Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA1751	85452	broad.mit.edu	37	1	1919956	1919956	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1919956C>A	uc001aim.1	-	4	447	c.291G>T	c.(289-291)AAG>AAT	p.K97N	KIAA1751_uc009vkz.1_Missense_Mutation_p.K97N|KIAA1751_uc001ain.1_Missense_Mutation_p.K97N	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	97										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CTCACCTCATCTTCTCAGTGA	0.587													27	101	---	---	---	---	PASS
CLCNKA	1187	broad.mit.edu	37	1	16360347	16360347	+	3'UTR	SNP	A	G	G	rs61772373	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16360347A>G	uc001axu.2	+	20					CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_3'UTR|CLCNKA_uc010obw.1_3'UTR|CLCNKB_uc001axw.3_Intron	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CCTGCCTTGAAAGACAAAAAT	0.522													5	40	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16913638	16913638	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16913638T>G	uc009vos.1	-	11	1573	c.685A>C	c.(685-687)ATC>CTC	p.I229L	NBPF1_uc009vot.1_5'UTR|NBPF1_uc001ayz.1_5'UTR|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	229	NBPF 1.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCAAAGGTGATGTTGATGTTC	0.463													104	261	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19499967	19499967	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19499967C>A	uc001bbi.2	-	23	3135	c.3131G>T	c.(3130-3132)CGG>CTG	p.R1044L	UBR4_uc001bbm.1_Missense_Mutation_p.R255L	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1044					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GATCCGGAGCCGAGAAGACCA	0.443													28	95	---	---	---	---	PASS
SFRS4	6429	broad.mit.edu	37	1	29474870	29474870	+	3'UTR	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29474870C>A	uc001bro.2	-	6					SFRS4_uc010ofy.1_3'UTR	NM_005626	NP_005617	Q08170	SRSF4_HUMAN	splicing factor, arginine/serine-rich 4						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding				0		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)		GCTACGGCTACCAAACATGTA	0.453													9	41	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	97544339	97544339	+	3'UTR	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97544339T>C	uc001drv.2	-	23						NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	TTCTATTTTATGACCACTAAT	0.254													3	1	---	---	---	---	PASS
WDR77	79084	broad.mit.edu	37	1	111990200	111990200	+	Splice_Site	SNP	T	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111990200T>A	uc001ebb.2	-	3	341	c.302_splice	c.e3-1	p.G101_splice	WDR77_uc010owd.1_Intron|WDR77_uc010owe.1_Intron|ATP5F1_uc009wgf.1_5'Flank|ATP5F1_uc001ebc.2_5'Flank|ATP5F1_uc001ebd.3_5'Flank	NM_024102	NP_077007	Q9BQA1	MEP50_HUMAN	WD repeat domain 77						ncRNA metabolic process|spliceosomal snRNP assembly	cytosol|nucleus	ligand-dependent nuclear receptor transcription coactivator activity|protein binding				0		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CAACAGCACCTGTTGGGGGTA	0.403													36	34	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152082009	152082009	+	Silent	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152082009T>C	uc001ezp.2	-	2	3684	c.3684A>G	c.(3682-3684)GAA>GAG	p.E1228E	TCHH_uc009wne.1_Silent_p.E1228E	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1228					keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTTTTCTGGTTCCCACTGCC	0.428													6	278	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152281068	152281068	+	Silent	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152281068T>C	uc001ezu.1	-	3	6330	c.6294A>G	c.(6292-6294)GAA>GAG	p.E2098E		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2098	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACTCAGACTGTTCATGAGTGC	0.577									Ichthyosis				5	172	---	---	---	---	PASS
ROBLD3	28956	broad.mit.edu	37	1	156025137	156025137	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156025137A>C	uc001fnb.3	+	2	316	c.152A>C	c.(151-153)AAC>ACC	p.N51T	UBQLN4_uc001fna.2_5'Flank|UBQLN4_uc010pgx.1_5'Flank|ROBLD3_uc010pgy.1_Missense_Mutation_p.N51T	NM_014017	NP_054736	Q9Y2Q5	LTOR2_HUMAN	roadblock domain-containing protein 3 isoform 1	51					cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade	lysosomal membrane|Ragulator complex					0						ATAGCCAGTAACATCTGGGCC	0.577													10	53	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179620176	179620176	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179620176G>C	uc001gnf.1	+	12	2225	c.1975G>C	c.(1975-1977)GTA>CTA	p.V659L	TDRD5_uc010pnp.1_Missense_Mutation_p.V659L|TDRD5_uc001gnh.1_Missense_Mutation_p.V214L	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	659					DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						CCATGCTATTGTATGCCGAGA	0.338													44	161	---	---	---	---	PASS
C1orf27	54953	broad.mit.edu	37	1	186357584	186357584	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186357584C>A	uc001grw.2	+	5	577	c.341C>A	c.(340-342)GCT>GAT	p.A114D	C1orf27_uc010poq.1_Missense_Mutation_p.A114D|C1orf27_uc010por.1_Missense_Mutation_p.A82D	NM_017847	NP_060317	Q5SWX8	ODR4_HUMAN	odorant response abnormal 4 isoform 1	114						integral to membrane	oxidoreductase activity|zinc ion binding			ovary(1)	1						CTAATGTTTGCTGTGGAAAAG	0.333													6	108	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198723495	198723495	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198723495G>T	uc001gur.1	+	32	3781	c.3601G>T	c.(3601-3603)GCT>TCT	p.A1201S	PTPRC_uc001gus.1_Missense_Mutation_p.A1153S|PTPRC_uc001gut.1_Missense_Mutation_p.A1040S	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1201	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						AGTGGTAAAAGCTCTACGCAA	0.388													62	117	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24469086	24469086	+	Silent	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24469086A>G	uc002rfe.2	-	29	3747	c.3489T>C	c.(3487-3489)GAT>GAC	p.D1163D	ITSN2_uc002rff.2_Silent_p.D1136D|ITSN2_uc002rfg.2_Silent_p.D1163D|ITSN2_uc002rfh.1_RNA	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	1163	SH3 5.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTGCCACCAATCAGGATCAT	0.413													64	107	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24498628	24498628	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24498628T>C	uc002rfe.2	-	18	2293	c.2035A>G	c.(2035-2037)AGA>GGA	p.R679G	ITSN2_uc002rff.2_Missense_Mutation_p.R652G|ITSN2_uc002rfg.2_Missense_Mutation_p.R679G	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	679	Potential.			R -> G (in Ref. 5; BAB13841).	endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTTCTAATCTTTTCCTTTCA	0.343													7	391	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61647969	61647969	+	Splice_Site	SNP	C	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61647969C>G	uc002sbe.2	-	2	66	c.44_splice	c.e2-1	p.I15_splice		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			ACATCTGATACTGAAATAAAA	0.323													10	255	---	---	---	---	PASS
ZAP70	7535	broad.mit.edu	37	2	98354307	98354307	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98354307A>G	uc002syd.1	+	12	1777	c.1570A>G	c.(1570-1572)AGC>GGC	p.S524G	ZAP70_uc002sye.1_Missense_Mutation_p.S414G|ZAP70_uc002syf.1_Missense_Mutation_p.S217G	NM_001079	NP_001070	P43403	ZAP70_HUMAN	zeta-chain associated protein kinase 70kDa	524	Protein kinase.				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						CGATGTCTGGAGCTATGGGGT	0.657													4	59	---	---	---	---	PASS
LIPT1	51601	broad.mit.edu	37	2	99779609	99779609	+	3'UTR	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99779609G>T	uc002szm.3	+	4					MRPL30_uc002szl.1_Intron|LIPT1_uc002szn.3_3'UTR|LIPT1_uc002szo.3_3'UTR|LIPT1_uc002szp.3_3'UTR|LIPT1_uc002szq.3_3'UTR|MRPL30_uc002szr.2_Intron	NM_145198	NP_660199	Q9Y234	LIPT_HUMAN	lipoyltransferase 1 precursor						lipid metabolic process|protein lipoylation	mitochondrion	acyltransferase activity				0					Lipoic Acid(DB00166)	CACATTGTATGTCAAAAAAAA	0.284													6	13	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138434352	138434352	+	3'UTR	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138434352G>T	uc002tva.1	+	27						NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GGATTATTAGGTCTGCCATTT	0.373													6	10	---	---	---	---	PASS
ITGB6	3694	broad.mit.edu	37	2	160983104	160983104	+	Missense_Mutation	SNP	C	A	A	rs143914557		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160983104C>A	uc002ubh.2	-	11	1685	c.1669G>T	c.(1669-1671)GAC>TAC	p.D557Y	ITGB6_uc010fou.2_Missense_Mutation_p.D557Y|ITGB6_uc010zcq.1_Missense_Mutation_p.D515Y|ITGB6_uc010fov.1_Missense_Mutation_p.D557Y	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor	557	Extracellular (Potential).|III.|Cysteine-rich tandem repeats.				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						CAGTCACAGTCGCCGTTACCT	0.522													6	23	---	---	---	---	PASS
ATIC	471	broad.mit.edu	37	2	216177160	216177160	+	Intron	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216177160G>A	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_5'UTR	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	ACCCTCCCAAGGCCTTGCAGA	0.552			T	ALK	ALCL								19	84	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121151237	121151237	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121151237C>G	uc003eee.3	-	30	7816	c.7687G>C	c.(7687-7689)GAA>CAA	p.E2563Q	POLQ_uc003eed.2_Missense_Mutation_p.E1735Q	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	2563					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		ACAGCACTTTCCATTTCATTC	0.398								DNA_polymerases_(catalytic_subunits)					13	150	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142169329	142169329	+	Intron	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142169329A>G	uc003eux.3	-						XRN1_uc003eus.2_5'Flank|XRN1_uc003eut.2_5'Flank|XRN1_uc003euu.2_5'Flank|XRN1_uc003euw.2_5'Flank|XRN1_uc011bnh.1_5'Flank|ATR_uc003euy.1_3'UTR	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein						cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						CACTAAAGAGAGAGTTCATCA	0.398								Other_conserved_DNA_damage_response_genes					5	103	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151166250	151166250	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151166250C>T	uc011bod.1	-	4	1519	c.1519G>A	c.(1519-1521)GTG>ATG	p.V507M		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	507	Ig-like C2-type 1.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGCCAATCCACGTGTGGGGTG	0.478													5	160	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193385032	193385032	+	Silent	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193385032G>A	uc003ftm.2	+	27	3015	c.2781G>A	c.(2779-2781)TTG>TTA	p.L927L	OPA1_uc003ftg.2_Silent_p.L982L|OPA1_uc003fth.2_Silent_p.L946L|OPA1_uc003fti.2_Silent_p.L964L|OPA1_uc003ftj.2_Silent_p.L945L|OPA1_uc003ftk.2_Silent_p.L928L|OPA1_uc003ftl.2_Silent_p.L909L|OPA1_uc003ftn.2_Silent_p.L891L	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1	927	Potential.|Mitochondrial intermembrane (By similarity).				apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AGATTAAATTGCTTACTGGTA	0.383													8	231	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195511877	195511877	+	Missense_Mutation	SNP	G	A	A	rs55824312		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195511877G>A	uc011bto.1	-	2	7034	c.6574C>T	c.(6574-6576)CCT>TCT	p.P2192S	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGCGTGA	0.597													4	49	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197422824	197422824	+	Silent	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197422824T>C	uc003fyc.2	-	9	1569	c.1386A>G	c.(1384-1386)GAA>GAG	p.E462E	KIAA0226_uc003fyd.3_Silent_p.E417E|KIAA0226_uc003fye.1_Silent_p.E169E|KIAA0226_uc003fyf.2_Silent_p.E310E	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	462					autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		GGAACATGCCTTCCCCTGAGC	0.507													5	128	---	---	---	---	PASS
DHX15	1665	broad.mit.edu	37	4	24572443	24572443	+	Nonsense_Mutation	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24572443G>A	uc003gqx.2	-	3	703	c.535C>T	c.(535-537)CGA>TGA	p.R179*		NM_001358	NP_001349	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 15	179	Helicase ATP-binding.				mRNA processing	U12-type spliceosomal complex	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(1)	1		Breast(46;0.0503)				GGTAATGATCGCATGTACTCC	0.418													51	95	---	---	---	---	PASS
DHX15	1665	broad.mit.edu	37	4	24572444	24572444	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24572444C>T	uc003gqx.2	-	3	702	c.534G>A	c.(532-534)ATG>ATA	p.M178I		NM_001358	NP_001349	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 15	178	Helicase ATP-binding.				mRNA processing	U12-type spliceosomal complex	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(1)	1		Breast(46;0.0503)				GTAATGATCGCATGTACTCCA	0.418													49	94	---	---	---	---	PASS
CENPC1	1060	broad.mit.edu	37	4	68338222	68338222	+	3'UTR	SNP	T	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68338222T>A	uc003hdd.1	-	19					CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA	NM_001812	NP_001803	Q03188	CENPC_HUMAN	centromere protein C 1						mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding			urinary_tract(1)|lung(1)	2						aatttttattttaaaaCATCA	0.224													25	35	---	---	---	---	PASS
EGF	1950	broad.mit.edu	37	4	110909739	110909739	+	Splice_Site	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110909739G>T	uc003hzy.3	+	18	3061	c.2609_splice	c.e18-1	p.D870_splice	EGF_uc011cfu.1_Splice_Site_p.D828_splice|EGF_uc011cfv.1_Splice_Site_p.D870_splice|EGF_uc010imk.2_Intron	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	TTTGCCCACAGATATAGATGA	0.428													75	131	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121958431	121958431	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121958431C>A	uc003idq.1	-	4	1222	c.695G>T	c.(694-696)AGT>ATT	p.S232I		NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor	232											0						ATCATCTGCACTCAGTTTTGC	0.448													122	231	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35874602	35874602	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35874602T>C	uc003jjs.2	+	6	847	c.758T>C	c.(757-759)GTC>GCC	p.V253A	IL7R_uc011coo.1_Intron|IL7R_uc011cop.1_Intron	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	253	Helical; (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TTTTTCTCTGTCGCTCTGTTG	0.443													7	344	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37168941	37168941	+	Silent	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37168941T>C	uc011cpa.1	-	34	7416	c.7185A>G	c.(7183-7185)AAA>AAG	p.K2395K	C5orf42_uc011coy.1_Silent_p.K895K|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Silent_p.K1470K|C5orf42_uc003jkr.1_Silent_p.K428K	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	2395										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ATCTTGGGTATTTTCTTTCTT	0.363													156	258	---	---	---	---	PASS
CD180	4064	broad.mit.edu	37	5	66479407	66479407	+	Silent	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66479407G>A	uc003juy.2	-	3	1412	c.1264C>T	c.(1264-1266)CTA>TTA	p.L422L		NM_005582	NP_005573	Q99467	CD180_HUMAN	CD180 molecule precursor	422	LRR 14.|Extracellular (Potential).				inflammatory response|innate immune response	integral to membrane|plasma membrane	receptor activity			ovary(1)	1		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		AGGAGTTCTAGCTGAGGACAT	0.458													125	187	---	---	---	---	PASS
JMY	133746	broad.mit.edu	37	5	78573870	78573870	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78573870G>A	uc003kfx.3	+	2	1690	c.1170G>A	c.(1168-1170)ATG>ATA	p.M390I	JMY_uc003kfw.1_Missense_Mutation_p.M36I	NM_152405	NP_689618	Q8N9B5	JMY_HUMAN	junction-mediating and regulatory protein	390					'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity				0		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		TCCGAGACATGAGAGAACTTG	0.383													47	88	---	---	---	---	PASS
SHROOM1	134549	broad.mit.edu	37	5	132160424	132160424	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132160424G>A	uc003kxx.2	-	6	1929	c.1124C>T	c.(1123-1125)ACC>ATC	p.T375I	SHROOM1_uc003kxy.1_Missense_Mutation_p.T375I	NM_133456	NP_597713	Q2M3G4	SHRM1_HUMAN	shroom family member 1	375					actin filament bundle assembly|cell morphogenesis	cytoplasm|microtubule	actin filament binding			pancreas(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CACAATGCAGGTCTCTGAGAC	0.582													59	94	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149212567	149212567	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149212567C>T	uc003lrc.2	+	5	973	c.931C>T	c.(931-933)CCA>TCA	p.P311S	PPARGC1B_uc003lrb.1_Missense_Mutation_p.P311S|PPARGC1B_uc003lrd.2_Missense_Mutation_p.P272S|PPARGC1B_uc003lrf.2_Missense_Mutation_p.P290S|PPARGC1B_uc003lre.1_Missense_Mutation_p.P290S	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	311					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GACCCCTGAGCCACTCCCCAA	0.632													10	29	---	---	---	---	PASS
EBF1	1879	broad.mit.edu	37	5	158250251	158250251	+	Silent	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158250251A>G	uc010jip.2	-	8	1013	c.711T>C	c.(709-711)AAT>AAC	p.N237N	EBF1_uc011ddw.1_Silent_p.N104N|EBF1_uc011ddx.1_Silent_p.N237N|EBF1_uc003lxl.3_Silent_p.N214N	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	237	Interaction with DNA (By similarity).				multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CATGCTTGGAATTATTATGGA	0.488			T	HMGA2	lipoma								36	66	---	---	---	---	PASS
UBLCP1	134510	broad.mit.edu	37	5	158710292	158710292	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158710292A>C	uc003lxq.2	+	10	1200	c.874A>C	c.(874-876)AAG>CAG	p.K292Q		NM_145049	NP_659486	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase	292	FCP1 homology.					nucleus	phosphoprotein phosphatase activity			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCAGTACCTCAAGGAGATAGC	0.299													65	71	---	---	---	---	PASS
SLC17A3	10786	broad.mit.edu	37	6	25850134	25850134	+	Silent	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25850134A>G	uc003nfi.3	-	9	1046	c.936T>C	c.(934-936)AAT>AAC	p.N312N	SLC17A3_uc003nfk.3_Silent_p.N390N	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),	312	Helical; (Potential).				glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						TATAGCCGGAATTGAGGTAAG	0.433													12	26	---	---	---	---	PASS
WASF1	8936	broad.mit.edu	37	6	110428287	110428287	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110428287T>C	uc003ptv.1	-	7	1370	c.533A>G	c.(532-534)AAG>AGG	p.K178R	WASF1_uc003ptw.1_Missense_Mutation_p.K178R|WASF1_uc003ptx.1_Missense_Mutation_p.K178R|WASF1_uc003pty.1_Missense_Mutation_p.K178R|WASF1_uc003ptz.1_Missense_Mutation_p.K178R	NM_003931	NP_003922	Q92558	WASF1_HUMAN	Wiskott-Aldrich syndrome protein family member	178					actin filament polymerization|cellular component movement	actin cytoskeleton	actin binding				0		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		TACCTTCTGCTTCCTCTTTTC	0.294													6	249	---	---	---	---	PASS
GJA1	2697	broad.mit.edu	37	6	121769154	121769154	+	3'UTR	SNP	A	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121769154A>C	uc003pyr.2	+	2					GJA1_uc011ebo.1_3'UTR|GJA1_uc011ebp.1_3'UTR	NM_000165	NP_000156	P17302	CXA1_HUMAN	connexin 43						cell-cell signaling|cellular membrane organization|gap junction assembly|heart development|muscle contraction|positive regulation of I-kappaB kinase/NF-kappaB cascade	connexon complex|Golgi-associated vesicle membrane|integral to plasma membrane|membrane raft	ion transmembrane transporter activity|signal transducer activity			ovary(2)	2				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	TACAGGCTTGAAAGCATCAAG	0.507													6	9	---	---	---	---	PASS
NPY	4852	broad.mit.edu	37	7	24331365	24331365	+	3'UTR	SNP	A	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24331365A>T	uc003sww.1	+	4						NM_000905	NP_000896	P01303	NPY_HUMAN	neuropeptide Y precursor						adult feeding behavior|calcium ion transport|cell proliferation|cellular component movement|central nervous system neuron development|cerebral cortex development|digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|neuron projection development|neuropeptide signaling pathway|positive regulation of appetite|synaptic transmission	cell|extracellular space	calcium channel regulator activity|G-protein coupled receptor activity|neuropeptide hormone activity				0						TTCATCGTGTAAAACGAGAAT	0.403													13	128	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48563901	48563901	+	Silent	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48563901A>G	uc003toq.2	+	54	14134	c.14109A>G	c.(14107-14109)AAA>AAG	p.K4703K	ABCA13_uc010kys.1_Silent_p.K1778K|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Silent_p.K433K	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	4703					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						ATGTTGAAAAAGAGGAAAAGA	0.383													5	148	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72873923	72873923	+	Silent	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72873923T>C	uc003tyc.2	-	13	3720	c.3375A>G	c.(3373-3375)GAA>GAG	p.E1125E		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1125					ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTGCTGAATCTTCACTTTGGA	0.388													8	638	---	---	---	---	PASS
PTPN12	5782	broad.mit.edu	37	7	77256021	77256021	+	Splice_Site	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77256021G>A	uc003ugh.2	+	13	1117	c.1026_splice	c.e13-1	p.S342_splice	PTPN12_uc011kgp.1_Splice_Site_p.S223_splice|PTPN12_uc011kgq.1_Splice_Site_p.S212_splice|PTPN12_uc010lds.2_Splice_Site_p.S74_splice	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type							soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3						TTGTTTTTCAGTTGCCTTGTT	0.408													42	67	---	---	---	---	PASS
TRYX3	136541	broad.mit.edu	37	7	141955033	141955033	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141955033A>G	uc003vxb.2	-	3	598	c.278T>C	c.(277-279)TTC>TCC	p.F93S	TRYX3_uc003vxc.3_Missense_Mutation_p.F93S	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN	trypsin X3 precursor	93	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0	Melanoma(164;0.0272)					AGTGACTGAGAAGTGTGGATG	0.418													5	164	---	---	---	---	PASS
PRSS1	5644	broad.mit.edu	37	7	142458829	142458829	+	Intron	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142458829A>G	uc003wak.2	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Silent_p.K130K|PRSS1_uc003wam.2_5'Flank	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein						digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			CTAGTGAGAAAAGCAGGCAAG	0.308									Hereditary_Pancreatitis				4	6	---	---	---	---	PASS
PIP	5304	broad.mit.edu	37	7	142836700	142836700	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142836700C>T	uc003wcf.1	+	4	442	c.406C>T	c.(406-408)CGG>TGG	p.R136W		NM_002652	NP_002643	P12273	PIP_HUMAN	prolactin-induced protein precursor	136						extracellular region	actin binding			ovary(1)	1	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		CAAAAACAACCGGTTTTATAC	0.428													4	172	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147336210	147336210	+	Nonsense_Mutation	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147336210G>A	uc003weu.1	+	13	2426	c.1910G>A	c.(1909-1911)TGG>TAG	p.W637*		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	637	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GACAAAGTGTGGACCATAGTG	0.463										HNSCC(39;0.1)			25	57	---	---	---	---	PASS
LONRF1	91694	broad.mit.edu	37	8	12592860	12592860	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12592860T>G	uc003wwd.1	-	7	1564	c.1501A>C	c.(1501-1503)AAT>CAT	p.N501H	LONRF1_uc011kxv.1_Missense_Mutation_p.N90H|LONRF1_uc010lsp.1_Missense_Mutation_p.N101H	NM_152271	NP_689484	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger	501	RING-type 2.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			ovary(1)	1				READ - Rectum adenocarcinoma(644;0.236)		TCAAGACAATTCTTACAGAAC	0.358													39	44	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	15977930	15977930	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15977930G>C	uc003wwz.2	-	9	1417	c.1219C>G	c.(1219-1221)CAA>GAA	p.Q407E	MSR1_uc010lsu.2_Missense_Mutation_p.Q425E|MSR1_uc003wxa.2_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	407	SRCR.|Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		AAATTACCTTGTCCAAAGTGA	0.338													26	24	---	---	---	---	PASS
DDHD2	23259	broad.mit.edu	37	8	38095758	38095758	+	Intron	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38095758T>C	uc003xlb.2	+						DDHD2_uc003xla.2_Missense_Mutation_p.F218S|DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			TTTCTTACCTTTGGATGTATT	0.363													6	326	---	---	---	---	PASS
HGSNAT	138050	broad.mit.edu	37	8	43016586	43016586	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43016586A>G	uc003xpx.3	+	5	547	c.499A>G	c.(499-501)AGC>GGC	p.S167G		NM_152419	NP_689632	Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	195	Helical; (Potential).				lysosomal transport|protein oligomerization	integral to membrane|lysosomal membrane	heparan-alpha-glucosaminide N-acetyltransferase activity				0	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TCTAGCTGTGAGCATTGCATT	0.393													7	473	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61763106	61763106	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61763106G>A	uc003xue.2	+	26	5936	c.5459G>A	c.(5458-5460)CGA>CAA	p.R1820Q		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1820					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TTTCTGGAACGAGTCGGTATG	0.507													18	50	---	---	---	---	PASS
SYBU	55638	broad.mit.edu	37	8	110587762	110587762	+	Silent	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110587762G>A	uc003ynj.3	-	7	1528	c.1365C>T	c.(1363-1365)GAC>GAT	p.D455D	SYBU_uc003yni.3_Silent_p.D452D|SYBU_uc003ynk.3_Silent_p.D336D|SYBU_uc010mco.2_Silent_p.D454D|SYBU_uc003ynl.3_Silent_p.D454D|SYBU_uc010mcp.2_Silent_p.D455D|SYBU_uc010mcq.2_Silent_p.D455D|SYBU_uc003yno.3_Silent_p.D336D|SYBU_uc010mcr.2_Silent_p.D455D|SYBU_uc003ynm.3_Silent_p.D454D|SYBU_uc003ynn.3_Silent_p.D454D|SYBU_uc010mcs.2_Silent_p.D336D|SYBU_uc010mct.2_Silent_p.D455D|SYBU_uc010mcu.2_Silent_p.D454D|SYBU_uc003ynp.3_Silent_p.D387D|SYBU_uc010mcv.2_Silent_p.D455D|SYBU_uc003ynh.3_Silent_p.D249D|SYBU_uc011lhw.1_Silent_p.D325D	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	455						cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						CAAGCTCCAGGTCACCAGATT	0.577													39	162	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121243762	121243762	+	Silent	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121243762C>A	uc003yox.2	+	19	2519	c.2254C>A	c.(2254-2256)CGG>AGG	p.R752R	COL14A1_uc003yoy.2_Silent_p.R430R	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	752	Fibronectin type-III 6.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTCTAGCCTGCGGGTAAAATG	0.438													5	226	---	---	---	---	PASS
MTBP	27085	broad.mit.edu	37	8	121463702	121463702	+	Intron	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121463702G>A	uc003ypc.1	+						MTBP_uc003ypb.1_3'UTR|MTBP_uc011lie.1_Intron	NM_022045	NP_071328	Q96DY7	MTBP_HUMAN	Mdm2, transformed 3T3 cell double minute 2, p53						cell cycle arrest					skin(2)|ovary(1)	3	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			CTCTCAATTTGGGCCTTTTAT	0.239													18	17	---	---	---	---	PASS
WASH5P	375690	broad.mit.edu	37	9	14764	14764	+	3'UTR	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14764C>T	uc010mgm.1	-	11					WASH5P_uc003zfr.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						GTCAGAGCAACGGCCCAAGTC	0.632													5	12	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071078	141071078	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071078A>G	uc004com.2	+	4	742	c.481A>G	c.(481-483)ATG>GTG	p.M161V	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						GTCTGCTACCATGAGTGGGGT	0.552													7	13	---	---	---	---	PASS
ZMYND11	10771	broad.mit.edu	37	10	225962	225962	+	Silent	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:225962T>C	uc010pzt.1	+	2	438	c.10T>C	c.(10-12)TTA>CTA	p.L4L	ZMYND11_uc001ifk.2_Silent_p.L4L|ZMYND11_uc010pzu.1_Silent_p.L4L|ZMYND11_uc010pzv.1_Silent_p.L4L|ZMYND11_uc010pzw.1_Silent_p.L4L|ZMYND11_uc001ifm.2_Silent_p.L4L|ZMYND11_uc010pzx.1_Silent_p.L4L|ZMYND11_uc001ifn.2_Silent_p.L4L|ZMYND11_uc009xhg.2_5'UTR	NM_006624	NP_006615	Q15326	ZMY11_HUMAN	zinc finger, MYND domain containing 11 isoform	Error:Variant_position_missing_in_Q15326_after_alignment					cell cycle|cell proliferation|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CATGGCACGTTTAACAAAAAG	0.373													50	74	---	---	---	---	PASS
DRGX	644168	broad.mit.edu	37	10	50574424	50574424	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50574424C>A	uc010qgq.1	-	6	544	c.544G>T	c.(544-546)GGC>TGC	p.G182C		NM_001080520	NP_001073989	A6NNA5	DRGX_HUMAN	dorsal root ganglia homeobox	182					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CACAGTGGGCCCCCTGGAAAA	0.577													4	16	---	---	---	---	PASS
CDHR1	92211	broad.mit.edu	37	10	85960393	85960393	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85960393G>T	uc001kcv.2	+	6	475	c.475G>T	c.(475-477)GCA>TCA	p.A159S	CDHR1_uc001kcw.2_Missense_Mutation_p.A159S|CDHR1_uc009xst.2_5'Flank	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	159	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						TAAGGTCCATGCAGTGGACAG	0.602													16	32	---	---	---	---	PASS
AMPD3	272	broad.mit.edu	37	11	10527578	10527578	+	3'UTR	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10527578T>C	uc001mio.1	+	15					AMPD3_uc010rbz.1_3'UTR|AMPD3_uc001min.1_3'UTR|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_3'UTR|AMPD3_uc009yfy.2_3'UTR	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B						AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		GTTGCACTGCTCACTTTAAGA	0.423													6	15	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46898361	46898361	+	Missense_Mutation	SNP	T	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46898361T>G	uc001ndn.3	-	24	3444	c.3298A>C	c.(3298-3300)AGC>CGC	p.S1100R		NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1100	Extracellular (Potential).|LDL-receptor class B 11.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		TGCAGTGTGCTGTCAGACCAG	0.547													37	30	---	---	---	---	PASS
ZFP91	80829	broad.mit.edu	37	11	58381764	58381764	+	Silent	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58381764A>G	uc001nmx.3	+	9	1218	c.1050A>G	c.(1048-1050)GGA>GGG	p.G350G	ZFP91_uc001nmy.3_Silent_p.G349G|ZFP91-CNTF_uc010rkm.1_RNA	NM_053023	NP_444251	Q96JP5	ZFP91_HUMAN	zinc finger protein 91	350	C2H2-type 2.|Interaction with MAP3K14/NIK.				activation of NF-kappaB-inducing kinase activity|protein K63-linked ubiquitination	nucleus	nucleic acid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				CCTCCTGTGGACGACTCTTCA	0.393													27	75	---	---	---	---	PASS
SLC22A24	283238	broad.mit.edu	37	11	62886306	62886306	+	Intron	SNP	A	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62886306A>C	uc009yop.2	-						SLC22A24_uc010rmn.1_Missense_Mutation_p.I157S	NM_001136506	NP_001129978			solute carrier family 22, member 24												0						GACCGAACAGATCCCAGGTGT	0.448													8	31	---	---	---	---	PASS
BCO2	83875	broad.mit.edu	37	11	112072899	112072899	+	Missense_Mutation	SNP	G	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112072899G>C	uc001pnf.2	+	8	1297	c.1180G>C	c.(1180-1182)GAA>CAA	p.E394Q	BCO2_uc001pne.1_Missense_Mutation_p.E221Q|BCO2_uc001png.2_Missense_Mutation_p.E321Q|BCO2_uc001pnh.2_Missense_Mutation_p.E360Q|BCO2_uc010rwt.1_Missense_Mutation_p.E289Q|BCO2_uc009yyn.2_Missense_Mutation_p.E360Q|BCO2_uc001pni.2_Missense_Mutation_p.E360Q	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN	beta-carotene dioxygenase 2 isoform a	394					carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GAAGGCTGGGGAAGGGCTTGA	0.383													41	134	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117280703	117280703	+	Intron	SNP	G	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117280703G>C	uc001prc.2	+						CEP164_uc001prb.2_Intron|CEP164_uc001prf.2_Intron|CEP164_uc009yzp.1_Intron|CEP164_uc001prg.1_Missense_Mutation_p.S798T	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa						cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		TCTGGGCGGAGCCTTCCCACC	0.388													3	11	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117280704	117280704	+	Intron	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117280704C>A	uc001prc.2	+						CEP164_uc001prb.2_Intron|CEP164_uc001prf.2_Intron|CEP164_uc009yzp.1_Intron|CEP164_uc001prg.1_Missense_Mutation_p.S798R	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa						cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CTGGGCGGAGCCTTCCCACCT	0.388													3	11	---	---	---	---	PASS
HYOU1	10525	broad.mit.edu	37	11	118916498	118916498	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118916498C>A	uc001puu.2	-	25	3126	c.2933G>T	c.(2932-2934)GGA>GTA	p.G978V	HYOU1_uc001put.2_Missense_Mutation_p.G944V|HYOU1_uc010ryu.1_Missense_Mutation_p.G936V|HYOU1_uc010ryv.1_Missense_Mutation_p.G867V|HYOU1_uc001pux.3_Missense_Mutation_p.G978V	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor	978						endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CTCACCTGCTCCAGGACCTCC	0.567													47	52	---	---	---	---	PASS
OR10G4	390264	broad.mit.edu	37	11	123886795	123886795	+	Nonsense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123886795C>T	uc010sac.1	+	1	514	c.514C>T	c.(514-516)CAG>TAG	p.Q172*		NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TGGACCCAACCAGATCCAGCA	0.557													41	87	---	---	---	---	PASS
ADAMTS8	11095	broad.mit.edu	37	11	130281574	130281574	+	Intron	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130281574C>T	uc001qgg.3	-						ADAMTS8_uc001qgf.2_5'UTR	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1						negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		TGGCCAATGCCCTGGCTTCCT	0.418													3	8	---	---	---	---	PASS
VAMP1	6843	broad.mit.edu	37	12	6572261	6572261	+	3'UTR	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6572261A>G	uc001qok.2	-	5					TAPBPL_uc001qoi.1_Intron|VAMP1_uc001qoj.2_Intron|VAMP1_uc001qol.2_3'UTR	NM_014231	NP_055046	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 isoform 1						neurotransmitter secretion|vesicle-mediated transport	cell junction|endocytic vesicle membrane|integral to plasma membrane|mitochondrial outer membrane|synaptic vesicle membrane|synaptosome	protein binding				0					Botulinum Toxin Type B(DB00042)	AAGCTCAGCAATTGCCCCGAA	0.517													22	25	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49444844	49444844	+	Nonsense_Mutation	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49444844G>T	uc001rta.3	-	10	2622	c.2622C>A	c.(2620-2622)TGC>TGA	p.C874*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	874	Pro-rich.			Missing (in Ref. 1; AAC51734).	chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CAGGTGCAGGGCATTGGCCTG	0.647			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			17	21	---	---	---	---	PASS
PDE1B	5153	broad.mit.edu	37	12	54967242	54967242	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54967242A>T	uc001sgd.1	+	9	1106	c.940A>T	c.(940-942)AAC>TAC	p.N314Y	PDE1B_uc010soz.1_Missense_Mutation_p.N177Y|PDE1B_uc010spa.1_Missense_Mutation_p.N273Y|PDE1B_uc001sgf.2_Missense_Mutation_p.N177Y|PDE1B_uc001sge.2_Missense_Mutation_p.N294Y|PDE1B_uc009znq.2_Missense_Mutation_p.N110Y	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1	314	Catalytic (By similarity).				activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						CATTTTCATCAACCTCACCAA	0.463													54	95	---	---	---	---	PASS
RASSF9	9182	broad.mit.edu	37	12	86199472	86199472	+	Nonsense_Mutation	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199472C>A	uc001taf.1	-	2	655	c.316G>T	c.(316-318)GAG>TAG	p.E106*		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	106	Ras-associating.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						TTGGGCTGCTCATCTCCCCAC	0.453													108	133	---	---	---	---	PASS
NME2P1	283458	broad.mit.edu	37	12	120720247	120720247	+	RNA	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120720247G>A	uc001tyb.1	+	1		c.308G>A				NR_001577				Homo sapiens non-metastatic cells 2, protein (NM23B) expressed in, pseudogene 1 (NME2P1), non-coding RNA.												0						ATTCTTCCCTGGGCTGGTGAA	0.597													26	58	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39452971	39452971	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39452971A>G	uc001uwv.2	+	23	9172	c.8863A>G	c.(8863-8865)AAA>GAA	p.K2955E		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2955	Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTTAAAGGACAAAGCTCAGCC	0.428													56	84	---	---	---	---	PASS
MRPS31	10240	broad.mit.edu	37	13	41345346	41345346	+	5'UTR	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41345346C>A	uc001uxm.3	-	1						NM_005830	NP_005821	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31 precursor							mitochondrion|ribosome	protein domain specific binding				0		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)		CCCGCCCTCTCTTCCGCTTCC	0.637													4	27	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103275378	103275378	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103275378G>T	uc001vpi.3	+	6	875	c.772G>T	c.(772-774)GTG>TTG	p.V258L		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	258					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCTCTCCATTGTGACCAGTGG	0.413													63	76	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30132916	30132916	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30132916C>T	uc001wqh.2	-	4	866	c.685G>A	c.(685-687)GAG>AAG	p.E229K		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	229					cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AGAAGGGGCTCATCAGGGGCA	0.527													15	33	---	---	---	---	PASS
STON2	85439	broad.mit.edu	37	14	81736986	81736986	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81736986G>A	uc010tvu.1	-	5	2842	c.2641C>T	c.(2641-2643)CTT>TTT	p.L881F	STON2_uc001xvk.1_Intron|STON2_uc010tvt.1_Missense_Mutation_p.L678F	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	881					endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		GGAGTTGGAAGCATTAGCCAG	0.473													28	64	---	---	---	---	PASS
STON2	85439	broad.mit.edu	37	14	81736987	81736987	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81736987C>T	uc010tvu.1	-	5	2841	c.2640G>A	c.(2638-2640)ATG>ATA	p.M880I	STON2_uc001xvk.1_Intron|STON2_uc010tvt.1_Missense_Mutation_p.M677I	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	880					endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		GAGTTGGAAGCATTAGCCAGA	0.473													28	64	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106974586	106974586	+	RNA	SNP	T	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106974586T>G	uc010tyt.1	-	197		c.8775A>C								Parts of antibodies, mostly variable regions.												0						TGGCGTTGTCTCTGGAGATGG	0.507													6	19	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43762208	43762208	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43762208T>C	uc001zrs.2	-	11	1370	c.1222A>G	c.(1222-1224)AAA>GAA	p.K408E	TP53BP1_uc010udp.1_Missense_Mutation_p.K408E|TP53BP1_uc001zrq.3_Missense_Mutation_p.K413E|TP53BP1_uc001zrr.3_Missense_Mutation_p.K413E|TP53BP1_uc010udq.1_Missense_Mutation_p.K413E	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	408					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTTTGAAGTTTCTTCTGAAAA	0.443								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					5	147	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43772068	43772068	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43772068T>C	uc001zrs.2	-	6	780	c.632A>G	c.(631-633)GAT>GGT	p.D211G	TP53BP1_uc010udp.1_Missense_Mutation_p.D211G|TP53BP1_uc001zrq.3_Missense_Mutation_p.D216G|TP53BP1_uc001zrr.3_Missense_Mutation_p.D216G|TP53BP1_uc010udq.1_Missense_Mutation_p.D216G	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	211					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AGTATTAGCATCCACATCAGA	0.393								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					5	174	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48764807	48764807	+	Missense_Mutation	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48764807C>A	uc001zwx.1	-	35	4605	c.4277G>T	c.(4276-4278)GGA>GTA	p.G1426V		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1426	EGF-like 24; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACAGCGGTATCCTCCTGGTGC	0.542													28	33	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51855579	51855579	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51855579T>C	uc002abf.2	-	6	791	c.566A>G	c.(565-567)AAG>AGG	p.K189R	DMXL2_uc010ufy.1_Missense_Mutation_p.K189R|DMXL2_uc010bfa.2_Missense_Mutation_p.K189R	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	189	WD 2.					cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		ATCCTTTACCTTTCCAGCAGT	0.259													5	129	---	---	---	---	PASS
PRKCB	5579	broad.mit.edu	37	16	24043486	24043486	+	Silent	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24043486C>T	uc002dmd.2	+	4	515	c.318C>T	c.(316-318)ATC>ATT	p.I106I	PRKCB_uc002dme.2_Silent_p.I106I	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	106	Phorbol-ester/DAG-type 2.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	AGTTTAAGATCCACACGTACT	0.512													6	140	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57241997	57241997	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57241997A>G	uc002elb.2	+	3	656	c.378A>G	c.(376-378)ATA>ATG	p.I126M	RSPRY1_uc002elc.2_Missense_Mutation_p.I126M|RSPRY1_uc002eld.2_Missense_Mutation_p.I126M	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	126						extracellular region	zinc ion binding			ovary(1)	1						ATTCAATGATAACATTACACG	0.284													5	294	---	---	---	---	PASS
C16orf80	29105	broad.mit.edu	37	16	58149294	58149294	+	Missense_Mutation	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58149294T>C	uc002enb.1	-	4	621	c.344A>G	c.(343-345)AAA>AGA	p.K115R		NM_013242	NP_037374	Q9Y6A4	CP080_HUMAN	transcription factor IIB	115					multicellular organismal development						0						GATGAAGGGTTTGACCCGGGT	0.517													6	159	---	---	---	---	PASS
RRAD	6236	broad.mit.edu	37	16	66956073	66956073	+	Missense_Mutation	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66956073G>T	uc002eqn.2	-	5	985	c.833C>A	c.(832-834)GCG>GAG	p.A278E	RRAD_uc002eqo.2_Missense_Mutation_p.A278E	NM_001128850	NP_001122322	P55042	RAD_HUMAN	Ras-related associated with diabetes	278	Calmodulin-binding.				small GTPase mediated signal transduction	plasma membrane	calmodulin binding|GTP binding|GTPase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GAAGCGCTTCGCCTTTTTGCC	0.612													6	43	---	---	---	---	PASS
C16orf46	123775	broad.mit.edu	37	16	81094757	81094757	+	3'UTR	SNP	C	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81094757C>G	uc002fgc.3	-	4					C16orf46_uc010chf.2_Intron|C16orf46_uc010vno.1_3'UTR	NM_152337	NP_689550	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46 isoform 2												0						GGGGTTCTACCGCAACCGCTC	0.522													8	51	---	---	---	---	PASS
WDR16	146845	broad.mit.edu	37	17	9503464	9503464	+	Silent	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9503464G>A	uc002gly.2	+	6	786	c.717G>A	c.(715-717)CTG>CTA	p.L239L	WDR16_uc002glz.2_Silent_p.L171L|WDR16_uc010coc.2_Silent_p.L249L	NM_145054	NP_659491	Q8N1V2	WDR16_HUMAN	WD40-repeat protein upregulated in HCC isoform	239						cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						CTAAACTGCTGACAGATGTTG	0.453													12	270	---	---	---	---	PASS
RAB11FIP4	84440	broad.mit.edu	37	17	29857420	29857420	+	Missense_Mutation	SNP	A	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29857420A>G	uc002hgn.1	+	14	1959	c.1730A>G	c.(1729-1731)AAC>AGC	p.N577S	RAB11FIP4_uc002hgo.2_Missense_Mutation_p.N475S	NM_032932	NP_116321	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	577	Potential.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.|FIP-RBD.				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				GAAGCAAAAAACCTCTTTGCT	0.542													39	30	---	---	---	---	PASS
CASC3	22794	broad.mit.edu	37	17	38325868	38325868	+	Silent	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38325868C>T	uc010cwt.1	+	13	2401	c.2106C>T	c.(2104-2106)TCC>TCT	p.S702S	CASC3_uc002hue.2_Silent_p.S702S	NM_007359	NP_031385	O15234	CASC3_HUMAN	metastatic lymph node 51	702	Necessary for localization in cytoplasmic stress granules.				mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding			ovary(1)	1						GCAGGGGTTCCAGTTAATACA	0.323													5	135	---	---	---	---	PASS
HAP1	9001	broad.mit.edu	37	17	39889026	39889026	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39889026G>A	uc002hxm.1	-	2	506	c.494C>T	c.(493-495)CCA>CTA	p.P165L	JUP_uc010wfs.1_Intron|HAP1_uc002hxn.1_Missense_Mutation_p.P165L|HAP1_uc002hxo.1_Missense_Mutation_p.P165L|HAP1_uc002hxp.1_Missense_Mutation_p.P165L	NM_177977	NP_817084	P54257	HAP1_HUMAN	huntingtin-associated protein 1 isoform 2	165	HAP1 N-terminal.				brain development|protein localization|synaptic transmission	actin cytoskeleton	protein binding			ovary(2)	2		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CTTTTTGACTGGCGGAGGTAG	0.517													36	113	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40618474	40618474	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40618474C>T	uc002hzr.2	+	3	312	c.145C>T	c.(145-147)CGG>TGG	p.R49W	ATP6V0A1_uc002hzq.2_Missense_Mutation_p.R49W|ATP6V0A1_uc002hzs.2_Missense_Mutation_p.R49W|ATP6V0A1_uc010wgj.1_Missense_Mutation_p.R49W|ATP6V0A1_uc010wgk.1_Missense_Mutation_p.R49W|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc002hzp.1_Missense_Mutation_p.R49W	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	49	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TGTTTTCCAACGGAAATTTGT	0.318													6	666	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	14188211	14188211	+	3'UTR	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14188211G>T	uc002ksv.1	+	3										Homo sapiens cDNA FLJ34795 fis, clone NT2NE2005921.																		CGTAATTATTGGCATATAGTG	0.284													19	4	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	14188212	14188212	+	3'UTR	SNP	G	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14188212G>T	uc002ksv.1	+	3										Homo sapiens cDNA FLJ34795 fis, clone NT2NE2005921.																		GTAATTATTGGCATATAGTGA	0.279													19	4	---	---	---	---	PASS
LONP1	9361	broad.mit.edu	37	19	5699170	5699170	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5699170A>T	uc002mcx.2	-	10	1586	c.1553T>A	c.(1552-1554)ATC>AAC	p.I518N	LONP1_uc002mcy.2_Missense_Mutation_p.I454N|LONP1_uc010duh.2_Missense_Mutation_p.I259N|LONP1_uc010dui.2_Missense_Mutation_p.I502N|LONP1_uc002mcz.2_Missense_Mutation_p.I322N	NM_004793	NP_004784	P36776	LONM_HUMAN	mitochondrial lon peptidase 1 precursor	518					cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding				0						GAAGCAGAGGATCTTGCCCTG	0.657													15	9	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9070714	9070714	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9070714C>T	uc002mkp.2	-	3	16936	c.16732G>A	c.(16732-16734)GGT>AGT	p.G5578S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5580	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGAAGGATACCCTGTGATGTA	0.512													5	217	---	---	---	---	PASS
CYTH2	9266	broad.mit.edu	37	19	48977567	48977567	+	Silent	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48977567C>T	uc002pjj.3	+	7	976	c.676C>T	c.(676-678)CTG>TTG	p.L226L	CYTH2_uc002pji.2_RNA	NM_017457	NP_059431	Q99418	CYH2_HUMAN	cytohesin 2 isoform 1	226					actin cytoskeleton organization|endocytosis|regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|membrane fraction|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						GGGCGGGGACCTGCCTGAGGA	0.652													4	10	---	---	---	---	PASS
KIR3DL3	115653	broad.mit.edu	37	19	55239272	55239272	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55239272C>T	uc002qgu.1	+	4	569	c.551C>T	c.(550-552)CCC>CTC	p.P184L	KIR2DL3_uc002qgv.2_Intron	NM_153443	NP_703144	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three	184	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		TCCATGGGTCCCATGACACCT	0.577													13	44	---	---	---	---	PASS
C20orf94	128710	broad.mit.edu	37	20	10603312	10603312	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10603312A>C	uc010zre.1	+	8	692	c.512A>C	c.(511-513)AAA>ACA	p.K171T		NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710	171							protein binding				0						TTCAGTGTGAAAAGAACTGAA	0.418													6	21	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57429460	57429460	+	Silent	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57429460C>A	uc002xzw.2	+	1	1425	c.1140C>A	c.(1138-1140)TCC>TCA	p.S380S	GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_RNA	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	Error:Variant_position_missing_in_P63092_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GGTACGGATCCCCTGCCGCCG	0.677			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			2	1	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19725219	19725219	+	Splice_Site	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19725219C>A	uc002ykw.2	-	10	1202	c.1171_splice	c.e10+1	p.G391_splice		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						ATGAATTATACCTGAAGCATT	0.348													32	18	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17472966	17472966	+	Missense_Mutation	SNP	C	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17472966C>G	uc002zlw.2	-	2	383	c.275G>C	c.(274-276)CGC>CCC	p.R92P	GAB4_uc010gqs.1_Missense_Mutation_p.R92P	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member	92	PH.									large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GTTGATGGTGCGCAGGGGCTT	0.502													37	123	---	---	---	---	PASS
IGLL1	3543	broad.mit.edu	37	22	23915501	23915501	+	Silent	SNP	G	A	A	rs1064418	byFrequency	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23915501G>A	uc002zxd.2	-	3	712	c.594C>T	c.(592-594)CAC>CAT	p.H198H	IGLL1_uc002zxe.2_3'UTR	NM_020070	NP_064455	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1 isoform	198	C region (By similarity to lambda light- chain).|Ig-like C1-type.				immune response	extracellular region|membrane					0						TGCTCCCTTCGTGCATGACCT	0.632													6	27	---	---	---	---	PASS
SGSM1	129049	broad.mit.edu	37	22	25282686	25282686	+	Missense_Mutation	SNP	A	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25282686A>C	uc003abg.2	+	17	2083	c.1926A>C	c.(1924-1926)GAA>GAC	p.E642D	SGSM1_uc003abh.2_Missense_Mutation_p.E642D|SGSM1_uc010guu.1_Missense_Mutation_p.E587D|SGSM1_uc003abj.2_Missense_Mutation_p.E587D|SGSM1_uc003abi.1_Missense_Mutation_p.E562D	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1	642	Rab-GAP TBC.					Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5						CGGAAACAGAAAGGAAAGAGG	0.592													9	19	---	---	---	---	PASS
HDAC10	83933	broad.mit.edu	37	22	50689480	50689480	+	Translation_Start_Site	SNP	C	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50689480C>A	uc003bkg.2	-	1	355	c.-18G>T	c.(-20--16)CAGGG>CATGG		HDAC10_uc003bke.2_Intron|HDAC10_uc003bkf.2_Intron|HDAC10_uc010hav.2_Translation_Start_Site|HDAC10_uc003bkh.2_Translation_Start_Site|HDAC10_uc003bki.2_Translation_Start_Site|HDAC10_uc003bkj.2_RNA|HDAC10_uc003bkk.1_5'Flank|MAPK12_uc003bkn.2_3'UTR|MAPK12_uc003bko.2_3'UTR|MAPK12_uc003bkl.1_3'UTR	NM_032019	NP_114408	Q969S8	HDA10_HUMAN	histone deacetylase 10 isoform 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nucleus	histone deacetylase activity|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGTGGTCACCCTGGGTTCCCA	0.701													3	5	---	---	---	---	PASS
EGFL6	25975	broad.mit.edu	37	X	13636139	13636139	+	Missense_Mutation	SNP	A	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13636139A>T	uc004cvi.2	+	8	1309	c.1069A>T	c.(1069-1071)ATA>TTA	p.I357L	EGFL6_uc004cvj.2_Missense_Mutation_p.I357L|EGFL6_uc011mik.1_Missense_Mutation_p.I258L	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN	epidermal growth factor-like protein 6	357	Potential.				cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2						GAAGAATGACATAGAGGAGCG	0.393													53	16	---	---	---	---	PASS
BHLHB9	80823	broad.mit.edu	37	X	102004560	102004560	+	Missense_Mutation	SNP	G	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102004560G>A	uc010nog.2	+	4	1208	c.637G>A	c.(637-639)GAC>AAC	p.D213N	BHLHB9_uc011mrq.1_Missense_Mutation_p.D213N|BHLHB9_uc011mrr.1_Missense_Mutation_p.D213N|BHLHB9_uc011mrs.1_Missense_Mutation_p.D213N|BHLHB9_uc011mrt.1_Missense_Mutation_p.D213N|BHLHB9_uc004ejo.2_Missense_Mutation_p.D213N|BHLHB9_uc011mru.1_Missense_Mutation_p.D213N|BHLHB9_uc011mrv.1_Missense_Mutation_p.D213N	NM_001142526	NP_001135998	Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class	213						cytoplasm|nucleus	binding			ovary(2)	2						TAGGCCCAAGGACTGGTCTGA	0.463													25	6	---	---	---	---	PASS
RAB39B	116442	broad.mit.edu	37	X	154490261	154490261	+	Missense_Mutation	SNP	C	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154490261C>T	uc004fne.2	-	2	748	c.469G>A	c.(469-471)GCC>ACC	p.A157T		NM_171998	NP_741995	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	157					protein transport|small GTPase mediated signal transduction|synapse organization|vesicle-mediated transport	Golgi apparatus|plasma membrane	GTP binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACATTAATGGCATCTCGGGCT	0.512													33	44	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	155255094	155255094	+	3'UTR	SNP	T	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155255094T>C	uc004fnx.3	+	9						NM_182905	NP_878908			WAS protein family homolog 1																		TGCTCTGACATGGACACAGCC	0.617													4	9	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16262974	16262974	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16262974delA	uc001axk.1	+						SPEN_uc010obp.1_Intron	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		catctcgtacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25513154	25513154	+	IGR	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25513154delC								RUNX3 (221542 upstream) : SYF2 (35613 downstream)																							TGAGGACAGTCCCACCATCAT	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38588650	38588650	+	IGR	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38588650delC								POU3F1 (76200 upstream) : RRAGC (716365 downstream)																							TGGGTGATTTCTGCCCAGGTG	0.328													4	2	---	---	---	---	
PPIH	10465	broad.mit.edu	37	1	43131362	43131362	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43131362delA	uc001chq.2	+						PPIH_uc009vwl.2_Intron	NM_006347	NP_006338	O43447	PPIH_HUMAN	peptidylprolyl isomerase H						protein complex assembly|protein folding	cytoplasm|nuclear speck|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|ribonucleoprotein binding				0	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)			L-Proline(DB00172)	cttaaaaaagaaaaaaaaaat	0.000													5	3	---	---	---	---	
SGIP1	84251	broad.mit.edu	37	1	67147913	67147913	+	Frame_Shift_Del	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67147913delT	uc001dcr.2	+	15	1393	c.1176delT	c.(1174-1176)GATfs	p.D392fs	SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Frame_Shift_Del_p.D159fs	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	392	Pro-rich.				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TTAAAGATGATTACTTAGAAA	0.512													42	35	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	91998794	91998795	+	IGR	DEL	CA	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91998794_91998795delCA								CDC7 (7474 upstream) : HSP90B3P (101773 downstream)																							GAGTGACTATcacacacacaca	0.465													4	2	---	---	---	---	
VPS45	11311	broad.mit.edu	37	1	150116661	150116661	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150116661delA	uc001etp.2	+						VPS45_uc010pbq.1_Intron|VPS45_uc010pbs.1_Intron|VPS45_uc001etq.2_Intron	NM_007259	NP_009190	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45A						blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			ATTTAATTCTAAAAAAAAAAA	0.348													4	5	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	153995962	153995962	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153995962delT	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AAttcttttcttttttttttg	0.159													4	2	---	---	---	---	
ETV3L	440695	broad.mit.edu	37	1	157071368	157071368	+	5'Flank	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157071368delA	uc001fqq.1	-							NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				ctTAAGACTTAAAAAAAAAAA	0.025													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161429066	161429067	+	IGR	DEL	CA	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161429066_161429067delCA								C1orf192 (91402 upstream) : FCGR2A (46138 downstream)																							gacgcgcacgcacacacacaca	0.223													4	2	---	---	---	---	
FMO4	2329	broad.mit.edu	37	1	171311117	171311119	+	3'UTR	DEL	TCT	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171311117_171311119delTCT	uc001gho.2	+	10						NM_002022	NP_002013	P31512	FMO4_HUMAN	flavin containing monooxygenase 4						xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			kidney(2)|skin(1)	3	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					tattgtattatcttcttctttgt	0.000													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185893066	185893066	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185893066delA	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CTTTTCCCCTAAAAAAGCCAG	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	193242645	193242646	+	IGR	DEL	TC	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193242645_193242646delTC								CDC73 (18705 upstream) : None (None downstream)																							ttttctttcttctgtttcttgt	0.000													4	2	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202269786	202269786	+	Intron	DEL	A	-	-	rs111707317		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202269786delA	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						cctgtctcagaaaaaaaaaaa	0.159													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213003306	213003307	+	IGR	INS	-	A	A	rs35803499		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213003306_213003307insA								TATDN3 (13139 upstream) : C1orf227 (180 downstream)																							gattctgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	216774945	216774945	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216774945delC	uc001hkw.1	-						ESRRG_uc001hky.1_Intron|ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron|ESRRG_uc001hkx.1_Intron|ESRRG_uc009xdo.1_Intron|ESRRG_uc001hle.1_Intron	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	TTACCTATTTCGTACAAGTTG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224179675	224179676	+	IGR	INS	-	CG	CG	rs55793298		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224179675_224179676insCG								TP53BP2 (146001 upstream) : FBXO28 (122115 downstream)																							cgaggccccccccccgacccca	0.015													4	4	---	---	---	---	
C1orf69	200205	broad.mit.edu	37	1	228356419	228356420	+	Intron	DEL	GC	-	-	rs138027373	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228356419_228356420delGC	uc001hsl.3	+							NM_001010867	NP_001010867	Q5T440	CAF17_HUMAN	hypothetical protein LOC200205 precursor						glycine catabolic process|heme biosynthetic process	mitochondrion	aminomethyltransferase activity				0		Prostate(94;0.0405)				GGCATTGGAGGCGGCTCTGTTC	0.564													4	2	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240286806	240286807	+	Intron	INS	-	C	C	rs114666740		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240286806_240286807insC	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GTTTGTACACaaaaaaaaaaaa	0.342													5	4	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240286807	240286808	+	Intron	INS	-	C	C	rs114666740		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240286807_240286808insC	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTTGTACACaaaaaaaaaaaaa	0.342													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240815811	240815812	+	IGR	DEL	CA	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240815811_240815812delCA								GREM2 (40349 upstream) : RGS7 (115743 downstream)																							CTGCCTTCTTCACTGTCTCACA	0.441													4	2	---	---	---	---	
ROCK2	9475	broad.mit.edu	37	2	11333629	11333630	+	Intron	INS	-	AAA	AAA			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11333629_11333630insAAA	uc002rbd.1	-							NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CATAACCAACCTTAAACAAAAA	0.307													8	4	---	---	---	---	
ROCK2	9475	broad.mit.edu	37	2	11333630	11333631	+	Intron	INS	-	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11333630_11333631insA	uc002rbd.1	-							NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		ATAACCAACCTTAAACAAAAAT	0.307													8	4	---	---	---	---	
MSH2	4436	broad.mit.edu	37	2	47641747	47641747	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47641747delT	uc002rvy.1	+						MSH2_uc010yoh.1_Intron|MSH2_uc002rvz.2_Intron|MSH2_uc010fbg.2_Intron	NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2						B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding			large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ACTTTTTAACttttttttttt	0.154			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				4	3	---	---	---	---	
TIA1	7072	broad.mit.edu	37	2	70442886	70442886	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70442886delT	uc002sgj.3	-						TIA1_uc002sgk.3_Intron|TIA1_uc002sgl.3_Intron	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding						apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						GAAATTTCAAttttttttttt	0.199													4	2	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152448221	152448221	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152448221delA	uc010fnx.2	-							NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TAAAAATCAGAAAAAAACATA	0.303													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	154540938	154540938	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154540938delT								RPRM (205616 upstream) : GALNT13 (187488 downstream)																							AATGTAACTATTTTTTTTCTG	0.353													6	3	---	---	---	---	
TTC21B	79809	broad.mit.edu	37	2	166768665	166768665	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166768665delA	uc002udk.2	-							NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B							cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						CCCTTACTGGAAAAAAAAATG	0.333													4	3	---	---	---	---	
MYO3B	140469	broad.mit.edu	37	2	171472041	171472041	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171472041delG	uc002ufy.2	+						MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						ggaagtgagtgaggggagGAG	0.025													4	2	---	---	---	---	
TLK1	9874	broad.mit.edu	37	2	171923670	171923671	+	Intron	INS	-	T	T	rs146279997		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171923670_171923671insT	uc002ugn.2	-						TLK1_uc002ugo.2_Intron|TLK1_uc002ugp.2_Intron|TLK1_uc002ugq.2_Intron|TLK1_uc010zdn.1_5'Flank	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						gtgcacttaggttttttttttt	0.000													3	4	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179557608	179557609	+	Intron	INS	-	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179557608_179557609insT	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATGAAGTTAGTTTTTTTTTTT	0.302													4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495217	187495218	+	Intron	INS	-	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495217_187495218insT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgggttgtgatataaattat	0.084													7	8	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495222	187495224	+	Intron	DEL	AAA	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495222_187495224delAAA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgtgatataaattataatctt	0.089													6	9	---	---	---	---	
STAT1	6772	broad.mit.edu	37	2	191864252	191864253	+	Intron	INS	-	AA	AA			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191864252_191864253insAA	uc002usj.2	-						STAT1_uc010fse.1_Intron|STAT1_uc002usk.2_Intron|STAT1_uc002usl.2_Intron|STAT1_uc010fsf.1_Intron	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription						activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	TTCAGAGTCATAAAATACTCGG	0.272													67	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	194122827	194122827	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194122827delT								PCGEM1 (481206 upstream) : None (None downstream)																							GTAGCCCATCTTTTTTTTTTA	0.343													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	228265615	228265617	+	IGR	DEL	TGT	-	-	rs150267252		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228265615_228265617delTGT								TM4SF20 (21593 upstream) : AGFG1 (71271 downstream)																							TTGTTGTTGCTGTTGTTGTTTTT	0.429													4	3	---	---	---	---	
PER2	8864	broad.mit.edu	37	2	239174546	239174546	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239174546delT	uc002vyc.2	-						PER2_uc010znv.1_Intron|PER2_uc010znw.1_Intron|PER2_uc010fyx.1_Intron	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2						circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		ATCTTTACGAttttttttttt	0.199													4	2	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242370891	242370891	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242370891delA	uc002wbi.1	+						FARP2_uc010zoq.1_Intron|FARP2_uc010zor.1_Intron	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		actccatctcaaaaaaaaaTT	0.114													3	4	---	---	---	---	
RBM5	10181	broad.mit.edu	37	3	50130874	50130874	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50130874delA	uc003cyg.2	+						RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron|RBM5_uc003cyf.2_Intron|RBM5_uc011bdj.1_Intron|RBM5_uc011bdk.1_Intron	NM_005778	NP_005769	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		aaactgtctcaaaaaaaaaaa	0.055													6	3	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52702551	52702551	+	Frame_Shift_Del	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52702551delA	uc003des.2	-	3	359	c.347delT	c.(346-348)TTCfs	p.F116fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.F116fs|PBRM1_uc003der.2_Frame_Shift_Del_p.F116fs|PBRM1_uc003det.2_Frame_Shift_Del_p.F116fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.F116fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.F116fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.F116fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.F116fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.F116fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.F14fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	116	Bromo 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AAGAAGCTGGAAGTCAGCAGT	0.308			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								83	169	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	94638308	94638308	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94638308delT								NSUN3 (792678 upstream) : LOC255025 (18799 downstream)																							atttattctgtttttaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	101648132	101648132	+	IGR	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101648132delG								NFKBIZ (68267 upstream) : LOC152225 (11571 downstream)																							caggcggcttgttatgcagtt	0.149													4	2	---	---	---	---	
CEP63	80254	broad.mit.edu	37	3	134250992	134250992	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134250992delA	uc003eqo.1	+						CEP63_uc003eql.1_Intron|CEP63_uc003eqm.2_Intron|CEP63_uc003eqn.1_Intron	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a						cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1						AAGAGATGCTAAAATATGTTT	0.308													12	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182011281	182011281	+	IGR	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182011281delA								SOX2OT (552278 upstream) : ATP11B (500010 downstream)																							AGGCCAGGCTAAGCTGGACGC	0.428													4	2	---	---	---	---	
LCORL	254251	broad.mit.edu	37	4	17911008	17911008	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17911008delA	uc003gpq.2	-						LCORL_uc011bxk.1_Intron	NM_153686	NP_710153	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						TTAAAAAGAGAAAGGCAAATC	0.294													24	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38413905	38413905	+	IGR	DEL	A	-	-	rs35041459		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38413905delA								TBC1D1 (273112 upstream) : FLJ13197 (200417 downstream)																							AGGATTCAGCACCCGTAATAG	0.468													4	9	---	---	---	---	
CDKL2	8999	broad.mit.edu	37	4	76521111	76521111	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76521111delA	uc003hiq.2	-						CDKL2_uc011cbp.1_Intron	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2						sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			agactccatgaaaaaaaaaag	0.000													6	3	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79343327	79343327	+	Intron	DEL	T	-	-	rs72048849		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79343327delT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron|FRAS1_uc010ijj.1_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CAGTTCCATCTTTTTTTTTTC	0.274													4	3	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83801742	83801742	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83801742delA	uc003hnf.2	-						SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				attctgtctcaaaaaaaaaaa	0.109													2	5	---	---	---	---	
HERC5	51191	broad.mit.edu	37	4	89422281	89422281	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89422281delT	uc003hrt.2	+						HERC5_uc011cdm.1_Intron	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5						innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		GTTGTATGTGTTTTGACATAT	0.214													10	6	---	---	---	---	
F11	2160	broad.mit.edu	37	4	187206477	187206478	+	Intron	DEL	GT	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187206477_187206478delGT	uc003iza.1	+							NM_000128	NP_000119	P03951	FA11_HUMAN	coagulation factor XI precursor						blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity				0		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	AGCGGTCTTCgtgtgtgtgtgt	0.292													4	2	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32000586	32000597	+	Intron	DEL	TTTGTTTTTGTT	-	-	rs71863988		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000586_32000597delTTTGTTTTTGTT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCTTAAGAAGtttgtttttgtttttgtttttg	0.222													6	3	---	---	---	---	
RAI14	26064	broad.mit.edu	37	5	34811290	34811290	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34811290delT	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron|RAI14_uc010ius.1_Intron|RAI14_uc003jis.2_Intron|RAI14_uc003jit.2_Intron|RAI14_uc011cok.1_Intron	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					TATTTCAAAATATCACAGCTA	0.333													33	35	---	---	---	---	
C5orf42	65250	broad.mit.edu	37	5	37195701	37195701	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37195701delA	uc011cpa.1	-						C5orf42_uc003jks.2_Intron|C5orf42_uc011coz.1_Intron|C5orf42_uc011cpb.1_Intron	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			actctgtctcaaaaaaaaaaa	0.100													3	3	---	---	---	---	
FCHO2	115548	broad.mit.edu	37	5	72330793	72330795	+	Intron	DEL	TGA	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72330793_72330795delTGA	uc003kcl.2	+						FCHO2_uc011csl.1_Intron|FCHO2_uc011csk.1_Intron|FCHO2_uc011csm.1_Intron	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a											ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		AAATATACATTGAAATAGTTTTC	0.266													9	4	---	---	---	---	
AP3B1	8546	broad.mit.edu	37	5	77436785	77436786	+	Intron	DEL	TC	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77436785_77436786delTC	uc003kfj.2	-							NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1						endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TAATCTGTTTTCTCTCTTACTA	0.342									Hermansky-Pudlak_syndrome				15	13	---	---	---	---	
MTX3	345778	broad.mit.edu	37	5	79281748	79281748	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79281748delT	uc010jag.2	-						MTX3_uc010jah.2_Intron|MTX3_uc003kge.3_Intron	NM_001010891	NP_001010891	Q5HYI7	MTX3_HUMAN	metaxin 3						protein targeting to mitochondrion	mitochondrial outer membrane					0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		CAATAATTAGTTTTTTTTTTT	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	79655916	79655916	+	5'Flank	DEL	A	-	-	rs111607880		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79655916delA	uc003kgo.2	-											SubName: Full=Putative uncharacterized protein; Flags: Fragment;																		CCATGGGCAGAAAAAAAAAAA	0.383													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122572158	122572158	+	IGR	DEL	T	-	-	rs35571960		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122572158delT								PRDM6 (48414 upstream) : CEP120 (108422 downstream)																							GAAACCCATCTTTTTTTTTTT	0.139													2	4	---	---	---	---	
GRAMD3	65983	broad.mit.edu	37	5	125821744	125821745	+	Intron	DEL	TT	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125821744_125821745delTT	uc003ktu.2	+						GRAMD3_uc011cwt.1_Intron|GRAMD3_uc011cwv.1_Intron|GRAMD3_uc011cww.1_Intron|GRAMD3_uc011cwx.1_Intron|GRAMD3_uc011cwy.1_Intron|GRAMD3_uc011cwz.1_Intron	NM_023927	NP_076416	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3 isoform 2											central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		ACCCTTGTTATTTTTTTTACCT	0.218													4	2	---	---	---	---	
TCERG1	10915	broad.mit.edu	37	5	145877853	145877853	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145877853delT	uc003lob.2	+						TCERG1_uc003loc.2_Intron	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATCTCTTTCttttttttttt	0.294													5	3	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154297201	154297201	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154297201delA	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GGCTTACTTTAAAAAAATGGA	0.363													4	2	---	---	---	---	
ADAM19	8728	broad.mit.edu	37	5	156922002	156922002	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156922002delT	uc003lwz.2	-						ADAM19_uc003lww.1_Intron|ADAM19_uc003lwy.2_Intron|ADAM19_uc011ddr.1_Intron	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATATAAATCCttttttttttc	0.209													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159149318	159149318	+	IGR	DEL	T	-	-	rs11309955		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159149318delT								LOC285627 (256034 upstream) : ADRA1B (194422 downstream)																							AAAGGATAACTTTTTGCCAGC	0.323													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180022067	180022068	+	IGR	DEL	GT	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180022067_180022068delGT								SCGB3A1 (3580 upstream) : FLT4 (6439 downstream)																							atgtgtgggggtgtgtgtgtgg	0.114													4	2	---	---	---	---	
TFAP2B	7021	broad.mit.edu	37	6	50811238	50811238	+	3'UTR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50811238delT	uc003pag.2	+	7						NM_003221	NP_003212	Q92481	AP2B_HUMAN	transcription factor AP-2 beta						nervous system development|positive regulation of transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0	Lung NSC(77;0.156)					ACAATCAAAATTTTAAAAAAA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	145214079	145214079	+	IGR	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145214079delC								UTRN (39911 upstream) : EPM2A (732367 downstream)																							ttgagaacTTCTAGAGGCTTA	0.244													4	2	---	---	---	---	
PLEKHG1	57480	broad.mit.edu	37	6	151036611	151036612	+	Intron	INS	-	T	T	rs145273046	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151036611_151036612insT	uc003qny.1	+						PLEKHG1_uc011eel.1_Intron|PLEKHG1_uc011eem.1_Intron	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GTTCATCACTAttttttttctt	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	10525331	10525331	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10525331delT								PER4 (849884 upstream) : NDUFA4 (447484 downstream)																							CCGAAAAGTCTTAcacttgca	0.080													4	2	---	---	---	---	
OSBPL3	26031	broad.mit.edu	37	7	24911905	24911905	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24911905delT	uc003sxf.2	-						OSBPL3_uc003sxd.2_Intron|OSBPL3_uc003sxe.2_Intron|OSBPL3_uc003sxg.2_Intron|OSBPL3_uc003sxh.2_Intron|OSBPL3_uc003sxi.2_Intron	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform						lipid transport		lipid binding|protein binding			skin(1)	1						TTTAAAGCTCTTTTTTTTTTA	0.318													9	4	---	---	---	---	
UBE2D4	51619	broad.mit.edu	37	7	43989956	43989957	+	Intron	DEL	GA	-	-	rs76093392		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43989956_43989957delGA	uc003tja.1	+						POLR2J4_uc003tjc.2_Intron|UBE2D4_uc003tjb.1_Intron	NM_015983	NP_057067	Q9Y2X8	UB2D4_HUMAN	ubiquitin-conjugating enzyme E2D 4 (putative)						protein K11-linked ubiquitination|protein K27-linked ubiquitination|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0						GAAGGGGAATGAGAACCAGGAT	0.554													4	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	69006573	69006573	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69006573delT								None (None upstream) : AUTS2 (57332 downstream)																							tttccaCTAATTTTTTTTTTC	0.015													3	3	---	---	---	---	
ADAM22	53616	broad.mit.edu	37	7	87563976	87563976	+	Intron	DEL	T	-	-	rs113442861		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87563976delT	uc003ujn.2	+						ADAM22_uc003uji.1_Intron|ADAM22_uc003ujj.1_Intron|ADAM22_uc003ujk.1_Intron|ADAM22_uc003ujl.1_Intron|ADAM22_uc003ujm.2_Intron|ADAM22_uc003ujo.2_Intron|ADAM22_uc003ujp.1_5'Flank	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			CGCGGGGAGAttttttttttt	0.507													3	3	---	---	---	---	
PLOD3	8985	broad.mit.edu	37	7	100858954	100858954	+	Intron	DEL	T	-	-	rs111818481		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100858954delT	uc003uyd.2	-						ZNHIT1_uc003uye.2_5'Flank|ZNHIT1_uc003uyf.2_5'Flank	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase						protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	tttttctttctttttttttgt	0.000													4	3	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126541197	126541197	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126541197delT	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	ccctgaactattttttttttc	0.020										HNSCC(24;0.065)			5	3	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127323073	127323074	+	Intron	DEL	AA	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127323073_127323074delAA	uc003vmi.2	+							NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CCAGACATTTAAAGTATTTTTC	0.361													6	3	---	---	---	---	
PRSS1	5644	broad.mit.edu	37	7	142458842	142458842	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142458842delT	uc003wak.2	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Frame_Shift_Del_p.S135fs|PRSS1_uc003wam.2_5'Flank	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein						digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			CAGGCAAGTATCTTTTGCTGG	0.274									Hereditary_Pancreatitis				6	3	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147041185	147041185	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147041185delA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			taccatagctaaaaaatgtca	0.085										HNSCC(39;0.1)			4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	148025602	148025602	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148025602delA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ctTGGTGTTCAATAGGCCTTG	0.264										HNSCC(39;0.1)			4	2	---	---	---	---	
CUL1	8454	broad.mit.edu	37	7	148465064	148465064	+	Intron	DEL	T	-	-	rs71723434		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148465064delT	uc010lpg.2	+						CUL1_uc003wey.2_Intron|CUL1_uc003wez.2_Intron	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			AATAATGTTATTTTTTTTTTC	0.358													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148609785	148609785	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148609785delT								EZH2 (28371 upstream) : MIR1975 (28795 downstream)																							TTGTGTGTTGTTTTTTTTTTA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149700700	149700701	+	IGR	DEL	GT	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149700700_149700701delGT								ATP6V0E2 (122914 upstream) : ACTR3C (243601 downstream)																							atgttatctggtgtgtgtgtgt	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	151831420	151831420	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151831420delT								GALNT11 (11993 upstream) : MLL3 (592 downstream)																							ccagcccACCTCCCATCTAAA	0.090													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157874317	157874317	+	Intron	DEL	A	-	-	rs149259519	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157874317delA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ATGCTATCCTAAAAAATTCAC	0.378													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4408332	4408332	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4408332delC	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ctacaaaccaccaccaattgg	0.050													4	2	---	---	---	---	
AGPAT5	55326	broad.mit.edu	37	8	6564136	6564137	+	5'Flank	DEL	AA	-	-	rs111492106		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6564136_6564137delAA	uc003wqo.2	+						AGPAT5_uc011kwm.1_5'Flank	NM_018361	NP_060831	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5						phospholipid biosynthetic process	integral to membrane|mitochondrion	1-acylglycerol-3-phosphate O-acyltransferase activity				0			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		GGAAAAAGGGAAAAAAAAAAAA	0.480													4	2	---	---	---	---	
RNF122	79845	broad.mit.edu	37	8	33406740	33406740	+	Intron	DEL	A	-	-	rs71899502		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33406740delA	uc003xjo.1	-							NM_024787	NP_079063	Q9H9V4	RN122_HUMAN	ring finger protein 122							endoplasmic reticulum|Golgi apparatus|integral to membrane	zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(67;0.0966)|Kidney(114;0.116)		actccaactcaaaaaaaaaag	0.239													4	2	---	---	---	---	
XKR4	114786	broad.mit.edu	37	8	56270664	56270664	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56270664delA	uc003xsf.2	+							NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			TCTTAGTAGGAAAAAAAAAAT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	65034503	65034503	+	IGR	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65034503delA								YTHDF3 (909158 upstream) : MIR124-2 (257203 downstream)																							tgtttgtaacaaaaaaaaagg	0.000													4	2	---	---	---	---	
ARFGEF1	10565	broad.mit.edu	37	8	68109260	68109260	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68109260delG	uc003xxl.1	-							NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine						exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TTAATGCCATGTACCACACAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	88515779	88515781	+	IGR	DEL	TGC	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88515779_88515781delTGC								CNBD1 (120824 upstream) : DCAF4L2 (367192 downstream)																							ttgttgttgttgctgctgctgct	0.291													4	2	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	128807893	128807893	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128807893delA	uc003ysj.2	+						PVT1_uc010mdq.2_Intron|PVT1_uc010mdp.1_Intron|MIR1204_hsa-mir-1204|MI0006337_5'Flank					Human proto-oncogene myc mRNA, 5' end, clone DMmyc.												0						CCTTGCTAGGAAAAAAAAACT	0.502													4	2	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141697879	141697880	+	Intron	INS	-	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141697879_141697880insA	uc003yvu.2	-						PTK2_uc011ljp.1_Intron|PTK2_uc003yvo.2_Intron|PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			GTAGTAGGAAGTTGGTGAAGGA	0.490													2	6	---	---	---	---	
AQP3	360	broad.mit.edu	37	9	33445447	33445447	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33445447delG	uc003zsx.2	-						SUGT1P1_uc010mjq.1_Intron|AQP3_uc003zsv.1_Intron|AQP3_uc003zsw.2_5'Flank|AQP3_uc010mju.2_Intron	NM_004925	NP_004916	Q92482	AQP3_HUMAN	aquaporin 3						excretion|odontogenesis|positive regulation of immune system process|regulation of keratinocyte differentiation|response to calcium ion|response to retinoic acid|response to vitamin D	basolateral plasma membrane|cell-cell junction|cytoplasm	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		GCAATGACATGGGGCAAAGGT	0.403													4	2	---	---	---	---	
KIF24	347240	broad.mit.edu	37	9	34254843	34254844	+	Intron	INS	-	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34254843_34254844insG	uc003zua.3	-						KIF24_uc010mkb.2_Intron	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)			GGATAGAGGCTGGAAACATTTT	0.540													4	2	---	---	---	---	
AQP7P1	375719	broad.mit.edu	37	9	67291107	67291108	+	5'Flank	DEL	TG	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67291107_67291108delTG	uc004aen.1	-						AQP7P1_uc004aeo.1_5'Flank|AQP7P1_uc004aep.1_5'Flank					Homo sapiens cDNA FLJ46364 fis, clone TESTI4051015.												0						TGTTATAATTTGTGTTTCTGCA	0.366													6	3	---	---	---	---	
PIP5K1B	8395	broad.mit.edu	37	9	71437244	71437244	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71437244delA	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		ccccatctctaaaaaaaaaaa	0.114													2	4	---	---	---	---	
ZCCHC6	79670	broad.mit.edu	37	9	88940046	88940046	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88940046delC	uc004aoq.2	-						ZCCHC6_uc011ltf.1_Intron|ZCCHC6_uc004aor.2_Intron|ZCCHC6_uc004aos.2_Intron|ZCCHC6_uc004aot.2_Intron|ZCCHC6_uc004aou.2_Intron	NM_024617	NP_078893	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6						RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2						GTTGTTTATACTTTAAAAACC	0.373													7	5	---	---	---	---	
SPIN1	10927	broad.mit.edu	37	9	91089886	91089886	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91089886delT	uc010mqj.2	+						SPIN1_uc004apy.2_Intron|SPIN1_uc004apz.2_Intron|SPIN1_uc010mqk.2_Intron	NM_006717	NP_006708	Q9Y657	SPIN1_HUMAN	spindlin						cell cycle|gamete generation|multicellular organismal development	nucleus	methylated histone residue binding				0						GCtattaaaattttttttaag	0.085													4	2	---	---	---	---	
ZNF510	22869	broad.mit.edu	37	9	99537348	99537348	+	Intron	DEL	T	-	-	rs113196824		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99537348delT	uc004awn.1	-						ZNF510_uc004awo.1_Intron	NM_014930	NP_055745	Q9Y2H8	ZN510_HUMAN	zinc finger protein 510						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				TGtttttttgttttttttttt	0.204													6	4	---	---	---	---	
PTPN3	5774	broad.mit.edu	37	9	112145032	112145032	+	Intron	DEL	T	-	-	rs113019092		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112145032delT	uc004bed.2	-						PTPN3_uc004beb.2_Intron|PTPN3_uc004bec.2_Intron|PTPN3_uc010mtu.2_Intron|PTPN3_uc011lwg.1_Intron|PTPN3_uc011lwh.1_Intron|PTPN3_uc011lwd.1_Intron|PTPN3_uc011lwe.1_Intron|PTPN3_uc011lwf.1_Intron	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type						negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						ATGCTGACTGTTTTTTTTTTT	0.259													4	2	---	---	---	---	
DFNB31	25861	broad.mit.edu	37	9	117169973	117169974	+	Intron	INS	-	GTCAAA	GTCAAA	rs144578991	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117169973_117169974insGTCAAA	uc004biz.3	-						DFNB31_uc004bix.2_Intron|DFNB31_uc004biy.3_Intron|DFNB31_uc004bja.3_Intron	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1						inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6						taagaaacttggtcaTACTGTG	0.272													3	3	---	---	---	---	
FAM73B	84895	broad.mit.edu	37	9	131823751	131823752	+	Intron	INS	-	GA	GA			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131823751_131823752insGA	uc004bxa.2	+						FAM73B_uc004bwy.2_Intron|FAM73B_uc004bwz.2_Intron|FAM73B_uc011mbn.1_Intron	NM_032809	NP_116198	Q7L4E1	FA73B_HUMAN	hypothetical protein LOC84895							integral to membrane				skin(1)	1						GGCTGCCTGAGGGCCGTGGTGA	0.579													6	3	---	---	---	---	
FNBP1	23048	broad.mit.edu	37	9	132741928	132741928	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132741928delT	uc004byw.1	-						FNBP1_uc011mbv.1_Intron|FNBP1_uc011mbw.1_Intron|FNBP1_uc004bza.2_Intron|FNBP1_uc004byz.1_Intron|FNBP1_uc004byx.1_Intron|FNBP1_uc004byy.1_Intron	NM_015033	NP_055848	Q96RU3	FNBP1_HUMAN	formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		AGTGGCtttctttttttttga	0.184			T	MLL	AML								4	2	---	---	---	---	
C10orf18	54906	broad.mit.edu	37	10	5798406	5798422	+	Intron	DEL	TACCTGATTCATTTATT	-	-	rs2797495	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5798406_5798422delTACCTGATTCATTTATT	uc001iij.2	+						C10orf18_uc001iik.2_Intron	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906											ovary(1)|central_nervous_system(1)	2						TTGTTAACAATACCTGATTCATTTATTTTATATATAA	0.184													5	6	---	---	---	---	
FAM171A1	221061	broad.mit.edu	37	10	15256751	15256751	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15256751delC	uc001iob.2	-							NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor							integral to membrane				ovary(2)|breast(1)|skin(1)	4						TCACCCCACGCCCTGTCtttt	0.229													4	4	---	---	---	---	
RUFY2	55680	broad.mit.edu	37	10	70146113	70146113	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70146113delT	uc001job.2	-						RUFY2_uc001jnz.1_Intron|RUFY2_uc001joc.2_Intron|RUFY2_uc010qiw.1_Intron|RUFY2_uc001jod.1_Intron|RUFY2_uc009xpv.1_Intron	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a							nucleus	metal ion binding			ovary(1)	1						GTGCTACTGAttttttttttc	0.149													6	3	---	---	---	---	
MINPP1	9562	broad.mit.edu	37	10	89272588	89272588	+	Intron	DEL	A	-	-	rs74898523		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89272588delA	uc001keu.2	+						MINPP1_uc009xtf.1_Intron|MINPP1_uc001kev.2_Intron	NM_004897	NP_004888	Q9UNW1	MINP1_HUMAN	multiple inositol polyphosphate histidine						bone mineralization|polyphosphate metabolic process	endoplasmic reticulum lumen	acid phosphatase activity|bisphosphoglycerate 3-phosphatase activity|multiple inositol-polyphosphate phosphatase activity|phosphohistidine phosphatase activity			urinary_tract(1)	1		Colorectal(252;0.122)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00123)		gaccctgtccaaaaaaaaaag	0.030													4	2	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94296845	94296845	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94296845delA	uc001kia.2	-							NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GTACCACGGTAAAAAAAAAAA	0.209													4	2	---	---	---	---	
MYOF	26509	broad.mit.edu	37	10	95076465	95076465	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95076465delC	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc009xue.2_Intron	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						CAAATGTAAGCCCTACCCAAG	0.378													141	73	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	102613998	102613999	+	IGR	DEL	AA	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102613998_102613999delAA								PAX2 (24301 upstream) : FAM178A (58327 downstream)																							CATCATCATTAATGGGCTAAAC	0.540													4	2	---	---	---	---	
PNLIPRP2	5408	broad.mit.edu	37	10	118383815	118383816	+	Intron	INS	-	CA	CA	rs144051797	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118383815_118383816insCA	uc001lcq.2	+						PNLIPRP2_uc009xyu.1_Intron|PNLIPRP2_uc009xyv.1_Intron	NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		acttacacattcacacacactg	0.282													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119351566	119351566	+	IGR	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119351566delG								EMX2 (42510 upstream) : RAB11FIP2 (412863 downstream)																							GATCCCTTGAGGCTACAGCTG	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	2110709	2110709	+	IGR	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2110709delA								H19 (91644 upstream) : IGF2 (39639 downstream)																							ttgatgacagaggggcggagg	0.000													4	2	---	---	---	---	
DENND5A	23258	broad.mit.edu	37	11	9166336	9166336	+	Intron	DEL	A	-	-	rs112911509		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9166336delA	uc001mhl.2	-						DENND5A_uc001mhk.2_Intron|DENND5A_uc010rbw.1_Intron	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1											liver(1)	1						actccgtctcaaaaaaaaaaa	0.164													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34042830	34042830	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34042830delT								LMO2 (128994 upstream) : CAPRIN1 (30400 downstream)																							TTCTTCAAGATTAATGGGTGA	0.378													4	2	---	---	---	---	
NAT10	55226	broad.mit.edu	37	11	34162956	34162957	+	Intron	DEL	CA	-	-	rs113817730		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34162956_34162957delCA	uc001mvk.2	+						NAT10_uc010ren.1_Intron	NM_024662	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 isoform a							nucleolus	ATP binding|N-acetyltransferase activity|protein binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				CATcacacatcacacacacaca	0.287													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	38904356	38904356	+	IGR	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38904356delA								None (None upstream) : None (None downstream)																							CTAATTGAGGAAAAAAAATTG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68396483	68396483	+	IGR	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68396483delC								SAPS3 (13684 upstream) : GAL (55500 downstream)																							gccagtttttctccttcacat	0.000													4	2	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70396615	70396615	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70396615delC	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TAAAGTCTAGCCCACTGCTAC	0.527													4	2	---	---	---	---	
POLD3	10714	broad.mit.edu	37	11	74340306	74340306	+	Frame_Shift_Del	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74340306delA	uc001ovf.1	+	9	1019	c.944delA	c.(943-945)GAAfs	p.E315fs	POLD3_uc009yua.1_Frame_Shift_Del_p.E209fs	NM_006591	NP_006582	Q15054	DPOD3_HUMAN	DNA-directed DNA polymerase delta 3	315					base-excision repair|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|mismatch repair|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm	DNA-directed DNA polymerase activity|protein binding			kidney(2)|ovary(1)	3	Breast(11;3.21e-06)					AAGGAAACTGAAAACATGAGG	0.388													85	77	---	---	---	---	
SLCO2B1	11309	broad.mit.edu	37	11	74876867	74876867	+	Frame_Shift_Del	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74876867delT	uc001owb.2	+	4	708	c.321delT	c.(319-321)TATfs	p.Y107fs	SLCO2B1_uc010rrq.1_Intron|SLCO2B1_uc010rrr.1_Intron|SLCO2B1_uc010rrs.1_5'UTR|SLCO2B1_uc001owc.2_5'UTR|SLCO2B1_uc001owd.2_Frame_Shift_Del_p.Y85fs	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	107	Helical; Name=2; (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	TTGTGAGCTATTTTGGCAGCC	0.587													147	147	---	---	---	---	
GAB2	9846	broad.mit.edu	37	11	77994931	77994931	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77994931delT	uc001ozh.2	-						GAB2_uc001ozg.2_Intron	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			tctgagattcttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	94742823	94742824	+	IGR	INS	-	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94742823_94742824insA								KDM4D (10149 upstream) : KDM4DL (15598 downstream)																							TCtgttaaaagaaaaaaaaccc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112652883	112652883	+	IGR	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112652883delA								PTS (512206 upstream) : NCAM1 (179112 downstream)																							tgaaacagacaaaaaaaaata	0.000													5	4	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126391552	126391553	+	Intron	DEL	TC	-	-	rs34230682		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126391552_126391553delTC	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		AGGTGTTGGTTCTCTCTCTCTC	0.347													4	2	---	---	---	---	
ARHGAP32	9743	broad.mit.edu	37	11	128838662	128838662	+	3'UTR	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128838662delG	uc009zcp.2	-	22					ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_3'UTR|ARHGAP32_uc001qez.2_3'UTR	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1						cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						AAAAGATGCTGATTTGTTTAC	0.328													4	2	---	---	---	---	
NRIP2	83714	broad.mit.edu	37	12	2944326	2944327	+	5'Flank	DEL	TG	-	-	rs67988987		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2944326_2944327delTG	uc001qlc.2	-						NRIP2_uc010sed.1_5'Flank|uc009zdz.1_5'Flank	NM_031474	NP_113662	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2						proteolysis|transcription, DNA-dependent	cytoplasm|nucleus	aspartic-type endopeptidase activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			ATGGGGCgtatgtgtgtgtgtg	0.446													4	2	---	---	---	---	
KRT73	319101	broad.mit.edu	37	12	53009412	53009412	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53009412delG	uc001sas.2	-							NM_175068	NP_778238	Q86Y46	K2C73_HUMAN	keratin 73							keratin filament	structural molecule activity			large_intestine(2)|ovary(2)|skin(2)	6				BRCA - Breast invasive adenocarcinoma(357;0.189)		ACAGAAGCATGCCAGCTACCC	0.537													4	2	---	---	---	---	
ZFC3H1	196441	broad.mit.edu	37	12	72005128	72005128	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72005128delA	uc001swo.2	-							NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2						RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						TTCACAGGAGaaaaaaaaaac	0.259													4	2	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78392511	78392511	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78392511delT	uc001syp.2	+						NAV3_uc001syo.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAACAGGTCCTTCCAAATGCA	0.264										HNSCC(70;0.22)			3	3	---	---	---	---	
TMTC2	160335	broad.mit.edu	37	12	83489010	83489010	+	Intron	DEL	T	-	-	rs80203455		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83489010delT	uc001szt.2	+						TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						tttttttttgttttttttttt	0.010													1	5	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104157766	104157766	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104157766delT	uc001tjw.2	+						STAB2_uc009zug.2_Intron	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TTAGATGTCCttttttttttt	0.060													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	108113475	108113475	+	IGR	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108113475delG								PWP1 (7218 upstream) : PRDM4 (13169 downstream)																							AAACTGGCCAGGCCATCAAGG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114857802	114857802	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114857802delT								TBX5 (11555 upstream) : TBX3 (250257 downstream)																							TTCCCTGCCCTTTGCCTTTGT	0.557													4	2	---	---	---	---	
MLXIP	22877	broad.mit.edu	37	12	122618624	122618625	+	Intron	INS	-	C	C			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122618624_122618625insC	uc001ubq.2	+						MLXIP_uc001ubr.2_Frame_Shift_Ins_p.T359fs|MLXIP_uc001ubt.2_Intron	NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN	MLX interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding			ovary(2)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		TGTGACCACCACCACCACCCTG	0.525													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20923732	20923733	+	IGR	INS	-	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20923732_20923733insA								GJB6 (117198 upstream) : CRYL1 (54076 downstream)																							TCTTGCCATTTAAAAATCTACC	0.535													4	2	---	---	---	---	
ZDHHC20	253832	broad.mit.edu	37	13	21976061	21976062	+	Intron	INS	-	AAA	AAA			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21976061_21976062insAAA	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		TAGACCACATCAAATAATACTG	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31582003	31582003	+	IGR	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31582003delG								C13orf26 (32852 upstream) : HSPH1 (128762 downstream)																							GAGAGACACTGGGAAAGAGCT	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	69560508	69560509	+	IGR	INS	-	ATA	ATA	rs138891114	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69560508_69560509insATA								None (None upstream) : KLHL1 (714217 downstream)																							TATGAGATGCTATAATGAGCTA	0.307													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	110769066	110769066	+	IGR	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110769066delG								IRS2 (330152 upstream) : COL4A1 (32245 downstream)																							CATGTGCTGCGGGGGGCGAGT	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19123636	19123636	+	IGR	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19123636delG								None (None upstream) : OR11H12 (253958 downstream)																							AACATCTGAAGGAACACCTGA	0.428													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106846005	106846005	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106846005delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ACAAATAAAGAAAAAAAAACA	0.428													6	3	---	---	---	---	
GOLGA8DP	100132979	broad.mit.edu	37	15	22711191	22711192	+	Intron	INS	-	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22711191_22711192insG	uc010axw.2	-						GOLGA8DP_uc010axx.2_Intron|uc010tzw.1_5'Flank|uc001yum.2_5'Flank	NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E												0						CTCCTCTGTCTGTGAAGCCAGG	0.569													4	2	---	---	---	---	
WHAMML1	339005	broad.mit.edu	37	15	23200510	23200511	+	Intron	DEL	TC	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23200510_23200511delTC	uc001yvg.2	-						WHAMML1_uc010ayc.2_Intron|WHAMML1_uc010ayd.2_Intron|WHAMML1_uc010aye.1_Intron	NR_003521				Homo sapiens mRNA; cDNA DKFZp313L2232 (from clone DKFZp313L2232).												0						CTGCAGAACATCTTTTTTAAAA	0.149													2	4	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	33780651	33780651	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33780651delT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAGTCTTGCCTTTTTTTTTTT	0.333													5	3	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	33951887	33951887	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33951887delC	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTGTCCAGCTCTGGGCAAAGC	0.458													170	116	---	---	---	---	
CHAC1	79094	broad.mit.edu	37	15	41246774	41246774	+	Intron	DEL	T	-	-	rs72422019		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41246774delT	uc001znh.2	+						CHAC1_uc010uct.1_Intron	NM_024111	NP_077016	Q9BUX1	CHAC1_HUMAN	ChaC, cation transport regulator-like 1 isoform						apoptosis in response to endoplasmic reticulum stress|response to unfolded protein	cytosol	protein binding				0		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.66e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.163)		TTGTCAACTGTTTTTTTTTTt	0.090													6	3	---	---	---	---	
ZFP106	64397	broad.mit.edu	37	15	42736773	42736774	+	Intron	INS	-	CCCCTTTCTTGCTGT	CCCCTTTCTTGCTGT	rs139713226	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42736773_42736774insCCCCTTTCTTGCTGT	uc001zpw.2	-						ZFP106_uc001zpu.2_Intron|ZFP106_uc001zpv.2_Intron|ZFP106_uc001zpx.2_Intron	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog							nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		tagggagaacacccttgtgggg	0.000													4	5	---	---	---	---	
TCF12	6938	broad.mit.edu	37	15	57524289	57524289	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57524289delT	uc002aec.2	+						TCF12_uc010ugm.1_Intron|TCF12_uc010ugn.1_Intron|TCF12_uc002aea.2_Intron|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Intron|TCF12_uc002aed.2_Intron|TCF12_uc002aee.2_Intron|TCF12_uc010bft.2_Intron|TCF12_uc010ugo.1_Intron	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b						immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CTTAGATTACTTTTTTCCCTA	0.318			T	TEC	extraskeletal myxoid chondrosarcoma								4	2	---	---	---	---	
ANXA2	302	broad.mit.edu	37	15	60649686	60649686	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60649686delT	uc002agn.2	-						ANXA2_uc002agk.2_Intron|ANXA2_uc002agl.2_Intron|ANXA2_uc002agm.2_Intron|ANXA2_uc010uhd.1_Intron|ANXA2_uc010bgj.2_Intron	NM_001136015	NP_001129487	P07355	ANXA2_HUMAN	annexin A2 isoform 2						angiogenesis|positive regulation of vesicle fusion|skeletal system development	basement membrane|melanosome|midbody|soluble fraction	calcium ion binding|calcium-dependent phospholipid binding|cytoskeletal protein binding|phospholipase inhibitor activity			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Tenecteplase(DB00031)	GTTAATATGGTTTTTTTTTTT	0.219													4	2	---	---	---	---	
VPS13C	54832	broad.mit.edu	37	15	62167305	62167305	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62167305delG	uc002agz.2	-						VPS13C_uc002aha.2_Intron|VPS13C_uc002ahb.1_Intron|VPS13C_uc002ahc.1_Intron	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A						protein localization					ovary(2)	2						AATATGGATAGAATATCTATT	0.299													4	2	---	---	---	---	
RPL4	6124	broad.mit.edu	37	15	66796912	66796912	+	Intron	DEL	C	-	-	rs139436991	byFrequency	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66796912delC	uc002apv.2	-						RPL4_uc010bhr.2_Intron|RPL4_uc002apw.2_Intron|RPL4_uc002apx.2_Intron|RPL4_uc010ujq.1_Intron|SNORD18B_uc002apy.1_5'Flank|SNORD16_uc010bht.2_5'Flank|SNORD18A_uc002apz.1_5'Flank|ZWILCH_uc010bhu.1_5'Flank|ZWILCH_uc002aqb.2_5'Flank|ZWILCH_uc002aqa.2_5'Flank|ZWILCH_uc010bhv.2_5'Flank	NM_000968	NP_000959	P36578	RL4_HUMAN	ribosomal protein L4						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						TCCACTACTGCTTCCCGGCGC	0.532													6	4	---	---	---	---	
STRA6	64220	broad.mit.edu	37	15	74490449	74490449	+	Intron	DEL	T	-	-	rs111675537		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74490449delT	uc002axk.2	-						STRA6_uc002axi.2_5'Flank|STRA6_uc010ulh.1_Intron|STRA6_uc002axj.2_Intron|STRA6_uc010bji.2_Intron|STRA6_uc002axl.2_Intron|STRA6_uc002axm.2_Intron|STRA6_uc002axn.2_Intron|STRA6_uc010uli.1_Intron|STRA6_uc010bjj.1_Intron|STRA6_uc010bjk.2_Intron	NM_022369	NP_071764	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid gene 6 homolog						adrenal gland development|alveolar primary septum development|developmental growth|diaphragm development|digestive tract morphogenesis|ear development|embryonic camera-type eye formation|embryonic digestive tract development|eyelid development in camera-type eye|face morphogenesis|feeding behavior|female genitalia development|kidney development|lung vasculature development|neuromuscular process|nose morphogenesis|paramesonephric duct development|positive regulation of behavior|pulmonary artery morphogenesis|pulmonary valve morphogenesis|smooth muscle tissue development|transport|uterus morphogenesis|ventricular septum development|vocal learning	integral to membrane|plasma membrane|protein complex	receptor activity			central_nervous_system(1)	1						ACttattctcttttttttttt	0.269													4	2	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85449173	85449174	+	Intron	INS	-	C	C	rs28506898		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85449173_85449174insC	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AAAAAAAAAAACCCAAATCTGC	0.297													2	4	---	---	---	---	
TARSL2	123283	broad.mit.edu	37	15	102212795	102212810	+	Intron	DEL	GAAAGCTGACTCCTGG	-	-	rs71769259		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102212795_102212810delGAAAGCTGACTCCTGG	uc002bxm.2	-						TARSL2_uc002bxl.2_Intron|TARSL2_uc010usi.1_Intron	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2						threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCATCATCAAGAAAGCTGACTCCTGGGAAAGCTGAC	0.560													4	4	---	---	---	---	
TPSAB1	7177	broad.mit.edu	37	16	1291717	1291718	+	Intron	INS	-	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1291717_1291718insG	uc002ckz.2	+						TPSAB1_uc010uux.1_Intron	NM_003294	NP_003285	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1 precursor						defense response|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				CTGGGGACAGTGGAGGTGGGGC	0.703													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5238445	5238445	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5238445delT								FAM86A (90656 upstream) : A2BP1 (830687 downstream)																							acatttaaactttttttagat	0.000													4	2	---	---	---	---	
ACSM2A	123876	broad.mit.edu	37	16	20488363	20488363	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20488363delG	uc010bwe.2	+						ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron|ACSM2A_uc002dhh.3_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						ATTGCATATTGGTGATCCCAT	0.244													4	2	---	---	---	---	
USP31	57478	broad.mit.edu	37	16	23161923	23161923	+	5'Flank	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23161923delA	uc002dll.2	-							NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		TGGTTCCATTAAAAAAAAAAT	0.224													6	3	---	---	---	---	
ARHGAP17	55114	broad.mit.edu	37	16	24947165	24947165	+	Intron	DEL	T	-	-	rs9932591	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24947165delT	uc002dnb.2	-						ARHGAP17_uc002dmy.2_Translation_Start_Site|ARHGAP17_uc002dmz.2_Intron|ARHGAP17_uc002dna.2_Intron|ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		CTTGGTGCCAtttttttttta	0.194													4	2	---	---	---	---	
QPRT	23475	broad.mit.edu	37	16	29703186	29703187	+	Intron	INS	-	CC	CC	rs148564017	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29703186_29703187insCC	uc002dto.2	+						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|QPRT_uc010vdu.1_Intron	NM_014298	NP_055113	Q15274	NADC_HUMAN	quinolinate phosphoribosyltransferase						protein oligomerization|quinolinate catabolic process|water-soluble vitamin metabolic process	cytosol	nicotinate-nucleotide diphosphorylase (carboxylating) activity|protein homodimerization activity				0					Niacin(DB00627)	GGCTTGTGGCTCGGAGGGGAGG	0.589													4	2	---	---	---	---	
KIF22	3835	broad.mit.edu	37	16	29810383	29810383	+	Frame_Shift_Del	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29810383delA	uc002dts.3	+	5	661	c.637delA	c.(637-639)AAGfs	p.K213fs	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|KIF22_uc010vdv.1_Frame_Shift_Del_p.K145fs|KIF22_uc010vdw.1_Frame_Shift_Del_p.K145fs|KIF22_uc010bzf.2_Frame_Shift_Del_p.K145fs	NM_007317	NP_015556	Q14807	KIF22_HUMAN	kinesin family member 22	213	Kinesin-motor.				blood coagulation|DNA repair|microtubule-based movement|mitosis	cytosol|kinetochore|microtubule|nucleus	ATP binding|DNA binding|microtubule motor activity|protein binding				0						TCTCTCCCAGAAGCCCATCAG	0.577													27	13	---	---	---	---	
LOC440354	440354	broad.mit.edu	37	16	30278810	30278811	+	RNA	INS	-	A	A			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30278810_30278811insA	uc010vep.1	-	2		c.2416_2417insT								Homo sapiens mRNA; cDNA DKFZp686H21113 (from clone DKFZp686H21113).												0						aaagcaaaattaaaaaaaAAAA	0.124													4	3	---	---	---	---	
SIAH1	6477	broad.mit.edu	37	16	48445321	48445322	+	Intron	INS	-	AGA	AGA	rs139022597	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48445321_48445322insAGA	uc002efl.2	-									Q8IUQ4	SIAH1_HUMAN	Homo sapiens SIAH1 mRNA for seven in absentia homolog 1 isoform a, complete cds, clone: FLJ08065AAAN.						axon guidance|cell cycle|neuron apoptosis|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	beta-catenin destruction complex|cytosol|nucleus	protein C-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				aaaaTTCTGAGAGGTGAGGGGA	0.243													3	5	---	---	---	---	
TSNAXIP1	55815	broad.mit.edu	37	16	67854645	67854645	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67854645delA	uc002euj.2	+						TSNAXIP1_uc010cep.2_Intron|TSNAXIP1_uc010vjz.1_Intron|TSNAXIP1_uc002euf.3_Intron|TSNAXIP1_uc010vka.1_Intron|TSNAXIP1_uc010vkb.1_Intron|TSNAXIP1_uc002eug.3_Intron|TSNAXIP1_uc002euh.3_Intron|TSNAXIP1_uc002eui.3_Intron|TSNAXIP1_uc002euk.2_5'Flank	NM_018430	NP_060900	Q2TAA8	TXIP1_HUMAN	translin-associated factor X interacting protein						cell differentiation|multicellular organismal development|spermatogenesis	perinuclear region of cytoplasm					0		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)		agactgtctcaaaaaaaaaaa	0.254													6	4	---	---	---	---	
MAF	4094	broad.mit.edu	37	16	79632506	79632507	+	3'UTR	INS	-	GG	GG			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79632506_79632507insGG	uc002ffn.2	-	1					MAF_uc002ffm.2_Intron	NM_001031804	NP_001026974	O75444	MAF_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene						transcription from RNA polymerase II promoter	chromatin|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		tgtgtgtgtgtggtgtgtgcgt	0.446			T	IGH@	MM								4	2	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2907078	2907078	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2907078delG	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						gtccccaagaggggggaacaa	0.129													4	2	---	---	---	---	
DHX33	56919	broad.mit.edu	37	17	5364627	5364627	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5364627delT	uc002gca.2	-						DHX33_uc002gbz.2_5'UTR|DHX33_uc002gcb.2_Intron|DHX33_uc010clf.2_Intron	NM_020162	NP_064547	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33							nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|pancreas(1)	2						CCTTTCCTTCTTTTTTTTTTT	0.279													4	2	---	---	---	---	
MYH1	4619	broad.mit.edu	37	17	10412686	10412688	+	Intron	DEL	CTC	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10412686_10412688delCTC	uc002gmo.2	-						uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult							muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						ATAAGGAATTCTCCTCATGTTTT	0.325													16	10	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11701016	11701016	+	Frame_Shift_Del	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11701016delC	uc002gne.2	+	43	8394	c.8326delC	c.(8326-8328)CTTfs	p.L2776fs	DNAH9_uc010coo.2_Frame_Shift_Del_p.L2070fs	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2776					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GTCTTGGGAACTTTTGACCCA	0.488													138	104	---	---	---	---	
COPS3	8533	broad.mit.edu	37	17	17165013	17165013	+	Intron	DEL	A	-	-	rs72321449		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17165013delA	uc002grd.2	-						COPS3_uc010vwv.1_Intron|COPS3_uc010vww.1_Intron	NM_003653	NP_003644	Q9UNS2	CSN3_HUMAN	COP9 constitutive photomorphogenic homolog						cullin deneddylation|response to light stimulus|signal transduction	cytoplasm|signalosome	protein binding			skin(1)	1						gtctctagggaaaaaaaaaaa	0.159													4	2	---	---	---	---	
RAI1	10743	broad.mit.edu	37	17	17642416	17642417	+	Intron	DEL	GT	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17642416_17642417delGT	uc002grm.2	+							NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		GCAATTCAAAGTGAAGAACGGG	0.554													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18988562	18988562	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18988562delT								GRAP (38226 upstream) : GRAPL (42220 downstream)																							CTGATGTGTGTTTTTTTTTTT	0.279													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21237414	21237417	+	IGR	DEL	CCCT	-	-	rs10587360		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21237414_21237417delCCCT								MAP2K3 (18865 upstream) : KCNJ12 (42282 downstream)																							gagcagagacccctccctcttaag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21328103	21328104	+	IGR	INS	-	A	A	rs144296496		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21328103_21328104insA								KCNJ12 (4924 upstream) : C17orf51 (103468 downstream)																							TGCCATGATCTGGGGTACAAGC	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	27632614	27632614	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27632614delT								NUFIP2 (11448 upstream) : TAOK1 (85329 downstream)																							cgtgtaactatttttttttcc	0.000													4	2	---	---	---	---	
KRT15	3866	broad.mit.edu	37	17	39675296	39675296	+	5'Flank	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39675296delT	uc002hwy.2	-						KRT15_uc002hwz.2_5'Flank|KRT15_uc002hxa.2_5'Flank|KRT15_uc002hxb.1_Intron	NM_002275	NP_002266	P19012	K1C15_HUMAN	keratin 15						epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000286)				TTCTCTTCTATTTTTTTTTAA	0.433													6	3	---	---	---	---	
VPS25	84313	broad.mit.edu	37	17	40927065	40927065	+	Intron	DEL	T	-	-	rs151270458	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40927065delT	uc002ibi.2	+							NM_032353	NP_115729	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25						cellular membrane organization|endosome transport|protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endosome membrane|nucleoplasm					0		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		TTCATGATACtttttttttgg	0.164													4	2	---	---	---	---	
ITGA2B	3674	broad.mit.edu	37	17	42453970	42453970	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42453970delT	uc002igt.1	-						ITGA2B_uc002igu.1_Intron	NM_000419	NP_000410	P08514	ITA2B_HUMAN	integrin alpha 2b preproprotein						axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Tirofiban(DB00775)	TTCAAAGACCttttttttttt	0.239													8	5	---	---	---	---	
MTMR4	9110	broad.mit.edu	37	17	56581545	56581546	+	Frame_Shift_Ins	INS	-	GT	GT			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56581545_56581546insGT	uc002iwj.2	-	14	1631_1632	c.1521_1522insAC	c.(1519-1524)TACGGCfs	p.Y507fs		NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	507_508	Myotubularin phosphatase.					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGAAGGTGCCGTAGAGGCAGG	0.559													60	43	---	---	---	---	
DDX42	11325	broad.mit.edu	37	17	61878276	61878276	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61878276delC	uc002jbu.2	+						DDX42_uc002jbv.2_Intron|DDX42_uc002jbw.1_Intron	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						tcttttctttccttccttcct	0.070													4	2	---	---	---	---	
SCN4A	6329	broad.mit.edu	37	17	62021504	62021504	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62021504delT	uc002jds.1	-							NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha						muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	cagcctcgtctttttttttgt	0.080													4	2	---	---	---	---	
CCDC45	90799	broad.mit.edu	37	17	62517877	62517877	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62517877delT	uc002jem.2	+						CCDC45_uc002jen.2_Intron|CCDC45_uc010wqb.1_Intron	NM_138363	NP_612372	Q96GE4	CEP95_HUMAN	coiled-coil domain containing 45							centrosome|spindle pole	protein binding				0	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			ACCACTTACCTTTTTTTTTTA	0.299													4	2	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80812014	80812014	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80812014delT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			cattgttgagtttttagttct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	94412	94412	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:94412delT								None (None upstream) : USP14 (64071 downstream)																							CTAtcttttcttttttttttt	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14145018	14145019	+	IGR	DEL	TA	-	-	rs34266186	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14145018_14145019delTA								ZNF519 (12589 upstream) : LOC284233 (192403 downstream)																							GGAGGCAGCGTACCCCCCCCAC	0.639													4	5	---	---	---	---	
CCDC102B	79839	broad.mit.edu	37	18	66505733	66505733	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66505733delT	uc002lkk.2	+						CCDC102B_uc002lki.2_Intron|CCDC102B_uc002lkj.1_Intron	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B											ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				GAGAAATGTATTTTTTTTATG	0.303													4	2	---	---	---	---	
NFIX	4784	broad.mit.edu	37	19	13192370	13192371	+	Intron	INS	-	G	G			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13192370_13192371insG	uc010xmx.1	+						NFIX_uc002mwd.2_Intron|NFIX_uc002mwe.2_Intron|NFIX_uc002mwf.2_Intron|NFIX_uc002mwg.1_Intron			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			gtgcctgtggcggctgccttac	0.287													5	3	---	---	---	---	
LPHN1	22859	broad.mit.edu	37	19	14270465	14270465	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14270465delA	uc010xnn.1	-						LPHN1_uc010xno.1_Intron|uc002myf.2_Intron	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5						TGGGCTCTGCATGCCCTCTTC	0.597													31	27	---	---	---	---	
PLVAP	83483	broad.mit.edu	37	19	17482768	17482768	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17482768delG	uc002ngk.1	-							NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein							caveola|integral to membrane|perinuclear region of cytoplasm					0						TGAATGTCCTGGGGGGACATG	0.328													4	2	---	---	---	---	
KCTD15	79047	broad.mit.edu	37	19	34291105	34291106	+	Intron	DEL	TG	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34291105_34291106delTG	uc002nuy.3	+						KCTD15_uc002nuv.2_Intron|KCTD15_uc002nuw.3_Intron|KCTD15_uc010xrt.1_Intron|KCTD15_uc002nux.3_Intron	NM_001129994	NP_001123466	Q96SI1	KCD15_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	Esophageal squamous(110;0.162)					tgagtgtgactgtgtgtgtgtg	0.386													4	2	---	---	---	---	
HPN	3249	broad.mit.edu	37	19	35556034	35556034	+	Intron	DEL	T	-	-	rs113406953		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35556034delT	uc002nxq.1	+						HPN_uc002nxr.1_Intron|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_Intron|HPN_uc002nxt.1_Intron|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin						cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	ccTATTGTGGTTTTTTTTTTA	0.299													4	2	---	---	---	---	
C19orf55	148137	broad.mit.edu	37	19	36255556	36255556	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36255556delA	uc002obq.1	+							NM_001039887	NP_001034976	Q2NL68	CS055_HUMAN	hypothetical protein LOC148137											ovary(1)	1	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			attcaatctcaaaaaaaaaaa	0.209													4	2	---	---	---	---	
HCST	10870	broad.mit.edu	37	19	36394910	36394910	+	Intron	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36394910delC	uc002ocl.1	+						HCST_uc002ock.1_Intron	NM_014266	NP_055081	Q9UBK5	HCST_HUMAN	hematopoietic cell signal transducer isoform 1						regulation of immune response	integral to membrane|plasma membrane					0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTGGGGAAACCCTGGGGGAG	0.657													26	21	---	---	---	---	
CEACAM1	634	broad.mit.edu	37	19	43016836	43016836	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43016836delT	uc002otv.2	-						uc010eif.1_Intron|uc002ott.1_Intron|uc010eig.1_Intron|uc010eih.1_Intron|CEACAM1_uc010eii.2_Intron|CEACAM1_uc002otw.2_Intron|CEACAM1_uc010eij.2_Intron|CEACAM1_uc002otx.2_Intron|CEACAM1_uc002oty.2_Intron|CEACAM1_uc002otz.2_Intron|CEACAM1_uc010eik.2_Intron	NM_001712	NP_001703	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion						angiogenesis|cell migration|homophilic cell adhesion|integrin-mediated signaling pathway	extracellular region|integral to plasma membrane|membrane fraction				ovary(1)|central_nervous_system(1)	2		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	ttttcttttcttttttttttt	0.154													4	5	---	---	---	---	
ZNF548	147694	broad.mit.edu	37	19	57910589	57910590	+	Frame_Shift_Ins	INS	-	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57910589_57910590insT	uc002qom.2	+	3	1184_1185	c.934_935insT	c.(934-936)AGGfs	p.R312fs	ZNF547_uc002qpm.3_Intron|ZNF548_uc002qon.2_Frame_Shift_Ins_p.R315fs	NM_152909	NP_690873	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	312	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTATGAGTGCAGGGAATGTGGG	0.436													70	57	---	---	---	---	
ZNF547	284306	broad.mit.edu	37	19	57946408	57946409	+	Intron	DEL	TT	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57946408_57946409delTT	uc002qpm.3	+						ZNF749_uc002qoq.2_5'Flank			Q8IVP9	ZN547_HUMAN	RecName: Full=Zinc finger protein 547;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTACTTGCAGTTTAGGAGTCAG	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	458955	458955	+	IGR	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:458955delG								TBC1D20 (15768 upstream) : CSNK2A1 (4383 downstream)																							GTTCTTCATAGGAAGTTCACC	0.473													4	2	---	---	---	---	
ZNF343	79175	broad.mit.edu	37	20	2464292	2464292	+	Frame_Shift_Del	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2464292delA	uc002wge.1	-	6	1803	c.1315delT	c.(1315-1317)TGCfs	p.C439fs	ZNF343_uc010gao.1_Frame_Shift_Del_p.C439fs|ZNF343_uc002wgd.1_Frame_Shift_Del_p.C349fs	NM_024325	NP_077301	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	439	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						CACTCCCTGCAAACATAAGGC	0.527													73	59	---	---	---	---	
DDRGK1	65992	broad.mit.edu	37	20	3172212	3172213	+	Intron	INS	-	T	T			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3172212_3172213insT	uc002wic.2	-						DDRGK1_uc010gaw.2_Intron	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1 precursor							endoplasmic reticulum	protein binding				0						TGGGGTTTGGGTTTTTTTTTTC	0.495													4	2	---	---	---	---	
PANK2	80025	broad.mit.edu	37	20	3890965	3890965	+	Intron	DEL	T	-	-	rs144898585	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3890965delT	uc002wkc.2	+						PANK2_uc002wkb.2_Intron|PANK2_uc010gbd.1_Intron|PANK2_uc002wkd.2_Intron|PANK2_uc002wke.2_Intron|PANK2_uc002wkf.2_Intron	NM_153638	NP_705902	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2 isoform 1 preproprotein						cell death|coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial intermembrane space|nucleus	ATP binding|pantothenate kinase activity|protein binding				0						gttttttttgttttttttttG	0.393													5	3	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	16022097	16022098	+	Intron	INS	-	A	A	rs775131	by1000genomes	TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16022097_16022098insA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron|MACROD2_uc002wpd.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ACCTCTTATTTAAAAAAAAAAC	0.287													5	3	---	---	---	---	
NKX2-2	4821	broad.mit.edu	37	20	21493005	21493005	+	Frame_Shift_Del	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21493005delG	uc002wsi.2	-	2	735	c.378delC	c.(376-378)GGCfs	p.G126fs		NM_002509	NP_002500	O95096	NKX22_HUMAN	NK2 transcription factor related, locus 2	126					brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity			pancreas(1)|skin(1)	2						TTCGCTTCTTGCCGGCGTCCC	0.697													4	2	---	---	---	---	
HSF2BP	11077	broad.mit.edu	37	21	45063849	45063849	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45063849delA	uc002zdi.2	-						HSF2BP_uc011aey.1_Intron	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding						spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)		aaaaaaaaggaaaaaaaaaat	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16957244	16957245	+	IGR	DEL	TG	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16957244_16957245delTG								OR11H1 (507440 upstream) : CCT8L2 (114403 downstream)																							GGATAAAACTTGTGTGTGTATA	0.243													2	4	---	---	---	---	
PI4KA	5297	broad.mit.edu	37	22	21099206	21099206	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21099206delA	uc002zsz.3	-							NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ATAAGAAATTAAAAAAAAAAG	0.353													9	5	---	---	---	---	
TBC1D10A	83874	broad.mit.edu	37	22	30689834	30689834	+	Intron	DEL	G	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30689834delG	uc011akt.1	-						GATSL3_uc003ahf.2_Intron|GATSL3_uc003ahg.2_Intron|GATSL3_uc003ahh.2_Intron|GATSL3_uc010gvq.2_Intron|GATSL3_uc003ahi.2_Intron|TBC1D10A_uc003ahj.3_Intron|TBC1D10A_uc010gvu.2_Intron|TBC1D10A_uc003ahk.3_Intron	NM_031937	NP_114143	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A							intracellular|microvillus	guanyl-nucleotide exchange factor activity|PDZ domain binding|Rab GTPase activator activity			ovary(1)	1						GAAGCTTTTTGGGGTTTCTCT	0.607													24	30	---	---	---	---	
TCN2	6948	broad.mit.edu	37	22	31012013	31012016	+	Intron	DEL	TGGA	-	-	rs145631512		TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31012013_31012016delTGGA	uc003aip.1	+						TCN2_uc003aiq.1_Intron|TCN2_uc003air.1_Intron	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGAAATGTTtggatggatggatg	0.333													3	3	---	---	---	---	
DEPDC5	9681	broad.mit.edu	37	22	32233339	32233339	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32233339delT	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alu.2_Intron|DEPDC5_uc003alv.2_Intron|DEPDC5_uc011alw.1_Intron|DEPDC5_uc003alw.2_Intron|DEPDC5_uc011alx.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						ttttttttccttttttttttt	0.020													4	3	---	---	---	---	
SHROOM4	57477	broad.mit.edu	37	X	50378780	50378780	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378780delA	uc004dpe.2	-						SHROOM4_uc004dpd.3_Intron|SHROOM4_uc004dpf.1_Intron	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4						actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					GAGGGTAGGCAAAAAAAAAAA	0.488													4	3	---	---	---	---	
KDM5C	8242	broad.mit.edu	37	X	53223899	53223899	+	Frame_Shift_Del	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53223899delC	uc004drz.2	-	23	3993	c.3460delG	c.(3460-3462)GAAfs	p.E1154fs	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Frame_Shift_Del_p.E1087fs|KDM5C_uc004dsa.2_Frame_Shift_Del_p.E1153fs	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	1154					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						TCCTTCTGTTCCCCCTCCTTG	0.567			N|F|S		clear cell renal carcinoma								59	87	---	---	---	---	
NONO	4841	broad.mit.edu	37	X	70512052	70512052	+	Intron	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70512052delT	uc004dzo.2	+						BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Intron|NONO_uc004dzp.2_Intron|NONO_uc011mpv.1_Intron|NONO_uc004dzq.2_5'Flank	NM_001145408	NP_001138880	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding						DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)					CCTTTGGAACttttttttttt	0.174			T	TFE3	papillary renal cancer								5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	139800306	139800306	+	IGR	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139800306delA								RP1-177G6.2 (3319 upstream) : CDR1 (65119 downstream)																							cgtctcaaagaaaaaaaaaga	0.060													6	3	---	---	---	---	
IDS	3423	broad.mit.edu	37	X	148571601	148571601	+	Intron	DEL	A	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148571601delA	uc011mxe.1	-						IDS_uc011mxd.1_Intron|IDS_uc011mxf.1_Intron|IDS_uc011mxg.1_Intron|IDS_uc010nsu.1_Intron|IDS_uc004fcw.3_Intron|IDS_uc011mxh.1_Intron|IDS_uc011mxi.1_Intron	NM_000202	NP_000193	P22304	IDS_HUMAN	iduronate-2-sulfatase isoform a precursor							lysosome	iduronate-2-sulfatase activity|metal ion binding				0	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					ATTCATCAAGAAAAAAAAAAA	0.463													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	7446615	7446615	+	IGR	DEL	C	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:7446615delC								PRKY (197029 upstream) : TTTY16 (120783 downstream)																							ATGAGCCAAACAGAGACAGAC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28099692	28099692	+	IGR	DEL	T	-	-			TCGA-AK-3430-01A-01D-1251-10	TCGA-AK-3430-10A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28099692delT								None (None upstream) : None (None downstream)																							GACTCTGGAATTTTTTCCTGC	0.398													4	2	---	---	---	---	
