3_3'UTR	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform						COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTCATTTGTTCCTTAAAATAA	0.209													3	18	---	---	---	---	PASS
VANGL2	57216	broad.mit.edu	37	1	160389046	160389046	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160389046C>A	uc001fwb.1	+	5	746	c.447C>A	c.(445-447)TTC>TTA	p.F149L	VANGL2_uc001fwc.1_Missense_Mutation_p.F149L	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	vang-like 2	149	Helical; Name=2; (Potential).				apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane				ovary(1)	1	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGGGCCTCTTCATCTCTGTCG	0.662													18	171	---	---	---	---	PASS
CD244	51744	broad.mit.edu	37	1	160801216	160801216	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160801216A>G	uc009wtq.2	-	9	1212	c.1034T>C	c.(1033-1035)ATT>ACT	p.I345T	CD244_uc001fxa.2_Missense_Mutation_p.I340T|CD244_uc009wtp.2_RNA|CD244_uc009wtr.2_Missense_Mutation_p.I248T	NM_016382	NP_057466	Q9BZW8	CD244_HUMAN	CD244 natural killer cell receptor 2B4	345	Cytoplasmic (Potential).				blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			ACTCTTTCCAATCTGCAAAAG	0.328													27	306	---	---	---	---	PASS
NME7	29922	broad.mit.edu	37	1	169101894	169101894	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169101894C>T	uc001gfu.2	-	12					ATP1B1_uc001gfs.1_RNA|NME7_uc010plq.1_RNA|NME7_uc001gft.2_3'UTR	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					GCCAGGAGTACAGTGCTCTTG	0.368													14	16	---	---	---	---	PASS
SELL	6402	broad.mit.edu	37	1	169677940	169677940	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169677940G>A	uc001ggk.2	-	3	288	c.90C>T	c.(88-90)TTC>TTT	p.F30F	C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_5'UTR|SELL_uc001ggl.1_Silent_p.F43F	NM_000655	NP_000646	P14151	LYAM1_HUMAN	selectin L precursor	30					blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding				0	all_hematologic(923;0.208)					GATGTGCCAGGAAATCTGCAA	0.294													4	4	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	170043669	170043669	+	5'UTR	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170043669C>T	uc001ggv.2	-	1					KIFAP3_uc010ply.1_5'UTR|KIFAP3_uc001ggw.1_5'UTR	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3						blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCGGTTATTTCCGGGGACGGT	0.642													10	13	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203667472	203667472	+	Silent	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203667472A>G	uc001gzw.2	+	3	1265	c.381A>G	c.(379-381)GAA>GAG	p.E127E	ATP2B4_uc001gzv.2_Silent_p.E127E|ATP2B4_uc009xaq.2_Silent_p.E127E	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	127	Extracellular (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CTGCTGGTGAAGAAAATGAAC	0.483													23	65	---	---	---	---	PASS
PIGR	5284	broad.mit.edu	37	1	207109079	207109079	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207109079T>C	uc001hez.2	-	5	1314	c.1130A>G	c.(1129-1131)GAA>GGA	p.E377G	PIGR_uc009xbz.2_Missense_Mutation_p.E377G	NM_002644	NP_002635	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor precursor	377	Ig-like V-type 4.|Extracellular (Potential).					extracellular region|integral to plasma membrane	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GCTTTTGCTTTCCTTACGGTT	0.622											OREG0014186	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	4	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8919858	8919858	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8919858G>A	uc002qzc.2	-	18	2498	c.2316C>T	c.(2314-2316)ATC>ATT	p.I772I	KIDINS220_uc010yiv.1_Silent_p.I538I|KIDINS220_uc002qzd.2_Silent_p.I730I|KIDINS220_uc010yiw.1_Silent_p.I773I	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	772	KAP NTPase.|Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATCCATCGATGATGACCACCA	0.468													21	36	---	---	---	---	PASS
CPSF3	51692	broad.mit.edu	37	2	9581956	9581956	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9581956C>T	uc002qzo.1	+	9	981	c.946C>T	c.(946-948)CAT>TAT	p.H316Y	CPSF3_uc010ewx.1_Missense_Mutation_p.H316Y|CPSF3_uc002qzp.1_Missense_Mutation_p.H279Y	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,	316					histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		GAGCATGGATCATTTTGATGA	0.398													40	42	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11367379	11367379	+	Splice_Site	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11367379C>T	uc002rbd.1	-	6	1317	c.868_splice	c.e6+1	p.G290_splice		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TATTTACTTACCCACTAGCAT	0.343													32	137	---	---	---	---	PASS
NT5C1B	93034	broad.mit.edu	37	2	18764244	18764244	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18764244G>A	uc002rcz.2	-	7	1195	c.1091C>T	c.(1090-1092)GCT>GTT	p.A364V	NT5C1B_uc002rcy.2_Missense_Mutation_p.A364V|NT5C1B_uc010exr.2_Missense_Mutation_p.A306V|NT5C1B_uc010yju.1_Missense_Mutation_p.A304V|NT5C1B_uc002rda.2_Missense_Mutation_p.A304V|NT5C1B_uc010yjv.1_Missense_Mutation_p.A381V|NT5C1B_uc010yjw.1_Missense_Mutation_p.A347V|NT5C1B_uc010exs.2_Missense_Mutation_p.A366V	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 1	364					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				ACGGAGTCTAGCATTGACATA	0.473													22	36	---	---	---	---	PASS
CGREF1	10669	broad.mit.edu	37	2	27324893	27324893	+	Intron	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27324893A>C	uc010eys.1	-						CGREF1_uc010ylf.1_Intron|CGREF1_uc002rip.1_Missense_Mutation_p.H92Q|CGREF1_uc002riq.2_Intron|CGREF1_uc010eyr.1_Intron|CGREF1_uc002rir.1_Intron|CGREF1_uc002ris.2_Intron	NM_006569	NP_006560	Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1						cell adhesion|cell cycle arrest|negative regulation of cell proliferation|response to stress	extracellular region	calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAAAGAGTTATGATGAGAAA	0.537													27	14	---	---	---	---	PASS
NLRC4	58484	broad.mit.edu	37	2	32475710	32475710	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32475710A>T	uc002roi.2	-	4	1469	c.1223T>A	c.(1222-1224)TTC>TAC	p.F408Y	NLRC4_uc002roj.1_Missense_Mutation_p.F408Y|NLRC4_uc010ezt.1_Intron	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12	408	NACHT.				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CTGCAGTTCGAAATCAAACTT	0.473													23	9	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32673877	32673877	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32673877G>A	uc010ezu.2	+	22	4633	c.4499G>A	c.(4498-4500)AGC>AAC	p.S1500N		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	1500					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GGATTATATAGCTCACCATTT	0.323													24	91	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39487881	39487881	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39487881A>G	uc002rro.2	-	29	2265	c.2174T>C	c.(2173-2175)TTT>TCT	p.F725S	MAP4K3_uc002rrp.2_Missense_Mutation_p.F704S|MAP4K3_uc010yns.1_Missense_Mutation_p.F278S	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	725	CNH.				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				CAGCATTTCAAACATTCTAAG	0.363													17	45	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55544701	55544701	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55544701G>A	uc002ryv.2	-	20	4440	c.3598C>T	c.(3598-3600)CGT>TGT	p.R1200C	CCDC88A_uc010yoz.1_Missense_Mutation_p.R1201C|CCDC88A_uc010ypa.1_Missense_Mutation_p.R1200C|CCDC88A_uc002ryu.2_Missense_Mutation_p.R483C|CCDC88A_uc002rys.2_Missense_Mutation_p.R186C|CCDC88A_uc002ryw.2_Missense_Mutation_p.R484C|CCDC88A_uc010fby.1_Missense_Mutation_p.R80C	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	1201	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						ATAAATTACCGGTCTTCAAGG	0.303													24	101	---	---	---	---	PASS
ARHGAP25	9938	broad.mit.edu	37	2	68962222	68962222	+	5'UTR	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68962222G>A	uc002seu.2	+	1					ARHGAP25_uc010yqk.1_Intron|ARHGAP25_uc010fdg.2_5'UTR|ARHGAP25_uc010yql.1_5'UTR	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						CAATCATAAGGAGGAACAAAA	0.443													8	18	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80101245	80101245	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80101245G>T	uc010ysh.1	+	5	634	c.629G>T	c.(628-630)CGA>CTA	p.R210L	CTNNA2_uc010yse.1_Missense_Mutation_p.R210L|CTNNA2_uc010ysf.1_Missense_Mutation_p.R210L|CTNNA2_uc010ysg.1_Missense_Mutation_p.R210L	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	210					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GCAGCCGCCCGAGGGGCTCTG	0.512													8	39	---	---	---	---	PASS
RMND5A	64795	broad.mit.edu	37	2	87116280	87116280	+	Intron	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87116280T>C	uc002srs.3	+						uc010fgu.1_RNA			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						CAAAGAGACATAGTATTTCTC	0.423													15	15	---	---	---	---	PASS
IL1RL1	9173	broad.mit.edu	37	2	102954647	102954647	+	5'UTR	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102954647C>T	uc002tbu.1	+	2					IL1RL1_uc010ywa.1_Intron|IL18R1_uc002tbw.3_Intron|IL1RL1_uc002tbv.2_5'UTR	NM_016232	NP_057316	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1 isoform 1						innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity			skin(2)|ovary(1)|central_nervous_system(1)	4						TGGTGACCTTCACTGTCGTAT	0.398													19	26	---	---	---	---	PASS
IFIH1	64135	broad.mit.edu	37	2	163136571	163136571	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163136571C>A	uc002uce.2	-	8	1798	c.1576G>T	c.(1576-1578)GAT>TAT	p.D526Y		NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	526					detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						TTCAGTTGATCAAGGTTTTCT	0.328													32	40	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170062610	170062610	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170062610C>G	uc002ues.2	-	40	7692	c.7479G>C	c.(7477-7479)ATG>ATC	p.M2493I		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2493	LDL-receptor class B 26.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CATCTTCAGCCATGGAATTAA	0.448													42	60	---	---	---	---	PASS
GAD1	2571	broad.mit.edu	37	2	171700564	171700564	+	Nonsense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171700564T>A	uc002ugi.2	+	7	1070	c.648T>A	c.(646-648)TAT>TAA	p.Y216*		NM_000817	NP_000808	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 isoform GAD67	216					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GGTTTACATATGAAATTGCAC	0.353													14	33	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179566962	179566962	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179566962C>T	uc010zfg.1	-	105	26936	c.26712G>A	c.(26710-26712)TCG>TCA	p.S8904S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.S5565S|TTN_uc010fre.1_Silent_p.S15S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9831							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGCGATGACCGAGTAGACAC	0.448													6	21	---	---	---	---	PASS
NIF3L1	60491	broad.mit.edu	37	2	201760010	201760010	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201760010G>A	uc002uwm.2	+	4	714	c.623G>A	c.(622-624)CGG>CAG	p.R208Q	NIF3L1_uc002uwl.2_Missense_Mutation_p.R181Q|NIF3L1_uc002uwn.2_Missense_Mutation_p.R181Q|NIF3L1_uc002uwo.2_Missense_Mutation_p.R208Q|NIF3L1_uc002uwp.2_Missense_Mutation_p.R208Q|NIF3L1_uc002uwq.2_Missense_Mutation_p.R208Q	NM_001136039	NP_001129511	Q9GZT8	NIF3L_HUMAN	NIF3 NGG1 interacting factor 3-like 1 isoform 1	208					positive regulation of transcription, DNA-dependent		transcription factor binding			skin(1)	1						GAACAAACACGGATTAATCTG	0.383													18	155	---	---	---	---	PASS
ALS2CR12	130540	broad.mit.edu	37	2	202153280	202153280	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202153280C>T	uc010ftg.2	-	15					ALS2CR12_uc002uya.3_3'UTR|ALS2CR12_uc010fth.2_RNA	NM_139163	NP_631902	Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)						regulation of GTPase activity		protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						GAACTAAACTCATTATATGCA	0.398													8	26	---	---	---	---	PASS
C2orf62	375307	broad.mit.edu	37	2	219232340	219232340	+	Intron	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219232340C>A	uc002vhr.2	+						C2orf62_uc002vhs.2_Intron|uc002vht.2_RNA	NM_198559	NP_940961	Q7Z7H3	CB062_HUMAN	hypothetical protein LOC375307												0		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCGTAGGGGCTAGAAGGCTC	0.647													9	9	---	---	---	---	PASS
UGT1A1	54658	broad.mit.edu	37	2	234669219	234669219	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234669219G>C	uc002vvb.2	+	1	301	c.286G>C	c.(286-288)GGG>CGG	p.G96R	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_Intron|UGT1A1_uc010znc.1_Missense_Mutation_p.G96R	NM_000463	NP_000454	P22309	UD11_HUMAN	UDP glycosyltransferase 1 family, polypeptide A1	96					bilirubin conjugation|digestion|estrogen metabolic process|flavone metabolic process|heme catabolic process	endoplasmic reticulum membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding|steroid binding			central_nervous_system(1)|skin(1)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Adenine(DB00173)|Diclofenac(DB00586)|Estradiol(DB00783)|Ezetimibe(DB00973)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Rifampin(DB01045)|Troglitazone(DB00197)	TGTTAGTCTCGGGCATAATGT	0.428													67	137	---	---	---	---	PASS
UGT1A1	54658	broad.mit.edu	37	2	234669236	234669236	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234669236G>T	uc002vvb.2	+	1	318	c.303G>T	c.(301-303)GAG>GAT	p.E101D	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_Intron|UGT1A1_uc010znc.1_Missense_Mutation_p.E101D	NM_000463	NP_000454	P22309	UD11_HUMAN	UDP glycosyltransferase 1 family, polypeptide A1	101					bilirubin conjugation|digestion|estrogen metabolic process|flavone metabolic process|heme catabolic process	endoplasmic reticulum membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding|steroid binding			central_nervous_system(1)|skin(1)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Adenine(DB00173)|Diclofenac(DB00586)|Estradiol(DB00783)|Ezetimibe(DB00973)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Rifampin(DB01045)|Troglitazone(DB00197)	ATGTTTTTGAGAATGATTCTT	0.423													98	83	---	---	---	---	PASS
TMEM111	55831	broad.mit.edu	37	3	10012301	10012301	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10012301C>G	uc003bun.2	-	6	718	c.539G>C	c.(538-540)CGG>CCG	p.R180P	CIDEC_uc003bto.2_Intron|TMEM111_uc003buo.2_Missense_Mutation_p.R180P	NM_018447	NP_060917	Q9P0I2	TM111_HUMAN	transmembrane protein 111	180						integral to membrane					0						GTAAATGCTCCGAAGCCCAAA	0.403													206	82	---	---	---	---	PASS
NR2C2	7182	broad.mit.edu	37	3	15062406	15062406	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15062406A>G	uc003bzj.3	+	5	740	c.523A>G	c.(523-525)AAA>GAA	p.K175E	NR2C2_uc003bzi.2_Missense_Mutation_p.K194E	NM_003298	NP_003289	P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	175	NR C4-type.|Nuclear receptor.				cell differentiation|nervous system development|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0						TTGCCGGCTGAAAAAATGCTT	0.408													14	44	---	---	---	---	PASS
ANKRD28	23243	broad.mit.edu	37	3	15762530	15762530	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15762530A>T	uc003caj.1	-	8	941	c.798T>A	c.(796-798)AAT>AAA	p.N266K	ANKRD28_uc003cai.1_Missense_Mutation_p.N112K|ANKRD28_uc011avz.1_Missense_Mutation_p.N112K|ANKRD28_uc003cak.1_RNA|ANKRD28_uc011awa.1_RNA|ANKRD28_uc003cal.1_Missense_Mutation_p.N296K|ANKRD28_uc003cam.2_Missense_Mutation_p.N299K	NM_015199	NP_056014	O15084	ANR28_HUMAN	ankyrin repeat domain 28	266	ANK 7.					nucleoplasm	protein binding			breast(1)	1						CATTCTTTTGATTCACAATAG	0.403													94	212	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19575409	19575409	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19575409A>C	uc003cbk.1	+	16	3337	c.3142A>C	c.(3142-3144)AGC>CGC	p.S1048R	KCNH8_uc010hex.1_Missense_Mutation_p.S509R	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	1048	Ser-rich.|Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						AGTTCTCCCAAGCAGATCAGA	0.488													56	56	---	---	---	---	PASS
EXOG	9941	broad.mit.edu	37	3	38537926	38537926	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38537926G>A	uc003cih.2	+	1	164	c.68G>A	c.(67-69)GGG>GAG	p.G23E	EXOG_uc010hhg.2_RNA|EXOG_uc011ayq.1_Missense_Mutation_p.G23E|EXOG_uc003cij.2_5'UTR|EXOG_uc010hhd.2_5'UTR|EXOG_uc010hhe.2_5'UTR|EXOG_uc003cik.2_5'UTR|EXOG_uc010hhf.2_5'UTR|EXOG_uc003cii.2_5'UTR	NM_005107	NP_005098	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	23						mitochondrial inner membrane	endonuclease activity|metal ion binding|nucleic acid binding				0						TTCGTGGCTGGGGCTGTAGTG	0.652											OREG0015479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	12	---	---	---	---	PASS
NKTR	4820	broad.mit.edu	37	3	42687412	42687412	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42687412G>A	uc003clo.2	+	17	4481	c.4334G>A	c.(4333-4335)AGT>AAT	p.S1445N	NKTR_uc003clp.2_Missense_Mutation_p.S1193N|NKTR_uc011azp.1_Missense_Mutation_p.V256M|NKTR_uc003cls.2_Missense_Mutation_p.S1145N	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence	1445					protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		GACAGTGAAAGTGACCGAAGT	0.353													9	19	---	---	---	---	PASS
CCDC12	151903	broad.mit.edu	37	3	46963496	46963496	+	3'UTR	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46963496C>T	uc003cqo.2	-	7						NM_144716	NP_653317	Q8WUD4	CCD12_HUMAN	coiled-coil domain containing 12												0		Prostate(884;0.0143)|Ovarian(412;0.0448)|Acute lymphoblastic leukemia(5;0.143)		OV - Ovarian serous cystadenocarcinoma(275;2.2e-56)|BRCA - Breast invasive adenocarcinoma(193;0.00136)|KIRC - Kidney renal clear cell carcinoma(197;0.00703)|Kidney(197;0.00809)		CTGCCCAAGACCATCCTCTGC	0.602													3	13	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47125299	47125299	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47125299C>A	uc003cqs.2	-	12	6024	c.5971G>T	c.(5971-5973)GAG>TAG	p.E1991*	SETD2_uc003cqv.2_Nonsense_Mutation_p.E2058*|SETD2_uc003cqt.1_RNA	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1991					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTTTCACTCTCCACATCAGAC	0.448			N|F|S|Mis		clear cell renal carcinoma								70	80	---	---	---	---	PASS
CCDC51	79714	broad.mit.edu	37	3	48474335	48474335	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48474335C>T	uc003csz.2	-	4	840	c.719G>A	c.(718-720)GGG>GAG	p.G240E	PLXNB1_uc003csx.2_5'Flank|CCDC51_uc003cta.2_Missense_Mutation_p.G131E|CCDC51_uc003ctb.2_Missense_Mutation_p.G131E|CCDC51_uc003ctc.2_Missense_Mutation_p.G240E|CCDC51_uc003ctd.2_Missense_Mutation_p.G131E	NM_024661	NP_078937	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	240						integral to membrane					0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		ACTCACAGGCCCCTTCTGCGC	0.602													39	42	---	---	---	---	PASS
WDR6	11180	broad.mit.edu	37	3	49051674	49051674	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49051674C>T	uc003cvj.2	+	3	2842	c.2704C>T	c.(2704-2706)CAG>TAG	p.Q902*	WDR6_uc011bby.1_Nonsense_Mutation_p.Q350*|WDR6_uc010hkn.2_Nonsense_Mutation_p.Q846*|WDR6_uc011bbz.1_Nonsense_Mutation_p.Q821*	NM_018031	NP_060501	Q9NNW5	WDR6_HUMAN	WD repeat domain 6 protein	872	WD 13.				cell cycle arrest|negative regulation of cell proliferation	cytoplasm				central_nervous_system(1)	1				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		TGAACTTGACCAGCCCGGCCT	0.582											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	30	---	---	---	---	PASS
USP19	10869	broad.mit.edu	37	3	49153998	49153998	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49153998G>A	uc003cwd.1	-	7	1027	c.866C>T	c.(865-867)TCG>TTG	p.S289L	USP19_uc003cwa.2_Missense_Mutation_p.S95L|USP19_uc003cvz.3_Missense_Mutation_p.S390L|USP19_uc011bcg.1_Missense_Mutation_p.S380L|USP19_uc003cwb.2_Missense_Mutation_p.S375L|USP19_uc003cwc.1_Missense_Mutation_p.S45L|USP19_uc011bch.1_Missense_Mutation_p.S390L|USP19_uc011bci.1_Missense_Mutation_p.S375L	NM_006677	NP_006668	O94966	UBP19_HUMAN	ubiquitin thioesterase 19	289	CS 2.|Cytoplasmic (Potential).				ER-associated protein catabolic process|positive regulation of cell cycle process|protein deubiquitination|regulation of protein stability|response to endoplasmic reticulum stress|skeletal muscle atrophy	endoplasmic reticulum membrane|integral to membrane	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(4)|breast(2)|lung(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTTCTCATACGAGTCATTCTT	0.537													42	50	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49929204	49929204	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49929204G>C	uc003cxy.3	-	15	3603	c.3339C>G	c.(3337-3339)ATC>ATG	p.I1113M	MST1R_uc011bdc.1_Translation_Start_Site	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	1113	Cytoplasmic (Potential).|Protein kinase.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TTAGTGACTTGATGGCACATT	0.517													84	79	---	---	---	---	PASS
ITIH3	3699	broad.mit.edu	37	3	52835110	52835110	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52835110A>G	uc003dfv.2	+	11	1367	c.1331A>G	c.(1330-1332)CAT>CGT	p.H444R	ITIH3_uc011bek.1_Missense_Mutation_p.H444R	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	444	VWFA.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTGGAGAACCATGGGTTTGCC	0.393													21	21	---	---	---	---	PASS
CACNA2D3	55799	broad.mit.edu	37	3	54420796	54420796	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54420796T>A	uc003dhf.2	+	4	424	c.376T>A	c.(376-378)TTA>ATA	p.L126I	CACNA2D3_uc011beu.1_RNA|CACNA2D3_uc003dhg.1_Missense_Mutation_p.L32I|CACNA2D3_uc003dhh.1_RNA|CACNA2D3_uc010hmv.1_5'UTR	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	126	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		TGATGCAGACTTACAGGTAAC	0.368													3	9	---	---	---	---	PASS
WNT5A	7474	broad.mit.edu	37	3	55504170	55504170	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55504170C>G	uc003dhn.2	-	5	1411	c.1093G>C	c.(1093-1095)GTC>CTC	p.V365L	WNT5A_uc003dhm.2_Missense_Mutation_p.V350L|WNT5A_uc010hmw.2_Missense_Mutation_p.V350L|WNT5A_uc010hmx.2_Missense_Mutation_p.V276L	NM_003392	NP_003383	P41221	WNT5A_HUMAN	wingless-type MMTV integration site family,	365					activation of JUN kinase activity|activation of protein kinase B activity|axon guidance|cartilage development|cellular protein localization|cellular response to calcium ion|cellular response to interferon-gamma|cellular response to lipopolysaccharide|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|cervix development|cochlea morphogenesis|convergent extension involved in organogenesis|dopaminergic neuron differentiation|dorsal/ventral axis specification|embryonic digit morphogenesis|embryonic skeletal system development|epithelial cell proliferation involved in mammary gland duct elongation|epithelial to mesenchymal transition|face development|genitalia development|heart looping|hemopoietic stem cell proliferation|keratinocyte differentiation|lateral sprouting involved in mammary gland duct morphogenesis|lens development in camera-type eye|male gonad development|mammary gland branching involved in thelarche|negative regulation of apoptosis|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of mesenchymal cell proliferation|negative regulation of transcription, DNA-dependent|neural tube closure|olfactory bulb interneuron development|optic cup formation involved in camera-type eye development|palate development|positive regulation of angiogenesis|positive regulation of cartilage development|positive regulation of cGMP metabolic process|positive regulation of chemokine biosynthetic process|positive regulation of cytokine secretion involved in immune response|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of macrophage activation|positive regulation of macrophage cytokine production|positive regulation of mesenchymal cell proliferation|positive regulation of neuron projection development|positive regulation of NF-kappaB transcription factor activity|positive regulation of ossification|positive regulation of protein catabolic process|positive regulation of protein kinase C signaling cascade|positive regulation of T cell chemotaxis|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|primitive streak formation|regulation of branching involved in mammary gland duct morphogenesis|somitogenesis|tail morphogenesis|type B pancreatic cell development|urinary bladder development|uterus development|vagina development|Wnt receptor signaling pathway, calcium modulating pathway|wound healing	extracellular space|membrane fraction|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|receptor tyrosine kinase-like orphan receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		TTGCACTTGACGTAGCAGCAC	0.592													22	30	---	---	---	---	PASS
KIAA1524	57650	broad.mit.edu	37	3	108273235	108273235	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108273235T>A	uc003dxb.3	-	18	2581	c.2312A>T	c.(2311-2313)GAA>GTA	p.E771V		NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	771	Potential.					cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						TTCATTTTGTTCCTTGAGTGA	0.269													5	12	---	---	---	---	PASS
CASR	846	broad.mit.edu	37	3	121994736	121994736	+	Silent	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121994736G>C	uc003eev.3	+	5	1827	c.1455G>C	c.(1453-1455)CTG>CTC	p.L485L	CASR_uc003eew.3_Silent_p.L485L	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	485	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GTGGTGACCTGGTGGGGAACT	0.488													63	96	---	---	---	---	PASS
ADCY5	111	broad.mit.edu	37	3	123046525	123046525	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123046525G>A	uc003egh.1	-	7	1887	c.1887C>T	c.(1885-1887)AAC>AAT	p.N629N	ADCY5_uc003egg.1_Silent_p.N262N|ADCY5_uc003egi.1_Silent_p.N188N	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	629	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		TGAGGTAGGCGTTGCGCTCGC	0.642													8	33	---	---	---	---	PASS
STAG1	10274	broad.mit.edu	37	3	136287647	136287647	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136287647C>T	uc003era.1	-	5	646	c.354G>A	c.(352-354)CTG>CTA	p.L118L	STAG1_uc003erb.1_Silent_p.L118L|STAG1_uc003erc.1_5'UTR|STAG1_uc010hua.1_5'UTR|STAG1_uc003erd.2_Silent_p.L21L|STAG1_uc003ere.2_Silent_p.L118L	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	118					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						TGATTAAATCCAGAAGTGCGA	0.353													14	44	---	---	---	---	PASS
MRPS22	56945	broad.mit.edu	37	3	139065815	139065815	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139065815A>T	uc003etb.2	+	2	276	c.268A>T	c.(268-270)ACT>TCT	p.T90S	MRPS22_uc003etc.2_RNA|MRPS22_uc003etd.2_Missense_Mutation_p.T89S|MRPS22_uc003ete.2_Missense_Mutation_p.T49S	NM_020191	NP_064576	P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	90						mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(2)|skin(1)	3						CTTGCAGAAGACTTTTAAGCC	0.413													55	70	---	---	---	---	PASS
TFDP2	7029	broad.mit.edu	37	3	141671502	141671502	+	Silent	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141671502G>C	uc003eun.3	-	13	1573	c.1194C>G	c.(1192-1194)GCC>GCG	p.A398A	TFDP2_uc003euk.3_Silent_p.A311A|TFDP2_uc010hur.2_Silent_p.A338A|TFDP2_uc003eul.3_Silent_p.A338A|TFDP2_uc011bnf.1_Silent_p.A301A|TFDP2_uc011bng.1_Silent_p.A262A|TFDP2_uc003eum.3_Silent_p.A338A	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization	398					cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						CAGTTGCTAAGGCCACTTCTG	0.493													32	42	---	---	---	---	PASS
TRPC1	7220	broad.mit.edu	37	3	142499680	142499680	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142499680G>A	uc003evc.2	+	6	905	c.769G>A	c.(769-771)GAT>AAT	p.D257N	TRPC1_uc003evb.2_Missense_Mutation_p.D223N	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	257	Cytoplasmic (Potential).				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						TTATAGGAATGATTATGAGGA	0.343													15	61	---	---	---	---	PASS
P2RY13	53829	broad.mit.edu	37	3	151046556	151046556	+	Silent	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151046556A>G	uc003eyv.2	-	2	309	c.288T>C	c.(286-288)CTT>CTC	p.L96L	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_176894	NP_795713	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	96	Helical; Name=2; (Potential).					integral to membrane|plasma membrane				ovary(3)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			TTTTGAAAGGAAGCATGAGTG	0.468													34	55	---	---	---	---	PASS
LXN	56925	broad.mit.edu	37	3	158390301	158390301	+	5'UTR	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158390301C>G	uc003fch.2	-	1					GFM1_uc003fcd.2_Intron|GFM1_uc003fce.2_Intron|GFM1_uc003fcf.2_Intron|GFM1_uc003fcg.2_Intron|LXN_uc011bov.1_5'UTR	NM_020169	NP_064554	Q9BS40	LXN_HUMAN	latexin							cytoplasm	metalloendopeptidase inhibitor activity|protein binding				0			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GCTTGGGCTACTCTGGCTTAA	0.602											OREG0015899	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	29	---	---	---	---	PASS
ATP11B	23200	broad.mit.edu	37	3	182631787	182631787	+	Intron	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182631787G>A	uc003flb.2	+						ATP11B_uc003flc.2_Missense_Mutation_p.E737K|ATP11B_uc010hxg.2_Intron	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B						aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			CAGCAGGTGTGAAATCTCTCT	0.468													76	90	---	---	---	---	PASS
GP5	2814	broad.mit.edu	37	3	194117570	194117570	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194117570C>T	uc003ftv.1	-	2	1473	c.1442G>A	c.(1441-1443)CGC>CAC	p.R481H		NM_004488	NP_004479	P40197	GPV_HUMAN	glycoprotein V (platelet) precursor	481	Extracellular (Potential).				blood coagulation, intrinsic pathway|cell adhesion|platelet activation	integral to plasma membrane				skin(2)|breast(1)	3	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		CGCAgcggggcggggaggcgg	0.612													32	36	---	---	---	---	PASS
SDHAP2	727956	broad.mit.edu	37	3	195400795	195400795	+	Missense_Mutation	SNP	C	T	T	rs7615357	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195400795C>T	uc003fuw.2	+	9	1285	c.91C>T	c.(91-93)CGC>TGC	p.R31C	SDHAP2_uc011btb.1_Missense_Mutation_p.S178L|SDHAP2_uc011btc.1_RNA|SDHAP2_uc003fuv.2_RNA					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						GGGGCAAACTCGCTGTTGGAC	0.592													3	30	---	---	---	---	PASS
SDHAP1	255812	broad.mit.edu	37	3	195701304	195701304	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195701304C>T	uc011btq.1	-	8	1189	c.560G>A	c.(559-561)GGC>GAC	p.G187D	SDHAP1_uc003fvx.3_RNA|SDHAP1_uc011btp.1_RNA					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AGGGCACATGCCTGACCAGAC	0.572													7	36	---	---	---	---	PASS
DRD5	1816	broad.mit.edu	37	4	9784901	9784901	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9784901C>T	uc003gmb.3	+	1	1644	c.1248C>T	c.(1246-1248)AAC>AAT	p.N416N		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	416	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	TGATGCCCAACGCCGTTACCC	0.562													20	42	---	---	---	---	PASS
PHOX2B	8929	broad.mit.edu	37	4	41748140	41748140	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41748140G>A	uc003gwf.3	-	3	989	c.629C>T	c.(628-630)GCG>GTG	p.A210V		NM_003924	NP_003915	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	210					positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			autonomic_ganglia(7)|lung(2)|ovary(2)|central_nervous_system(1)	12						gccTCCATTCGCCCCGCAGCT	0.408			Mis|F		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				7	16	---	---	---	---	PASS
NMU	10874	broad.mit.edu	37	4	56471508	56471508	+	Silent	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56471508A>C	uc003hbc.2	-	7	475	c.369T>G	c.(367-369)GTT>GTG	p.V123V	NMU_uc003hbd.1_Intron|NMU_uc010igv.1_RNA|NMU_uc010igw.1_Silent_p.V38V|NMU_uc010igx.1_Intron	NM_006681	NP_006672	P48645	NMU_HUMAN	neuromedin U precursor	123					neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		ACGGATGCACAACTGACGACT	0.463													29	27	---	---	---	---	PASS
DCK	1633	broad.mit.edu	37	4	71895173	71895173	+	3'UTR	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71895173A>C	uc003hfx.2	+	7					DCK_uc011cbb.1_3'UTR	NM_000788	NP_000779	P27707	DCK_HUMAN	deoxycytidine kinase						purine base metabolic process|purine-containing compound salvage|pyrimidine base metabolic process|pyrimidine nucleoside salvage|pyrimidine nucleotide metabolic process	cytosol|nucleus	ATP binding|deoxycytidine kinase activity|drug binding|phosphotransferase activity, alcohol group as acceptor|protein homodimerization activity			ovary(1)	1			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Decitabine(DB01262)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	ATATTAATATAAGTTTCTTTA	0.299													14	66	---	---	---	---	PASS
PDE5A	8654	broad.mit.edu	37	4	120484008	120484008	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120484008T>C	uc003idh.2	-	6	1266	c.1111A>G	c.(1111-1113)ATA>GTA	p.I371V	PDE5A_uc003idf.2_Missense_Mutation_p.I329V|PDE5A_uc003idg.2_Missense_Mutation_p.I319V	NM_001083	NP_001074	O76074	PDE5A_HUMAN	phosphodiesterase 5A isoform 1	371	GAF 2.				platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)	TCATCCACTATGAAAATGGTG	0.299													23	64	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121958158	121958158	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121958158A>C	uc003idq.1	-	4	1495	c.968T>G	c.(967-969)ATG>AGG	p.M323R		NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor	323	Fibronectin type-III 1.										0						AGCGGTGCTCATGTTGCTGTT	0.418													29	46	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134071562	134071562	+	Silent	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134071562C>A	uc003iha.2	+	1	1093	c.267C>A	c.(265-267)CCC>CCA	p.P89P	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Silent_p.P89P	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	89	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		AACAGAGCCCCTCCTGTGTCC	0.547													25	42	---	---	---	---	PASS
USP38	84640	broad.mit.edu	37	4	144127185	144127185	+	Splice_Site	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144127185G>A	uc003ijb.2	+	6	1744	c.1210_splice	c.e6-1	p.D404_splice	USP38_uc003ija.3_Splice_Site_p.D404_splice|USP38_uc003ijc.2_Splice_Site	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)					ATGACCTATAGGATTTTCCTA	0.308													20	29	---	---	---	---	PASS
TMEM154	201799	broad.mit.edu	37	4	153549452	153549452	+	3'UTR	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153549452T>C	uc003imw.1	-	7						NM_152680	NP_689893	Q6P9G4	TM154_HUMAN	transmembrane protein 154 precursor							integral to membrane					0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CGCCTCCTTCTCCACCCTCAG	0.493													2	5	---	---	---	---	PASS
FAM198B	51313	broad.mit.edu	37	4	159092554	159092554	+	5'UTR	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159092554G>C	uc003ipp.3	-	2					uc003ipu.1_5'Flank|FAM198B_uc003ipq.3_5'UTR|FAM198B_uc003ipr.3_5'UTR|FAM198B_uc003ips.2_5'UTR|uc003ipt.1_RNA	NM_016613	NP_057697	Q6UWH4	F198B_HUMAN	hypothetical protein LOC51313 isoform 2							Golgi membrane|integral to membrane					0						CATGTTGAACGGAGTTTAAAG	0.552													8	19	---	---	---	---	PASS
NPY5R	4889	broad.mit.edu	37	4	164271624	164271624	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164271624A>G	uc003iqn.2	+	4	381	c.199A>G	c.(199-201)ATG>GTG	p.M67V		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	67	Cytoplasmic (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				AATGGCTCTCATGAAAAAGCG	0.383													56	129	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169167598	169167598	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169167598C>A	uc003irp.2	-	30	4427	c.4135G>T	c.(4135-4137)GGA>TGA	p.G1379*		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1379							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GGGTCATCTCCCTTGGAAGCC	0.507													3	22	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7817004	7817004	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7817004T>C	uc003jdz.1	+	23	2976	c.2909T>C	c.(2908-2910)ATT>ACT	p.I970T	ADCY2_uc011cmo.1_Missense_Mutation_p.I790T|ADCY2_uc010itm.1_Missense_Mutation_p.I166T	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	970	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						TACATGCACATTGGCACCATG	0.517											OREG0016499	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	57	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14492807	14492807	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14492807G>A	uc003jff.2	+	49	7770	c.7764G>A	c.(7762-7764)ATG>ATA	p.M2588I	TRIO_uc003jfg.2_RNA	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	2588	SH3 2.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					AGCAGAACATGTTTCTGGTGT	0.562													5	24	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33576343	33576343	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576343G>A	uc003jia.1	-	19	3951	c.3788C>T	c.(3787-3789)ACG>ATG	p.T1263M	ADAMTS12_uc010iuq.1_Missense_Mutation_p.T1178M	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1263	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						ACGGTTTGCCGTCTTTCCTGA	0.502										HNSCC(64;0.19)			48	92	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34686993	34686993	+	5'UTR	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34686993T>C	uc003jir.2	+	2					RAI14_uc010iur.2_5'UTR|RAI14_uc011coj.1_5'UTR|RAI14_uc010ius.1_5'UTR|RAI14_uc003jis.2_5'UTR|RAI14_uc003jit.2_5'UTR|RAI14_uc011cok.1_5'Flank	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					AAAAGTCTCCTCTAGAGCTTT	0.438													12	28	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	36976326	36976326	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36976326G>C	uc003jkl.3	+	9	1816	c.1317G>C	c.(1315-1317)CAG>CAC	p.Q439H	NIPBL_uc003jkk.3_Missense_Mutation_p.Q439H|NIPBL_uc003jkm.1_Missense_Mutation_p.Q318H	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	439	Gln-rich.				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TTTTACAACAGAACACTTCAG	0.423													22	46	---	---	---	---	PASS
MAP3K1	4214	broad.mit.edu	37	5	56152428	56152428	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56152428C>T	uc003jqw.3	+	2	985	c.484C>T	c.(484-486)CGT>TGT	p.R162C		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	162					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GCATTTTAGTCGTGAGATGGA	0.373													11	12	---	---	---	---	PASS
TNPO1	3842	broad.mit.edu	37	5	72144225	72144225	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72144225A>C	uc003kck.3	+	2	176	c.29A>C	c.(28-30)GAG>GCG	p.E10A	TNPO1_uc011csi.1_RNA|TNPO1_uc011csj.1_Missense_Mutation_p.E10A|TNPO1_uc003kch.2_Missense_Mutation_p.E2A|TNPO1_uc003kci.3_Missense_Mutation_p.E2A|TNPO1_uc003kcg.3_Missense_Mutation_p.E2A	NM_002270	NP_002261	Q92973	TNPO1_HUMAN	transportin 1 isoform 1	10					interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		ACCAAGATGGAGTATGAGTGG	0.562													19	5	---	---	---	---	PASS
WDR36	134430	broad.mit.edu	37	5	110459882	110459882	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110459882A>T	uc003kpd.2	+	21	2630	c.2513A>T	c.(2512-2514)AAT>ATT	p.N838I	WDR36_uc010jbu.2_Intron	NM_139281	NP_644810	Q8NI36	WDR36_HUMAN	WD repeat domain 36	838					response to stimulus|rRNA processing|visual perception	small-subunit processome				ovary(1)|skin(1)	2		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		CTGGTAAATAATAAGTGTAAG	0.279													14	77	---	---	---	---	PASS
SEMA6A	57556	broad.mit.edu	37	5	115833065	115833065	+	Silent	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115833065A>T	uc010jck.2	-	4	946	c.237T>A	c.(235-237)GTT>GTA	p.V79V	SEMA6A_uc003krx.3_Silent_p.V79V	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and	79	Sema.|Extracellular (Potential).				apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TGTCTATATCAACAGTATAAA	0.303													5	53	---	---	---	---	PASS
HSD17B4	3295	broad.mit.edu	37	5	118865646	118865646	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118865646T>C	uc003ksj.2	+	21	1948	c.1825T>C	c.(1825-1827)TCT>CCT	p.S609P	HSD17B4_uc011cwg.1_Missense_Mutation_p.S585P|HSD17B4_uc011cwh.1_Missense_Mutation_p.S591P|HSD17B4_uc011cwi.1_Missense_Mutation_p.S634P|HSD17B4_uc003ksk.3_Missense_Mutation_p.S462P|HSD17B4_uc011cwj.1_Missense_Mutation_p.S462P|HSD17B4_uc010jcn.1_Missense_Mutation_p.S347P|HSD17B4_uc010jco.1_Silent_p.H77H	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	609	Enoyl-CoA hydratase 2.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	TGCACCAACATCTGGTACTTC	0.363													22	128	---	---	---	---	PASS
MATR3	9782	broad.mit.edu	37	5	138654644	138654644	+	Silent	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138654644T>C	uc003ldu.2	+	11	1783	c.1356T>C	c.(1354-1356)GAT>GAC	p.D452D	MATR3_uc010jfb.2_Silent_p.D452D|MATR3_uc003ldt.2_Silent_p.D114D|MATR3_uc003ldw.2_Silent_p.D452D|MATR3_uc003ldx.2_Silent_p.D452D|MATR3_uc010jfc.2_Silent_p.D452D|MATR3_uc003ldy.2_Silent_p.D129D|MATR3_uc011czb.1_Silent_p.D164D|MATR3_uc003ldz.2_Silent_p.D452D|MATR3_uc003lea.2_Silent_p.D452D|MATR3_uc003leb.2_Silent_p.D114D|MATR3_uc003lec.2_Silent_p.D129D	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3	452	RRM 1.					nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCGCAGTGGATTATTACACAA	0.363													15	36	---	---	---	---	PASS
C5orf53	492311	broad.mit.edu	37	5	139508200	139508200	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139508200G>A	uc003lfb.1	+	1	2680	c.139G>A	c.(139-141)GAG>AAG	p.E47K		NM_001007189	NP_001007190	A6NJ69	IGIP_HUMAN	IgA-inducing protein precursor	47						extracellular region					0						CAGCCGGCTTGAGTTTGTTCA	0.393													21	67	---	---	---	---	PASS
PCDHA4	56144	broad.mit.edu	37	5	140186836	140186836	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140186836G>A	uc003lhi.2	+	1	165	c.64G>A	c.(64-66)GCA>ACA	p.A22T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.A22T|PCDHA4_uc011daa.1_Missense_Mutation_p.A22T	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	22					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTCTCCTCGCAGCCTGGGA	0.572													31	96	---	---	---	---	PASS
KCTD16	57528	broad.mit.edu	37	5	143586786	143586786	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143586786A>G	uc003lnm.1	+	3	1138	c.509A>G	c.(508-510)TAC>TGC	p.Y170C	KCTD16_uc003lnn.1_Missense_Mutation_p.Y170C	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain	170						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			ACTGTGGGTTACAGAGGATCC	0.537													36	28	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176707662	176707662	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176707662A>G	uc003mfr.3	+	18	5857	c.5719A>G	c.(5719-5721)ATA>GTA	p.I1907V	NSD1_uc003mft.3_Missense_Mutation_p.I1638V|NSD1_uc003mfs.1_Missense_Mutation_p.I1804V|NSD1_uc011dfx.1_Missense_Mutation_p.I1555V	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1907	AWS.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CCCCTGTGGGATAGACTCTGA	0.522			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			35	37	---	---	---	---	PASS
B4GALT7	11285	broad.mit.edu	37	5	177034458	177034458	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177034458T>G	uc003mhy.2	+	3	609	c.569T>G	c.(568-570)CTC>CGC	p.L190R	B4GALT7_uc003mhz.2_Missense_Mutation_p.L76R	NM_007255	NP_009186	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase 7	190	Lumenal (Potential).				fibril organization|glycosaminoglycan biosynthetic process|negative regulation of fibroblast proliferation|protein modification process|proteoglycan metabolic process	Golgi cisterna membrane|integral to membrane	metal ion binding|xylosylprotein 4-beta-galactosyltransferase activity			pancreas(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCCCGGAGCTCCACCCTCTC	0.617											OREG0017092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	27	---	---	---	---	PASS
HNRNPAB	3182	broad.mit.edu	37	5	177637274	177637274	+	Splice_Site	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177637274G>A	uc003miu.2	+	7	1185	c.928_splice	c.e7+1	p.S310_splice	HNRNPAB_uc003miv.2_Intron|HNRNPAB_uc010jks.2_Intron|HNRNPAB_uc003miw.2_Splice_Site_p.S310_splice|HNRNPAB_uc003mix.2_Intron|AGXT2L2_uc003miy.2_Intron|AGXT2L2_uc003mjc.2_Intron|AGXT2L2_uc003miz.2_Intron|AGXT2L2_uc003mja.2_Intron|AGXT2L2_uc003mjb.2_Intron	NM_031266	NP_112556	Q99729	ROAA_HUMAN	heterogeneous nuclear ribonucleoprotein A/B						epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0						TACGACTACAGTAAGTAGGAG	0.567													10	6	---	---	---	---	PASS
HIST1H3A	8350	broad.mit.edu	37	6	26020953	26020953	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26020953T>G	uc003nfp.1	+	1	236	c.236T>G	c.(235-237)TTT>TGT	p.F79C	HIST1H1A_uc003nfo.2_5'Flank|HIST1H4A_uc003nfq.2_5'Flank	NM_003529	NP_003520	P68431	H31_HUMAN	histone cluster 1, H3a	79					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)|pancreas(1)	2						GCGCAGGACTTTAAAACAGAC	0.562													13	25	---	---	---	---	PASS
SLC44A4	80736	broad.mit.edu	37	6	31831441	31831441	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31831441T>A	uc010jti.2	-	21	2162	c.2096A>T	c.(2095-2097)AAC>ATC	p.N699I	NEU1_uc003nxq.3_5'Flank|NEU1_uc010jtg.2_5'Flank|NEU1_uc003nxr.3_5'Flank|NEU1_uc010jth.2_5'Flank|NEU1_uc003nxs.3_5'Flank	NM_025257	NP_079533	Q53GD3	CTL4_HUMAN	choline transporter-like protein 4	699	Cytoplasmic (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4					Choline(DB00122)	GGGCGCCTCGTTCTTCTTGCC	0.597													15	22	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31919363	31919363	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31919363G>A	uc003nyj.3	+	17	2399	c.2121G>A	c.(2119-2121)AAG>AAA	p.K707K	CFB_uc011dor.1_Silent_p.K1209K	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein	707	Peptidase S1.				complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						TAGTTCACAAGAGAAGTCGTT	0.512													65	164	---	---	---	---	PASS
PSMB8	5696	broad.mit.edu	37	6	32808759	32808759	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32808759G>A	uc003oce.2	-	6	851	c.808C>T	c.(808-810)CAG>TAG	p.Q270*	TAP2_uc011dqf.1_5'Flank|TAP2_uc003ocb.1_5'Flank|TAP2_uc003occ.2_5'Flank|TAP2_uc003ocd.2_5'Flank|PSMB8_uc003ocf.2_Nonsense_Mutation_p.Q266*	NM_148919	NP_683720	P28062	PSB8_HUMAN	proteasome beta 8 subunit isoform E2 proprotein	270					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|type I interferon-mediated signaling pathway|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			skin(1)	1						TCCCGGTACTGGTGCAGCAGG	0.512													49	48	---	---	---	---	PASS
BRD2	6046	broad.mit.edu	37	6	32945996	32945996	+	Silent	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32945996C>A	uc003ocn.3	+	10	3373	c.1672C>A	c.(1672-1674)CGG>AGG	p.R558R	BRD2_uc003oco.2_RNA|BRD2_uc003ocq.3_Silent_p.R558R|BRD2_uc003ocp.3_Silent_p.R438R|BRD2_uc010juh.2_Silent_p.R558R	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	558	Poly-Lys.|Nuclear localization signal (Potential).|Arg/Lys-rich (highly basic).		R -> G (in a gastric adenocarcinoma sample; somatic mutation).		spermatogenesis	nucleus	protein serine/threonine kinase activity	p.R558G(1)		central_nervous_system(3)|stomach(2)	5						AAAGAAGAAACGGAAGGCAGA	0.527													12	63	---	---	---	---	PASS
B3GALT4	8705	broad.mit.edu	37	6	33245680	33245680	+	Nonsense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33245680G>T	uc003odr.2	+	1	764	c.484G>T	c.(484-486)GAG>TAG	p.E162*		NM_003782	NP_003773	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta	162	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	ganglioside galactosyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)|breast(1)	2						GAACTGGGCTGAGAAACACTG	0.607													25	77	---	---	---	---	PASS
MDFI	4188	broad.mit.edu	37	6	41621154	41621154	+	Silent	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41621154G>C	uc003oqp.3	+	6	911	c.582G>C	c.(580-582)TCG>TCC	p.S194S	MDFI_uc003oqq.3_Silent_p.S194S|MDFI_uc010jxn.2_Silent_p.S194S	NM_005586	NP_005577	Q99750	MDFI_HUMAN	MyoD family inhibitor	194	Cys-rich.				cytoplasmic sequestering of transcription factor|dorsal/ventral axis specification|negative regulation of DNA binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of Wnt receptor signaling pathway	cytoplasm|nucleus					0	Ovarian(28;0.0327)|Colorectal(47;0.121)		Colorectal(64;0.0123)|COAD - Colon adenocarcinoma(64;0.0264)|KIRC - Kidney renal clear cell carcinoma(1;0.138)			CCTGCAGCTCGGAGGACTCGT	0.647													9	14	---	---	---	---	PASS
C6orf223	221416	broad.mit.edu	37	6	43970834	43970834	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43970834C>T	uc003own.2	+	4	718	c.700C>T	c.(700-702)CGC>TGC	p.R234C	uc003owm.1_Intron|C6orf223_uc003owo.2_Missense_Mutation_p.R214C	NM_153246	NP_694978	Q8N319	CF223_HUMAN	hypothetical protein LOC221416	234											0	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			CGCGGCGCTCCGCGGCGCTGG	0.667													5	9	---	---	---	---	PASS
RUNX2	860	broad.mit.edu	37	6	45296430	45296430	+	5'UTR	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45296430G>T	uc011dvx.1	+	2					SUPT3H_uc003oxn.1_Intron|SUPT3H_uc003oxo.2_Intron|SUPT3H_uc011dvv.1_Intron|SUPT3H_uc003oxp.2_Intron|RUNX2_uc011dvy.1_5'UTR|RUNX2_uc003oxs.1_RNA	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						ACAACAGAGGGTACAAGTTCT	0.388													19	23	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56325021	56325021	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56325021A>T	uc003pdf.2	-	96	16701	c.16673T>A	c.(16672-16674)CTT>CAT	p.L5558H	DST_uc003pcz.3_Missense_Mutation_p.L5380H|DST_uc011dxj.1_Missense_Mutation_p.L5409H|DST_uc011dxk.1_Missense_Mutation_p.L5420H|DST_uc003pcy.3_Missense_Mutation_p.L5054H|DST_uc003pcv.3_Missense_Mutation_p.L176H|DST_uc003pcw.3_Missense_Mutation_p.L137H|DST_uc003pcx.3_Missense_Mutation_p.L100H	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	7453					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATATCCTGGAAGTCGAAGCTT	0.463													19	25	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79655145	79655145	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79655145C>G	uc003pir.2	-	39	4926	c.4700G>C	c.(4699-4701)AGT>ACT	p.S1567T	PHIP_uc003piq.2_Missense_Mutation_p.S591T|PHIP_uc011dyp.1_Missense_Mutation_p.S1566T|IRAK1BP1_uc010kbg.1_RNA|PHIP_uc003pio.3_Missense_Mutation_p.S453T	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1567					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		AGTGCCATGACTAAAACTGGA	0.348													16	39	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82910359	82910359	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82910359C>T	uc003pjl.1	-	20	3384	c.2857G>A	c.(2857-2859)GTA>ATA	p.V953I	IBTK_uc011dyu.1_5'UTR|IBTK_uc011dyv.1_Missense_Mutation_p.V953I|IBTK_uc011dyw.1_Missense_Mutation_p.V752I|IBTK_uc010kbi.1_Missense_Mutation_p.V647I|IBTK_uc003pjm.2_Missense_Mutation_p.V953I	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	953					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CCATCTTCTACTTCCAAATAG	0.269													16	12	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87970340	87970340	+	Silent	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87970340C>G	uc003plm.3	+	8	7034	c.6993C>G	c.(6991-6993)CCC>CCG	p.P2331P		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	2331					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TAAAAATGCCCAAGACCAAAC	0.378													14	12	---	---	---	---	PASS
MAP3K7	6885	broad.mit.edu	37	6	91246267	91246267	+	Intron	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91246267G>A	uc003pnz.1	-						MAP3K7_uc003pny.1_5'UTR|MAP3K7_uc003poa.1_Intron|MAP3K7_uc003pob.1_Intron|MAP3K7_uc003poc.1_Intron	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TTATTGCTaagaaaaaaaaaa	0.303													4	9	---	---	---	---	PASS
PRDM1	639	broad.mit.edu	37	6	106547284	106547284	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106547284C>A	uc003prd.2	+	4	755	c.521C>A	c.(520-522)GCT>GAT	p.A174D	PRDM1_uc003pre.2_Missense_Mutation_p.A40D	NM_001198	NP_001189	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain isoform	174	SET.				negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.Y174*(1)		haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CAAAACCTGGCTGCGTGTCAG	0.502			D|N|Mis|F|S		DLBCL								23	37	---	---	---	---	PASS
C6orf203	51250	broad.mit.edu	37	6	107365530	107365530	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107365530C>A	uc003prq.2	+	3	618	c.537C>A	c.(535-537)AGC>AGA	p.S179R	C6orf203_uc011eaj.1_Missense_Mutation_p.S184R|C6orf203_uc010kde.2_Missense_Mutation_p.S179R	NM_016487	NP_057571	Q9P0P8	CF203_HUMAN	hypothetical protein LOC51250 isoform a	179											0	Breast(9;0.00124)|all_epithelial(6;0.0729)	all_cancers(87;0.00461)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|Colorectal(196;0.171)|all_epithelial(87;0.23)	BRCA - Breast invasive adenocarcinoma(8;0.000395)|all cancers(7;0.00065)|Epithelial(6;0.000834)|OV - Ovarian serous cystadenocarcinoma(5;0.244)	BRCA - Breast invasive adenocarcinoma(108;0.117)		GGAAGAAAAGCAGAACGGTGA	0.363													19	723	---	---	---	---	PASS
IL20RA	53832	broad.mit.edu	37	6	137325794	137325794	+	Silent	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137325794A>G	uc003qhj.2	-	6	1261	c.828T>C	c.(826-828)TAT>TAC	p.Y276Y	IL20RA_uc011edl.1_Silent_p.Y227Y|IL20RA_uc003qhk.2_Silent_p.Y165Y|IL20RA_uc003qhi.2_Silent_p.Y8Y	NM_014432	NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha precursor	276	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(2)|skin(2)	4	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		CAACGTGGATATATCGGTAGA	0.413													134	77	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143092722	143092722	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143092722C>G	uc003qjd.2	-	5	3897	c.3154G>C	c.(3154-3156)GAT>CAT	p.D1052H		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1052					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TTCCCATAATCAAATGATTTG	0.557													33	22	---	---	---	---	PASS
SYTL3	94120	broad.mit.edu	37	6	159181706	159181706	+	Missense_Mutation	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159181706A>C	uc003qrp.2	+	14	1587	c.1343A>C	c.(1342-1344)AAT>ACT	p.N448T	SYTL3_uc011efp.1_Missense_Mutation_p.N448T|SYTL3_uc003qro.2_Missense_Mutation_p.N380T|SYTL3_uc003qrq.2_Missense_Mutation_p.N380T|SYTL3_uc003qrr.2_Missense_Mutation_p.N448T|SYTL3_uc003qrs.2_Missense_Mutation_p.N380T|SYTL3_uc011efq.1_Missense_Mutation_p.N174T	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	448					intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		CCTCAGAGTAATGGAGAGCTC	0.557													19	65	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160483635	160483635	+	Silent	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160483635C>G	uc003qta.2	+	26	3802	c.3654C>G	c.(3652-3654)CCC>CCG	p.P1218P		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	1218	8.|Lumenal (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		AAGCCTGTCCCGTTGTCAGAG	0.463													16	27	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1527588	1527588	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1527588T>C	uc003skn.2	-	19	2425	c.2324A>G	c.(2323-2325)TAC>TGC	p.Y775C	INTS1_uc003skp.1_Missense_Mutation_p.Y122C	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	775					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TGGGTAGGAGTAGTTGCTAGG	0.652													61	85	---	---	---	---	PASS
C7orf27	221927	broad.mit.edu	37	7	2594068	2594068	+	5'UTR	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2594068T>G	uc003smi.2	-	2					C7orf27_uc003smj.1_5'UTR	NM_152743	NP_689956	Q6PJG6	BRAT1_HUMAN	hypothetical protein LOC221927 precursor						response to ionizing radiation	nucleus	protein binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)		GGGTCCATGGTGAGGCCGCAG	0.612													15	20	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4171955	4171955	+	Splice_Site	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4171955A>T	uc003smx.2	+	28	4269	c.4130_splice	c.e28-2	p.A1377_splice	SDK1_uc010kso.2_Splice_Site_p.A653_splice|SDK1_uc003smy.2_Splice_Site	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TTTTCCCTTCAGCCCCAGGCC	0.582													8	12	---	---	---	---	PASS
CYTH3	9265	broad.mit.edu	37	7	6210831	6210831	+	Splice_Site	SNP	A	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6210831A>C	uc003spt.2	-	7	666	c.562_splice	c.e7+1	p.D188_splice	CYTH3_uc011jws.1_Splice_Site_p.D103_splice	NM_004227	NP_004218	O43739	CYH3_HUMAN	cytohesin 3						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity				0						CTCTGCACTGACCTGTGGACT	0.662													25	72	---	---	---	---	PASS
ICA1	3382	broad.mit.edu	37	7	8260975	8260975	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8260975G>T	uc003srm.2	-	5	377	c.310C>A	c.(310-312)CAA>AAA	p.Q104K	ICA1_uc010ktr.2_Missense_Mutation_p.Q104K|ICA1_uc003srl.2_Missense_Mutation_p.Q92K|ICA1_uc003srn.3_Missense_Mutation_p.Q30K|ICA1_uc003srp.3_Missense_Mutation_p.Q103K|ICA1_uc010kts.2_RNA|ICA1_uc003srq.2_Missense_Mutation_p.Q104K|ICA1_uc003srr.2_Missense_Mutation_p.Q103K|ICA1_uc003sro.3_Missense_Mutation_p.Q104K|ICA1_uc011jxg.1_Missense_Mutation_p.Q104K|ICA1_uc003srs.1_Missense_Mutation_p.Q104K	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1	104	AH.				neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		GTTTTATCTTGGAAACCTTGG	0.443													10	101	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20180449	20180449	+	3'UTR	SNP	G	C	C	rs113534252		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20180449G>C	uc003sus.3	-	7					MACC1_uc010kug.2_3'UTR	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						cacacacacagacacacacac	0.164													6	74	---	---	---	---	PASS
NPC1L1	29881	broad.mit.edu	37	7	44556935	44556935	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44556935T>C	uc003tlb.2	-	16	3295	c.3239A>G	c.(3238-3240)CAC>CGC	p.H1080R	NPC1L1_uc003tlc.2_Missense_Mutation_p.H1053R|NPC1L1_uc011kbw.1_Missense_Mutation_p.H1007R|NPC1L1_uc003tla.2_Missense_Mutation_p.H56R	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	1080	Cytoplasmic (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	CAGGGGCTTGTGATAGGCCAT	0.557													20	49	---	---	---	---	PASS
MYO1G	64005	broad.mit.edu	37	7	45006183	45006183	+	Intron	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45006183C>T	uc003tmh.2	-						MYO1G_uc003tmf.2_Intron|MYO1G_uc003tmg.2_Intron|MYO1G_uc010kym.2_Intron|MYO1G_uc003tmi.1_Silent_p.T591T	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG							myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						ATGTTTGCGACGTGCTGTTTG	0.547													12	5	---	---	---	---	PASS
SUN3	256979	broad.mit.edu	37	7	48026769	48026769	+	3'UTR	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48026769A>G	uc003tof.2	-	11					SUN3_uc010kyq.2_3'UTR|SUN3_uc003tog.2_3'UTR|SUN3_uc011kcf.1_3'UTR	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1							integral to membrane				central_nervous_system(1)	1						ATATTTTTTTATTAGTAAAAT	0.323													6	7	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72419702	72419702	+	3'UTR	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72419702G>A	uc010lam.1	+	16					NSUN5P2_uc003twl.2_RNA|NSUN5P2_uc003twm.2_Intron|NSUN5P2_uc003twn.2_Intron|NSUN5P2_uc003two.2_Intron|NSUN5P2_uc003twq.2_Intron|NSUN5P2_uc010lan.1_Intron|NSUN5P2_uc003twp.2_Intron	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				TGAAATCCTCGCTCCTGAAAT	0.532													8	30	---	---	---	---	PASS
PPP1R9A	55607	broad.mit.edu	37	7	94540651	94540651	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94540651G>A	uc003unp.2	+	2	1508	c.1226G>A	c.(1225-1227)AGG>AAG	p.R409K	PPP1R9A_uc010lfj.2_Missense_Mutation_p.R409K|PPP1R9A_uc011kif.1_Missense_Mutation_p.R409K|PPP1R9A_uc003unq.2_Missense_Mutation_p.R409K|PPP1R9A_uc011kig.1_Missense_Mutation_p.R409K	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	409						cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			GTGAGATCCAGGTATAATTCA	0.423										HNSCC(28;0.073)			24	21	---	---	---	---	PASS
ACN9	57001	broad.mit.edu	37	7	96810409	96810409	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96810409A>G	uc003uoo.3	+	2	1391	c.260A>G	c.(259-261)GAA>GGA	p.E87G		NM_020186	NP_064571	Q9NRP4	ACN9_HUMAN	ACN9 homolog precursor	87					regulation of gluconeogenesis	mitochondrial intermembrane space					0	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					TTCCTCCCAGAAGAAAAACTT	0.388													38	24	---	---	---	---	PASS
TECPR1	25851	broad.mit.edu	37	7	97863074	97863074	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97863074G>A	uc003upg.2	-	11	1536	c.1331C>T	c.(1330-1332)TCA>TTA	p.S444L	TECPR1_uc003uph.1_Missense_Mutation_p.S374L	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	444						integral to membrane	protein binding			pancreas(1)	1						GCCTGAGGCTGAGTTCCCTGT	0.647													6	7	---	---	---	---	PASS
LRCH4	4034	broad.mit.edu	37	7	100172746	100172746	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100172746C>G	uc003uvj.2	-	18	2089	c.2036G>C	c.(2035-2037)CGG>CCG	p.R679P	uc003uvh.2_5'Flank|LRCH4_uc010lgz.2_RNA|LRCH4_uc003uvi.2_RNA|LRCH4_uc011kjw.1_3'UTR	NM_002319	NP_002310	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH)	679					nervous system development	PML body	protein binding			large_intestine(1)|ovary(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACCCAGGAGCCGAGTGTAGGT	0.637													3	14	---	---	---	---	PASS
LRRC17	10234	broad.mit.edu	37	7	102574512	102574512	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102574512G>A	uc003vau.2	+	2	541	c.152G>A	c.(151-153)GGC>GAC	p.G51D	FBXL13_uc010liq.1_Intron|FBXL13_uc003vaq.2_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron|LRRC17_uc003vat.2_Missense_Mutation_p.G51D	NM_001031692	NP_001026862	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17 isoform 1	51					bone marrow development|negative regulation of osteoclast differentiation|ossification	extracellular space				ovary(1)	1						TACGCACCAGGCCTCCCGTGT	0.542													6	31	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121650516	121650516	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121650516G>A	uc003vjy.2	+	12	1811	c.1416G>A	c.(1414-1416)ACG>ACA	p.T472T	PTPRZ1_uc003vjz.2_Silent_p.T472T|PTPRZ1_uc011knt.1_5'UTR	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	472	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						GCATAGGGACGAAATACAATG	0.433													42	32	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123599683	123599683	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123599683A>G	uc003vld.2	+	6	1592	c.1190A>G	c.(1189-1191)TAT>TGT	p.Y397C	SPAM1_uc003vle.2_Missense_Mutation_p.Y397C|SPAM1_uc011koa.1_Missense_Mutation_p.Y53C|SPAM1_uc003vlf.3_Missense_Mutation_p.Y397C|SPAM1_uc010lku.2_Missense_Mutation_p.Y397C	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	397					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	TCAAGTGACTATCTTCACCTC	0.418													18	38	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133884160	133884160	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133884160G>A	uc003vrm.1	+	14	1750	c.1734G>A	c.(1732-1734)GAG>GAA	p.E578E		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	578	Guanylate kinase-like.						ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						ATTTTGATGAGGTAATCAATG	0.318													24	87	---	---	---	---	PASS
HIPK2	28996	broad.mit.edu	37	7	139299121	139299121	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139299121C>T	uc003vvf.3	-	8	2075	c.1901G>A	c.(1900-1902)AGC>AAC	p.S634N	HIPK2_uc003vvd.3_Missense_Mutation_p.S607N	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	634	Interaction with SKI and SMAD1.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					CAGGGGCATGCTCCGCTGGGC	0.577													3	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142032547	142032547	+	Intron	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142032547T>G	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krs.1_Missense_Mutation_p.C123G					SubName: Full=V_segment translation product; Flags: Fragment;																		ACTGCTCCAGTGTCAGCTTGG	0.398													5	5	---	---	---	---	PASS
TPK1	27010	broad.mit.edu	37	7	144320258	144320258	+	Splice_Site	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144320258C>T	uc003weq.2	-	6	457	c.354_splice	c.e6+1	p.K118_splice	TPK1_uc003weo.2_Splice_Site_p.K113_splice|TPK1_uc003wep.2_Splice_Site|TPK1_uc003wer.2_Splice_Site_p.K118_splice|TPK1_uc003wes.2_Splice_Site	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	GTATATATTACCTTTAAGTCT	0.328													62	64	---	---	---	---	PASS
LPL	4023	broad.mit.edu	37	8	19818562	19818562	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19818562G>A	uc003wzk.3	+	8	1660	c.1290G>A	c.(1288-1290)AAG>AAA	p.K430K		NM_000237	NP_000228	P06858	LIPL_HUMAN	lipoprotein lipase precursor	430	PLAT.|Heparin-binding (By similarity).				fatty acid biosynthetic process|lipoprotein metabolic process|phospholipid metabolic process|positive regulation of cholesterol storage|positive regulation of sequestering of triglyceride|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	anchored to membrane|chylomicron|plasma membrane|very-low-density lipoprotein particle	heparin binding|lipoprotein lipase activity|phospholipase activity|receptor binding|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	Clofibrate(DB00636)|Gemfibrozil(DB01241)|Orlistat(DB01083)	CCATTCAGAAGATCAGAGTAA	0.428													21	16	---	---	---	---	PASS
EIF4EBP1	1978	broad.mit.edu	37	8	37914710	37914710	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37914710G>A	uc003xks.2	+	2	329	c.257G>A	c.(256-258)AGT>AAT	p.S86N		NM_004095	NP_004086	Q13541	4EBP1_HUMAN	eukaryotic translation initiation factor 4E	86					G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|positive regulation of mitotic cell cycle|TOR signaling cascade|translation	cytosol					0	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)				AGCCCTTCCAGTGATGAGCCC	0.602													14	34	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38068103	38068103	+	3'UTR	SNP	G	T	T	rs111385150	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38068103G>T	uc003xky.1	+	5					BAG4_uc003xkz.1_3'UTR	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4						anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				GCCTGTTGATGACAAGAAGCA	0.338													6	15	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55541521	55541521	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541521G>T	uc003xsd.1	+	4	5227	c.5079G>T	c.(5077-5079)TTG>TTT	p.L1693F	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1693					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CATCTATGTTGCAGGAATTCC	0.403													38	236	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62366715	62366715	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62366715C>G	uc003xuh.2	+	4	970	c.646C>G	c.(646-648)CGC>GGC	p.R216G	CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Missense_Mutation_p.R216G	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	216	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						CTTTCCTGCCCGCTTTGGAGG	0.493													179	117	---	---	---	---	PASS
CRH	1392	broad.mit.edu	37	8	67089287	67089287	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67089287G>A	uc003xvy.1	-	2	611	c.426C>T	c.(424-426)GGC>GGT	p.G142G		NM_000756	NP_000747	P06850	CRF_HUMAN	corticotropin releasing hormone precursor	142					female pregnancy|negative regulation of circadian sleep/wake cycle, REM sleep|parturition|positive regulation of circadian sleep/wake cycle, wakefulness|positive regulation of cortisol secretion|signal transduction|synaptic transmission	extracellular region|soluble fraction	neuropeptide hormone activity				0		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	CCTGGTGGCCGCCGAGGGCAT	0.667											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	10	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	67976623	67976623	+	5'UTR	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67976623G>C	uc003xxi.2	+	1					CSPP1_uc003xxg.1_5'UTR|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_5'UTR|COPS5_uc003xxd.2_5'Flank|COPS5_uc003xxe.2_5'Flank|COPS5_uc003xxf.2_5'Flank|COPS5_uc010lyv.1_5'Flank	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GCCCCGGCCCGGAGGTCTGTC	0.726											OREG0018811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	7	---	---	---	---	PASS
SULF1	23213	broad.mit.edu	37	8	70539485	70539485	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70539485G>A	uc010lza.1	+	16	2608	c.1891G>A	c.(1891-1893)GAA>AAA	p.E631K	SULF1_uc003xyd.2_Missense_Mutation_p.E631K|SULF1_uc003xye.2_Missense_Mutation_p.E631K|SULF1_uc003xyf.2_Missense_Mutation_p.E631K|SULF1_uc003xyg.2_Missense_Mutation_p.E631K|SULF1_uc003xyh.1_RNA|SULF1_uc003xyi.1_5'Flank	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	631					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TTGTGAGAGAGAACTGTACCA	0.388													69	48	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763236	77763236	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763236G>T	uc003yav.2	+	10	4331	c.3944G>T	c.(3943-3945)TGG>TTG	p.W1315L	ZFHX4_uc003yau.1_Missense_Mutation_p.W1360L|ZFHX4_uc003yaw.1_Missense_Mutation_p.W1315L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1315						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTCTCAGAATGGAATAAAAAT	0.423										HNSCC(33;0.089)			8	33	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100146891	100146891	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100146891A>G	uc003yiv.2	+	9	1349	c.1238A>G	c.(1237-1239)TAC>TGC	p.Y413C	VPS13B_uc003yiw.2_Missense_Mutation_p.Y413C|VPS13B_uc003yit.2_Missense_Mutation_p.Y413C|VPS13B_uc003yiu.1_Missense_Mutation_p.Y413C|VPS13B_uc003yix.1_5'Flank	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	413					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGTAGTTATTACAGTCCACAG	0.274													32	124	---	---	---	---	PASS
MAF1	84232	broad.mit.edu	37	8	145161270	145161270	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145161270C>A	uc003zbc.1	+	5	904	c.403C>A	c.(403-405)CTG>ATG	p.L135M	SHARPIN_uc003zba.2_5'Flank|SHARPIN_uc003zbb.2_5'Flank|KIAA1875_uc003zbd.3_5'Flank|KIAA1875_uc011lky.1_5'Flank	NM_032272	NP_115648	Q9H063	MAF1_HUMAN	MAF1 protein	135					negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	cytoplasm|nucleus					0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.1e-42)|Epithelial(56;1.23e-40)|all cancers(56;4.84e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAACTGCAGTCTGTTCTCAGC	0.582													30	15	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2086985	2086985	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2086985C>G	uc003zhc.2	+	18	2782	c.2683C>G	c.(2683-2685)CTC>GTC	p.L895V	SMARCA2_uc003zhd.2_Missense_Mutation_p.L895V|SMARCA2_uc010mha.2_Intron	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	895	Helicase ATP-binding.				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CTGGGCCCTCCTCAACTTCCT	0.507													75	13	---	---	---	---	PASS
INSL4	3641	broad.mit.edu	37	9	5231710	5231710	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5231710C>T	uc003ziy.2	+	1	292	c.187C>T	c.(187-189)CGT>TGT	p.R63C		NM_002195	NP_002186	Q14641	INSL4_HUMAN	insulin-like 4 precursor	63					cell proliferation|cell-cell signaling|female pregnancy|multicellular organismal development|signal transduction	extracellular space|soluble fraction	hormone activity|insulin-like growth factor receptor binding				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.14)		GGAATCTGGACGTCCCAAAGG	0.517													22	7	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385532	33385532	+	Intron	SNP	T	C	C	rs115950431	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385532T>C	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_3'UTR|AQP7_uc010mjt.2_3'UTR|AQP7_uc011lnx.1_3'UTR|AQP7_uc011lny.1_3'UTR|AQP7_uc003zss.3_3'UTR|AQP7_uc011lnz.1_3'UTR|AQP7_uc011loa.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CTCCCCAGGCTACCTGGGGGC	0.592													4	22	---	---	---	---	PASS
KIAA1045	23349	broad.mit.edu	37	9	34976675	34976675	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34976675A>G	uc003zvq.2	+	5	965	c.787A>G	c.(787-789)ATA>GTA	p.I263V	KIAA1045_uc003zvr.2_Missense_Mutation_p.I263V	NM_015297	NP_056112	Q9UPV7	K1045_HUMAN	hypothetical protein LOC23349	263							calcium ion binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00575)			TCGAGGCCACATAGAGTGGCC	0.622													66	60	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84532668	84532668	+	3'UTR	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84532668G>A	uc011lst.1	+	4					uc004ame.2_5'Flank	NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						GGTGAGTGAGGACCACTGCGT	0.423													18	25	---	---	---	---	PASS
C9orf3	84909	broad.mit.edu	37	9	97848190	97848190	+	Intron	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97848190G>A	uc004ava.2	+						C9orf3_uc004auy.2_Intron|C9orf3_uc004avc.2_Intron|C9orf3_uc004avd.2_Intron|uc004avg.3_RNA|MIR24-1_hsa-mir-24-1|MI0000080_5'Flank	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGGGCGCGGTGAACTCTCTCT	0.617													3	1	---	---	---	---	PASS
TMOD1	7111	broad.mit.edu	37	9	100326379	100326379	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100326379G>C	uc004axk.1	+	6	760	c.547G>C	c.(547-549)GTA>CTA	p.V183L	TMOD1_uc004axl.1_Missense_Mutation_p.V183L	NM_003275	NP_003266	P28289	TMOD1_HUMAN	tropomodulin 1	183					muscle filament sliding	cytosol	actin binding				0		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		TTCAACAGACGTAGAGGAAAC	0.443													17	22	---	---	---	---	PASS
TSTD2	158427	broad.mit.edu	37	9	100367863	100367863	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100367863C>T	uc004axn.2	-	8	1503	c.1015G>A	c.(1015-1017)GTT>ATT	p.V339I	TSTD2_uc004axo.2_Missense_Mutation_p.V113I|TSTD2_uc004axp.1_Missense_Mutation_p.V113I	NM_139246	NP_640339	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like	339	Rhodanese.									ovary(2)	2						TTTTTGTCAACGTAGCTAGGG	0.463													36	77	---	---	---	---	PASS
PPP3R2	5535	broad.mit.edu	37	9	104356643	104356643	+	3'UTR	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104356643A>T	uc004bbr.2	-	1					GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta								calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	CTTGAAAGAGATAGGGAAGAA	0.448													28	57	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123232480	123232480	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123232480T>C	uc004bkf.2	-	17	2058	c.1877A>G	c.(1876-1878)TAT>TGT	p.Y626C	CDK5RAP2_uc004bke.2_5'UTR|CDK5RAP2_uc004bkg.2_Missense_Mutation_p.Y626C|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.Y625C|CDK5RAP2_uc004bki.2_Missense_Mutation_p.Y425C	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	626					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						TTGATCACTATAAAGTGAAAA	0.363													7	19	---	---	---	---	PASS
SPTAN1	6709	broad.mit.edu	37	9	131329130	131329130	+	Silent	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131329130T>C	uc004bvl.3	+	2	224	c.111T>C	c.(109-111)CGT>CGC	p.R37R	SPTAN1_uc011mbg.1_Silent_p.R37R|SPTAN1_uc011mbh.1_Silent_p.R49R|SPTAN1_uc004bvm.3_Silent_p.R37R|SPTAN1_uc004bvn.3_Silent_p.R37R	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	37	Spectrin 1.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						CCCTTAGGCGTCAGAAGCTGG	0.493													72	55	---	---	---	---	PASS
ACBD7	414149	broad.mit.edu	37	10	15058950	15058950	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15058950C>T	uc010qby.1	-	7	550	c.241G>A	c.(241-243)GGC>AGC	p.G81S				Q8N6N7	ACBD7_HUMAN	SubName: Full=cDNA FLJ52263, highly similar to Artemis protein (EC 3.1.-.-);	Error:Variant_position_missing_in_Q8N6N7_after_alignment							fatty-acyl-CoA binding				0						TATTCATAGCCATAAGCCGCT	0.373													30	117	---	---	---	---	PASS
ABI1	10006	broad.mit.edu	37	10	27112231	27112231	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27112231T>C	uc001isx.2	-	2	288	c.121A>G	c.(121-123)ACA>GCA	p.T41A	ABI1_uc001ite.2_Missense_Mutation_p.T41A|ABI1_uc010qdh.1_Missense_Mutation_p.T41A|ABI1_uc010qdi.1_Missense_Mutation_p.T41A|ABI1_uc001isy.2_Missense_Mutation_p.T41A|ABI1_uc001ita.2_Missense_Mutation_p.T41A|ABI1_uc001isz.2_Missense_Mutation_p.T41A|ABI1_uc001itb.2_Missense_Mutation_p.T58A|ABI1_uc001itc.2_Missense_Mutation_p.T41A|ABI1_uc010qdj.1_Missense_Mutation_p.T41A|ABI1_uc001itd.2_Missense_Mutation_p.T41A|ABI1_uc010qdk.1_Missense_Mutation_p.T41A	NM_005470	NP_005461	Q8IZP0	ABI1_HUMAN	abl-interactor 1 isoform a	41	Required for binding to WASF1 (By similarity).				actin polymerization or depolymerization|cellular component movement|negative regulation of cell proliferation|peptidyl-tyrosine phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cell junction|cytoskeleton|cytosol|endoplasmic reticulum|filopodium|growth cone|lamellipodium|nucleus|soluble fraction|synapse|synaptosome	cytoskeletal protein binding			central_nervous_system(1)	1						CTCTTGTCTGTAGCCTGAAAT	0.303													18	47	---	---	---	---	PASS
MRPS16	51021	broad.mit.edu	37	10	75009319	75009319	+	3'UTR	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75009319G>T	uc001jts.1	-	3					DNAJC9_uc001jtr.2_5'Flank|DNAJC9_uc010qkg.1_5'Flank|MRPS16_uc010qkh.1_Intron|MRPS16_uc001jtt.1_RNA	NM_016065	NP_057149	Q9Y3D3	RT16_HUMAN	mitochondrial ribosomal protein S16 precursor						translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0	Prostate(51;0.0119)					AAAAGTACAAGAATAAGGTTC	0.383													3	3	---	---	---	---	PASS
SYNPO2L	79933	broad.mit.edu	37	10	75406722	75406722	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75406722C>T	uc001jut.3	-	4	2840	c.2688G>A	c.(2686-2688)CAG>CAA	p.Q896Q	SYNPO2L_uc001jus.3_Silent_p.Q672Q	NM_001114133	NP_001107605	Q9H987	SYP2L_HUMAN	synaptopodin 2-like isoform a	896	Pro-rich.					cytoplasm|cytoskeleton	actin binding			ovary(1)	1	Prostate(51;0.0112)					CTGCAGTGGGCTGGGGTGCCG	0.627													31	13	---	---	---	---	PASS
FAM178A	55719	broad.mit.edu	37	10	102684688	102684688	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102684688G>A	uc001krt.3	+	5	2472	c.1930G>A	c.(1930-1932)GCT>ACT	p.A644T	FAM178A_uc001krr.1_Missense_Mutation_p.A644T|FAM178A_uc001krs.2_Missense_Mutation_p.A644T|FAM178A_uc001kru.1_Missense_Mutation_p.A579T	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	644											0						AAAGCCTCCTGCTCTTTCCAA	0.403													89	37	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104679190	104679190	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104679190C>T	uc001kwm.2	+	1	1077	c.953C>T	c.(952-954)TCA>TTA	p.S318L	CNNM2_uc001kwn.2_Missense_Mutation_p.S318L|CNNM2_uc001kwl.2_Missense_Mutation_p.S318L	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	318	DUF21.|Helical; (Potential).				ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CTGCTGTGCTCACTGCTGCTG	0.632													15	9	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120817659	120817659	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120817659G>A	uc001ldu.2	-	12	1932	c.1786C>T	c.(1786-1788)CAG>TAG	p.Q596*	EIF3A_uc010qsu.1_Nonsense_Mutation_p.Q562*	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	596	Glu-rich.				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		GCTTCCCTCTGTTCCAATTCT	0.512													33	99	---	---	---	---	PASS
GRK5	2869	broad.mit.edu	37	10	121093304	121093304	+	Intron	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121093304C>T	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		CGCTGATCTCCTGGAGCTCAT	0.493													19	46	---	---	---	---	PASS
C10orf90	118611	broad.mit.edu	37	10	128192613	128192613	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128192613C>T	uc001ljq.2	-	3	1277	c.1156G>A	c.(1156-1158)GGG>AGG	p.G386R	C10orf90_uc001ljp.2_Missense_Mutation_p.G339R|C10orf90_uc010qum.1_Missense_Mutation_p.G483R|C10orf90_uc009yao.2_Missense_Mutation_p.G483R|C10orf90_uc001ljs.1_Missense_Mutation_p.G339R	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	386										ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TCCTTTTCCCCTTTTCTTACA	0.502											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	43	14	---	---	---	---	PASS
MGMT	4255	broad.mit.edu	37	10	131565073	131565073	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131565073C>G	uc001lkh.2	+	5	555	c.529C>G	c.(529-531)CAC>GAC	p.H177D		NM_002412	NP_002403	P16455	MGMT_HUMAN	O-6-methylguanine-DNA methyltransferase	146										ovary(1)|breast(1)	2		all_cancers(35;9.44e-09)|all_epithelial(44;6.98e-08)|Lung NSC(174;0.0157)|all_lung(145;0.0201)|all_neural(114;0.0732)|Colorectal(57;0.0792)|Breast(234;0.167)		OV - Ovarian serous cystadenocarcinoma(35;0.00291)		CATCCCGTGCCACAGAGTGGT	0.632								Direct_reversal_of_damage					5	4	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134018389	134018389	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134018389C>T	uc009ybb.2	+	14	1828	c.1674C>T	c.(1672-1674)ATC>ATT	p.I558I		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	558					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CACAGAAGATCATGGCACCAC	0.672													31	139	---	---	---	---	PASS
KNDC1	85442	broad.mit.edu	37	10	135011911	135011911	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135011911C>T	uc001llz.1	+	13	1978	c.1977C>T	c.(1975-1977)TGC>TGT	p.C659C	KNDC1_uc001lma.1_Silent_p.C594C|KNDC1_uc001lmb.1_Silent_p.C71C	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	659					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		AGCACCCCTGCGGTGAAGAAG	0.682													4	5	---	---	---	---	PASS
OR56B4	196335	broad.mit.edu	37	11	6129404	6129404	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6129404C>T	uc010qzx.1	+	1	396	c.396C>T	c.(394-396)ATC>ATT	p.I132I		NM_001005181	NP_001005181	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B,	132	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACATAGCCATCTGTCGCCCTC	0.498													69	25	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17115836	17115836	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17115836T>C	uc001mmq.3	-	27	4489	c.4423A>G	c.(4423-4425)ATT>GTT	p.I1475V	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Missense_Mutation_p.I1095V|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	1475	PX.				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	GGAAAAATAATACTGAGCTTA	0.348													22	9	---	---	---	---	PASS
MRGPRX1	259249	broad.mit.edu	37	11	18955715	18955715	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18955715G>A	uc001mpg.2	-	1	835	c.617C>T	c.(616-618)TCC>TTC	p.S206F		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	206	Cytoplasmic (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						TATCTTCCGGGATCCACAGAG	0.502													11	52	---	---	---	---	PASS
CAT	847	broad.mit.edu	37	11	34489896	34489896	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34489896T>C	uc001mvm.2	+	11	1471	c.1388T>C	c.(1387-1389)ATT>ACT	p.I463T	CAT_uc001mvn.2_Missense_Mutation_p.I72T	NM_001752	NP_001743	P04040	CATA_HUMAN	catalase	463					hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	TGTGAGAACATTGCCGGCCAC	0.488													82	20	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55872916	55872916	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872916C>A	uc010riy.1	+	1	398	c.398C>A	c.(397-399)ACA>AAA	p.T133K		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	133	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					CTACACTACACAGTTATTATG	0.463										HNSCC(53;0.14)			140	78	---	---	---	---	PASS
SLC43A3	29015	broad.mit.edu	37	11	57193147	57193147	+	Intron	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57193147G>T	uc001nkg.2	-						PRG2_uc001nke.2_5'Flank|SLC43A3_uc001nkh.2_Intron|SLC43A3_uc010rjr.1_Missense_Mutation_p.P74T|SLC43A3_uc009yme.2_Intron|SLC43A3_uc001nki.2_Intron|SLC43A3_uc009ymf.1_Intron|SLC43A3_uc010rjs.1_Intron|SLC43A3_uc009ymg.1_Missense_Mutation_p.P74T	NM_014096	NP_054815	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3						transmembrane transport	integral to membrane				central_nervous_system(1)	1						TTGCAGTCTGGAGTAGAAAAA	0.532													6	16	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78433795	78433795	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78433795C>T	uc001ozl.3	-	24	4181	c.3718G>A	c.(3718-3720)GAC>AAC	p.D1240N		NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1240	Extracellular (Potential).|NHL 1.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						AGGCTCCCGTCAGAGCCACAG	0.562													24	57	---	---	---	---	PASS
MMP20	9313	broad.mit.edu	37	11	102495964	102495964	+	Silent	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102495964G>C	uc001phc.2	-	1	100	c.87C>G	c.(85-87)GCC>GCG	p.A29A		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	29					proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		TCCTGGGGGAGGCTGCAACTA	0.537													47	20	---	---	---	---	PASS
DCPS	28960	broad.mit.edu	37	11	126176504	126176504	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126176504G>A	uc001qdp.2	+	2	570	c.241G>A	c.(241-243)GTT>ATT	p.V81I		NM_014026	NP_054745	Q96C86	DCPS_HUMAN	mRNA decapping enzyme	81					deadenylation-dependent decapping of nuclear-transcribed mRNA|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	exoribonuclease activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		AGAGGATGCCGTTGTGATCCT	0.572													13	6	---	---	---	---	PASS
FBXL14	144699	broad.mit.edu	37	12	1675768	1675768	+	3'UTR	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1675768C>A	uc001qjh.2	-	2						NM_152441	NP_689654	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14							cytoplasm				ovary(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			cacaaggtaccggagcagaag	0.000													4	14	---	---	---	---	PASS
NCAPD2	9918	broad.mit.edu	37	12	6623746	6623746	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6623746A>G	uc001qoo.2	+	8	878	c.832A>G	c.(832-834)ATT>GTT	p.I278V	NCAPD2_uc009zen.1_Missense_Mutation_p.I150V|NCAPD2_uc010sfd.1_Missense_Mutation_p.I233V	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	278	Interactions with SMC2 and SMC4.				cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						AGTGGGAGAGATTGTAAGGTG	0.443													34	33	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9571472	9571472	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9571472G>C	uc010sgs.1	-	26	2785	c.2590C>G	c.(2590-2592)CGA>GGA	p.R864G	DDX12_uc001qvx.3_Missense_Mutation_p.R86G|DDX12_uc001qvy.1_3'UTR	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						CGGGCGTATCGCTGGTCCAGG	0.647													6	16	---	---	---	---	PASS
RECQL	5965	broad.mit.edu	37	12	21627868	21627868	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21627868C>T	uc001rex.2	-	12	1610	c.1262G>A	c.(1261-1263)GGA>GAA	p.G421E	RECQL_uc001rey.2_Missense_Mutation_p.G421E	NM_032941	NP_116559	P46063	RECQ1_HUMAN	RecQ protein-like	421	Helicase C-terminal.				DNA recombination|DNA repair|DNA replication	nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|DNA strand annealing activity|protein binding			ovary(1)|lung(1)	2						GAATATATCTCCAAAGCCGTA	0.373								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					107	54	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22005388	22005388	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22005388C>G	uc001rfi.1	-	21	2577	c.2557G>C	c.(2557-2559)GAG>CAG	p.E853Q	ABCC9_uc001rfh.2_Missense_Mutation_p.E853Q|ABCC9_uc001rfj.1_Missense_Mutation_p.E817Q	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	853	Cytoplasmic (Potential).|ABC transporter 1.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AAAATCCCCTCCTGCATTAAA	0.408													16	205	---	---	---	---	PASS
DENND5B	160518	broad.mit.edu	37	12	31648850	31648850	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31648850T>G	uc001rki.1	-	2	317	c.131A>C	c.(130-132)GAA>GCA	p.E44A	DENND5B_uc001rkh.1_Missense_Mutation_p.E79A|DENND5B_uc001rkj.2_Missense_Mutation_p.E66A|DENND5B_uc001rkk.1_5'UTR	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	44						integral to membrane				ovary(1)|central_nervous_system(1)	2						GTCAAAATTTTCGCCTACAAC	0.338													19	63	---	---	---	---	PASS
LARP4	113251	broad.mit.edu	37	12	50829280	50829280	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50829280G>T	uc001rwp.1	+	5	552	c.408G>T	c.(406-408)TTG>TTT	p.L136F	LARP4_uc001rwo.1_Missense_Mutation_p.L142F|LARP4_uc001rwq.1_Missense_Mutation_p.L136F|LARP4_uc001rwr.1_Missense_Mutation_p.L136F|LARP4_uc001rws.1_Missense_Mutation_p.L135F|LARP4_uc009zlr.1_5'Flank|LARP4_uc001rwm.2_Missense_Mutation_p.L136F|LARP4_uc001rwn.2_Missense_Mutation_p.L66F	NM_052879	NP_443111	Q71RC2	LARP4_HUMAN	c-Mpl binding protein isoform a	136	HTH La-type RNA-binding.						nucleotide binding|RNA binding			ovary(1)	1						GAGAAAATTTGTCAAAGGATC	0.313													25	111	---	---	---	---	PASS
LETMD1	25875	broad.mit.edu	37	12	51442959	51442959	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51442959T>G	uc001rxm.2	+	2	321	c.265T>G	c.(265-267)TTC>GTC	p.F89V	LETMD1_uc010smz.1_Missense_Mutation_p.F89V|LETMD1_uc010sna.1_Missense_Mutation_p.F89V|LETMD1_uc001rxl.2_Missense_Mutation_p.F33V|LETMD1_uc009zlv.2_RNA|LETMD1_uc001rxs.2_Missense_Mutation_p.F89V|LETMD1_uc009zlw.2_Missense_Mutation_p.F89V|LETMD1_uc001rxn.2_5'UTR|LETMD1_uc001rxo.2_RNA|LETMD1_uc001rxp.2_Intron|LETMD1_uc001rxq.2_Missense_Mutation_p.F89V|LETMD1_uc001rxr.2_RNA|LETMD1_uc001rxt.2_5'UTR	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1	89	Cytoplasmic (Potential).|LETM1.|Required and sufficient for mitochondrial import.					integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						GTACACAATCTTCATGAAAGG	0.403													7	211	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52164425	52164425	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52164425G>C	uc001ryw.2	+	19	3781	c.3603G>C	c.(3601-3603)GAG>GAC	p.E1201D	SCN8A_uc010snl.1_Missense_Mutation_p.E1066D	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1201	III.|Helical; Name=S1 of repeat III; (Potential).				axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	ACTGGTTTGAGACCTTCATCA	0.557													10	133	---	---	---	---	PASS
ESPL1	9700	broad.mit.edu	37	12	53677876	53677876	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53677876G>A	uc001sck.2	+	17	3203	c.3112G>A	c.(3112-3114)GAG>AAG	p.E1038K	ESPL1_uc001scj.2_Missense_Mutation_p.E713K|ESPL1_uc010soe.1_Missense_Mutation_p.E249K	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	1038					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						GGGCGAGCTGGAGCTGGCCCG	0.532													79	173	---	---	---	---	PASS
OR6C70	390327	broad.mit.edu	37	12	55863095	55863095	+	Silent	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55863095A>G	uc010spn.1	-	1	828	c.828T>C	c.(826-828)AAT>AAC	p.N276N		NM_001005499	NP_001005499	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C,	276	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CAACTGAAGTATTGAGCACAG	0.358													16	179	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72057170	72057170	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72057170G>A	uc001swo.2	-	1	580	c.221C>T	c.(220-222)TCG>TTG	p.S74L	ZFC3H1_uc010sts.1_Missense_Mutation_p.S74L|ZFC3H1_uc001swp.2_Missense_Mutation_p.S74L|THAP2_uc001swq.2_5'Flank	NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	74	Ser-rich.				RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						GGACGATGACGAGGAAGAGCC	0.677											OREG0021993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	289	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72680477	72680477	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72680477C>T	uc001sxa.2	+	2	826	c.796C>T	c.(796-798)CAG>TAG	p.Q266*		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	266	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TGGTGTTACTCAGTTTTCGCC	0.363													82	441	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72680639	72680639	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72680639C>T	uc001sxa.2	+	2	988	c.958C>T	c.(958-960)CAC>TAC	p.H320Y		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	320	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GGTTACGGATCACTTTTCACA	0.408													127	531	---	---	---	---	PASS
TMPO	7112	broad.mit.edu	37	12	98925604	98925604	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98925604G>C	uc001tfj.2	+	3	790	c.553G>C	c.(553-555)GAC>CAC	p.D185H	TMPO_uc001tfi.1_Missense_Mutation_p.D185H|TMPO_uc001tfk.2_Missense_Mutation_p.D185H|TMPO_uc001tfl.2_RNA|TMPO_uc001tfh.1_Missense_Mutation_p.D185H	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta	185	Nucleoplasmic (Potential).|NAKAP95-binding N.					integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						CAGATACAGTGACAATGAAGA	0.313													29	35	---	---	---	---	PASS
NUAK1	9891	broad.mit.edu	37	12	106500253	106500253	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106500253C>A	uc001tlj.1	-	2	1671	c.291G>T	c.(289-291)ATG>ATT	p.M97I		NM_014840	NP_055655	O60285	NUAK1_HUMAN	AMPK-related protein kinase 5	97	Protein kinase.						ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2						TGATGTGAACCATGTCTTGTT	0.343													25	5	---	---	---	---	PASS
CUX2	23316	broad.mit.edu	37	12	111758093	111758093	+	Silent	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111758093G>T	uc001tsa.1	+	17	2433	c.2280G>T	c.(2278-2280)CCG>CCT	p.P760P		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	760						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						CGCCGCTCCCGGTCCTGTCCC	0.736													11	16	---	---	---	---	PASS
HPD	3242	broad.mit.edu	37	12	122281692	122281692	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122281692G>A	uc001ubj.2	-	12	918	c.878C>T	c.(877-879)TCC>TTC	p.S293F	HPD_uc001ubk.2_Missense_Mutation_p.S254F	NM_002150	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	293					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	GTAGTACGTGGAGGGAACAGA	0.542													22	29	---	---	---	---	PASS
GPR109B	8843	broad.mit.edu	37	12	123200017	123200017	+	3'UTR	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123200017G>A	uc001ucy.3	-	1					GPR81_uc001ucw.1_Intron	NM_006018	NP_006009	P49019	HCAR3_HUMAN	G protein-coupled receptor 109B							integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	GGATTCCTGCGGTCACACCTT	0.493													4	28	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130912840	130912840	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130912840G>A	uc001uil.2	-	12	2409	c.2245C>T	c.(2245-2247)CGG>TGG	p.R749W		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	749						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCAGACCCCCGGCTGCTCTCT	0.617													14	45	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67802415	67802415	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67802415T>C	uc001vik.2	-	2	850	c.158A>G	c.(157-159)AAT>AGT	p.N53S	PCDH9_uc001vil.2_Missense_Mutation_p.N53S|PCDH9_uc010thl.1_Missense_Mutation_p.N53S|PCDH9_uc001vin.3_Missense_Mutation_p.N53S	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	53	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TGTGGCAGCATTGATGTGAGA	0.458													24	12	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76378450	76378450	+	5'UTR	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76378450A>G	uc001vjv.2	+	5					LMO7_uc010thv.1_Silent_p.E281E|LMO7_uc001vjt.1_Silent_p.E229E|LMO7_uc010thw.1_Silent_p.E190E|LMO7_uc001vjw.1_5'UTR|LMO7_uc001vju.1_RNA	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CAGATTCGGAATTTACATTTA	0.398													22	53	---	---	---	---	PASS
ZNF828	283489	broad.mit.edu	37	13	115091876	115091876	+	3'UTR	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115091876T>G	uc010ahb.2	+	3					ZNF828_uc001vuv.2_3'UTR|ZNF828_uc010tko.1_3'UTR	NM_001164144	NP_001157616	Q96JM3	ZN828_HUMAN	zinc finger protein 828						attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|protein localization to kinetochore|protein localization to microtubule|sister chromatid biorientation	condensed chromosome kinetochore|cytoplasm|nucleus|spindle	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_epithelial(44;0.122)|all_lung(25;0.123)	BRCA - Breast invasive adenocarcinoma(86;0.104)	OV - Ovarian serous cystadenocarcinoma(48;0.193)|Epithelial(10;0.197)		CGTGTTTCACTGTCTCAGTTG	0.353													2	4	---	---	---	---	PASS
REC8	9985	broad.mit.edu	37	14	24648917	24648917	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24648917T>G	uc001wmr.2	+	19	1863	c.1436T>G	c.(1435-1437)CTG>CGG	p.L479R	REC8_uc001wms.2_Missense_Mutation_p.L479R	NM_005132	NP_005123	O95072	REC8_HUMAN	REC8 homolog	479	Glu-rich.				mitotic metaphase/anaphase transition|mitotic prometaphase|reciprocal meiotic recombination|sister chromatid cohesion	nucleoplasm					0				GBM - Glioblastoma multiforme(265;0.00839)		CTGCTCTCACTGGAAGCAGTG	0.612													26	48	---	---	---	---	PASS
CTSG	1511	broad.mit.edu	37	14	25043947	25043947	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25043947C>T	uc001wpq.2	-	3	310	c.273G>A	c.(271-273)GCG>GCA	p.A91A		NM_001911	NP_001902	P08311	CATG_HUMAN	cathepsin G preproprotein	91	Peptidase S1.				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0269)		TGGCTCTGCGCGCAGTGATGT	0.532													25	69	---	---	---	---	PASS
TRIM9	114088	broad.mit.edu	37	14	51561002	51561002	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51561002C>T	uc001wyx.3	-	1	1421	c.656G>A	c.(655-657)CGG>CAG	p.R219Q	TRIM9_uc001wyy.2_Missense_Mutation_p.R219Q|TRIM9_uc001wyz.3_Missense_Mutation_p.R219Q	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 1	219					proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)					GCTCAGCCTCCGGCTCACACG	0.672													8	22	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65197535	65197535	+	Silent	SNP	G	T	T	rs144144480		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65197535G>T	uc001xho.1	+	6	854	c.585G>T	c.(583-585)ACG>ACT	p.T195T	PLEKHG3_uc001xhn.1_Silent_p.T139T|PLEKHG3_uc001xhp.2_Silent_p.T195T|PLEKHG3_uc010aqh.1_5'UTR	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	195	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CCGCCCTGACGGAATGCATGC	0.642													13	15	---	---	---	---	PASS
C14orf181	400223	broad.mit.edu	37	14	69262557	69262557	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69262557G>C	uc001xkj.1	-	1	634	c.455C>G	c.(454-456)TCG>TGG	p.S152W	ZFP36L1_uc001xkh.1_5'Flank|ZFP36L1_uc001xki.1_5'Flank	NM_207442	NP_997325			hypothetical protein LOC400223												0				all cancers(60;0.002)|BRCA - Breast invasive adenocarcinoma(234;0.00204)|OV - Ovarian serous cystadenocarcinoma(108;0.0399)		AGGAGGGAGCGAGTCCCTTAA	0.617													27	31	---	---	---	---	PASS
C14orf45	80127	broad.mit.edu	37	14	74489638	74489638	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74489638G>A	uc010tup.1	+	2	199	c.76G>A	c.(76-78)GAA>AAA	p.E26K		NM_025057	NP_079333	Q8ND07	CN045_HUMAN	hypothetical protein LOC80127	26											0				BRCA - Breast invasive adenocarcinoma(234;0.00351)		AAAAACAGATGAATCTGTGGT	0.388													8	16	---	---	---	---	PASS
RPS6KA5	9252	broad.mit.edu	37	14	91356957	91356957	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91356957C>T	uc001xys.2	-	14	1925	c.1710G>A	c.(1708-1710)CGG>CGA	p.R570R	RPS6KA5_uc010twi.1_Silent_p.R491R	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5	570	Protein kinase 2.				axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		GTGGCTTTAGCCGTGCAAATC	0.413													3	55	---	---	---	---	PASS
BCL8	606	broad.mit.edu	37	15	20876477	20876477	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20876477T>C	uc010tze.1	-	2	343	c.136A>G	c.(136-138)ATT>GTT	p.I46V	BCL8_uc010tzd.1_RNA	NR_027992				RecName: Full=Putative protein BCL8;												0						GCTGGGTTAATAAACAAAATA	0.338													7	54	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28467360	28467360	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28467360G>A	uc001zbj.2	-	36	5572	c.5466C>T	c.(5464-5466)GGC>GGT	p.G1822G		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	1822					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CACAACTGGGGCCTGATGGAG	0.443													16	29	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48752456	48752456	+	Silent	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48752456G>C	uc001zwx.1	-	43	5611	c.5283C>G	c.(5281-5283)ACC>ACG	p.T1761T	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1761					heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CGGGTAAACCGGTATAAATGT	0.418													15	21	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48787780	48787780	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48787780C>T	uc001zwx.1	-	21	2753	c.2425G>A	c.(2425-2427)GAT>AAT	p.D809N		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	809	EGF-like 13; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TCGCATTCATCAATGTCTGAA	0.378													64	99	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49309824	49309824	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49309824T>A	uc001zxe.1	-	9	1306	c.1172A>T	c.(1171-1173)GAT>GTT	p.D391V	SECISBP2L_uc001zxd.1_Missense_Mutation_p.D346V|SECISBP2L_uc010bep.1_Missense_Mutation_p.D153V|SECISBP2L_uc010beq.1_Missense_Mutation_p.D263V	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	391										breast(1)|skin(1)	2						CCCATCTTCATCCTGAAATGT	0.284													5	18	---	---	---	---	PASS
DPP8	54878	broad.mit.edu	37	15	65790284	65790284	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65790284C>G	uc002aov.2	-	5	2259	c.681G>C	c.(679-681)TGG>TGC	p.W227C	DPP8_uc002aow.2_Missense_Mutation_p.W227C|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Missense_Mutation_p.W211C|DPP8_uc002aoy.2_Missense_Mutation_p.W227C|DPP8_uc002aoz.2_Missense_Mutation_p.W211C|DPP8_uc010bhj.2_Missense_Mutation_p.W227C|DPP8_uc002apa.2_Missense_Mutation_p.W124C	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1	227					immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						TAAAAGCAATCCAGTCTGGAT	0.403													33	34	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72193566	72193566	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72193566A>G	uc002atl.3	-	23	3589	c.3116T>C	c.(3115-3117)TTC>TCC	p.F1039S	MYO9A_uc010biq.2_Missense_Mutation_p.F659S|MYO9A_uc002atn.1_Missense_Mutation_p.F1020S|MYO9A_uc002atk.2_5'Flank|MYO9A_uc002atm.1_5'Flank	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	1039	IQ 1.|Neck or regulatory domain.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						CAGATGGAGGAAATGCTGCCT	0.443													21	26	---	---	---	---	PASS
PML	5371	broad.mit.edu	37	15	74315653	74315653	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74315653G>A	uc002awv.2	+	3	1227	c.1087G>A	c.(1087-1089)GAG>AAG	p.E363K	PML_uc002awm.2_Missense_Mutation_p.E363K|PML_uc002awl.2_Missense_Mutation_p.E363K|PML_uc002awj.1_Missense_Mutation_p.E363K|PML_uc002awk.2_Missense_Mutation_p.E363K|PML_uc002awn.2_Missense_Mutation_p.E363K|PML_uc002awo.2_Missense_Mutation_p.E363K|PML_uc002awp.2_Missense_Mutation_p.E363K|PML_uc002awq.2_Missense_Mutation_p.E363K|PML_uc002awr.2_Missense_Mutation_p.E363K|PML_uc002aws.2_Missense_Mutation_p.E363K|PML_uc002awt.2_Missense_Mutation_p.E363K|PML_uc002awu.2_Missense_Mutation_p.E363K|PML_uc010ule.1_Intron|PML_uc002aww.1_Missense_Mutation_p.E278K|PML_uc002awx.2_Missense_Mutation_p.E121K|PML_uc002awy.2_5'Flank	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	363					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						GCGCCAGGAGGAGCCCCAGAG	0.652			T	RARA|PAX5	APL|ALL								9	20	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	76994116	76994116	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76994116G>A	uc002bby.2	-	19	2550	c.2491C>T	c.(2491-2493)CTG>TTG	p.L831L	SCAPER_uc010bkr.2_Silent_p.L139L|SCAPER_uc002bbx.2_Silent_p.L585L|SCAPER_uc002bbz.1_Silent_p.L702L|SCAPER_uc002bca.1_Silent_p.L696L	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	830						endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						TCATCTGACAGTTCACGCCCC	0.373													33	21	---	---	---	---	PASS
MORF4L1	10933	broad.mit.edu	37	15	79187188	79187188	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79187188A>T	uc002bel.2	+	12	1134	c.946A>T	c.(946-948)ACA>TCA	p.T316S	MORF4L1_uc002bem.2_Missense_Mutation_p.T277S|MORF4L1_uc010une.1_Missense_Mutation_p.T189S	NM_206839	NP_996670	Q9UBU8	MO4L1_HUMAN	MORF-related gene 15 isoform 2	316	Sufficient for interaction with PHF12.				double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0						GTTGGCTTATACACCTCTGGA	0.343													36	43	---	---	---	---	PASS
FAH	2184	broad.mit.edu	37	15	80445352	80445352	+	Intron	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80445352C>G	uc002bfj.2	+						FAH_uc002bfk.1_Intron|FAH_uc002bfm.1_5'UTR|FAH_uc002bfn.1_5'Flank|FAH_uc010unl.1_Intron|FAH_uc002bfl.1_5'UTR	NM_000137	NP_000128	P16930	FAAA_HUMAN	fumarylacetoacetase						L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	fumarylacetoacetase activity|metal ion binding				0						GTCCTGCTCTCCGCACGCCAC	0.567									Tyrosinemia_type_1				4	11	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83349915	83349915	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83349915C>A	uc010uoh.1	-	6	714	c.537G>T	c.(535-537)CAG>CAT	p.Q179H	AP3B2_uc010uoi.1_Missense_Mutation_p.Q179H|AP3B2_uc010uoj.1_Missense_Mutation_p.Q147H|AP3B2_uc010uog.1_5'Flank	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	179					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			GCTGATCCTTCTGGTCAGAGT	0.577													6	8	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90348650	90348650	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90348650G>A	uc002bop.3	-	3	951	c.659C>T	c.(658-660)TCC>TTC	p.S220F		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	220	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	GCATGGGAAGGACTTCCGGGC	0.602													20	14	---	---	---	---	PASS
ZNF710	374655	broad.mit.edu	37	15	90611334	90611334	+	Missense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90611334C>A	uc002bov.1	+	2	1088	c.965C>A	c.(964-966)CCA>CAA	p.P322Q		NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	322					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			GGCATCAAGCCACACTCGTGC	0.637													9	22	---	---	---	---	PASS
BLM	641	broad.mit.edu	37	15	91290711	91290711	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91290711C>T	uc002bpr.2	+	2	186	c.89C>T	c.(88-90)CCA>CTA	p.P30L	BLM_uc010uqh.1_Missense_Mutation_p.P30L|BLM_uc010uqi.1_5'UTR|BLM_uc010bnx.2_Missense_Mutation_p.P30L	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	30					double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			CTTTCAAAACCAAAATTTTCG	0.294			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				7	13	---	---	---	---	PASS
C16orf11	146325	broad.mit.edu	37	16	613383	613383	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:613383C>G	uc002chk.2	+	2	368	c.89C>G	c.(88-90)CCC>CGC	p.P30R		NM_145270	NP_660313	P0CG20	CP011_HUMAN	hypothetical protein LOC146325	30										central_nervous_system(1)	1						ATCCCGCGGCCCTGGGGCAAA	0.622													10	10	---	---	---	---	PASS
LMF1	64788	broad.mit.edu	37	16	919947	919947	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:919947C>T	uc002ckj.2	-	9	1356	c.1352G>A	c.(1351-1353)CGG>CAG	p.R451Q	LMF1_uc010brg.2_5'Flank|LMF1_uc010brh.2_Missense_Mutation_p.R234Q|LMF1_uc010bri.2_Missense_Mutation_p.R214Q|LMF1_uc002ckk.2_Missense_Mutation_p.R234Q	NM_022773	NP_073610	Q96S06	LMF1_HUMAN	lipase maturation factor 1	451	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)				GAGGCAGGGCCGTCTGCTGGG	0.672													10	7	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15082229	15082229	+	Intron	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15082229A>G	uc010uzl.1	+						PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002dda.3_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_Silent_p.L279L	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	AGGGAGGCCAAGCTGAACCAG	0.602													8	52	---	---	---	---	PASS
USP31	57478	broad.mit.edu	37	16	23116802	23116802	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23116802C>G	uc002dll.2	-	5	1049	c.1049G>C	c.(1048-1050)CGG>CCG	p.R350P		NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31	350					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		CACTGCTTCCCGAAGTCTGGC	0.468													27	51	---	---	---	---	PASS
COG7	91949	broad.mit.edu	37	16	23445959	23445959	+	Missense_Mutation	SNP	T	C	C	rs140030187		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23445959T>C	uc002dlo.2	-	5	873	c.685A>G	c.(685-687)AAG>GAG	p.K229E		NM_153603	NP_705831	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	229					intracellular protein transport|protein glycosylation|protein localization in Golgi apparatus|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0				GBM - Glioblastoma multiforme(48;0.0401)		CTTCTTACCTTGTGACACTTG	0.433											OREG0023684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	33	---	---	---	---	PASS
PLK1	5347	broad.mit.edu	37	16	23700964	23700964	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23700964C>T	uc002dlz.1	+	9	1628	c.1575C>T	c.(1573-1575)CTC>CTT	p.L525L		NM_005030	NP_005021	P53350	PLK1_HUMAN	polo-like kinase 1	525	POLO box 2.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G2/M transition DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic prophase|negative regulation of cyclin-dependent protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|protein localization to chromatin|protein ubiquitination|regulation of mitotic anaphase|regulation of protein binding	centrosome|condensed nuclear chromosome outer kinetochore|cytosol|nucleoplasm|spindle microtubule|spindle midzone|spindle pole	anaphase-promoting complex binding|ATP binding|polo kinase kinase activity|protein kinase binding			lung(1)|skin(1)	2				GBM - Glioblastoma multiforme(48;0.0156)		TCCTGCACCTCAGCAACGGCA	0.652													13	13	---	---	---	---	PASS
SH2B1	25970	broad.mit.edu	37	16	28878329	28878329	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28878329G>T	uc002dri.2	+	4	1353	c.914G>T	c.(913-915)CGC>CTC	p.R305L	uc010vct.1_Intron|SH2B1_uc010vdc.1_Intron|SH2B1_uc002drj.2_Missense_Mutation_p.R305L|SH2B1_uc002drk.2_Missense_Mutation_p.R305L|SH2B1_uc002drl.2_Missense_Mutation_p.R305L|SH2B1_uc010vdd.1_Intron|SH2B1_uc010vde.1_Missense_Mutation_p.R305L|SH2B1_uc002drm.2_Missense_Mutation_p.R305L	NM_001145795	NP_001139267	Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1 isoform 1	305	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation) (By similarity).|PH.				blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity			ovary(2)	2						GGAGGAAGTCGCCTGGAGTTC	0.607													23	25	---	---	---	---	PASS
VKORC1	79001	broad.mit.edu	37	16	31102541	31102541	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31102541T>C	uc002eas.2	-	3	632	c.406A>G	c.(406-408)ATC>GTC	p.I136V	PRSS53_uc002eaq.2_5'Flank|PRSS53_uc002ear.2_5'UTR|VKORC1_uc002eat.2_3'UTR|VKORC1_uc002eau.2_3'UTR	NM_024006	NP_076869	Q9BQB6	VKOR1_HUMAN	vitamin K epoxide reductase complex, subunit 1	136	Helical; (Potential).				peptidyl-glutamic acid carboxylation|post-translational protein modification	endoplasmic reticulum membrane|integral to membrane	vitamin-K-epoxide reductase (warfarin-sensitive) activity				0					Acenocoumarol(DB01418)|Dicumarol(DB00266)|Menadione(DB00170)|Phenindione(DB00498)|Phenprocoumon(DB00946)|Warfarin(DB00682)	TAGGTGGTGATACAAACAATG	0.537													12	69	---	---	---	---	PASS
MYLK3	91807	broad.mit.edu	37	16	46761062	46761062	+	Intron	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46761062G>A	uc002eei.3	-						MYLK3_uc010vge.1_Intron|MYLK3_uc002eej.1_3'UTR	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3						cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				agctgggactgtctgTGGATA	0.299													11	10	---	---	---	---	PASS
CNGB1	1258	broad.mit.edu	37	16	57935276	57935276	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57935276T>A	uc002emt.2	-	29	3021	c.2956A>T	c.(2956-2958)AAC>TAC	p.N986Y	CNGB1_uc010cdh.2_Missense_Mutation_p.N980Y	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	986	Cytoplasmic (Potential).|cAMP (By similarity).				sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						ACATAGTCGTTGGGCAGGTAG	0.567													29	68	---	---	---	---	PASS
RLTPR	146206	broad.mit.edu	37	16	67679643	67679643	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67679643G>A	uc002etn.2	+	3	269	c.149G>A	c.(148-150)AGA>AAA	p.R50K	RLTPR_uc010cel.1_Missense_Mutation_p.R50K|RLTPR_uc010vjr.1_Missense_Mutation_p.R50K	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	50										breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		CTACGATGGAGAGCCTACCTG	0.667													32	29	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69959346	69959346	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69959346C>T	uc002exu.1	+	12	1282	c.1193C>T	c.(1192-1194)TCG>TTG	p.S398L	WWP2_uc002exv.1_Missense_Mutation_p.S398L|WWP2_uc010vlm.1_Missense_Mutation_p.S282L|WWP2_uc010vln.1_Missense_Mutation_p.S16L|WWP2_uc002exw.1_5'UTR	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	398					entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						TCGAGTGCTTCGACTGACCAT	0.488													242	221	---	---	---	---	PASS
ZNF23	7571	broad.mit.edu	37	16	71483770	71483770	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71483770T>A	uc002faf.2	-	6	972	c.158A>T	c.(157-159)AAT>ATT	p.N53I	ZNF23_uc002fad.2_5'UTR|ZNF23_uc002fae.2_5'UTR|ZNF23_uc010vmf.1_5'UTR|ZNF23_uc002fag.2_5'UTR|ZNF23_uc002fah.2_Missense_Mutation_p.N53I|ZNF23_uc002fai.2_Missense_Mutation_p.N92I	NM_145911	NP_666016	P17027	ZNF23_HUMAN	zinc finger protein 23	53					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		TGTCAAATCATTGTCAGTCTG	0.318													14	36	---	---	---	---	PASS
RFWD3	55159	broad.mit.edu	37	16	74685992	74685992	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74685992G>A	uc002fda.2	-	3	645	c.547C>T	c.(547-549)CAG>TAG	p.Q183*	RFWD3_uc010cgq.2_Nonsense_Mutation_p.Q183*	NM_018124	NP_060594	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	183					DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|response to ionizing radiation	nucleus	MDM2 binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(1)	3						CTGCTCACCTGAAAGTAAGCA	0.413													13	35	---	---	---	---	PASS
ZFPM1	161882	broad.mit.edu	37	16	88555534	88555534	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88555534G>A	uc002fkv.2	+	3	274	c.241G>A	c.(241-243)GAG>AAG	p.E81K		NM_153813	NP_722520	Q8IX07	FOG1_HUMAN	zinc finger protein, multitype 1	81					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|transcription factor binding|zinc ion binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0478)		CACGGAGGAAGAGCCGGGCAG	0.711													3	7	---	---	---	---	PASS
ANKRD11	29123	broad.mit.edu	37	16	89345686	89345686	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89345686T>C	uc002fmx.1	-	9	7725	c.7264A>G	c.(7264-7266)ATC>GTC	p.I2422V	ANKRD11_uc002fmy.1_Missense_Mutation_p.I2422V|ANKRD11_uc002fnc.1_Missense_Mutation_p.I2422V|ANKRD11_uc002fna.1_Missense_Mutation_p.I87V|ANKRD11_uc002fnb.1_Missense_Mutation_p.I2379V	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2422						nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCCAGCTTGATGGCGTCCACG	0.607													3	4	---	---	---	---	PASS
DPEP1	1800	broad.mit.edu	37	16	89702959	89702959	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89702959G>T	uc010cin.2	+	5	592	c.389G>T	c.(388-390)CGG>CTG	p.R130L	DPEP1_uc002fnr.3_Missense_Mutation_p.R130L|DPEP1_uc002fns.3_Missense_Mutation_p.R130L	NM_001128141	NP_001121613	P16444	DPEP1_HUMAN	dipeptidase 1 precursor	130					proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	CAGGCCTTCCGGGAAGGGAAG	0.662													9	23	---	---	---	---	PASS
TMEM107	84314	broad.mit.edu	37	17	8076901	8076901	+	3'UTR	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8076901G>A	uc002gkg.3	-	5					TMEM107_uc002gkh.3_3'UTR|TMEM107_uc002gki.3_3'UTR|TMEM107_uc002gkj.3_RNA	NM_183065	NP_898888	Q6UX40	TM107_HUMAN	transmembrane protein 107 isoform 2							integral to membrane					0						tatcccacctgacgatACAGA	0.204													5	18	---	---	---	---	PASS
MED9	55090	broad.mit.edu	37	17	17394774	17394774	+	Nonsense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17394774A>T	uc002grh.1	+	2	462	c.406A>T	c.(406-408)AAG>TAG	p.K136*		NM_018019	NP_060489	Q9NWA0	MED9_HUMAN	mediator complex subunit 9	136	Potential.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		protein binding				0						GCAAAAGTACAAGAGCCTCTG	0.567													22	66	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18035826	18035826	+	Missense_Mutation	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18035826G>C	uc010vxh.1	+	10	4604	c.4266G>C	c.(4264-4266)CAG>CAC	p.Q1422H		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	1422	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					TGCCTGCCCAGCTCAGGCAGG	0.582													12	57	---	---	---	---	PASS
SLFN12L	342615	broad.mit.edu	37	17	33849600	33849600	+	5'UTR	SNP	A	G	G	rs7213293	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33849600A>G	uc002hjn.2	-	2						NM_001145027	NP_001138499			schlafen family member 12-like											ovary(1)	1						GTGCCTGCAAAACTATAGGAC	0.567													5	90	---	---	---	---	PASS
SLFN12L	342615	broad.mit.edu	37	17	33849601	33849601	+	5'UTR	SNP	A	G	G	rs7213294	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33849601A>G	uc002hjn.2	-	2						NM_001145027	NP_001138499			schlafen family member 12-like											ovary(1)	1						TGCCTGCAAAACTATAGGACG	0.567													5	91	---	---	---	---	PASS
LASP1	3927	broad.mit.edu	37	17	37026461	37026461	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37026461C>G	uc002hra.2	+	1	350	c.19C>G	c.(19-21)CGG>GGG	p.R7G	LASP1_uc010wdy.1_Missense_Mutation_p.R7G|LASP1_uc010cvq.2_5'UTR|LASP1_uc010wdz.1_5'UTR	NM_006148	NP_006139	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	7	LIM zinc-binding.					cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1						CAACTGCGCCCGGTGCGGCAA	0.672			T	MLL	AML								15	12	---	---	---	---	PASS
KRTAP4-9	100132386	broad.mit.edu	37	17	39261768	39261768	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39261768G>A	uc010wfp.1	+	1	128	c.128G>A	c.(127-129)AGC>AAC	p.S43N		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	43	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].|4.					keratin filament					0						TGCCGCCCCAGCTGTTGTGTA	0.652													8	29	---	---	---	---	PASS
SLC4A1	6521	broad.mit.edu	37	17	42337895	42337895	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42337895A>G	uc002igf.3	-	6	511	c.362T>C	c.(361-363)CTA>CCA	p.L121P	SLC4A1_uc002igg.3_Missense_Mutation_p.L121P	NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	121	Cytoplasmic.				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TTGCAGGTCTAGGAGGACAGT	0.597													13	47	---	---	---	---	PASS
TRIM25	7706	broad.mit.edu	37	17	54985878	54985878	+	Missense_Mutation	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54985878C>G	uc002iut.2	-	2	704	c.644G>C	c.(643-645)GGG>GCG	p.G215A	TRIM25_uc010dcj.2_Missense_Mutation_p.G7A	NM_005082	NP_005073	Q14258	TRI25_HUMAN	tripartite motif-containing 25	215	Interaction with influenza A virus NS1.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|response to virus	cell junction|cytosol|nucleus	sequence-specific DNA binding transcription factor activity|ubiquitin-protein ligase activity|zinc ion binding			lung(1)|breast(1)|skin(1)	3	Breast(9;6.15e-08)					TCTCGACGCCCCGTTGATCTG	0.582													48	69	---	---	---	---	PASS
RAD51C	5889	broad.mit.edu	37	17	56774141	56774141	+	Silent	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56774141T>C	uc002iwu.2	+	3	534	c.492T>C	c.(490-492)TTT>TTC	p.F164F	RAD51C_uc010woa.1_Silent_p.F164F|RAD51C_uc010ddc.2_RNA|RAD51C_uc002iwv.2_Intron|RAD51C_uc002iww.2_Intron|RAD51C_uc010wob.1_RNA	NM_058216	NP_478123	O43502	RA51C_HUMAN	RAD51 homolog C isoform 1	164					blood coagulation|DNA repair	mitochondrion|nucleoplasm|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGGAAGTTTTATGGTTGATA	0.423								Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2				95	83	---	---	---	---	PASS
OTOP3	347741	broad.mit.edu	37	17	72942918	72942918	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72942918T>C	uc010wrr.1	+	6	968	c.968T>C	c.(967-969)ATG>ACG	p.M323T	OTOP3_uc010wrq.1_Missense_Mutation_p.M305T	NM_178233	NP_839947	Q7RTS5	OTOP3_HUMAN	otopetrin 3	323						integral to membrane|intracellular	zinc ion binding			ovary(1)	1	all_lung(278;0.151)|Lung NSC(278;0.185)					GCACCCCACATGGGTGCCCAC	0.632													80	180	---	---	---	---	PASS
TRIM65	201292	broad.mit.edu	37	17	73887267	73887267	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73887267G>T	uc002jpx.2	-	6	1183	c.1147C>A	c.(1147-1149)CAC>AAC	p.H383N		NM_173547	NP_775818	Q6PJ69	TRI65_HUMAN	tripartite motif-containing 65	383	B30.2/SPRY.					intracellular	zinc ion binding				0			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGTAGTGGTGCCCGGCCTGG	0.672													6	52	---	---	---	---	PASS
SEPT9	10801	broad.mit.edu	37	17	75471826	75471826	+	Intron	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75471826C>T	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc002jtx.1_Intron|SEPT9_uc010wtl.1_Intron|SEPT9_uc002jty.3_Intron|SEPT9_uc010wtm.1_Intron|SEPT9_uc010wtn.1_Intron|SEPT9_uc010dhd.2_Missense_Mutation_p.R76W	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			CTGTAGATGCCGGCAGCTTTC	0.657													7	27	---	---	---	---	PASS
TNRC6C	57690	broad.mit.edu	37	17	76079209	76079209	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76079209C>T	uc002jud.2	+	12	4039	c.3439C>T	c.(3439-3441)CAT>TAT	p.H1147Y	TNRC6C_uc002juf.2_Missense_Mutation_p.H1144Y	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2	1147					gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TAATCCTCAACATATGACGAT	0.463													49	42	---	---	---	---	PASS
ACTG1	71	broad.mit.edu	37	17	79478446	79478446	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79478446C>T	uc002kaj.1	-	3	595	c.570G>A	c.(568-570)ATG>ATA	p.M190I	ACTG1_uc002kah.1_Missense_Mutation_p.M68I|ACTG1_uc002kai.1_Missense_Mutation_p.M147I|ACTG1_uc002kak.1_Missense_Mutation_p.M190I|ACTG1_uc010wun.1_Missense_Mutation_p.M190I|ACTG1_uc002kal.1_Missense_Mutation_p.M190I|ACTG1_uc002kag.2_RNA	NM_001614	NP_001605	P63261	ACTG_HUMAN	actin, gamma 1 propeptide	190					adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol	ATP binding|identical protein binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			TGAGGATCTTCATGAGGTAGT	0.642													26	59	---	---	---	---	PASS
RAB12	201475	broad.mit.edu	37	18	8609959	8609959	+	Intron	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8609959C>T	uc002knp.2	+						RAB12_uc002kno.1_Silent_p.G174G	NM_001025300	NP_001020471	Q6IQ22	RAB12_HUMAN	RAB12, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding				0						TGGGTAAGGGCGCCACGGCGA	0.687													12	2	---	---	---	---	PASS
IMPA2	3613	broad.mit.edu	37	18	11999053	11999053	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11999053A>G	uc002kqp.1	+	2	311	c.97A>G	c.(97-99)ATC>GTC	p.I33V	IMPA2_uc002kqo.1_5'UTR|IMPA2_uc010dlb.1_5'UTR|IMPA2_uc002kqq.1_5'UTR	NM_014214	NP_055029	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	33					inositol phosphate dephosphorylation|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(2)	2					Lithium(DB01356)	TTTATTTCAGATCATCAGAAA	0.423													56	17	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22806433	22806433	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806433G>A	uc002kvk.2	-	4	1696	c.1449C>T	c.(1447-1449)TCC>TCT	p.S483S	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.S483S|ZNF521_uc002kvl.2_Silent_p.S263S	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	483	C2H2-type 11.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGACAACTTCGGAACAGAAGT	0.443			T	PAX5	ALL								37	64	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31318937	31318937	+	Silent	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31318937A>G	uc010dmg.1	+	11	1624	c.1569A>G	c.(1567-1569)TCA>TCG	p.S523S	ASXL3_uc002kxq.2_Silent_p.S230S	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	523					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						AAGGGAAGTCAGAATCACCCC	0.393													11	10	---	---	---	---	PASS
SEC11C	90701	broad.mit.edu	37	18	56823121	56823121	+	Intron	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56823121C>T	uc002lht.2	+						SEC11C_uc010xej.1_3'UTR	NM_033280	NP_150596	Q9BY50	SC11C_HUMAN	SEC11-like 3						energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	endoplasmic reticulum membrane|integral to membrane|microsome	serine-type peptidase activity				0		Colorectal(73;0.175)				GCTAATGAGTCGTTAATTACA	0.318													13	5	---	---	---	---	PASS
EBI3	10148	broad.mit.edu	37	19	4236932	4236932	+	Splice_Site	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4236932G>A	uc002lzu.2	+	5	546	c.538_splice	c.e5-1	p.V180_splice		NM_005755	NP_005746	Q14213	IL27B_HUMAN	Epstein-Barr virus induced 3 precursor						humoral immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of interferon-gamma biosynthetic process|T-helper 1 type immune response	extracellular space|plasma membrane	cytokine activity|cytokine receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0336)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTTCTCTCAGGTGGGGCCCA	0.622													3	65	---	---	---	---	PASS
WDR88	126248	broad.mit.edu	37	19	33663289	33663289	+	Silent	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33663289T>C	uc002nui.2	+	10	1263	c.1185T>C	c.(1183-1185)ATT>ATC	p.I395I		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	395	WD 7.									ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					TTGAAGAAATTGATGAAATTC	0.323													74	35	---	---	---	---	PASS
ZNF829	374899	broad.mit.edu	37	19	37383113	37383113	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37383113T>G	uc002ofa.1	-	6	942	c.580A>C	c.(580-582)AGT>CGT	p.S194R	ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	194	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAGCCACGACTAAAGGACTTC	0.368													24	105	---	---	---	---	PASS
PAF1	54623	broad.mit.edu	37	19	39877398	39877398	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39877398G>A	uc002old.2	-	12	1203	c.1028C>T	c.(1027-1029)TCA>TTA	p.S343L	PAF1_uc002ole.1_Missense_Mutation_p.S333L|PAF1_uc010xuv.1_RNA	NM_019088	NP_061961	Q8N7H5	PAF1_HUMAN	Paf1, RNA polymerase II associated factor,	343					histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			pancreas(1)	1	all_cancers(60;9.14e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			GTTGGTGCCTGACTGAACCCC	0.567													60	230	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45867687	45867687	+	Missense_Mutation	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45867687T>C	uc002pbj.2	-	8	760	c.713A>G	c.(712-714)AAC>AGC	p.N238S	ERCC2_uc002pbi.2_5'Flank|ERCC2_uc010ejz.2_Missense_Mutation_p.N160S|ERCC2_uc002pbk.2_Missense_Mutation_p.N214S|ERCC2_uc002pbl.3_Missense_Mutation_p.N214S|ERCC2_uc010xxj.1_Intron	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent	238	Helicase ATP-binding.				cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CTCACCAATGTTGTGGGCCTC	0.637			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				11	6	---	---	---	---	PASS
PIH1D1	55011	broad.mit.edu	37	19	49950297	49950297	+	Missense_Mutation	SNP	A	G	G	rs17844886		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49950297A>G	uc002pns.2	-	7	955	c.671T>C	c.(670-672)GTT>GCT	p.V224A	uc002pnr.1_5'Flank	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN	NOP17	224					box C/D snoRNP assembly	pre-snoRNP complex					0		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		GGGGAGGTCAACTTCGGCCAA	0.592													102	47	---	---	---	---	PASS
ZSCAN5A	79149	broad.mit.edu	37	19	56733066	56733066	+	Nonsense_Mutation	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56733066C>A	uc002qmq.2	-	5	1535	c.1369G>T	c.(1369-1371)GAG>TAG	p.E457*	ZSCAN5A_uc010ygi.1_Nonsense_Mutation_p.E340*|ZSCAN5A_uc002qmr.2_Nonsense_Mutation_p.E457*|ZSCAN5A_uc002qms.1_Nonsense_Mutation_p.E456*	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	457	C2H2-type 4.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						CGCTGGTGCTCCTTCAGGCTC	0.498													22	90	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58619360	58619360	+	Intron	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58619360A>G	uc010yht.1	-						ZSCAN18_uc002qrm.2_RNA	NM_001145542	NP_001139014	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		AAAGTTTGACACTGGTTACAG	0.468													3	12	---	---	---	---	PASS
ZNF324	25799	broad.mit.edu	37	19	58982236	58982236	+	Missense_Mutation	SNP	G	C	C	rs145109076	byFrequency	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58982236G>C	uc002qsw.1	+	4	471	c.377G>C	c.(376-378)CGG>CCG	p.R126P	ZNF324_uc002qsx.1_5'Flank	NM_014347	NP_055162	O75467	Z324A_HUMAN	zinc finger protein 324	126					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CAGAGACAACGGGGTGCCTCC	0.607													17	112	---	---	---	---	PASS
TGM3	7053	broad.mit.edu	37	20	2315885	2315885	+	Missense_Mutation	SNP	A	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2315885A>T	uc002wfx.3	+	11	1863	c.1766A>T	c.(1765-1767)GAC>GTC	p.D589V		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	589					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	GTGGAGCGGGACATCATCCTG	0.602													8	64	---	---	---	---	PASS
ID1	3397	broad.mit.edu	37	20	30193120	30193120	+	5'UTR	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30193120C>T	uc002wwg.1	+	1					ID1_uc002wwh.1_5'UTR|hsa-mir-3193|MI0014238_5'Flank	NM_002165	NP_002156	P41134	ID1_HUMAN	inhibitor of DNA binding 1 isoform a						angiogenesis|blood vessel endothelial cell migration|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by transcription factor localization|transforming growth factor beta receptor signaling pathway	cytoplasm	protein binding			ovary(1)	1	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TTCCATTTTCCGTATCTGCTT	0.537													9	23	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47888256	47888256	+	Silent	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47888256A>G	uc002xui.2	-	3	340	c.93T>C	c.(91-93)GCT>GCC	p.A31A		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	31							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CCTGATTTCTAGCTCTTGGTG	0.507													29	37	---	---	---	---	PASS
ZNF217	7764	broad.mit.edu	37	20	52192283	52192283	+	Missense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52192283G>A	uc002xwq.3	-	3	3291	c.3020C>T	c.(3019-3021)TCC>TTC	p.S1007F	ZNF217_uc010gij.1_Missense_Mutation_p.S999F	NM_006526	NP_006517	O75362	ZN217_HUMAN	zinc finger protein 217	1007					negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CGTCGAGCTGGATGCTGGACT	0.448													16	36	---	---	---	---	PASS
PPP1R3D	5509	broad.mit.edu	37	20	58514308	58514308	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58514308C>T	uc002ybb.2	-	1	1045	c.679G>A	c.(679-681)GCA>ACA	p.A227T	C20orf177_uc002yba.2_Intron|C20orf177_uc010zzx.1_5'Flank|C20orf177_uc002ybc.2_5'Flank	NM_006242	NP_006233	O95685	PPR3D_HUMAN	protein phosphatase 1, regulatory subunit 3D	227	CBM21.				glycogen metabolic process		protein binding|protein serine/threonine phosphatase activity				0	all_lung(29;0.00391)		BRCA - Breast invasive adenocarcinoma(7;5.12e-09)			TCGGGGCCTGCGGGCCCGCGC	0.692													12	34	---	---	---	---	PASS
ADRM1	11047	broad.mit.edu	37	20	60883123	60883123	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60883123C>T	uc002ycn.2	+	8	983	c.903C>T	c.(901-903)CTC>CTT	p.L301L	ADRM1_uc002yco.2_Silent_p.L301L	NM_007002	NP_008933	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1 precursor	301					proteasome assembly|transcription elongation from RNA polymerase II promoter	cytoplasm|integral to plasma membrane|membrane fraction|nucleus|proteasome complex	endopeptidase activator activity|protease binding|proteasome binding				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			CTCCCATCCTCGCCAACGCGG	0.627													9	11	---	---	---	---	PASS
C20orf20	55257	broad.mit.edu	37	20	61428545	61428545	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61428545T>G	uc002ydi.2	+	2	303	c.232T>G	c.(232-234)TGG>GGG	p.W78G		NM_018270	NP_060740	Q9NV56	MRGBP_HUMAN	MRG-binding protein	78					chromatin modification|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	H4/H2A histone acetyltransferase complex					0	Breast(26;3.65e-08)					CAAGGTCATCTGGGACCATCT	0.622													9	46	---	---	---	---	PASS
OGFR	11054	broad.mit.edu	37	20	61445149	61445149	+	3'UTR	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61445149C>G	uc002ydj.2	+	7					OGFR_uc002ydk.2_3'UTR|OGFR_uc002ydl.2_3'UTR|uc011aam.1_5'Flank	NM_007346	NP_031372	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor						regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)					GCCACTATAGCAGCCACCAGA	0.692													6	4	---	---	---	---	PASS
CRYZL1	9946	broad.mit.edu	37	21	34994369	34994369	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34994369C>T	uc011adw.1	-	4	330	c.150G>A	c.(148-150)CTG>CTA	p.L50L	DONSON_uc002ysn.1_Intron|CRYZL1_uc002ysr.1_Silent_p.L74L|CRYZL1_uc002yss.1_RNA|CRYZL1_uc002yst.1_RNA|CRYZL1_uc002ysu.2_Silent_p.L50L	NM_145858	NP_665857	O95825	QORL1_HUMAN	crystallin, zeta-like 1	50					quinone cofactor metabolic process	cytosol	NADP binding|NADPH:quinone reductase activity|zinc ion binding				0						TCATTTCTGCCAGAAGCTAAA	0.338													50	90	---	---	---	---	PASS
B3GALT5	10317	broad.mit.edu	37	21	41032664	41032664	+	Missense_Mutation	SNP	G	C	C	rs146778477		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41032664G>C	uc002yyb.1	+	5	770	c.178G>C	c.(178-180)GTC>CTC	p.V60L	B3GALT5_uc002yye.2_Missense_Mutation_p.V60L|B3GALT5_uc002yyi.1_Missense_Mutation_p.V60L|B3GALT5_uc002yyj.1_Missense_Mutation_p.V60L|B3GALT5_uc002yyk.1_Missense_Mutation_p.V60L|B3GALT5_uc002yyl.1_Missense_Mutation_p.V60L|B3GALT5_uc002yym.1_Missense_Mutation_p.V60L	NM_033173	NP_149363	Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta	60	Lumenal (Potential).				protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1		Prostate(19;2.55e-06)				TCCCTTCCTCGTCCTGCTGGT	0.522													12	113	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	18846140	18846140	+	RNA	SNP	T	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18846140T>C	uc002zoe.2	+	5		c.2502T>C			uc002zof.2_5'Flank					Homo sapiens cDNA FLJ76361 complete cds.																		TAGGGCACCTTGGACCTCTCT	0.617													6	30	---	---	---	---	PASS
ARVCF	421	broad.mit.edu	37	22	19961220	19961220	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19961220C>T	uc002zqz.2	-	13	2456	c.2185G>A	c.(2185-2187)GTC>ATC	p.V729I	ARVCF_uc002zqy.2_Missense_Mutation_p.V245I	NM_001670	NP_001661	O00192	ARVC_HUMAN	armadillo repeat protein	729	ARM 8.				cell adhesion|multicellular organismal development		protein binding			liver(1)	1	Colorectal(54;0.0993)					GCGATGGCGACGGCGCGCACC	0.662													20	150	---	---	---	---	PASS
SERPIND1	3053	broad.mit.edu	37	22	21133553	21133553	+	Intron	SNP	C	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21133553C>G	uc002ztb.1	+						PI4KA_uc002zsz.3_Intron|SERPIND1_uc002ztc.2_Missense_Mutation_p.R13G	NM_000185	NP_000176	P05546	HEP2_HUMAN	heparin cofactor II precursor						blood coagulation|chemotaxis|regulation of proteolysis	extracellular region	heparin binding|serine-type endopeptidase inhibitor activity				0	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)	TCAGCCAGGCCGCCTTTCACT	0.498													14	38	---	---	---	---	PASS
PI4KAP2	375133	broad.mit.edu	37	22	21829555	21829555	+	Missense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21829555T>G	uc002zuv.3	-	14	3847	c.1588A>C	c.(1588-1590)ATC>CTC	p.I530L	PI4KAP2_uc002zuw.2_Intron|PI4KAP2_uc011aid.1_Intron					SubName: Full=Putative uncharacterized protein PI4KA;												0						TCCAACATGATAGTGACCAGG	0.607													3	2	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36697582	36697582	+	Nonsense_Mutation	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36697582G>A	uc003apg.2	-	21	2860	c.2629C>T	c.(2629-2631)CAG>TAG	p.Q877*	MYH9_uc003aph.1_Nonsense_Mutation_p.Q741*	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	877	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						ACACCCACCTGAGACTGCAGC	0.607			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated		OREG0026520	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	56	---	---	---	---	PASS
GTPBP1	9567	broad.mit.edu	37	22	39126720	39126720	+	3'UTR	SNP	G	C	C			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39126720G>C	uc003awg.2	+	12						NM_004286	NP_004277	O00178	GTPB1_HUMAN	GTP binding protein 1						immune response|positive regulation of mRNA catabolic process|signal transduction	cytoplasmic exosome (RNase complex)|cytosol	GTP binding|GTPase activity			ovary(1)	1	Melanoma(58;0.04)					ACCTTCCCCTGGCCCACCCTC	0.677													6	15	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41553195	41553195	+	Missense_Mutation	SNP	G	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41553195G>T	uc003azl.3	+	18	3679	c.3284G>T	c.(3283-3285)AGC>ATC	p.S1095I		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1095	Bromo.				apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						ATTGTGAAGAGCCCCATGGAT	0.393			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				19	29	---	---	---	---	PASS
POLR3H	171568	broad.mit.edu	37	22	41928097	41928097	+	Splice_Site	SNP	C	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41928097C>A	uc003baf.2	-	5	419	c.359_splice	c.e5+1	p.F120_splice	POLR3H_uc003bae.2_Splice_Site|POLR3H_uc003bag.2_Splice_Site_p.F120_splice|POLR3H_uc003bai.2_Splice_Site_p.F91_splice	NM_138338	NP_612211	Q9Y535	RPC8_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity			skin(1)	1						TTGGAGGATACAACTTGGCTG	0.557													22	28	---	---	---	---	PASS
PMM1	5372	broad.mit.edu	37	22	41980552	41980552	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41980552G>A	uc003bal.2	-	3	323	c.261C>T	c.(259-261)CAC>CAT	p.H87H		NM_002676	NP_002667	Q92871	PMM1_HUMAN	phosphomannomutase 1	87					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	metal ion binding|phosphomannomutase activity			ovary(1)	1						GCAGTCGTCCGTGCTTATACT	0.552													51	36	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50563824	50563824	+	Silent	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50563824C>T	uc003bjj.2	+	11	1656	c.1573C>T	c.(1573-1575)CTG>TTG	p.L525L	MOV10L1_uc003bjk.3_Silent_p.L525L|MOV10L1_uc011arp.1_Silent_p.L505L|MOV10L1_uc011arq.1_Silent_p.L286L|MOV10L1_uc010hao.1_RNA	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	525					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TTTCCAGCTTCTGAACATGTC	0.438													34	11	---	---	---	---	PASS
MSL3	10943	broad.mit.edu	37	X	11783848	11783848	+	Missense_Mutation	SNP	A	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11783848A>G	uc004cuw.2	+	9	1276	c.1171A>G	c.(1171-1173)AAG>GAG	p.K391E	MSL3_uc004cuv.1_Missense_Mutation_p.S391G|MSL3_uc004cux.2_Missense_Mutation_p.K332E|MSL3_uc011mig.1_Missense_Mutation_p.K242E|MSL3_uc011mih.1_Missense_Mutation_p.K379E|MSL3_uc004cuy.2_Missense_Mutation_p.K225E	NM_078629	NP_523353	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3-like 1 isoform a	391					histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCTGGAAAAGAGTAGGTTCAT	0.582													39	39	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44922802	44922802	+	Nonsense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44922802C>T	uc004dge.3	+	16	2038	c.1663C>T	c.(1663-1665)CAG>TAG	p.Q555*	KDM6A_uc010nhk.2_Nonsense_Mutation_p.Q521*|KDM6A_uc011mkz.1_Nonsense_Mutation_p.Q607*|KDM6A_uc011mla.1_Nonsense_Mutation_p.Q510*|KDM6A_uc011mlb.1_Nonsense_Mutation_p.Q562*|KDM6A_uc011mlc.1_Nonsense_Mutation_p.Q259*|KDM6A_uc011mld.1_Nonsense_Mutation_p.Q194*	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	555					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						TAGCGTCTCTCAGCCTGGAGT	0.567			D|N|F|S		renal|oesophageal SCC|MM								13	9	---	---	---	---	PASS
VSIG4	11326	broad.mit.edu	37	X	65242174	65242174	+	Silent	SNP	G	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65242174G>A	uc004dwh.2	-	8	1258	c.1131C>T	c.(1129-1131)TAC>TAT	p.Y377Y	VSIG4_uc004dwi.2_Silent_p.Y283Y|VSIG4_uc010nkq.1_3'UTR|VSIG4_uc004dwj.2_3'UTR|VSIG4_uc011moy.1_3'UTR|VSIG4_uc004dwk.2_3'UTR|VSIG4_uc004dwl.2_Intron	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	377	Cytoplasmic (Potential).				complement activation, alternative pathway	integral to membrane	protein binding				0						GCAGGCGGGCGTAGTTGCCAT	0.517													7	14	---	---	---	---	PASS
OGT	8473	broad.mit.edu	37	X	70784470	70784470	+	Missense_Mutation	SNP	C	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70784470C>T	uc004eaa.1	+	19	2673	c.2456C>T	c.(2455-2457)ACT>ATT	p.T819I	BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Missense_Mutation_p.T809I|OGT_uc004eac.2_Missense_Mutation_p.T680I|OGT_uc004ead.2_Missense_Mutation_p.T438I	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1	819					cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)					AAGGCTGCAACTGGAGAGGAG	0.368													15	14	---	---	---	---	PASS
TAF7L	54457	broad.mit.edu	37	X	100532627	100532627	+	Missense_Mutation	SNP	T	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100532627T>A	uc004ehb.2	-	9	928	c.916A>T	c.(916-918)ATG>TTG	p.M306L	TAF7L_uc004eha.2_Missense_Mutation_p.M220L|TAF7L_uc004ehc.1_Missense_Mutation_p.M220L	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	306					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						TGGCTGCTCATTCCCGAGGAT	0.458													69	38	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135428141	135428141	+	Nonsense_Mutation	SNP	T	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135428141T>G	uc004ezu.1	+	6	2567	c.2276T>G	c.(2275-2277)TTA>TGA	p.L759*	GPR112_uc010nsb.1_Nonsense_Mutation_p.L554*|GPR112_uc010nsc.1_Nonsense_Mutation_p.L526*	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	759	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					CTTACCACTTTACTACTAAAA	0.358													23	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	20200621	20200623	+	IGR	DEL	CAC	-	-	rs144954291		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20200621_20200623delCAC								RNF186 (58850 upstream) : OTUD3 (8265 downstream)																							ccaccaccatcaccaccaccacc	0.202													5	4	---	---	---	---	
C1orf135	79000	broad.mit.edu	37	1	26186959	26186960	+	5'Flank	INS	-	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26186959_26186960insT	uc001bkw.1	-							NM_024037	NP_076942	Q9H7T9	CA135_HUMAN	aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AAATTTTGTAATTTTTTTTTTT	0.272													4	3	---	---	---	---	
JAK1	3716	broad.mit.edu	37	1	65306879	65306896	+	Intron	DEL	ATGGCGGAGGGCTCTGCC	-	-	rs5774724		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65306879_65306896delATGGCGGAGGGCTCTGCC	uc001dbu.1	-						JAK1_uc009wam.1_Intron|JAK1_uc009wal.1_Intron	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		GGCGCTGTGGATGGCGGAGGGCTCTGCCATCAGCAGCA	0.546			Mis		ALL								31	12	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145298623	145298630	+	Intron	DEL	ATGGTGCT	-	-	rs66470618		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145298623_145298630delATGGTGCT	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ttaggcaggcatggtgctgcacgcctat	0.111													4	2	---	---	---	---	
RABGAP1L	9910	broad.mit.edu	37	1	174671596	174671596	+	Intron	DEL	A	-	-	rs11296570		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174671596delA	uc001gjx.2	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gkd.3_Intron	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						TAAGGCATATATAATTCCTAC	0.229													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237819091	237819091	+	Intron	DEL	T	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237819091delT	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CATATAGTAATTTTTTTTTTT	0.418													6	3	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237972206	237972209	+	Frame_Shift_Del	DEL	ATTA	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237972206_237972209delATTA	uc001hyl.1	+	100	14424_14427	c.14304_14307delATTA	c.(14302-14307)GTATTAfs	p.V4768fs	RYR2_uc010pyb.1_Frame_Shift_Del_p.V201fs	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4768_4769	Helical; Name=M8; (Potential).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCCAGCTCGTATTAACCGTTGGCT	0.407													306	46	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132768083	132768084	+	IGR	INS	-	G	G	rs111469343	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132768083_132768084insG								C2orf27B (208849 upstream) : NCRNA00164 (137080 downstream)																							TCTTGATGTTAACTATcagctg	0.218													2	5	---	---	---	---	
RBM44	375316	broad.mit.edu	37	2	238726935	238726943	+	In_Frame_Del	DEL	CAAGTTGTA	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238726935_238726943delCAAGTTGTA	uc002vxi.3	+	3	1508_1516	c.1376_1384delCAAGTTGTA	c.(1375-1386)GCAAGTTGTACA>GCA	p.SCT460del		NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	459_461							nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		ACAGATGCAGCAAGTTGTACAGTCACAAT	0.397													65	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128164636	128164638	+	IGR	DEL	TGA	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128164636_128164638delTGA								EEFSEC (37148 upstream) : DNAJB8 (16644 downstream)																							gtggtggtggtgatgatggtggt	0.000													2	4	---	---	---	---	
GATA2	2624	broad.mit.edu	37	3	128200555	128200559	+	Intron	DEL	CCCAA	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128200555_128200559delCCCAA	uc003ekm.3	-						GATA2_uc003ekn.3_Intron|GATA2_uc003eko.2_Intron	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1						blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		GCAGCAGCTTCCCAAGCCAAGCCAA	0.668			Mis		AML(CML blast transformation)								5	3	---	---	---	---	
SDHAP2	727956	broad.mit.edu	37	3	195400918	195400919	+	Intron	INS	-	T	T	rs138187538	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195400918_195400919insT	uc003fuw.2	+						SDHAP2_uc011btc.1_Intron|SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AGTCttttttctttttttttga	0.252													8	4	---	---	---	---	
PAK2	5062	broad.mit.edu	37	3	196538099	196538099	+	Intron	DEL	C	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196538099delC	uc003fwy.3	+							NM_002577	NP_002568	Q13177	PAK2_HUMAN	p21-activated kinase 2						axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity			ovary(1)|lung(1)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		tccctcccttcccttcccttc	0.114													3	3	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48537632	48537633	+	Intron	DEL	AT	-	-	rs78674320	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48537632_48537633delAT	uc003gyh.1	-						FRYL_uc003gyg.1_Intron|FRYL_uc003gyi.1_Intron|FRYL_uc003gyj.1_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						acacacacacatatatatataG	0.213													6	5	---	---	---	---	
IGJ	3512	broad.mit.edu	37	4	71521932	71521932	+	3'UTR	DEL	A	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71521932delA	uc003hfn.3	-	4					IGJ_uc010ihz.2_3'UTR	NM_144646	NP_653247	P01591	IGJ_HUMAN	immunoglobulin J chain						immune response	extracellular region	antigen binding				0			Lung(101;0.235)			TACATCACCCAAAAAAAAAAA	0.308													7	5	---	---	---	---	
DDX60	55601	broad.mit.edu	37	4	169194907	169194908	+	Intron	DEL	TG	-	-	rs144885399		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169194907_169194908delTG	uc003irp.2	-							NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		tgtacatgtttgtgtgtgtgtg	0.203													1	5	---	---	---	---	
HCN1	348980	broad.mit.edu	37	5	45303603	45303608	+	Intron	DEL	CAAAAC	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45303603_45303608delCAAAAC	uc003jok.2	-							NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic							integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GGTTTACATTCAAAACCAAAAAACTG	0.330													6	12	---	---	---	---	
MRPS36	92259	broad.mit.edu	37	5	68524875	68524875	+	Intron	DEL	G	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68524875delG	uc003jvq.2	+						MRPS36_uc003jvr.2_Intron	NM_033281	NP_150597	P82909	RT36_HUMAN	mitochondrial ribosomal protein S36						translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.04e-56)|Epithelial(20;8.79e-53)|all cancers(19;2.01e-48)|Lung(70;0.0176)		aaaaaaaaaagaaTTGATATG	0.119													4	2	---	---	---	---	
FAM172A	83989	broad.mit.edu	37	5	93386302	93386303	+	Intron	INS	-	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93386302_93386303insA	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Intron	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0						TAAAAAGGAACAAAAAAAAAAA	0.213													4	4	---	---	---	---	
ERAP2	64167	broad.mit.edu	37	5	96219739	96219750	+	Intron	DEL	TATCTATCTATC	-	-	rs146256833		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96219739_96219750delTATCTATCTATC	uc003kmq.2	+						uc003kmo.1_Intron|ERAP2_uc003kmt.2_Intron|ERAP2_uc003kmr.2_Intron|ERAP2_uc003kms.2_Intron|ERAP2_uc003kmu.2_Intron	NM_022350	NP_071745	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2						antigen processing and presentation of endogenous peptide antigen via MHC class I|proteolysis|regulation of blood pressure	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding				0		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		AATTTGTTTTtatctatctatctatctatcta	0.259													5	7	---	---	---	---	
CSNK1A1	1452	broad.mit.edu	37	5	148884875	148884875	+	Intron	DEL	T	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148884875delT	uc003lqx.1	-						CSNK1A1_uc011dcb.1_Intron|CSNK1A1_uc011dcc.1_Intron|CSNK1A1_uc003lqv.1_Intron|CSNK1A1_uc003lqw.1_Intron|CSNK1A1_uc003lqy.1_Intron|CSNK1A1_uc010jha.1_Intron	NM_001892	NP_001883	P48729	KC1A_HUMAN	casein kinase 1, alpha 1 isoform 2						cell division|mitosis|Wnt receptor signaling pathway	centrosome|condensed chromosome kinetochore|cytosol|nuclear speck	ATP binding|protein binding|protein binding|protein serine/threonine kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		CAAGGACGTCTTTTTTTTTTT	0.224													4	2	---	---	---	---	
HK3	3101	broad.mit.edu	37	5	176308405	176308406	+	Frame_Shift_Ins	INS	-	C	C	rs145283059		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176308405_176308406insC	uc003mfa.2	-	18	2616_2617	c.2524_2525insG	c.(2524-2526)GCGfs	p.A842fs	HK3_uc003mez.2_Frame_Shift_Ins_p.A398fs	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3	842	Catalytic.				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCTACACCCGCCCCACAGAGC	0.639													29	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58779178	58779179	+	IGR	INS	-	CA	CA	rs4382311		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58779178_58779179insCA								GUSBL2 (491454 upstream) : None (None downstream)																							tggctgcattccacacacacgg	0.000													787	11	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	66012440	66012441	+	Intron	INS	-	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66012440_66012441insT	uc011dxu.1	-						uc011dxv.1_Frame_Shift_Ins_p.Y9fs	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						GAAGACTGCTATTTTTTTTTCT	0.446													4	2	---	---	---	---	
ZNF292	23036	broad.mit.edu	37	6	87955207	87955207	+	Intron	DEL	T	-	-	rs72438234		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87955207delT	uc003plm.3	+							NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TTATTATAACTTTTTTTTTTT	0.308													6	3	---	---	---	---	
SGK1	6446	broad.mit.edu	37	6	134493873	134493887	+	In_Frame_Del	DEL	GTTCCAGGAAGCAGC	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134493873_134493887delGTTCCAGGAAGCAGC	uc003qen.3	-	7	664_678	c.575_589delGCTGCTTCCTGGAAC	c.(574-591)CGCTGCTTCCTGGAACCA>CCA	p.RCFLE192del	SGK1_uc003qeo.3_In_Frame_Del_p.RCFLE287del|SGK1_uc011ect.1_In_Frame_Del_p.RCFLE182del|SGK1_uc011ecu.1_In_Frame_Del_p.RCFLE148del|SGK1_uc011ecv.1_In_Frame_Del_p.RCFLE206del|SGK1_uc011ecw.1_In_Frame_Del_p.RCFLE220del	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	192_196	Protein kinase.			E -> G (in Ref. 4; CAR58095).	apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CGAGCCCGTGGTTCCAGGAAGCAGCGTTCCCTCTG	0.460													28	13	---	---	---	---	
C7orf26	79034	broad.mit.edu	37	7	6646327	6646328	+	Intron	DEL	TT	-	-	rs67788546		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6646327_6646328delTT	uc003sqo.1	+						C7orf26_uc003sqp.1_Intron|C7orf26_uc003sqq.1_Intron	NM_024067	NP_076972	Q96N11	CG026_HUMAN	hypothetical protein LOC79034											ovary(1)	1		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		CCAGAGGGCCtttttttttttt	0.332													3	5	---	---	---	---	
CDK13	8621	broad.mit.edu	37	7	40027759	40027772	+	Frame_Shift_Del	DEL	AGGAGCCAAGGAGA	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40027759_40027772delAGGAGCCAAGGAGA	uc003thh.3	+	2	2055_2068	c.1773_1786delAGGAGCCAAGGAGA	c.(1771-1788)ATAGGAGCCAAGGAGAAGfs	p.I591fs	CDK13_uc003thi.3_Frame_Shift_Del_p.I591fs|CDK13_uc011kbf.1_5'UTR	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	591_596					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						CACCAAGCATAGGAGCCAAGGAGAAGGAGCAACA	0.430													40	12	---	---	---	---	
PKD1L1	168507	broad.mit.edu	37	7	47921350	47921351	+	Intron	INS	-	AG	AG			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47921350_47921351insAG	uc003tny.1	-							NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						AGAAGAGTCTCAGGCCATAGTC	0.426													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61968770	61968770	+	IGR	DEL	G	-	-	rs61713499		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61968770delG								None (None upstream) : LOC643955 (782902 downstream)																							ttgaaacactgtttttgcgga	0.000													512	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61970472	61970472	+	IGR	DEL	C	-	-	rs4302722		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61970472delC								None (None upstream) : LOC643955 (781200 downstream)																							ttgaaacactctttttgcgga	0.000													1018	18	---	---	---	---	
AASS	10157	broad.mit.edu	37	7	121719810	121719810	+	Intron	DEL	T	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121719810delT	uc003vka.2	-						AASS_uc011knu.1_Intron|AASS_uc011knv.1_Intron|AASS_uc003vkb.2_Intron|AASS_uc011knw.1_Intron	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor						protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	CCCTAACAAATTTTTTTTTAA	0.294													17	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61850546	61850552	+	IGR	DEL	GCAATCA	-	-	rs146762178	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61850546_61850552delGCAATCA								CHD7 (71083 upstream) : CLVS1 (349973 downstream)																							CTTTCTACTGGCAATCAGGAGACTGAA	0.478													27	30	---	---	---	---	
UBE2W	55284	broad.mit.edu	37	8	74782627	74782627	+	Intron	DEL	G	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74782627delG	uc003xzv.2	-						UBE2W_uc003xzt.2_Intron|UBE2W_uc003xzu.2_Intron|UBE2W_uc003xzw.2_Intron	NM_018299	NP_060769	Q96B02	UBE2W_HUMAN	ubiquitin-conjugating enzyme E2W (putative)						protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)			CTAGAAATCAGAAAAAAAAAA	0.328													4	2	---	---	---	---	
NBN	4683	broad.mit.edu	37	8	90955588	90955607	+	Splice_Site	DEL	ATGTGACCTATTGAATAATA	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90955588_90955607delATGTGACCTATTGAATAATA	uc003yej.1	-	14	2181	c.2071_splice	c.e14-1	p.V691_splice	NBN_uc003yei.1_Splice_Site_p.V609_splice|NBN_uc011lgb.1_Splice_Site_p.V691_splice	NM_002485	NP_002476	O60934	NBN_HUMAN	nibrin						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding			central_nervous_system(3)|kidney(3)|lung(1)	7			BRCA - Breast invasive adenocarcinoma(11;0.0344)			GCTCCAGGATATGTGACCTATTGAATAATAAAAGTAGTAC	0.336								Direct_reversal_of_damage|Homologous_recombination	Nijmegen_Breakage_syndrome				94	45	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110460747	110460747	+	Intron	DEL	T	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460747delT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			gtttgtttggttttttttttt	0.090										HNSCC(38;0.096)			4	3	---	---	---	---	
DENND4C	55667	broad.mit.edu	37	9	19372238	19372239	+	3'UTR	INS	-	G	G			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19372238_19372239insG	uc003znq.2	+	28					DENND4C_uc011lnc.1_3'UTR|DENND4C_uc011lnd.1_3'UTR|DENND4C_uc003znr.2_3'UTR|DENND4C_uc003zns.2_3'UTR	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C							integral to membrane				ovary(1)|skin(1)	2						AACATTCAAGTTTTTTTTTCCA	0.347													61	21	---	---	---	---	
HIATL2	84278	broad.mit.edu	37	9	99734982	99734982	+	Intron	DEL	A	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99734982delA	uc004aws.2	-						HIATL2_uc004awr.1_Intron	NR_002894				RecName: Full=Hippocampus abundant transcript-like protein 2;												0						ACCACAATGGaaaaaaaaaaa	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383712	42383713	+	IGR	INS	-	A	A	rs68020006		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383712_42383713insA								None (None upstream) : LOC441666 (443602 downstream)																							caaatggaatcaaaataaccat	0.000													87	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383716	42383717	+	IGR	INS	-	G	G	rs145968937		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383716_42383717insG								None (None upstream) : LOC441666 (443598 downstream)																							tggaatcaaaataaccatcatc	0.000													84	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385250	42385250	+	IGR	DEL	A	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385250delA								None (None upstream) : LOC441666 (442065 downstream)																							aatcattatcaaatggaatcg	0.000													2478	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385707	42385722	+	IGR	DEL	AATGGAATCATCATTA	-	-	rs33914712		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385707_42385722delAATGGAATCATCATTA								None (None upstream) : LOC441666 (441593 downstream)																							aatggaatcgaatggaatcatcattaaatggaatca	0.042													179	27	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42529341	42529341	+	IGR	DEL	A	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42529341delA								None (None upstream) : LOC441666 (297974 downstream)																							agttgaatacacacaacacaa	0.000													515	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42599647	42599649	+	IGR	DEL	TCA	-	-	rs149027666		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42599647_42599649delTCA								None (None upstream) : LOC441666 (227666 downstream)																							atgaaaggagtcatcatctaatg	0.000													1985	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42599952	42599952	+	IGR	DEL	G	-	-	rs36165691		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42599952delG								None (None upstream) : LOC441666 (227363 downstream)																							atcatctaatggaatggaatg	0.000													1210	7	---	---	---	---	
BMPR1A	657	broad.mit.edu	37	10	88614690	88614691	+	Intron	INS	-	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88614690_88614691insT	uc001kdy.2	+							NM_004329	NP_004320	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA						BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8						TTttctttttcttttttttttt	0.188			Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				4	2	---	---	---	---	
C11orf9	745	broad.mit.edu	37	11	61544788	61544806	+	Frame_Shift_Del	DEL	CACAGGTGCCCGACACCGT	-	-	rs75764154	byFrequency	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61544788_61544806delCACAGGTGCCCGACACCGT	uc001nsc.1	+	12	1739_1757	c.1643_1661delCACAGGTGCCCGACACCGT	c.(1642-1662)GCACAGGTGCCCGACACCGTCfs	p.A548fs	C11orf9_uc001nse.1_Frame_Shift_Del_p.A539fs|C11orf9_uc010rll.1_5'Flank	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	548_554					central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						TGGCAGCGGGCACAGGTGCCCGACACCGTCTTCCACCAC	0.653													13	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115597853	115597854	+	IGR	INS	-	A	A			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115597853_115597854insA								CADM1 (222612 upstream) : None (None downstream)																							gggaaggaaggagggaaggaag	0.000													5	4	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178450	134178451	+	Intron	INS	-	CAC	CAC	rs140914654	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178450_134178451insCAC	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		accatcaccatcaccaccacca	0.000													3	4	---	---	---	---	
ATF7	11016	broad.mit.edu	37	12	53926424	53926424	+	Intron	DEL	A	-	-	rs111391259		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53926424delA	uc001sdy.2	-						ATF7_uc010sok.1_Intron|ATF7_uc001sdz.2_Intron|ATF7_uc010sol.1_Intron	NM_001130059	NP_001123531	P17544	ATF7_HUMAN	activating transcription factor 7 isoform 1						interspecies interaction between organisms	cytoplasm|nuclear periphery|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						CGAGAGAAGGAAAAAAAAAAA	0.493													8	7	---	---	---	---	
AVIL	10677	broad.mit.edu	37	12	58197160	58197179	+	Splice_Site	DEL	ATTTCCTGCTGAAGTCTGCA	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58197160_58197179delATTTCCTGCTGAAGTCTGCA	uc001sqj.1	-	15	1847	c.1818_splice	c.e15-1	p.R606_splice	AVIL_uc009zqe.1_Splice_Site_p.R599_splice|AVIL_uc001sqk.1_Splice_Site_p.R184_splice	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin						actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GACATCTAGGATTTCCTGCTGAAGTCTGCAATATAGTCCA	0.459											OREG0021955	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	59	34	---	---	---	---	
NUP107	57122	broad.mit.edu	37	12	69120293	69120305	+	Frame_Shift_Del	DEL	TTTAGCAAATGGC	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69120293_69120305delTTTAGCAAATGGC	uc001suf.2	+	19	1706_1718	c.1591_1603delTTTAGCAAATGGC	c.(1591-1605)TTTAGCAAATGGCTTfs	p.F531fs	NUP107_uc001sug.2_Frame_Shift_Del_p.F378fs|NUP107_uc010stj.1_Frame_Shift_Del_p.F502fs	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa	531_535					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			GATGGATGAGTTTAGCAAATGGCTTTCCAAAAG	0.352													277	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	77054675	77054676	+	IGR	INS	-	A	A	rs34680604		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77054675_77054676insA								OSBPL8 (101086 upstream) : ZDHHC17 (103178 downstream)																							TAATAGGTGttaaaaaaaaaaa	0.386													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110868215	110868216	+	IGR	DEL	GT	-	-	rs113592903		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110868215_110868216delGT								ANAPC7 (26680 upstream) : ARPC3 (4491 downstream)																							CAgtgtgtgcgtgtgtgtgtgt	0.342													4	2	---	---	---	---	
TBX5	6910	broad.mit.edu	37	12	114836462	114836462	+	Frame_Shift_Del	DEL	G	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114836462delG	uc001tvo.2	-	5	921	c.426delC	c.(424-426)CCCfs	p.P142fs	TBX5_uc001tvp.2_Frame_Shift_Del_p.P142fs|TBX5_uc001tvq.2_Frame_Shift_Del_p.P92fs|TBX5_uc010syv.1_Frame_Shift_Del_p.P142fs	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	142	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CCCCGGTGGCGGGGGAGTCTG	0.612													22	18	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965094	117965107	+	Intron	DEL	ACACACACACACAG	-	-	rs59836858		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965094_117965107delACACACACACACAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGacacacacacacacacacacagacacacacac	0.234													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124762486	124762488	+	IGR	DEL	CCT	-	-	rs56853585		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124762486_124762488delCCT								ZNF664 (262519 upstream) : FAM101A (11222 downstream)																							tctccacccccctcctcctcctc	0.261													4	2	---	---	---	---	
CDADC1	81602	broad.mit.edu	37	13	49848636	49848636	+	Intron	DEL	A	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49848636delA	uc001vcu.2	+						CDADC1_uc010tgk.1_Intron|CDADC1_uc001vcv.2_Intron	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1								hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		catctctactaaaaaaaaaaa	0.060													4	2	---	---	---	---	
SEL1L	6400	broad.mit.edu	37	14	81951795	81951796	+	Intron	INS	-	T	T	rs148050335		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81951795_81951796insT	uc010tvv.1	-							NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor						Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		aattttttttgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98311208	98311211	+	IGR	DEL	GAAG	-	-	rs111619571	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98311208_98311211delGAAG								VRK1 (963258 upstream) : C14orf64 (80736 downstream)																							aggaaggaaagaaggaaggaagga	0.123													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31136397	31136400	+	IGR	DEL	TTTG	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31136397_31136400delTTTG								ARHGAP11B (158588 upstream) : MTMR15 (59655 downstream)																							TCTATTTGTCTTTGTTTGTTTTAA	0.358													28	8	---	---	---	---	
CHP	11261	broad.mit.edu	37	15	41555240	41555241	+	Intron	INS	-	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41555240_41555241insT	uc001znl.2	+							NM_007236	NP_009167	Q99653	CHP1_HUMAN	calcium binding protein P22						potassium ion transport|small GTPase mediated signal transduction		potassium channel regulator activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;5.87e-16)|Lung NSC(122;8.86e-12)|all_lung(180;2.47e-10)|Melanoma(134;0.0574)|Colorectal(260;0.0946)|Ovarian(310;0.143)		GBM - Glioblastoma multiforme(113;1.68e-06)|LUSC - Lung squamous cell carcinoma(244;0.008)|Lung(196;0.00802)|BRCA - Breast invasive adenocarcinoma(123;0.169)		ctagtctacccttttttggtcg	0.054													4	2	---	---	---	---	
SNUPN	10073	broad.mit.edu	37	15	75913092	75913092	+	Intron	DEL	C	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75913092delC	uc002ban.2	-						SNUPN_uc002bao.2_Intron|SNUPN_uc002bap.2_Intron|SNUPN_uc002baq.2_Intron|SNUPN_uc002bar.2_Intron|SNUPN_uc002bas.2_Intron	NM_005701	NP_005692	O95149	SPN1_HUMAN	snurportin 1						ncRNA metabolic process|protein import into nucleus|spliceosomal snRNP assembly	cytosol|nuclear pore	protein transporter activity|RNA cap binding			pancreas(1)	1						CCAGGATTTACCCCTCCCAAC	0.453													27	7	---	---	---	---	
TMC5	79838	broad.mit.edu	37	16	19502280	19502281	+	Intron	INS	-	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19502280_19502281insT	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron|TMC5_uc002dgd.1_Intron|TMC5_uc002dge.3_Intron|TMC5_uc002dgf.3_Intron|TMC5_uc002dgg.3_Intron	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1						ctttccccttcccctcccttcc	0.000													5	3	---	---	---	---	
GPR139	124274	broad.mit.edu	37	16	20065999	20066009	+	Intron	DEL	CTTCCTTCCTT	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20065999_20066009delCTTCCTTCCTT	uc002dgu.1	-						GPR139_uc010vaw.1_Intron	NM_001002911	NP_001002911	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139							integral to membrane|plasma membrane				ovary(2)	2						tacagatttccttccttccttcttccttcct	0.009													3	3	---	---	---	---	
ZNF768	79724	broad.mit.edu	37	16	30537683	30537692	+	Frame_Shift_Del	DEL	AACTCTGCAC	-	-	rs145753318		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30537683_30537692delAACTCTGCAC	uc002dyk.3	-	1	219_228	c.43_52delGTGCAGAGTT	c.(43-54)GTGCAGAGTTCTfs	p.V15fs	ZNF768_uc010vex.1_Intron|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Intron	NM_024671	NP_078947	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	15_18					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding				0						ATTTCGTCAGAACTCTGCACATCCTGGGGC	0.714													28	7	---	---	---	---	
PYCARD	29108	broad.mit.edu	37	16	31213582	31213596	+	Intron	DEL	GTCCCGTTGGTCGGT	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31213582_31213596delGTCCCGTTGGTCGGT	uc010cak.2	-						PYCARD_uc002ebm.2_Intron	NM_013258	NP_037390	Q9ULZ3	ASC_HUMAN	PYD and CARD domain containing isoform a						induction of apoptosis|positive regulation of interleukin-1 beta secretion|positive regulation of NF-kappaB transcription factor activity|proteolysis|tumor necrosis factor-mediated signaling pathway	IkappaB kinase complex	caspase activator activity|cysteine-type endopeptidase activity|protein homodimerization activity|Pyrin domain binding				0						TGGGGCCGGGGTCCCGTTGGTCGGTAGGCCAAGCG	0.651													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46388420	46388422	+	IGR	DEL	GAT	-	-	rs28778314		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46388420_46388422delGAT								None (None upstream) : ANKRD26P1 (114827 downstream)																							aattccattcgatgatgattccc	0.000													412	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46391827	46391849	+	IGR	DEL	GATGATTCCACTCGAGTCCATTC	-	-	rs9708865		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46391827_46391849delGATGATTCCACTCGAGTCCATTC								None (None upstream) : ANKRD26P1 (111400 downstream)																							tccattcgatgatgattccactcgagtccattcgatgattcca	0.000													192	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46393126	46393126	+	IGR	DEL	T	-	-	rs4967131		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46393126delT								None (None upstream) : ANKRD26P1 (110123 downstream)																							ttcgattccatttgatgattt	0.000													639	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46394988	46394990	+	IGR	DEL	ATG	-	-	rs144015128		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46394988_46394990delATG								None (None upstream) : ANKRD26P1 (108259 downstream)																							tcgattccatatgatgatgactc	0.000													236	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46405916	46405916	+	IGR	DEL	T	-	-	rs77422485		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46405916delT								None (None upstream) : ANKRD26P1 (97333 downstream)																							ctttcaatcattCCCTTTGAT	0.050													589	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46406908	46406910	+	IGR	DEL	ATG	-	-	rs142002187		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46406908_46406910delATG								None (None upstream) : ANKRD26P1 (96339 downstream)																							tcgattccatatgatgatgactc	0.000													381	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46417207	46417216	+	IGR	DEL	TTCGAATGGA	-	-	rs60768439		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46417207_46417216delTTCGAATGGA								None (None upstream) : ANKRD26P1 (86033 downstream)																							tggAATCATCTtcgaatggaattgaatgga	0.052													128	43	---	---	---	---	
NFAT5	10725	broad.mit.edu	37	16	69725894	69725908	+	In_Frame_Del	DEL	ATTGCAGCAGGCTAC	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69725894_69725908delATTGCAGCAGGCTAC	uc002exm.1	+	12	3320_3334	c.2112_2126delATTGCAGCAGGCTAC	c.(2110-2127)CTATTGCAGCAGGCTACA>CTA	p.LQQAT705del	NFAT5_uc002exi.2_In_Frame_Del_p.LQQAT629del|NFAT5_uc002exj.1_In_Frame_Del_p.LQQAT629del|NFAT5_uc002exk.1_In_Frame_Del_p.LQQAT629del|NFAT5_uc002exl.1_In_Frame_Del_p.LQQAT723del|NFAT5_uc002exn.1_In_Frame_Del_p.LQQAT722del|NFAT5_uc002exo.1_5'Flank	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c	705_709					excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						GCGATGCACTATTGCAGCAGGCTACACAGTTTCAG	0.465													65	13	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81232612	81232624	+	Frame_Shift_Del	DEL	GGGTGGTGGACTC	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81232612_81232624delGGGTGGTGGACTC	uc002fgh.1	-	7	1186_1198	c.1186_1198delGAGTCCACCACCC	c.(1186-1200)GAGTCCACCACCCAAfs	p.E396fs	PKD1L2_uc002fgj.2_Frame_Shift_Del_p.E396fs	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	396_400	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GAGCCCTTTTGGGTGGTGGACTCGGCCAGGGTT	0.516													84	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22261619	22261620	+	IGR	INS	-	C	C	rs7503042		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22261619_22261620insC								FLJ36000 (348549 upstream) : None (None downstream)																							tctgcaagtggatatttggacc	0.000													510	17	---	---	---	---	
PIGW	284098	broad.mit.edu	37	17	34894609	34894610	+	3'UTR	INS	-	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34894609_34894610insT	uc002hmy.1	+	2					PIGW_uc002hmz.1_3'UTR	NM_178517	NP_848612	Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan, class W						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	O-acyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATGCTTAATTAttttttttttt	0.134													4	2	---	---	---	---	
ATP5H	10476	broad.mit.edu	37	17	73038515	73038515	+	Intron	DEL	C	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73038515delC	uc002jmn.1	-						KCTD2_uc010dfy.1_Intron|KCTD2_uc010dfz.2_Intron|ATP5H_uc002jmo.1_Intron	NM_006356	NP_006347	O75947	ATP5H_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP catabolic process|respiratory electron transport chain	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity				0	all_lung(278;0.226)					GCAAGGATTTCTTTATATGTT	0.383													150	28	---	---	---	---	
DNAH17	8632	broad.mit.edu	37	17	76566968	76566969	+	Intron	INS	-	AA	AA	rs150958453	by1000genomes	TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76566968_76566969insAA	uc002jvv.1	-											RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			aaagaaaaaagaaaagaaaaga	0.257													4	3	---	---	---	---	
ATP8B3	148229	broad.mit.edu	37	19	1787226	1787249	+	Intron	DEL	CAGGCACCCAAGGAGCCTGCCAAG	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1787226_1787249delCAGGCACCCAAGGAGCCTGCCAAG	uc002ltw.2	-						ATP8B3_uc002ltv.2_Intron|ATP8B3_uc002ltx.2_Intron	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3						ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTCAGCCTCCAGGCACCCAAGGAGCCTGCCAAGCAGGCACCCA	0.598													5	4	---	---	---	---	
SLC5A5	6528	broad.mit.edu	37	19	17994332	17994332	+	Intron	DEL	G	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17994332delG	uc002nhr.3	+							NM_000453	NP_000444	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium iodide						cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4						GCAGGAACAAGGGGGGGGGGT	0.542													5	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27736391	27736392	+	IGR	DEL	CT	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27736391_27736392delCT								None (None upstream) : LOC148189 (545010 downstream)																							tttggaaacactctgtttgtaa	0.000													696	8	---	---	---	---	
MAP3K10	4294	broad.mit.edu	37	19	40715308	40715309	+	Intron	INS	-	T	T			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40715308_40715309insT	uc002ona.2	+						MAP3K10_uc002onb.2_Intron	NM_002446	NP_002437	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity			ovary(2)|lung(2)|skin(1)|pancreas(1)	6						aggataatttcttttttttttt	0.000													5	3	---	---	---	---	
C20orf96	140680	broad.mit.edu	37	20	259767	259770	+	Intron	DEL	GGTT	-	-	rs113750630		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:259767_259770delGGTT	uc002wde.1	-						C20orf96_uc002wdc.2_Intron|C20orf96_uc002wdd.2_Intron|C20orf96_uc010zpi.1_Intron|C20orf96_uc010zpj.1_Intron|C20orf96_uc010zpk.1_Intron	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680												0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			gagggacggaggttgggacggagg	0.289													4	4	---	---	---	---	
LSS	4047	broad.mit.edu	37	21	47641892	47641903	+	Intron	DEL	ACAGGAGCAGAG	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47641892_47641903delACAGGAGCAGAG	uc002zij.2	-						LSS_uc011afv.1_Intron|LSS_uc002zil.2_Intron|LSS_uc002zik.2_Intron	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1						cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)					CAATGTGCCTACAGGAGCAGAGGACAGGTGAG	0.462													46	17	---	---	---	---	
EWSR1	2130	broad.mit.edu	37	22	29694497	29694498	+	Intron	INS	-	A	A	rs35896020		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29694497_29694498insA	uc003aet.2	+						EWSR1_uc003aev.2_Intron|EWSR1_uc003aew.2_Intron|EWSR1_uc003aex.2_Intron|EWSR1_uc003aey.2_Intron|EWSR1_uc003aez.2_Intron	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						actccgtctccaaaaaaaaaaa	0.238			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								4	2	---	---	---	---	
TMPRSS6	164656	broad.mit.edu	37	22	37469387	37469390	+	Intron	DEL	GATG	-	-	rs111916270		TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37469387_37469390delGATG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						GAGACCAGAAgatggatggatgga	0.162													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61731081	61731082	+	IGR	DEL	CT	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61731081_61731082delCT								None (None upstream) : SPIN4 (836026 downstream)																							ttcaaaactgctctctcaaaag	0.000													71	9	---	---	---	---	
THOC2	57187	broad.mit.edu	37	X	122758187	122758188	+	Intron	DEL	AC	-	-			TCGA-DK-A1A7-01A-11D-A13W-08	TCGA-DK-A1A7-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122758187_122758188delAC	uc004etu.2	-						THOC2_uc010nqt.1_5'Flank|THOC2_uc004etw.1_5'Flank	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						TTCAACTTATACAAAGATACTA	0.277													4	2	---	---	---	---	
