Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SPSB1	80176	broad.mit.edu	37	1	9415972	9415972	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9415972G>A	uc010oae.1	+	2	361	c.22G>A	c.(22-24)GGG>AGG	p.G8R	SPSB1_uc001apv.2_Missense_Mutation_p.G8R	NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box	8					intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		GGTCACTGGAGGGATCAAGAC	0.562													12	88	---	---	---	---	PASS
SFRS4	6429	broad.mit.edu	37	1	29481292	29481292	+	Missense_Mutation	SNP	A	G	G	rs111495066		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29481292A>G	uc001bro.2	-	4	867	c.494T>C	c.(493-495)GTC>GCC	p.V165A	SFRS4_uc010ofy.1_Intron|SFRS4_uc009vtp.2_RNA	NM_005626	NP_005617	Q08170	SRSF4_HUMAN	splicing factor, arginine/serine-rich 4	165	RRM 2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding				0		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)		TCTCCCATTGACTTCAGTTCC	0.428													18	103	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44064327	44064327	+	Intron	SNP	T	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44064327T>C	uc001cjr.2	+						PTPRF_uc001cjs.2_Intron|PTPRF_uc001cju.2_Intron|PTPRF_uc009vwt.2_Intron|PTPRF_uc001cjv.2_Intron|PTPRF_uc001cjw.2_5'UTR	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TCAAGTTTGCTGTGCCCACCT	0.617													11	28	---	---	---	---	PASS
GCLM	2730	broad.mit.edu	37	1	94370100	94370100	+	Silent	SNP	T	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94370100T>C	uc001dqg.1	-	2	464	c.171A>G	c.(169-171)CAA>CAG	p.Q57Q		NM_002061	NP_002052	P48507	GSH0_HUMAN	glutamate-cysteine ligase regulatory protein	57					glutamate metabolic process|glutathione biosynthetic process|regulation of blood vessel size|response to drug|response to oxidative stress|xenobiotic metabolic process	cytosol|soluble fraction	glutamate-cysteine ligase catalytic subunit binding			ovary(1)	1		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)	CTGGGTTGATTTGGGAACTCC	0.338													34	94	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142819310	142819310	+	Intron	SNP	A	G	G	rs4118821		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142819310A>G	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron|uc001ejc.2_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		AGAAAGGTGCAAAAGAAGTGA	0.299													6	34	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144865887	144865887	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144865887G>C	uc001elw.3	-	35	5984	c.5693C>G	c.(5692-5694)CCT>CGT	p.P1898R	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.P1792R|PDE4DIP_uc001elv.3_Missense_Mutation_p.P905R|PDE4DIP_uc001ema.2_Missense_Mutation_p.P85R	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1898	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GCAGAGCTGAGGTATGGACTC	0.458			T	PDGFRB	MPD								79	472	---	---	---	---	PASS
MAEL	84944	broad.mit.edu	37	1	166962002	166962002	+	Silent	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166962002C>T	uc001gdy.1	+	4	476	c.405C>T	c.(403-405)CTC>CTT	p.L135L	MAEL_uc001gdz.1_Silent_p.L104L|MAEL_uc009wvf.1_RNA	NM_032858	NP_116247	Q96JY0	MAEL_HUMAN	maelstrom homolog	135					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|multicellular organismal development|piRNA metabolic process|spermatogenesis	piP-body	DNA binding			skin(1)	1						AGCGCTTCCTCCCTTGTGAAA	0.378													44	164	---	---	---	---	PASS
TOR3A	64222	broad.mit.edu	37	1	179057211	179057211	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179057211T>G	uc001gmd.2	+	4	957	c.805T>G	c.(805-807)TTT>GTT	p.F269V	TOR3A_uc010pnd.1_Missense_Mutation_p.F53V	NM_022371	NP_071766	Q9H497	TOR3A_HUMAN	torsin family 3, member A precursor	269					chaperone mediated protein folding requiring cofactor	endoplasmic reticulum	ATP binding			pancreas(1)	1						ATGGACTATCTTTCTGTTTCT	0.607													21	106	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241875161	241875161	+	Silent	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241875161G>A	uc001hze.1	+	8	1209	c.1002G>A	c.(1000-1002)AAG>AAA	p.K334K	WDR64_uc001hzf.1_Silent_p.K54K			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;	334	WD 3.									skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			ACTGTGTTAAGGCAAATGTGA	0.408													9	53	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73677725	73677725	+	Silent	SNP	T	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73677725T>A	uc002sje.1	+	10	4185	c.4074T>A	c.(4072-4074)GCT>GCA	p.A1358A	ALMS1_uc002sjf.1_Silent_p.A1314A|ALMS1_uc002sjg.2_Silent_p.A744A|ALMS1_uc002sjh.1_Silent_p.A744A	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1356	18.|34 X 47 AA approximate tandem repeat.				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CTGAAGAGGCTCTGAAAATTT	0.438													33	118	---	---	---	---	PASS
ASTL	431705	broad.mit.edu	37	2	96789864	96789864	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96789864C>A	uc010yui.1	-	9	1021	c.1021G>T	c.(1021-1023)GAG>TAG	p.E341*		NM_001002036	NP_001002036	Q6HA08	ASTL_HUMAN	astacin-like metalloendopeptidase precursor	341					proteolysis		metalloendopeptidase activity|zinc ion binding				0						TGTGGGCTCTCCCCAGGCCCT	0.652													20	89	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098803	178098803	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098803C>T	uc002ulh.3	-	2	797	c.242G>A	c.(241-243)GGT>GAT	p.G81D	NFE2L2_uc002ulg.3_Missense_Mutation_p.G65D|NFE2L2_uc010zfa.1_Missense_Mutation_p.G65D|NFE2L2_uc002uli.3_Missense_Mutation_p.G65D|NFE2L2_uc010fra.2_Missense_Mutation_p.G65D|NFE2L2_uc010frb.2_Missense_Mutation_p.G65D	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	81					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGAAATTCACCTGTCTCTTC	0.433			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			22	97	---	---	---	---	PASS
NAB1	4664	broad.mit.edu	37	2	191550288	191550288	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191550288G>C	uc002usb.2	+	8	1754	c.1182G>C	c.(1180-1182)TTG>TTC	p.L394F	NAB1_uc010fsc.2_Missense_Mutation_p.L394F|NAB1_uc010fsd.2_Missense_Mutation_p.L393F|NAB1_uc002usc.2_Missense_Mutation_p.L393F|NAB1_uc010zgh.1_Missense_Mutation_p.L364F	NM_005966	NP_005957	Q13506	NAB1_HUMAN	NGFI-A binding protein 1	394					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			AGAGGAGGTTGTCTGCAGGGC	0.488													18	49	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196642652	196642652	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196642652C>T	uc002utj.3	-	59	11037	c.10936G>A	c.(10936-10938)GTG>ATG	p.V3646M	DNAH7_uc002uti.3_Missense_Mutation_p.V129M	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3646					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCATCGGTCACTCTGCCTCCG	0.473													11	35	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225729384	225729384	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225729384A>C	uc010fwz.1	-	13	1727	c.1488T>G	c.(1486-1488)TTT>TTG	p.F496L	DOCK10_uc002vob.2_Missense_Mutation_p.F490L|DOCK10_uc002vod.1_Missense_Mutation_p.F496L	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	496							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TGCTTACAGAAAATACAGCCT	0.353													13	65	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183752	10183752	+	Missense_Mutation	SNP	T	A	A	rs5030803		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183752T>A	uc003bvc.2	+	1	434	c.221T>A	c.(220-222)GTC>GAC	p.V74D	VHL_uc003bvd.2_Missense_Mutation_p.V74D	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	74					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V74D(4)|p.V74fs*85(2)|p.V74A(1)|p.S72_V87>L(1)|p.P71fs*84(1)|p.R60fs*35(1)|p.N67_V74del(1)|p.V74fs*58(1)|p.V74fs*77(1)|p.V74fs*82(1)|p.V74fs*51(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCTCCCAGGTCATCTTCTGC	0.721		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	12	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183753	10183753	+	Silent	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183753C>T	uc003bvc.2	+	1	435	c.222C>T	c.(220-222)GTC>GTT	p.V74V	VHL_uc003bvd.2_Silent_p.V74V	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	74					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V74D(4)|p.V74fs*85(2)|p.V74A(1)|p.S72_V87>L(1)|p.P71fs*84(1)|p.R60fs*35(1)|p.V74fs*51(1)|p.V74fs*58(1)|p.V74fs*77(1)|p.V74fs*82(1)|p.N67_V74del(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCTCCCAGGTCATCTTCTGCA	0.721		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	12	---	---	---	---	PASS
FBLN2	2199	broad.mit.edu	37	3	13670697	13670697	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13670697G>T	uc011avb.1	+	12	2731	c.2606G>T	c.(2605-2607)TGC>TTC	p.C869F	FBLN2_uc011auz.1_Missense_Mutation_p.C895F|FBLN2_uc011ava.1_Missense_Mutation_p.C916F|FBLN2_uc011avc.1_Missense_Mutation_p.C916F	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	869	EGF-like 6; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GTGCACCGCTGCGGTGAGGGC	0.652													4	18	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52441262	52441262	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52441262A>C	uc003ddx.2	-	7	623	c.508T>G	c.(508-510)TTT>GTT	p.F170V	BAP1_uc010hmh.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	170					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	p.E166fs*13(1)		pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TAGCTGACAAAGTGGAACGCC	0.577			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								11	35	---	---	---	---	PASS
POLR2H	5437	broad.mit.edu	37	3	184082991	184082991	+	Silent	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184082991C>T	uc003fok.1	+	3	315	c.228C>T	c.(226-228)AAC>AAT	p.N76N	POLR2H_uc003foj.1_RNA	NM_006232	NP_006223	P52434	RPAB3_HUMAN	RNA polymerase II, polypeptide H	76					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex|nucleolus	DNA-directed RNA polymerase activity|protein binding|zinc ion binding				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GTGAATACAACCCCACTGATG	0.408													40	136	---	---	---	---	PASS
SDHAP1	255812	broad.mit.edu	37	3	195701417	195701417	+	Silent	SNP	G	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195701417G>C	uc011btq.1	-	8	1076	c.447C>G	c.(445-447)GGC>GGG	p.G149G	SDHAP1_uc003fvx.3_RNA|SDHAP1_uc011btp.1_RNA					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						TCTGATCCTGGCCATTCCCGT	0.592													8	90	---	---	---	---	PASS
PIGG	54872	broad.mit.edu	37	4	515604	515604	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:515604T>A	uc003gak.3	+	8	1624	c.1488T>A	c.(1486-1488)AGT>AGA	p.S496R	PIGG_uc003gaj.3_Missense_Mutation_p.S488R|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_Missense_Mutation_p.S363R|PIGG_uc003gal.3_Missense_Mutation_p.S407R|PIGG_uc003gai.2_RNA|PIGG_uc011buw.1_3'UTR|PIGG_uc003gam.2_3'UTR|PIGG_uc003gan.2_Missense_Mutation_p.S407R	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	496					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			central_nervous_system(2)|ovary(1)|skin(1)	4						CAGCTGAAAGTTCGTGCTACT	0.552													15	59	---	---	---	---	PASS
DCAF4L1	285429	broad.mit.edu	37	4	41983927	41983927	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41983927A>C	uc003gwk.2	+	1	215	c.118A>C	c.(118-120)ACC>CCC	p.T40P		NM_001029955	NP_001025126	Q3SXM0	DC4L1_HUMAN	WD repeat domain 21B	40										skin(1)	1						CCTCAACGTCACCAGTTACTC	0.532													24	91	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56314944	56314944	+	Splice_Site	SNP	A	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56314944A>G	uc003haz.1	-	19	2465	c.1539_splice	c.e19+1	p.Q513_splice	CLOCK_uc003hba.1_Splice_Site_p.Q513_splice|CLOCK_uc010igu.1_Splice_Site	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock						circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			ACCAAAAAGTACCTGGGACAT	0.294													11	46	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56314945	56314945	+	Splice_Site	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56314945C>A	uc003haz.1	-	19	2465	c.1539_splice	c.e19+1	p.Q513_splice	CLOCK_uc003hba.1_Splice_Site_p.Q513_splice|CLOCK_uc010igu.1_Splice_Site	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock						circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			CCAAAAAGTACCTGGGACATG	0.294													11	47	---	---	---	---	PASS
TMPRSS11D	9407	broad.mit.edu	37	4	68719845	68719845	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68719845G>A	uc003hdq.2	-	3	255	c.190C>T	c.(190-192)CAG>TAG	p.Q64*	LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_5'UTR	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	64	SEA.|Extracellular (Potential).				proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GAATTTAACTGACTATTATAT	0.303													31	105	---	---	---	---	PASS
TRIM61	391712	broad.mit.edu	37	4	165891059	165891059	+	Silent	SNP	C	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165891059C>G	uc003iqw.2	-	3	707	c.96G>C	c.(94-96)GGG>GGC	p.G32G		NM_001012414	NP_001012414	Q5EBN2	TRI61_HUMAN	tripartite motif-containing 61	32	RING-type.					intracellular	zinc ion binding			skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.109)		GBM - Glioblastoma multiforme(119;0.155)		AGAAGTTATGCCCACAGCTGA	0.488													4	63	---	---	---	---	PASS
CD180	4064	broad.mit.edu	37	5	66479940	66479940	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66479940T>G	uc003juy.2	-	3	879	c.731A>C	c.(730-732)AAC>ACC	p.N244T		NM_005582	NP_005573	Q99467	CD180_HUMAN	CD180 molecule precursor	244	Extracellular (Potential).				inflammatory response|innate immune response	integral to membrane|plasma membrane	receptor activity			ovary(1)	1		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		AGTAGTAGAGTTCTGCAGACC	0.413													21	81	---	---	---	---	PASS
TNPO1	3842	broad.mit.edu	37	5	72185719	72185719	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72185719C>G	uc003kck.3	+	14	1783	c.1636C>G	c.(1636-1638)CTG>GTG	p.L546V	TNPO1_uc011csj.1_Missense_Mutation_p.L496V|TNPO1_uc003kch.2_Missense_Mutation_p.L538V|TNPO1_uc003kci.3_Missense_Mutation_p.L538V|TNPO1_uc003kcg.3_Missense_Mutation_p.L538V	NM_002270	NP_002261	Q92973	TNPO1_HUMAN	transportin 1 isoform 1	546					interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		GCATAAGAACCTGCTCATTCT	0.368													11	123	---	---	---	---	PASS
ATP6AP1L	92270	broad.mit.edu	37	5	81614047	81614047	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81614047G>T	uc003khv.2	+	10	1928	c.603G>T	c.(601-603)AAG>AAT	p.K201N	ATP6AP1L_uc003khw.2_Missense_Mutation_p.K201N	NM_001017971	NP_001017971	Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory	201					ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0						CCGAAGAGAAGGAGCTGCTGA	0.527													5	40	---	---	---	---	PASS
MYOT	9499	broad.mit.edu	37	5	137213306	137213306	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137213306C>T	uc011cye.1	+	4	646	c.629C>T	c.(628-630)TCG>TTG	p.S210L	MYOT_uc003lbv.2_Missense_Mutation_p.S210L|MYOT_uc011cyg.1_Missense_Mutation_p.S26L|MYOT_uc011cyh.1_Missense_Mutation_p.S95L	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b	210					muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GCACAAGACTCGCAGGTAAGT	0.388													26	77	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154396598	154396598	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154396598G>T	uc010jih.1	+	1	3339	c.3179G>T	c.(3178-3180)GGT>GTT	p.G1060V		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1060	Interaction with PRC1 (By similarity).|Globular (By similarity).				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			gatggtgatggtgatggcgac	0.383													17	64	---	---	---	---	PASS
DUSP1	1843	broad.mit.edu	37	5	172197509	172197509	+	Intron	SNP	C	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172197509C>G	uc003mbv.1	-						DUSP1_uc011dez.1_5'Flank|DUSP1_uc003mbu.1_5'UTR	NM_004417	NP_004408	P28562	DUS1_HUMAN	dual specificity phosphatase 1						cell cycle|endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|non-membrane spanning protein tyrosine phosphatase activity|protein binding			breast(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		GTGGGGCGATCCCCCGGGAGC	0.612													4	4	---	---	---	---	PASS
UIMC1	51720	broad.mit.edu	37	5	176402397	176402397	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176402397G>A	uc011dfp.1	-	3	399	c.232C>T	c.(232-234)CAG>TAG	p.Q78*	UIMC1_uc003mfc.1_5'UTR|UIMC1_uc003mfd.1_5'UTR|UIMC1_uc003mfg.1_Nonsense_Mutation_p.Q78*|UIMC1_uc003mfh.1_Nonsense_Mutation_p.Q78*|UIMC1_uc010jkj.1_Nonsense_Mutation_p.Q78*|UIMC1_uc011dfq.1_Nonsense_Mutation_p.Q78*	NM_016290	NP_057374	Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	78	Necessary for transcriptional repression.				double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding			ovary(3)|skin(1)	4	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAAACATACGTGCGATTTTT	0.289													26	129	---	---	---	---	PASS
GMCL1L	64396	broad.mit.edu	37	5	177612983	177612983	+	Missense_Mutation	SNP	G	A	A	rs13169133	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177612983G>A	uc003mit.1	-	1	1451	c.1318C>T	c.(1318-1320)CGC>TGC	p.R440C		NR_003281				SubName: Full=Germ cell-less homolog 1 (Drosophila); SubName: Full=Putative uncharacterized protein FLJ13057;												0						GACCCGCTGCGTGGCTGATTC	0.418													4	39	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66205260	66205260	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66205260T>A	uc011dxu.1	-	4	582	c.44A>T	c.(43-45)CAC>CTC	p.H15L	EYS_uc003peq.2_Missense_Mutation_p.H15L|EYS_uc003per.1_Missense_Mutation_p.H15L|EYS_uc010kaj.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	15					response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						GAAAGAGCTGTGAAAAACCAT	0.338													17	79	---	---	---	---	PASS
TCF21	6943	broad.mit.edu	37	6	134210722	134210722	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134210722C>A	uc003qei.3	+	1	463	c.187C>A	c.(187-189)CCC>ACC	p.P63T	uc003qeg.1_5'Flank|TCF21_uc003qej.2_Missense_Mutation_p.P63T	NM_003206	NP_003197	O43680	TCF21_HUMAN	transcription factor 21	63					branching involved in ureteric bud morphogenesis|mesoderm development|negative regulation of androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	androgen receptor binding|E-box binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity				0	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		GAGGAAGGCGCCCACCAAGAA	0.672													5	30	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21913067	21913067	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21913067C>A	uc003svc.2	+	75	12195	c.12164C>A	c.(12163-12165)CCC>CAC	p.P4055H		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4055	AAA 6 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						ACTAATGAACCCCCAACAGGG	0.473									Kartagener_syndrome				16	84	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23802525	23802525	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23802525C>T	uc003sws.3	+	11	1466	c.1399C>T	c.(1399-1401)CGC>TGC	p.R467C	STK31_uc003swt.3_Missense_Mutation_p.R444C|STK31_uc011jze.1_Missense_Mutation_p.R467C|STK31_uc010kuq.2_Missense_Mutation_p.R444C	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	467							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TCTTAATAAACGCTTAAAAAC	0.289													16	80	---	---	---	---	PASS
KIAA0895	23366	broad.mit.edu	37	7	36396480	36396480	+	Intron	SNP	A	G	G	rs3735401	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36396480A>G	uc003tfd.2	-						KIAA0895_uc003tfc.2_Intron|KIAA0895_uc011kaw.1_Intron|KIAA0895_uc003tfb.2_Intron|KIAA0895_uc011kax.1_Intron|KIAA0895_uc003tfe.2_Missense_Mutation_p.F287L|KIAA0895_uc011kay.1_Missense_Mutation_p.F249L	NM_001100425	NP_001093895	Q8NCT3	K0895_HUMAN	hypothetical protein LOC23366 isoform 1												0						GTACATAAAAATGAACTACCA	0.338													3	61	---	---	---	---	PASS
HIP1	3092	broad.mit.edu	37	7	75182782	75182782	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75182782G>T	uc003uds.1	-	22	2306	c.2265C>A	c.(2263-2265)AAC>AAA	p.N755K	HIP1_uc011kfz.1_Missense_Mutation_p.N632K	NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1	755					activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						TGCTCAGGCAGTTCCTCATGG	0.562			T	PDGFRB	CMML								13	141	---	---	---	---	PASS
ZNF655	79027	broad.mit.edu	37	7	99170286	99170286	+	Silent	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99170286G>A	uc003urh.2	+	3	948	c.555G>A	c.(553-555)CAG>CAA	p.Q185Q	ZNF655_uc010lga.2_Silent_p.Q220Q|ZNF655_uc010lgc.2_Silent_p.Q220Q|ZNF655_uc003urj.2_Silent_p.Q185Q|ZNF655_uc003urk.2_Silent_p.Q22Q|ZNF655_uc010lgd.2_Silent_p.Q22Q	NM_138494	NP_612503	Q8N720	ZN655_HUMAN	zinc finger protein 655 isoform a	185					G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					AGGATTTTCAGAGTAGTGAAT	0.378													17	74	---	---	---	---	PASS
SRRT	51593	broad.mit.edu	37	7	100486192	100486192	+	3'UTR	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100486192C>T	uc003uwy.2	+	21					SRRT_uc010lhl.1_3'UTR|SRRT_uc003uxa.2_3'UTR|SRRT_uc003uwz.2_3'UTR|uc010lhm.1_5'Flank	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a						cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						TTCCTCAGTCCTGTATCATCC	0.488													8	36	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142575239	142575239	+	Intron	SNP	A	T	T	rs4987654	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142575239A>T	uc003wbx.1	-						TRPV6_uc003wbw.1_5'Flank|TRPV6_uc010lou.1_5'UTR	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,						regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					GCAGGCGTTCAAGTGATGGGC	0.542													4	20	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	68084731	68084731	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68084731A>T	uc003xxi.2	+	25	3030	c.2999A>T	c.(2998-3000)AAG>ATG	p.K1000M	CSPP1_uc003xxj.2_Missense_Mutation_p.K965M|CSPP1_uc003xxk.2_Missense_Mutation_p.K620M|CSPP1_uc010lyw.2_Missense_Mutation_p.K60M	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	1000						centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			CAGTCCCCTAAGGGCTTAGAC	0.398													16	70	---	---	---	---	PASS
CYP11B2	1585	broad.mit.edu	37	8	143994011	143994011	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143994011A>T	uc003yxk.1	-	8	1336	c.1333T>A	c.(1333-1335)TTT>ATT	p.F445I		NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,	445					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	CGCATGCCAAAGCCAAAGGGC	0.677									Familial_Hyperaldosteronism_type_I				15	47	---	---	---	---	PASS
GNA14	9630	broad.mit.edu	37	9	80043923	80043923	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80043923T>G	uc004aku.2	-	5	1146	c.623A>C	c.(622-624)GAA>GCA	p.E208A		NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14	208					activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2						CTTCCGTCTTTCCGATCGTTG	0.458													12	187	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84532821	84532821	+	3'UTR	SNP	G	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84532821G>C	uc011lst.1	+	4					uc004ame.2_5'Flank	NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						ATCGGAAGAGGATATTTCCAA	0.438													4	28	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113241933	113241933	+	Silent	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113241933C>T	uc010mtz.2	-	13	2806	c.2469G>A	c.(2467-2469)GAG>GAA	p.E823E	SVEP1_uc010mua.1_Silent_p.E823E|SVEP1_uc004beu.2_Silent_p.E823E	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	823					cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						CCAGGGTCGTCTCAAATGCTT	0.388													43	318	---	---	---	---	PASS
ALAD	210	broad.mit.edu	37	9	116154422	116154422	+	Silent	SNP	G	T	T	rs116243288	byFrequency	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116154422G>T	uc011lxf.1	-	3	343	c.141C>A	c.(139-141)ATC>ATA	p.I47I	ALAD_uc011lxe.1_Intron|ALAD_uc004bhl.3_Silent_p.I76I	NM_000031	NP_000022	P13716	HEM2_HUMAN	delta-aminolevulinic acid dehydratase	47					heme biosynthetic process|protein homooligomerization	cytosol	identical protein binding|lead ion binding|porphobilinogen synthase activity|zinc ion binding				0					Aminolevulinic acid(DB00855)	GGAGGCTGGTGATAGGCTGTA	0.577													6	20	---	---	---	---	PASS
SEC61A2	55176	broad.mit.edu	37	10	12209851	12209851	+	Intron	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12209851G>A	uc001ilg.3	+						SEC61A2_uc001ilf.3_RNA|SEC61A2_uc001ilh.3_RNA|uc001ili.1_5'Flank|NUDT5_uc001ilj.2_Intron|NUDT5_uc001ilk.2_Intron	NM_001142627	NP_001136099	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform c							endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				ATGCCGTTAAGGAAGGACAAA	0.428													8	86	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55038375	55038375	+	3'UTR	SNP	T	C	C	rs3213870	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55038375T>C	uc010rid.1	+	6						NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48							intracellular	zinc ion binding				0						TCCTTCTCACTTCCTCTCAGA	0.433													4	78	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55038385	55038385	+	3'UTR	SNP	A	G	G	rs61894896	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55038385A>G	uc010rid.1	+	6						NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48							intracellular	zinc ion binding				0						TTCCTCTCAGACCTATCTTTT	0.448													4	80	---	---	---	---	PASS
C11orf84	144097	broad.mit.edu	37	11	63586459	63586459	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63586459G>A	uc001nxt.2	+	5	1155	c.919G>A	c.(919-921)GAG>AAG	p.E307K		NM_138471	NP_612480	Q9BUA3	CK084_HUMAN	hypothetical protein LOC144097	307											0						TCCCCGGGCGGAGAGCCCCTC	0.647													4	36	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108202714	108202714	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108202714A>T	uc001pkb.1	+	52	8123	c.7738A>T	c.(7738-7740)AGA>TGA	p.R2580*	ATM_uc009yxr.1_Nonsense_Mutation_p.R2580*|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Nonsense_Mutation_p.R1232*|ATM_uc001pkg.1_Nonsense_Mutation_p.R937*	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2580					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		GGTAGCCAGAAGAAGCAGAAT	0.363			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			25	98	---	---	---	---	PASS
RAPGEF3	10411	broad.mit.edu	37	12	48134634	48134634	+	Intron	SNP	C	T	T	rs11168219	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48134634C>T	uc009zkp.2	-						uc001rpv.2_RNA|RAPGEF3_uc001rpw.2_Intron|RAPGEF3_uc001rpx.2_Intron|RAPGEF3_uc010sln.1_Intron|RAPGEF3_uc001rpy.2_Intron|RAPGEF3_uc009zkq.2_Intron|RAPGEF3_uc001rpz.3_Intron	NM_001098532	NP_001092002	A8K2G5	A8K2G5_HUMAN	Rap guanine nucleotide exchange factor 3 isoform						regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex	cAMP-dependent protein kinase regulator activity|guanyl-nucleotide exchange factor activity			lung(2)|skin(1)|pancreas(1)	4	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		GAGAGGTCAGCGAGTGCTGAG	0.662													3	16	---	---	---	---	PASS
NR1H4	9971	broad.mit.edu	37	12	100930297	100930297	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100930297C>G	uc001tht.1	+	5	798	c.770C>G	c.(769-771)ACT>AGT	p.T257S	NR1H4_uc001thp.1_Missense_Mutation_p.T243S|NR1H4_uc001thq.1_Missense_Mutation_p.T247S|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Missense_Mutation_p.T247S|NR1H4_uc010svk.1_Missense_Mutation_p.T196S|NR1H4_uc001ths.1_Missense_Mutation_p.T253S	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	257	Ligand-binding.				bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TAGGAGAAAACTGAACTCACC	0.353													26	110	---	---	---	---	PASS
LOC374491	374491	broad.mit.edu	37	13	25161456	25161456	+	RNA	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25161456C>T	uc001upm.2	+	8		c.980C>T			LOC374491_uc001upn.2_RNA|LOC374491_uc001upo.2_RNA					Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0						ATTATTTATTCGATTCGTGGT	0.378													9	81	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29600300	29600300	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29600300C>A	uc001usl.3	+	1	1553	c.1495C>A	c.(1495-1497)CCT>ACT	p.P499T		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	489						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						GCCCCTGGACCCTCAAAGTGG	0.502													10	46	---	---	---	---	PASS
COG6	57511	broad.mit.edu	37	13	40268842	40268842	+	Silent	SNP	A	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40268842A>G	uc001uxh.2	+	12	1246	c.1146A>G	c.(1144-1146)AAA>AAG	p.K382K	COG6_uc001uxi.2_Silent_p.K330K|COG6_uc010acb.2_Silent_p.K382K	NM_020751	NP_065802	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6 isoform	382					protein transport	Golgi membrane|Golgi transport complex				kidney(1)|skin(1)	2		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		ATCTCCTCAAATTTTATCACC	0.308													24	108	---	---	---	---	PASS
SPRY2	10253	broad.mit.edu	37	13	80911095	80911095	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80911095C>T	uc001vli.2	-	2	1724	c.746G>A	c.(745-747)TGT>TAT	p.C249Y	SPRY2_uc001vlj.2_Missense_Mutation_p.C249Y	NM_005842	NP_005833	O43597	SPY2_HUMAN	sprouty 2	249	SPR.|Cys-rich.				epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of ERK1 and ERK2 cascade|positive regulation of gene expression|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein kinase B signaling cascade	cytosol|microtubule|ruffle membrane	protein serine/threonine kinase activator activity			ovary(1)|lung(1)	2	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		TCGTGTACAACAGTGAGACTG	0.478													6	39	---	---	---	---	PASS
BIVM	54841	broad.mit.edu	37	13	103468958	103468958	+	Intron	SNP	G	A	A	rs7320687	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103468958G>A	uc001vps.2	+						BIVM_uc010agc.2_Intron|BIVM_uc001vpt.2_3'UTR|ERCC5_uc001vpu.1_Intron	NM_017693	NP_060163	Q86UB2	BIVM_HUMAN	basic, immunoglobulin-like variable motif							cytoplasm|nucleus					0	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ATATATGTTGGCAATAACGTA	0.239													5	81	---	---	---	---	PASS
DHRS7	51635	broad.mit.edu	37	14	60616042	60616042	+	Intron	SNP	C	T	T	rs411880	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60616042C>T	uc001xes.2	-						C14orf135_uc001xeq.2_Intron|DHRS7_uc001xet.2_Intron|DHRS7_uc001xeu.2_Missense_Mutation_p.S334N	NM_016029	NP_057113	Q9Y394	DHRS7_HUMAN	dehydrogenase/reductase (SDR family) member 7								binding|oxidoreductase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.121)		TTGGTACATACTATTAAGAAA	0.299													4	70	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64547342	64547342	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64547342T>G	uc001xgm.2	+	56	11562	c.11332T>G	c.(11332-11334)TCA>GCA	p.S3778A	SYNE2_uc001xgl.2_Missense_Mutation_p.S3778A|SYNE2_uc010apy.2_Missense_Mutation_p.S140A|SYNE2_uc010apx.1_Missense_Mutation_p.S170A	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3778	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GTGTAGAACCTCACAGTTGAA	0.413													5	90	---	---	---	---	PASS
ACYP1	97	broad.mit.edu	37	14	75520065	75520065	+	3'UTR	SNP	T	C	C	rs7303	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75520065T>C	uc001xrg.2	-	3					MLH3_uc001xrd.1_5'Flank|MLH3_uc001xre.1_5'Flank|ACYP1_uc001xrf.2_3'UTR	NM_001107	NP_001098	P07311	ACYP1_HUMAN	acylphosphatase 1 isoform a						phosphate metabolic process		acylphosphatase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00646)		CTAATGCTAATATTAACACAC	0.259													4	52	---	---	---	---	PASS
FLVCR2	55640	broad.mit.edu	37	14	76045408	76045408	+	Silent	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76045408C>A	uc001xrs.2	+	1	469	c.93C>A	c.(91-93)CCC>CCA	p.P31P		NM_017791	NP_060261	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular	31	8 X 6 AA tandem repeats of P-S-[VS]-S- [VIAG]-[HNP].|2.				transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)		CGGTCCATCCCAGCGTCTCGG	0.642													16	64	---	---	---	---	PASS
SMEK1	55671	broad.mit.edu	37	14	91942100	91942100	+	Intron	SNP	A	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91942100A>G	uc001xzn.2	-						SMEK1_uc001xzm.2_Intron|SMEK1_uc001xzo.2_Intron|SMEK1_uc010atz.2_Intron|SMEK1_uc001xzp.1_Intron|SMEK1_uc001xzq.1_Missense_Mutation_p.F317L	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1							microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		GAATAATAAAAACAGTTATAG	0.299													2	13	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52486064	52486064	+	3'UTR	SNP	C	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52486064C>G	uc010bff.2	-	41					GNB5_uc002abt.1_5'Flank|MYO5C_uc010uga.1_RNA|uc002abv.2_Intron	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		CTTCACTTAGCTTTTGAAGAA	0.378													12	170	---	---	---	---	PASS
RABEP2	79874	broad.mit.edu	37	16	28916276	28916276	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28916276G>C	uc002drq.2	-	13	1746	c.1698C>G	c.(1696-1698)ATC>ATG	p.I566M	uc010vct.1_Intron|RABEP2_uc010vdf.1_Missense_Mutation_p.I495M|RABEP2_uc010byn.2_Missense_Mutation_p.I530M	NM_024816	NP_079092	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	566					endocytosis|protein transport	early endosome	growth factor activity|GTPase activator activity			ovary(1)|breast(1)|skin(1)	3						AGGTGTCCTTGATGTCCCTGA	0.637													14	48	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51173795	51173795	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51173795C>T	uc010vgs.1	-	2	2369	c.2338G>A	c.(2338-2340)GTC>ATC	p.V780I	SALL1_uc010vgr.1_Missense_Mutation_p.V683I|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	780	C2H2-type 5.				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGCTGCAGGACCACAGCGTTC	0.557													20	77	---	---	---	---	PASS
LOC283922	283922	broad.mit.edu	37	16	74394745	74394745	+	5'UTR	SNP	A	G	G	rs71391080	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394745A>G	uc002fcr.2	-	2					LOC283922_uc010vms.1_RNA					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						GACAGCAACCAGTAGAACATC	0.483													5	17	---	---	---	---	PASS
PHF23	79142	broad.mit.edu	37	17	7139521	7139521	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7139521G>A	uc002gfa.2	-	4	952	c.725C>T	c.(724-726)CCC>CTC	p.P242L	DVL2_uc002gez.1_5'Flank|DVL2_uc010vtr.1_5'Flank|DVL2_uc010clz.1_5'Flank|PHF23_uc010vtt.1_Missense_Mutation_p.P175L|PHF23_uc010cma.2_Missense_Mutation_p.P112L	NM_024297	NP_077273	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	242							zinc ion binding				0						TGTATCACTGGGGGGTGCCTG	0.453													13	242	---	---	---	---	PASS
SMARCE1	6605	broad.mit.edu	37	17	38798730	38798730	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38798730G>A	uc002hux.2	-	4	257	c.133C>T	c.(133-135)CCG>TCG	p.P45S	SMARCE1_uc010wff.1_Intron|SMARCE1_uc010wfg.1_Intron|SMARCE1_uc002huy.2_Intron|SMARCE1_uc010wfh.1_Intron|SMARCE1_uc010wfi.1_Missense_Mutation_p.P27S|SMARCE1_uc002huz.1_Intron|SMARCE1_uc010wfj.1_Missense_Mutation_p.P27S|SMARCE1_uc002hva.2_Missense_Mutation_p.P45S	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	45	Pro-rich.				chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)				TTGGTGCCCGGGTTCCCTCCC	0.488													16	89	---	---	---	---	PASS
COPZ2	51226	broad.mit.edu	37	17	46103760	46103760	+	3'UTR	SNP	A	G	G	rs12051	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46103760A>G	uc002imy.2	-	13						NM_016429	NP_057513	Q9P299	COPZ2_HUMAN	coatomer protein complex, subunit zeta 2						intracellular protein transport|vesicle-mediated transport	cis-Golgi network|COPI vesicle coat					0						TGGGGAAATGATCTGGGGGGC	0.547											OREG0024510	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	22	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71357832	71357832	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71357832G>T	uc010dfm.2	-	39	5458	c.5458C>A	c.(5458-5460)CCC>ACC	p.P1820T	SDK2_uc002jjt.3_Missense_Mutation_p.P960T|SDK2_uc010dfn.2_Missense_Mutation_p.P1499T	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	1820	Extracellular (Potential).				cell adhesion	integral to membrane				ovary(2)	2						CCTTCTCCGGGGCCCGTGGTG	0.577													8	32	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10463680	10463680	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10463680T>G	uc002moc.3	-	22	3500	c.3122A>C	c.(3121-3123)GAC>GCC	p.D1041A	TYK2_uc010dxe.2_Missense_Mutation_p.D856A	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	1041	Protein kinase 2.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TAGGCCAAAGTCCCCGATCTT	0.657													6	18	---	---	---	---	PASS
EPS15L1	58513	broad.mit.edu	37	19	16535940	16535940	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16535940T>C	uc002ndz.1	-	9	752	c.746A>G	c.(745-747)AAC>AGC	p.N249S	EPS15L1_uc002ndx.2_Missense_Mutation_p.N249S|EPS15L1_uc002ndy.2_RNA|EPS15L1_uc010xpe.1_Missense_Mutation_p.N139S|EPS15L1_uc010xpf.1_Missense_Mutation_p.N152S|EPS15L1_uc002nea.1_Missense_Mutation_p.N249S|EPS15L1_uc010eah.1_Missense_Mutation_p.N249S|EPS15L1_uc002neb.1_Missense_Mutation_p.N95S|EPS15L1_uc002nec.1_Missense_Mutation_p.N249S	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	249					endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						CCCTGTGCTGTTGAGGCTGCT	0.647													15	31	---	---	---	---	PASS
CHERP	10523	broad.mit.edu	37	19	16630029	16630029	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16630029G>A	uc002nei.1	-	17	2766	c.2692C>T	c.(2692-2694)CGC>TGC	p.R898C	MED26_uc002nee.2_RNA|C19orf44_uc002neh.1_Intron|C19orf44_uc010eai.1_Intron|CHERP_uc010xpg.1_Missense_Mutation_p.R437C	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum	898					cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						TTGTTCCTGCGGTAGTTCTCA	0.642													15	41	---	---	---	---	PASS
SLC27A1	376497	broad.mit.edu	37	19	17611525	17611525	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17611525C>G	uc002ngu.1	+	10	1526	c.1476C>G	c.(1474-1476)GAC>GAG	p.D492E	SLC27A1_uc010xpp.1_Missense_Mutation_p.D313E|SLC27A1_uc002ngv.1_Missense_Mutation_p.D94E	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN	solute carrier family 27, member 1	492	Cytoplasmic (Potential).				cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0						TGCCAGGTGACGTGCTAGTGA	0.657													5	37	---	---	---	---	PASS
PSG3	5671	broad.mit.edu	37	19	43228148	43228148	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43228148G>T	uc002oue.2	-	6	1405	c.1273C>A	c.(1273-1275)CTT>ATT	p.L425I	PSG3_uc002ouf.2_RNA|PSG3_uc010eil.2_Intron	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	425					defense response|female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				AATGGATTAAGGCCAGGAAGA	0.443													17	142	---	---	---	---	PASS
PLA2G4C	8605	broad.mit.edu	37	19	48601350	48601350	+	Intron	SNP	T	C	C	rs251685	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48601350T>C	uc002phx.2	-						PLA2G4C_uc002phw.2_Intron|PLA2G4C_uc010elr.2_Intron|PLA2G4C_uc010xzd.1_Intron|PLA2G4C_uc002phy.3_3'UTR	NM_003706	NP_003697	Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC isoform 1 precursor						arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding			ovary(1)|skin(1)	2		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		CACTCCGTGCTGTTCCATCCC	0.537													7	170	---	---	---	---	PASS
GZF1	64412	broad.mit.edu	37	20	23347703	23347703	+	Silent	SNP	C	T	T			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23347703C>T	uc010gdb.2	+	4	1602	c.1428C>T	c.(1426-1428)CAC>CAT	p.H476H	GZF1_uc002wsy.2_Silent_p.H476H|GZF1_uc010zsq.1_5'UTR|GZF1_uc010zsr.1_Intron|GZF1_uc002wsz.2_Silent_p.H476H	NM_022482	NP_071927	Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	476	C2H2-type 6.				transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding			kidney(1)	1	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					CTCAGAACCACATGCTGATTT	0.348													20	67	---	---	---	---	PASS
RNF160	26046	broad.mit.edu	37	21	30332994	30332994	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30332994G>A	uc002ymr.2	-	12	2349	c.2336C>T	c.(2335-2337)ACT>ATT	p.T779I		NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294	733							ligase activity|zinc ion binding				0						GAGCCAAGGAGTTACTAAAGC	0.373													5	58	---	---	---	---	PASS
ANKRD54	129138	broad.mit.edu	37	22	38227935	38227935	+	3'UTR	SNP	A	G	G			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38227935A>G	uc003auc.2	-	8					ANKRD54_uc003aud.2_3'UTR	NM_138797	NP_620152	Q6NXT1	ANR54_HUMAN	ankyrin repeat domain 54												0	Melanoma(58;0.045)					GCAGGAAGGCAGGGAGCCTCT	0.582													4	11	---	---	---	---	PASS
GK	2710	broad.mit.edu	37	X	30695527	30695527	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30695527G>A	uc004dch.3	+	4	474	c.295G>A	c.(295-297)GTC>ATC	p.V99I	GK_uc010ngj.2_Missense_Mutation_p.V99I|GK_uc004dci.3_Missense_Mutation_p.V99I|GK_uc011mjz.1_5'UTR|GK_uc011mka.1_5'UTR|GK_uc010ngk.2_5'UTR	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a	99					glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1						AACCACTGTAGTCTGGGACAA	0.413													5	115	---	---	---	---	PASS
TBC1D25	4943	broad.mit.edu	37	X	48403330	48403330	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48403330G>C	uc004dka.1	+	3	418	c.307G>C	c.(307-309)GAC>CAC	p.D103H	TBC1D25_uc011mly.1_Missense_Mutation_p.D45H|TBC1D25_uc004dkb.1_Intron|TBC1D25_uc011mlz.1_Intron|TBC1D25_uc011mma.1_5'UTR|TBC1D25_uc004dkc.1_Intron|TBC1D25_uc011mmb.1_Missense_Mutation_p.D107H|TBC1D25_uc011mmc.1_Intron|TBC1D25_uc011mmd.1_5'UTR	NM_002536	NP_002527	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	103						intracellular	Rab GTPase activator activity			ovary(1)	1						ACTTCTATCTGACTGGGACCT	0.562													4	50	---	---	---	---	PASS
ALAS2	212	broad.mit.edu	37	X	55039931	55039931	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55039931C>A	uc004dua.3	-	10	1726	c.1588G>T	c.(1588-1590)GAA>TAA	p.E530*	ALAS2_uc004dub.3_Nonsense_Mutation_p.E517*|ALAS2_uc004dud.3_Nonsense_Mutation_p.E493*	NM_000032	NP_000023	P22557	HEM0_HUMAN	5-aminolevulinate synthase 2 isoform a	530					cellular iron ion homeostasis|erythrocyte differentiation|heme biosynthetic process|hemoglobin biosynthetic process|oxygen homeostasis|response to hypoxia	mitochondrial inner membrane|mitochondrial matrix	5-aminolevulinate synthase activity|coenzyme binding|glycine binding|protein binding|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(1)	1					Glycine(DB00145)	ACAAAATCTTCCATCATCTGA	0.577													11	54	---	---	---	---	PASS
TEX13A	56157	broad.mit.edu	37	X	104463697	104463697	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104463697C>A	uc004ema.2	-	5	1291	c.1179G>T	c.(1177-1179)AGG>AGT	p.R393S	IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_3'UTR	NM_031274	NP_112564	Q9BXU3	TX13A_HUMAN	testis expressed sequence 13A	393	RanBP2-type.					intracellular	zinc ion binding			ovary(2)	2						AGCAAGTATCCCTCCGTGAAA	0.488													40	222	---	---	---	---	PASS
MIR450A1	554214	broad.mit.edu	37	X	133674458	133674458	+	RNA	SNP	G	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133674458G>A	hsa-mir-450a-1|MI0001652	-			c.4G>A			MIR450B_hsa-mir-450b|MI0005531_5'Flank|uc011mvl.1_RNA																	0						GTTTAGTATCGTTTTTGATTG	0.328													20	72	---	---	---	---	PASS
AFF2	2334	broad.mit.edu	37	X	148035250	148035250	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148035250C>A	uc004fcp.2	+	10	2017	c.1538C>A	c.(1537-1539)CCT>CAT	p.P513H	AFF2_uc004fcq.2_Missense_Mutation_p.P503H|AFF2_uc004fcr.2_Missense_Mutation_p.P474H|AFF2_uc011mxb.1_Missense_Mutation_p.P478H|AFF2_uc004fcs.2_Missense_Mutation_p.P480H|AFF2_uc011mxc.1_Missense_Mutation_p.P154H	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	513					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					AATGAGGCACCTCGTGTGGCA	0.522													22	111	---	---	---	---	PASS
SORT1	6272	broad.mit.edu	37	1	109883200	109883200	+	Intron	DEL	A	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109883200delA	uc001dxm.1	-						SORT1_uc010ovi.1_Intron	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ttgccacaataaaaaaAAAAA	0.209													4	2	---	---	---	---	
MED12L	116931	broad.mit.edu	37	3	151078612	151078612	+	Intron	DEL	T	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151078612delT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGATCATAGGTTTTTTTTCCC	0.259													4	2	---	---	---	---	
KIAA1530	57654	broad.mit.edu	37	4	1348691	1348692	+	Intron	INS	-	G	G	rs138445940	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1348691_1348692insG	uc003gde.3	+							NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654												0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			GTGCCATGCATGGGGGGGGTCC	0.639													4	3	---	---	---	---	
ATP10D	57205	broad.mit.edu	37	4	47574662	47574663	+	Intron	DEL	GT	-	-	rs143303182		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47574662_47574663delGT	uc003gxk.1	+						ATP10D_uc003gxl.1_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TTGTGCGCACgtgtgtgtgtgt	0.188													4	2	---	---	---	---	
GALNT10	55568	broad.mit.edu	37	5	153677361	153677362	+	Intron	INS	-	TCCCC	TCCCC	rs146520730	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153677361_153677362insTCCCC	uc003lvh.2	+						GALNT10_uc003lvg.1_Intron|GALNT10_uc010jic.2_Intron|GALNT10_uc010jid.2_5'Flank	NM_198321	NP_938080	Q86SR1	GLT10_HUMAN	GalNAc transferase 10 isoform a							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			CTCTTTGTACTGAGCAAAAACT	0.233													6	3	---	---	---	---	
SNAP91	9892	broad.mit.edu	37	6	84292066	84292066	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84292066delC	uc011dze.1	-	22	2341	c.2024delG	c.(2023-2025)GGTfs	p.G675fs	SNAP91_uc011dzd.1_Frame_Shift_Del_p.G178fs|SNAP91_uc003pkb.2_Frame_Shift_Del_p.G584fs|SNAP91_uc003pkc.2_Frame_Shift_Del_p.G645fs|SNAP91_uc003pkd.2_Frame_Shift_Del_p.G368fs|SNAP91_uc003pka.2_Frame_Shift_Del_p.G673fs	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	675					clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		CATGAAAGAACCCCCAAATCC	0.408													17	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62701951	62701952	+	IGR	INS	-	A	A			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62701951_62701952insA								None (None upstream) : LOC643955 (49720 downstream)																							CTTTTTTGGAGAAAAAATATAT	0.337													4	2	---	---	---	---	
LRGUK	136332	broad.mit.edu	37	7	133876636	133876637	+	Intron	INS	-	T	T	rs111830556		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133876636_133876637insT	uc003vrm.1	+							NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						TTTTTATGGGGTTTTTTTTTTT	0.262													4	2	---	---	---	---	
MSR1	4481	broad.mit.edu	37	8	15978192	15978192	+	Intron	DEL	T	-	-	rs35356880		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15978192delT	uc003wwz.2	-						MSR1_uc010lsu.2_Intron|MSR1_uc003wxa.2_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TTTACAGCACTTTTTTTTTAA	0.279													4	2	---	---	---	---	
TRIM55	84675	broad.mit.edu	37	8	67062909	67062909	+	Intron	DEL	T	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67062909delT	uc003xvv.2	+						TRIM55_uc003xvu.2_Intron|TRIM55_uc003xvw.2_Intron|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1							cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			ATATGGTGCCttttttttttt	0.189													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94488677	94488677	+	Intron	DEL	A	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94488677delA	uc004arj.1	-						ROR2_uc004ari.1_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						TAGTTTACAGAAAAAAAAAAT	0.219													4	2	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140218010	140218010	+	Intron	DEL	C	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140218010delC	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						TCACCCCGGACCCACGAGGGA	0.677													8	5	---	---	---	---	
UBTD1	80019	broad.mit.edu	37	10	99329676	99329676	+	Intron	DEL	A	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99329676delA	uc001knv.1	+						ANKRD2_uc001knw.2_5'Flank|ANKRD2_uc009xvu.2_5'Flank	NM_024954	NP_079230	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1												0		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		gtctcaaaagaaaaaaaaaaa	0.000													2	4	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105186867	105186868	+	Intron	INS	-	A	A	rs75558099		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105186867_105186868insA	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		ccttgtcccagaaaaaaaaaaa	0.208													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134650140	134650140	+	Intron	DEL	C	-	-	rs3833717		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134650140delC	uc010qux.1	-							NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		CTCTGGACGGCCCCCCCCCCT	0.657													5	4	---	---	---	---	
HSD17B12	51144	broad.mit.edu	37	11	43819741	43819741	+	Intron	DEL	G	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43819741delG	uc001mxq.3	+							NM_016142	NP_057226	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12						long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0						AAATTATCCTGGTGTAAATTT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	58060361	58060362	+	IGR	INS	-	T	T	rs34408829		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58060361_58060362insT								OR10W1 (24629 upstream) : OR5B17 (65238 downstream)																							ATTGAGATTCCttttttttttt	0.223													4	3	---	---	---	---	
ARHGEF12	23365	broad.mit.edu	37	11	120335712	120335713	+	Intron	INS	-	A	A	rs141433804	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120335712_120335713insA	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		aacactgtctcaaaaaaaagaa	0.124			T	MLL	AML								6	5	---	---	---	---	
CLSTN3	9746	broad.mit.edu	37	12	7295315	7295315	+	Intron	DEL	T	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7295315delT	uc001qsr.2	+						CLSTN3_uc001qss.2_Intron	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						tCttttttccttttttttttt	0.030											OREG0021650	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
LPCAT4	254531	broad.mit.edu	37	15	34656626	34656627	+	Intron	DEL	TC	-	-	rs60508631	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34656626_34656627delTC	uc001zig.2	-						LPCAT4_uc010bav.1_Intron	NM_153613	NP_705841	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding				0						tttttttttttctgttgttgtt	0.203													6	3	---	---	---	---	
TMEM220	388335	broad.mit.edu	37	17	10619317	10619318	+	Intron	INS	-	GATA	GATA	rs146093202	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10619317_10619318insGATA	uc002gmx.2	-						TMEM220_uc002gmy.2_Intron	NM_001004313	NP_001004313	Q6QAJ8	TM220_HUMAN	transmembrane protein 220							integral to membrane					0						tataCTGCCCTGACACAAAATG	0.203													5	3	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64794848	64794848	+	Intron	DEL	G	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64794848delG	uc002jfp.1	+							NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	tggtggtggtggtgatggtgg	0.000													4	2	---	---	---	---	
FBF1	85302	broad.mit.edu	37	17	73928960	73928960	+	Intron	DEL	A	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73928960delA	uc002jqc.2	-						FBF1_uc002jqa.1_5'Flank|FBF1_uc010wsp.1_Intron|FBF1_uc002jqd.1_Intron	NM_001080542	NP_001074011	Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1												0						aatattctctaaaaaaaaaaa	0.209													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5576516	5576517	+	IGR	INS	-	T	T	rs147507953	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5576516_5576517insT								PLAC2 (8511 upstream) : SAFB2 (10494 downstream)																							tatcaagcccattttTTTTAAC	0.158													2	5	---	---	---	---	
RASAL3	64926	broad.mit.edu	37	19	15572476	15572476	+	Intron	DEL	C	-	-			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15572476delC	uc002nbe.2	-							NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						CCTCAGGCTACCCTTTCCATT	0.597													4	2	---	---	---	---	
ZNF880	400713	broad.mit.edu	37	19	52877717	52877717	+	Intron	DEL	T	-	-	rs77187934		TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52877717delT	uc002pzc.2	+						ZNF880_uc002pzb.3_Intron	NM_001145434	NP_001138906	Q6PDB4	ZN880_HUMAN	zinc finger protein LOC400713						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						GGCCCCATAAttttttttttt	0.254													4	2	---	---	---	---	
RASL10A	10633	broad.mit.edu	37	22	29709663	29709664	+	Intron	INS	-	C	C	rs146834773	by1000genomes	TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29709663_29709664insC	uc003aff.2	-						RASL10A_uc003afg.2_3'UTR	NM_006477	NP_006468	Q92737	RSLAA_HUMAN	RAS-related on chromosome 22 isoform a						small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity				0						CAGAGACACCGCCCCCCCCGCC	0.653													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13463949	13463950	+	IGR	INS	-	CACC	CACC			TCGA-B0-5097-01A-01D-1421-08	TCGA-B0-5097-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13463949_13463950insCACC								None (None upstream) : None (None downstream)																							GGGTGTGTCTTCCCCCCCCTCC	0.639													4	3	---	---	---	---	
