Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16975868	16975868	+	Intron	SNP	T	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16975868T>A	uc010och.1	+						MST1P2_uc001azl.3_Intron|MST1P2_uc009vox.2_Intron|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						AGAGCTTCTCTCCCAGCCATA	0.577													7	22	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16976641	16976641	+	RNA	SNP	C	T	T	rs1057417	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16976641C>T	uc010och.1	+	14		c.2362C>T			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						AATCCCCAACCGAGTATGCGC	0.577													8	46	---	---	---	---	PASS
LRRC40	55631	broad.mit.edu	37	1	70618119	70618119	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70618119A>C	uc001der.1	-	12	1488	c.1436T>G	c.(1435-1437)CTC>CGC	p.L479R		NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	479	LRR 16.									ovary(1)	1						TAAATACCTGAGATCTAAAAA	0.294													66	144	---	---	---	---	PASS
ODF2L	57489	broad.mit.edu	37	1	86841980	86841980	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86841980T>C	uc001dll.1	-	8	1086	c.746A>G	c.(745-747)TAC>TGC	p.Y249C	ODF2L_uc001dlm.1_Missense_Mutation_p.Y249C|ODF2L_uc001dln.2_Missense_Mutation_p.Y249C|ODF2L_uc001dlo.2_Missense_Mutation_p.Y118C|ODF2L_uc001dlp.2_Missense_Mutation_p.Y249C|ODF2L_uc010osg.1_Missense_Mutation_p.Y249C|ODF2L_uc001dlq.1_Missense_Mutation_p.Y79C|ODF2L_uc009wcr.1_Missense_Mutation_p.Y118C	NM_020729	NP_065780	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like isoform	249	Potential.					centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)		CCTTTGTTTGTAAACTTTAGA	0.323													7	606	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93649561	93649561	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93649561A>G	uc001dpq.2	+	3	683	c.515A>G	c.(514-516)TAT>TGT	p.Y172C		NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	54										ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AATTCTGATTATGCCCCTAAT	0.323													64	144	---	---	---	---	PASS
CHD1L	9557	broad.mit.edu	37	1	146743932	146743932	+	Silent	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146743932T>C	uc001epm.3	+	12	1323	c.1260T>C	c.(1258-1260)AGT>AGC	p.S420S	uc001epp.2_Intron|CHD1L_uc001epn.3_Silent_p.S307S|CHD1L_uc010ozo.1_RNA|CHD1L_uc009wjg.2_Intron|CHD1L_uc009wjh.2_Intron|CHD1L_uc010ozp.1_Silent_p.S139S|CHD1L_uc001epo.3_Silent_p.S216S|CHD1L_uc010ozq.1_Intron|CHD1L_uc009wji.2_Silent_p.S139S	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein	420	Helicase C-terminal.				chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)					TTCTCCTGAGTACTAGGGCAG	0.438													5	460	---	---	---	---	PASS
TOR3A	64222	broad.mit.edu	37	1	179057120	179057120	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179057120G>C	uc001gmd.2	+	4	866	c.714G>C	c.(712-714)GAG>GAC	p.E238D	TOR3A_uc010pnd.1_Missense_Mutation_p.E22D	NM_022371	NP_071766	Q9H497	TOR3A_HUMAN	torsin family 3, member A precursor	238					chaperone mediated protein folding requiring cofactor	endoplasmic reticulum	ATP binding			pancreas(1)	1						ATGAAGCGGAGAAGCTGCACC	0.607													15	35	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190423861	190423861	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190423861A>G	uc001gse.1	-	2	392	c.160T>C	c.(160-162)TTC>CTC	p.F54L	FAM5C_uc010pot.1_Silent_p.P15P	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	54						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					GAGCGATGGAAGGGTCCCTTA	0.483													5	228	---	---	---	---	PASS
RNASEH1	246243	broad.mit.edu	37	2	3596250	3596250	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3596250T>C	uc002qxt.2	-	6	719	c.629A>G	c.(628-630)GAC>GGC	p.D210G	RNASEH1_uc002qxs.2_Missense_Mutation_p.D93G	NM_002936	NP_002927	O60930	RNH1_HUMAN	ribonuclease H1	210	RNase H.	Magnesium 1 (By similarity).			RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		AAACATACTGTCTGTATACAG	0.388													6	457	---	---	---	---	PASS
FEZ2	9637	broad.mit.edu	37	2	36808457	36808457	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36808457A>G	uc002rph.2	-	4	657	c.610T>C	c.(610-612)TCT>CCT	p.S204P	FEZ2_uc002rpe.2_Missense_Mutation_p.S33P|FEZ2_uc002rpf.2_Missense_Mutation_p.S33P|FEZ2_uc002rpg.2_Missense_Mutation_p.S204P|FEZ2_uc002rpi.2_Missense_Mutation_p.S59P|FEZ2_uc002rpj.2_Missense_Mutation_p.S204P	NM_005102	NP_005093	Q9UHY8	FEZ2_HUMAN	zygin 2 isoform 1	204					axon guidance|signal transduction		protein binding			ovary(1)	1		all_hematologic(82;0.21)				CCGGTACTAGACCTCTTGAGA	0.423													7	545	---	---	---	---	PASS
MIR663B	100302269	broad.mit.edu	37	2	133015485	133015485	+	5'Flank	SNP	C	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133015485C>A	hsa-mir-663b|MI0006336	-						NCRNA00164_uc002ttj.3_RNA																	0						AACCCACACACAACCTGTCGG	0.697													3	23	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179398617	179398617	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179398617T>C	uc010zfg.1	-	307	95245	c.95021A>G	c.(95020-95022)AAG>AGG	p.K31674R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K25369R|TTN_uc010zfi.1_Missense_Mutation_p.K25302R|TTN_uc010zfj.1_Missense_Mutation_p.K25177R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32601							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTAATTTTCTTCATGGTTCT	0.403													73	125	---	---	---	---	PASS
CDK15	65061	broad.mit.edu	37	2	202672661	202672661	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202672661C>A	uc002uyt.2	+	3	403	c.354C>A	c.(352-354)TAC>TAA	p.Y118*	CDK15_uc010ftm.2_5'UTR|CDK15_uc002uys.2_Nonsense_Mutation_p.Y67*|CDK15_uc010ftn.1_Nonsense_Mutation_p.Y67*|CDK15_uc010fto.1_Nonsense_Mutation_p.Y118*	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2	118	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	CGACAGTTTACAAGGGGATTA	0.323													8	226	---	---	---	---	PASS
UNC80	285175	broad.mit.edu	37	2	210685123	210685123	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210685123T>C	uc010zjc.1	+	13	2131	c.2051T>C	c.(2050-2052)CTT>CCT	p.L684P		NM_032504	NP_115893	Q8N2C7	UNC80_HUMAN	chromosome 2 open reading frame 21 isoform 1	684						integral to membrane					0						GAATGCTTGCTTCAACTTGGT	0.433													6	347	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219399357	219399357	+	Silent	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219399357T>C	uc002vie.2	-	9	1206	c.753A>G	c.(751-753)AAA>AAG	p.K251K	USP37_uc010fvs.1_Silent_p.K251K|USP37_uc010zkf.1_Silent_p.K251K|USP37_uc002vif.2_Silent_p.K251K|USP37_uc002vig.2_Silent_p.K179K|USP37_uc010zkg.1_Silent_p.K251K	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	251					ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		CTTCTGACTGTTTCAAACTCA	0.313													7	667	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	240504869	240504869	+	3'UTR	SNP	G	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240504869G>T	uc002vym.1	+	2										SubName: Full=cDNA FLJ45964 fis, clone PLACE7014396;																		AGCATGTTTGGTAGCCATTCT	0.478													9	201	---	---	---	---	PASS
TOP2B	7155	broad.mit.edu	37	3	25670359	25670359	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25670359A>C	uc011awn.1	-	15	1928	c.1885T>G	c.(1885-1887)TGG>GGG	p.W629G	TOP2B_uc003cdj.2_Missense_Mutation_p.W624G	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme	629					DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						TTTATTTTCCAGGCTTTCTGG	0.259													10	214	---	---	---	---	PASS
CGGBP1	8545	broad.mit.edu	37	3	88104822	88104822	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88104822C>G	uc003dqs.2	-	4	817	c.305G>C	c.(304-306)AGT>ACT	p.S102T	CGGBP1_uc003dqt.2_Missense_Mutation_p.S102T|CGGBP1_uc003dqu.2_Missense_Mutation_p.S102T	NM_001008390	NP_001008391	Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1	102					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding				0		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		CTGGATAACACTGACTTTCTC	0.483													51	110	---	---	---	---	PASS
CCDC54	84692	broad.mit.edu	37	3	107097368	107097368	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107097368A>G	uc003dwi.1	+	1	1181	c.934A>G	c.(934-936)AAC>GAC	p.N312D		NM_032600	NP_115989	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	312											0						CTCCATCTTCAACAATATTTA	0.423													92	235	---	---	---	---	PASS
C3orf1	51300	broad.mit.edu	37	3	119242475	119242475	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119242475G>T	uc003ecn.2	+	7	943	c.730G>T	c.(730-732)GAG>TAG	p.E244*	C3orf1_uc003eco.2_RNA|C3orf1_uc003ecp.2_RNA	NM_016589	NP_057673	Q9NPL8	TIDC1_HUMAN	hypothetical protein LOC51300	244						integral to membrane|mitochondrial inner membrane	protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.186)		ACAAGTTACTGAGCACCTCCC	0.358													99	244	---	---	---	---	PASS
FAIM	55179	broad.mit.edu	37	3	138347993	138347993	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138347993A>G	uc003esr.2	+	4	645	c.385A>G	c.(385-387)ACA>GCA	p.T129A	FAIM_uc003eso.1_Missense_Mutation_p.T163A|FAIM_uc003esp.2_Missense_Mutation_p.T163A|FAIM_uc003esq.2_Missense_Mutation_p.T151A|FAIM_uc003ess.2_Missense_Mutation_p.T129A	NM_001033032	NP_001028204	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule isoform c	129					apoptosis	cytoplasm					0						AAAATTGGAGACAGCGGTAAG	0.318													7	657	---	---	---	---	PASS
GPR171	29909	broad.mit.edu	37	3	150916358	150916358	+	Silent	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150916358G>A	uc003eyq.3	-	3	1056	c.816C>T	c.(814-816)CTC>CTT	p.L272L	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_013308	NP_037440	O14626	GP171_HUMAN	G protein-coupled receptor 171	272	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACACAGCCAGGAGCAGTGTAG	0.473													4	153	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	159819469	159819469	+	Intron	SNP	G	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159819469G>T	uc003fcw.1	-						uc003fcz.1_RNA					Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																		GAGGACTCTGGAGATGCCGAA	0.473													6	202	---	---	---	---	PASS
MUC20	200958	broad.mit.edu	37	3	195452619	195452619	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195452619C>T	uc010hzo.2	+	3	758	c.632C>T	c.(631-633)GCC>GTC	p.A211V	MUC20_uc010hzp.2_Missense_Mutation_p.A176V|MUC20_uc011bte.1_RNA	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	382	11.|Ser-rich.|12 X 20 AA approximate tandem repeats of S-S-E-S-S-A-S-S-D-S-P-H-P-V-I-T-P-S-R-A.				protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CCGTCACGGGCCTCAGAGAGC	0.662													5	18	---	---	---	---	PASS
MUC20	200958	broad.mit.edu	37	3	195452645	195452645	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195452645G>A	uc010hzo.2	+	3	784	c.658G>A	c.(658-660)GGC>AGC	p.G220S	MUC20_uc010hzp.2_Missense_Mutation_p.G185S|MUC20_uc011bte.1_RNA	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	391	12 X 20 AA approximate tandem repeats of S-S-E-S-S-A-S-S-D-S-P-H-P-V-I-T-P-S-R-A.|12; approximate.				protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTCTTCCGACGGCCCCCATCC	0.622													5	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	53610390	53610390	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53610390C>T	uc003gzr.2	-	4	2254	c.1298G>A	c.(1297-1299)CGA>CAA	p.R433Q	uc003gzs.2_Missense_Mutation_p.R433Q					RecName: Full=Uncharacterized protein LP9056; Flags: Precursor;																		agccgtttgtcgttgggtggt	0.000													6	276	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	256578	256578	+	3'UTR	SNP	T	C	C	rs150891426		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:256578T>C	uc003jao.3	+	15					SDHA_uc011clw.1_3'UTR|SDHA_uc003jap.3_3'UTR|SDHA_uc003jaq.3_3'UTR|SDHA_uc003jar.3_3'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TTTGTAATTATGTATAATAGC	0.468									Familial_Paragangliomas				8	42	---	---	---	---	PASS
ELOVL7	79993	broad.mit.edu	37	5	60053458	60053458	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60053458A>G	uc003jsi.3	-	8	714	c.514T>C	c.(514-516)TTC>CTC	p.F172L	ELOVL7_uc011cqo.1_Missense_Mutation_p.F85L|ELOVL7_uc010iwk.2_Missense_Mutation_p.F172L|ELOVL7_uc003jsj.3_Missense_Mutation_p.F159L	NM_024930	NP_079206	A1L3X0	ELOV7_HUMAN	elongation of very long chain fatty acids-like	172	Helical; (Potential).				fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				AGGGCATGGAATGTTCCCAAA	0.373													5	237	---	---	---	---	PASS
FBXL17	64839	broad.mit.edu	37	5	107703606	107703606	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107703606C>G	uc011cvc.1	-	2	1449	c.1042G>C	c.(1042-1044)GTT>CTT	p.V348L	FBXL17_uc003kon.3_5'UTR	NM_001163315	NP_001156787	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17	348	F-box.										0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		TACTTGCAAACCAATGATGCG	0.403													81	238	---	---	---	---	PASS
YTHDC2	64848	broad.mit.edu	37	5	112899759	112899759	+	Silent	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112899759T>C	uc003kqn.2	+	20	2829	c.2646T>C	c.(2644-2646)GCT>GCC	p.A882A		NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	882							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		AACGTGCAGCTATGCTTTGTA	0.418													63	216	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	1515255	1515255	+	RNA	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1515255C>T	uc003mto.2	+	4		c.475C>T								Homo sapiens cDNA clone IMAGE:30390216.																		TCAGACTCTTCAGTTGACGCC	0.443													11	224	---	---	---	---	PASS
CYP21A2	1589	broad.mit.edu	37	6	31974158	31974158	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31974158A>G	uc010jtp.2	+	3	426	c.308A>G	c.(307-309)AAG>AGG	p.K103R	CYP21A2_uc011dpb.1_Missense_Mutation_p.K73R			P08686	CP21A_HUMAN	SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2; SubName: Full=Cytochrome P450 21-hydroxylase; SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2, isoform CRA_b; SubName: Full=DJ34F7.3 (Cytochrome P450, subfamily XXIA (Steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21, P450c21B)); SubName: Full=cDNA, FLJ95495, Homo sapiens cytochrome P450, family 21, subfamily A, polypeptide 2(CYP21A2), mRNA;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						CTGGTGTCTAAGAACTACCCG	0.607													5	127	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	65532669	65532669	+	Silent	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65532669A>G	uc011dxu.1	-	20	3577	c.3039T>C	c.(3037-3039)TGT>TGC	p.C1013C	EYS_uc011dxt.1_5'Flank	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	1013	EGF-like 16; calcium-binding (Potential).				response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						CATCATGGAGACAGGGCTCTG	0.398													5	200	---	---	---	---	PASS
LTV1	84946	broad.mit.edu	37	6	144178368	144178368	+	Intron	SNP	T	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144178368T>G	uc003qjs.2	+						LTV1_uc003qju.1_5'UTR|C6orf94_uc010khj.2_5'Flank	NM_032860	NP_116249	Q96GA3	LTV1_HUMAN	LTV1 homolog											ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TCATAGGTCCTTATATTGTGA	0.333													59	120	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4247891	4247891	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4247891C>A	uc003smx.2	+	37	5514	c.5375C>A	c.(5374-5376)CCC>CAC	p.P1792H	SDK1_uc010kso.2_Missense_Mutation_p.P1048H|SDK1_uc003smy.2_Missense_Mutation_p.P279H	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1792	Fibronectin type-III 11.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AAGAGTGACCCCCAGCAGGGG	0.627													5	77	---	---	---	---	PASS
DPY19L2P1	554236	broad.mit.edu	37	7	35180648	35180648	+	Silent	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35180648C>T	uc003teq.1	-	11	1449	c.342G>A	c.(340-342)ACG>ACA	p.T114T	DPY19L2P1_uc003tep.1_RNA|DPY19L2P1_uc010kwz.1_RNA					RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						CACTTACCCACGTCATTAACA	0.308													5	202	---	---	---	---	PASS
ADCY1	107	broad.mit.edu	37	7	45725770	45725770	+	Silent	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45725770G>A	uc003tne.3	+	13	2301	c.2283G>A	c.(2281-2283)ACG>ACA	p.T761T		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	761	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGCTCACCACGTCCTACATCC	0.567													26	40	---	---	---	---	PASS
SPDYE7P	441251	broad.mit.edu	37	7	72334477	72334477	+	RNA	SNP	C	T	T	rs144410215	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72334477C>T	uc010lal.1	-	1		c.5179G>A				NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0						CTAGGAAAGGCGAGCGCGATC	0.577													6	144	---	---	---	---	PASS
SPDYE7P	441251	broad.mit.edu	37	7	72334482	72334482	+	RNA	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72334482G>A	uc010lal.1	-	1		c.5174C>T				NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0						AAAGGCGAGCGCGATCTCGCG	0.587													9	152	---	---	---	---	PASS
CROT	54677	broad.mit.edu	37	7	86991106	86991106	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86991106T>C	uc003uit.2	+	6	730	c.485T>C	c.(484-486)CTA>CCA	p.L162P	CROT_uc003uiu.2_Missense_Mutation_p.L190P	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	162					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TTCCGAATGCTATTTTCTACC	0.313													4	212	---	---	---	---	PASS
PCOLCE	5118	broad.mit.edu	37	7	100205606	100205606	+	Silent	SNP	C	T	T	rs139354390		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100205606C>T	uc003uvo.2	+	9	1428	c.1230C>T	c.(1228-1230)CCC>CCT	p.P410P	PCOLCE_uc010lhb.1_RNA|PCOLCE_uc003uvp.1_RNA	NM_002593	NP_002584	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer	410	NTR.				multicellular organismal development	extracellular space	collagen binding|heparin binding|peptidase activator activity				0	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					ACAGAGGCCCCGTCCTTCCTC	0.562													3	42	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121228727	121228727	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121228727G>A	uc003yox.2	+	14	2000	c.1735G>A	c.(1735-1737)GAG>AAG	p.E579K	COL14A1_uc003yoy.2_Missense_Mutation_p.E257K|COL14A1_uc010mde.1_Missense_Mutation_p.E257K	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	579	Fibronectin type-III 4.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TGAAATCAATGAGGTAAGTTC	0.284													4	178	---	---	---	---	PASS
RECK	8434	broad.mit.edu	37	9	36117073	36117073	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36117073C>T	uc003zyv.2	+	17	2238	c.2152C>T	c.(2152-2154)CAG>TAG	p.Q718*	RECK_uc003zyw.2_Nonsense_Mutation_p.Q590*|RECK_uc003zyx.2_RNA	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor	718	Kazal-like 2.					anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			CGCGTGTGACCAGGTCCAAGA	0.468													5	312	---	---	---	---	PASS
UBQLN1	29979	broad.mit.edu	37	9	86276810	86276810	+	Silent	SNP	G	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86276810G>C	uc004amv.2	-	11	2236	c.1662C>G	c.(1660-1662)CTC>CTG	p.L554L	UBQLN1_uc004amw.2_Silent_p.L526L	NM_013438	NP_038466	Q9UMX0	UBQL1_HUMAN	ubiquilin 1 isoform 1	554	UBA.				apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding				0						CCATTGCACTGAGTTGTTCCA	0.418													119	273	---	---	---	---	PASS
CKS2	1164	broad.mit.edu	37	9	91931300	91931300	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91931300T>G	uc004aqh.2	+	3	295	c.200T>G	c.(199-201)CTT>CGT	p.L67R	SECISBP2_uc010mqn.1_5'Flank|SECISBP2_uc004aqi.1_5'Flank|SECISBP2_uc004aqj.1_5'Flank|SECISBP2_uc011ltk.1_5'Flank|SECISBP2_uc004aqk.1_5'Flank|SECISBP2_uc010mqo.1_5'Flank|SECISBP2_uc011ltl.1_5'Flank	NM_001827	NP_001818	P33552	CKS2_HUMAN	CDC28 protein kinase 2	67					cell division|cell proliferation|phosphatidylinositol-mediated signaling|regulation of cyclin-dependent protein kinase activity|spindle organization		cyclin-dependent protein kinase regulator activity				0						CCACATATTCTTCTCTTTAGA	0.289													60	194	---	---	---	---	PASS
PALM2-AKAP2	445815	broad.mit.edu	37	9	112918733	112918733	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112918733G>T	uc004bej.3	+	9	3310	c.3130G>T	c.(3130-3132)GAG>TAG	p.E1044*	PALM2-AKAP2_uc004bek.3_Nonsense_Mutation_p.E1044*|AKAP2_uc011lwi.1_Nonsense_Mutation_p.E902*|AKAP2_uc004bem.2_Nonsense_Mutation_p.E902*|AKAP2_uc011lwj.1_Nonsense_Mutation_p.E813*|PALM2-AKAP2_uc004ben.2_Intron	NM_007203	NP_009134	Q9Y2D5	AKAP2_HUMAN	PALM2-AKAP2 protein isoform 1	813							enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						GGAAGACTATGAGACACACAA	0.537													44	87	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121929513	121929513	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121929513G>A	uc004bkc.2	-	8	2591	c.2135C>T	c.(2134-2136)CCG>CTG	p.P712L		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	712			P -> T (in a colorectal cancer sample; somatic mutation).		cell cycle arrest|cell death	cytoplasm	protein binding	p.P712T(1)		skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						GGGTTTCCCCGGGGCCACAGG	0.557													4	116	---	---	---	---	PASS
TRDMT1	1787	broad.mit.edu	37	10	17195591	17195591	+	Silent	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17195591T>C	uc001iop.2	-	10	1038	c.990A>G	c.(988-990)GAA>GAG	p.E330E	TRDMT1_uc001ioq.2_Silent_p.E306E|TRDMT1_uc001ior.2_Silent_p.E284E|TRDMT1_uc001ios.2_Silent_p.E259E|TRDMT1_uc009xjt.2_Silent_p.E249E|TRDMT1_uc010qcc.1_Silent_p.E259E|TRDMT1_uc010qcd.1_Silent_p.E207E	NM_004412	NP_004403	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1 isoform	330					tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding			ovary(1)	1						TTGTTATCTGTTCTTCTTGTG	0.343													187	453	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55587279	55587279	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55587279C>T	uc001jju.1	-	32	4636	c.4241G>A	c.(4240-4242)CGA>CAA	p.R1414Q	PCDH15_uc010qhq.1_Missense_Mutation_p.R1419Q|PCDH15_uc010qhr.1_Missense_Mutation_p.R1414Q|PCDH15_uc010qhs.1_Missense_Mutation_p.R1426Q|PCDH15_uc010qht.1_Missense_Mutation_p.R1421Q|PCDH15_uc010qhu.1_Missense_Mutation_p.R1414Q|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.R1411Q|PCDH15_uc010qhw.1_Missense_Mutation_p.R1374Q|PCDH15_uc010qhx.1_Missense_Mutation_p.R1343Q|PCDH15_uc010qhy.1_Missense_Mutation_p.R1419Q|PCDH15_uc010qhz.1_Missense_Mutation_p.R1414Q|PCDH15_uc010qia.1_Missense_Mutation_p.R1392Q|PCDH15_uc010qib.1_Missense_Mutation_p.R1389Q	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1414	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				GGCCTGAATTCGTGCAGTCTT	0.408										HNSCC(58;0.16)			17	53	---	---	---	---	PASS
NHLRC2	374354	broad.mit.edu	37	10	115614767	115614767	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115614767G>A	uc001lax.1	+	1	348	c.136G>A	c.(136-138)GAC>AAC	p.D46N	DCLRE1A_uc001law.2_5'Flank	NM_198514	NP_940916	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	46	Thioredoxin.				cell redox homeostasis					ovary(1)	1				Epithelial(162;0.017)|all cancers(201;0.0187)		GCAGAAGGTGGACGGCTGGGA	0.677													10	42	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													4	45	---	---	---	---	PASS
STK33	65975	broad.mit.edu	37	11	8494714	8494714	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8494714A>T	uc001mgi.1	-	2	1254	c.335T>A	c.(334-336)ATT>AAT	p.I112N	STK33_uc001mgj.1_Missense_Mutation_p.I112N|STK33_uc001mgk.1_Missense_Mutation_p.I112N|STK33_uc010rbn.1_Missense_Mutation_p.I71N|STK33_uc001mgl.3_Intron|STK33_uc009yfp.2_Intron	NM_030906	NP_112168	Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	112						Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		ATATACCTCAATAGCAGCTCC	0.368													13	387	---	---	---	---	PASS
CATSPER1	117144	broad.mit.edu	37	11	65792685	65792685	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65792685T>G	uc001ogt.2	-	1	1304	c.1166A>C	c.(1165-1167)AAA>ACA	p.K389T		NM_053054	NP_444282	Q8NEC5	CTSR1_HUMAN	sperm-associated cation channel 1	389	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	protein binding			ovary(2)	2						TTCTGAATGTTTGGTGGAGAT	0.552													121	234	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103229065	103229065	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103229065A>G	uc001pho.2	+	83	12278	c.12134A>G	c.(12133-12135)AAT>AGT	p.N4045S	DYNC2H1_uc001phn.1_Missense_Mutation_p.N4052S|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4045					cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CCTGTCCTCAATCTCTGGAAG	0.408													123	310	---	---	---	---	PASS
USP28	57646	broad.mit.edu	37	11	113683084	113683084	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113683084A>C	uc001poh.2	-	16	1919	c.1886T>G	c.(1885-1887)GTT>GGT	p.V629G	USP28_uc001pog.2_Missense_Mutation_p.V337G|USP28_uc010rwy.1_Missense_Mutation_p.V504G|USP28_uc001poi.2_5'UTR	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	629					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		ATCTCTTTCAACTTCTTCCCA	0.413													14	307	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122931975	122931975	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122931975C>G	uc001pyo.2	-	2	136	c.58G>C	c.(58-60)GTT>CTT	p.V20L	HSPA8_uc009zbc.2_5'Flank|HSPA8_uc001pyp.2_Missense_Mutation_p.V20L|HSPA8_uc010rzu.1_Missense_Mutation_p.V20L|HSPA8_uc009zbd.1_Missense_Mutation_p.V20L|HSPA8_uc010rzv.1_Missense_Mutation_p.V20L	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	20					cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TGCTGGAAAACACCCACACAA	0.438													34	100	---	---	---	---	PASS
CCDC91	55297	broad.mit.edu	37	12	28636996	28636996	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28636996G>T	uc001riq.2	+	11	1129	c.1113G>T	c.(1111-1113)AAG>AAT	p.K371N	CCDC91_uc001rio.2_Missense_Mutation_p.K341N|CCDC91_uc009zjk.2_RNA|CCDC91_uc001rir.2_Missense_Mutation_p.K209N|CCDC91_uc009zjl.2_Missense_Mutation_p.K173N	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner	371	Potential.|Homodimerization.				protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					AAACTGTTAAGGCAGCAATAA	0.388													66	194	---	---	---	---	PASS
GJB6	10804	broad.mit.edu	37	13	20797320	20797320	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20797320G>T	uc001umz.3	-	3	853	c.300C>A	c.(298-300)CAC>CAA	p.H100Q	GJB6_uc001unc.3_Missense_Mutation_p.H100Q|GJB6_uc001una.3_Missense_Mutation_p.H100Q|GJB6_uc001und.3_Missense_Mutation_p.H100Q|GJB6_uc001unb.3_Missense_Mutation_p.H100Q	NM_006783	NP_006774	O95452	CXB6_HUMAN	gap junction protein, beta 6	100	Cytoplasmic (Potential).				cell communication|sensory perception of sound	connexon complex|integral to membrane|intracellular membrane-bounded organelle				ovary(1)	1		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		GAGTGGTTTCGTGCCTGTAGT	0.547													10	39	---	---	---	---	PASS
N4BP2L2	10443	broad.mit.edu	37	13	33101400	33101400	+	Intron	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33101400A>G	uc001uuk.3	-						N4BP2L2_uc001uuj.2_Intron|N4BP2L2_uc010abe.1_Intron|N4BP2L2_uc010tdz.1_Intron|N4BP2L2_uc001uul.1_3'UTR	NM_014887	NP_055702	Q92802	N42L2_HUMAN	phosphonoformate immuno-associated protein 5												0		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		accacctctaacagatggaga	0.000													4	5	---	---	---	---	PASS
NEK3	4752	broad.mit.edu	37	13	52718122	52718122	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52718122T>C	uc001vgi.2	-	10	1040	c.805A>G	c.(805-807)ATC>GTC	p.I269V	NEK3_uc001vgg.2_Missense_Mutation_p.I263V|NEK3_uc001vgh.2_Missense_Mutation_p.I290V|NEK3_uc010tgx.1_RNA|NEK3_uc010tgy.1_Missense_Mutation_p.I269V	NM_152720	NP_689933	P51956	NEK3_HUMAN	NIMA-related kinase 3 isoform a	269	Interaction with VAV2.				cell division|mitosis	nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TCCATGATGATCTGAAATTTA	0.289													7	485	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20389529	20389529	+	Missense_Mutation	SNP	T	C	C	rs143533809	byFrequency	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389529T>C	uc010tkw.1	+	1	764	c.764T>C	c.(763-765)ATC>ACC	p.I255T		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	255	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGACCTTGCATCTTCATCTAT	0.403													6	419	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21868737	21868737	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21868737G>T	uc001was.1	-	23	3662	c.3568C>A	c.(3568-3570)CGC>AGC	p.R1190S	CHD8_uc001war.1_Missense_Mutation_p.R1086S|CHD8_uc001wav.1_Missense_Mutation_p.R632S	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1469					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CGCTTGAAGCGTCCATGAGAT	0.423													6	145	---	---	---	---	PASS
HEATR5A	25938	broad.mit.edu	37	14	31777103	31777103	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31777103T>A	uc001wrf.3	-	24	4012	c.3935A>T	c.(3934-3936)GAT>GTT	p.D1312V	HEATR5A_uc010ami.2_Missense_Mutation_p.D1210V	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1599							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		AATCACCTGATCACTGCCAAT	0.388													7	375	---	---	---	---	PASS
ACTN1	87	broad.mit.edu	37	14	69356966	69356966	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69356966T>G	uc001xkl.2	-	11	1434	c.1124A>C	c.(1123-1125)GAG>GCG	p.E375A	ACTN1_uc001xkk.2_5'Flank|ACTN1_uc010ttb.1_Missense_Mutation_p.E310A|ACTN1_uc001xkm.2_Missense_Mutation_p.E375A|ACTN1_uc001xkn.2_Missense_Mutation_p.E375A|ACTN1_uc001xko.1_Missense_Mutation_p.E310A|ACTN1_uc010ttd.1_Missense_Mutation_p.E354A	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	375	Spectrin 1.|Interaction with DDN.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		ATAGCCCTTCTCCACCTGCTC	0.622													18	49	---	---	---	---	PASS
C15orf29	79768	broad.mit.edu	37	15	34438864	34438864	+	Intron	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34438864T>C	uc001zhp.2	-						C15orf29_uc010ubz.1_3'UTR	NM_024713	NP_078989	Q9H079	CO029_HUMAN	hypothetical protein LOC79768							nucleolus				ovary(1)	1		all_lung(180;1.86e-06)		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)		ATAAATACCATACACTGATGA	0.328													39	69	---	---	---	---	PASS
VPS18	57617	broad.mit.edu	37	15	41191988	41191988	+	Silent	SNP	A	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41191988A>C	uc001zne.2	+	4	1311	c.972A>C	c.(970-972)CCA>CCC	p.P324P		NM_020857	NP_065908	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18	324					endosome organization|lysosome organization|protein transport	HOPS complex|late endosome membrane|lysosomal membrane	metal ion binding|protein binding			ovary(2)|large_intestine(1)	3		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GGGCCAGCCCACCCCTAGCCA	0.647													4	17	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50366324	50366324	+	Silent	SNP	C	T	T	rs150270500	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50366324C>T	uc001zxu.2	-	3	229	c.87G>A	c.(85-87)GCG>GCA	p.A29A	ATP8B4_uc010ber.2_5'UTR|ATP8B4_uc010ufd.1_5'UTR|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	29	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TTTCACTTACCGCATACTGGA	0.373													11	498	---	---	---	---	PASS
CRYM	1428	broad.mit.edu	37	16	21269906	21269906	+	3'UTR	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21269906G>A	uc002dik.2	-	8					CRYM_uc010bwq.1_Intron|CRYM_uc002dil.2_3'UTR|CRYM_uc002dim.2_3'UTR	NM_001888	NP_001879	Q14894	CRYM_HUMAN	crystallin, mu isoform 1						negative regulation of transcription from RNA polymerase II promoter|sensory perception of sound|thyroid hormone transport	cytoplasm|nucleus|plasma membrane	NADP binding|protein homodimerization activity|thyroid hormone binding|transcription corepressor activity				0				GBM - Glioblastoma multiforme(48;0.0573)	Levothyroxine(DB00451)	TTATAACTTGGTAGAACAGAA	0.353													4	9	---	---	---	---	PASS
EDC4	23644	broad.mit.edu	37	16	67916780	67916780	+	Intron	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67916780G>A	uc002eur.2	+						EDC4_uc010cer.2_Intron|EDC4_uc002eus.2_Intron|EDC4_uc002eut.1_Missense_Mutation_p.R133K|NRN1L_uc002euu.2_5'Flank	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TGTGTGGGCAGAGTACTGGGC	0.602											OREG0023890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	31	---	---	---	---	PASS
ZC3H18	124245	broad.mit.edu	37	16	88688681	88688681	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88688681C>A	uc002fky.2	+	9	1752	c.1552C>A	c.(1552-1554)CCT>ACT	p.P518T	ZC3H18_uc010voz.1_Missense_Mutation_p.P542T|ZC3H18_uc010chw.2_RNA	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	518						nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GTGGAAGGACCCTTGGCGCCG	0.602													15	40	---	---	---	---	PASS
PSMD11	5717	broad.mit.edu	37	17	30806900	30806900	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30806900C>T	uc010cta.1	+	11	1110	c.1070C>T	c.(1069-1071)TCC>TTC	p.S357F	PSMD11_uc002hhm.2_Missense_Mutation_p.S357F	NM_002815	NP_002806	O00231	PSD11_HUMAN	proteasome 26S non-ATPase subunit 11	357	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			ATCAAACTCTCCAAGGTAAGG	0.498													111	229	---	---	---	---	PASS
CDK12	51755	broad.mit.edu	37	17	37681129	37681129	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37681129G>A	uc010cvv.2	+	12	3884	c.3298G>A	c.(3298-3300)GAT>AAT	p.D1100N	CDK12_uc010wef.1_Missense_Mutation_p.D1099N|CDK12_uc002hrw.3_Missense_Mutation_p.D1100N	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	1100					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						TGGGGCTGGGGATGCAATAGG	0.517										TCGA Ovarian(9;0.13)			15	39	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44116407	44116407	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44116407G>C	uc002ikb.2	-	8	2463	c.2378C>G	c.(2377-2379)TCT>TGT	p.S793C	KIAA1267_uc002ikc.2_Missense_Mutation_p.S793C|KIAA1267_uc002ikd.2_Missense_Mutation_p.S793C|KIAA1267_uc010dav.2_Missense_Mutation_p.S793C|KIAA1267_uc010wkb.1_Missense_Mutation_p.S124C|KIAA1267_uc010wkc.1_Intron	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	793						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				ACTTCTCTCAGATGAATGGTC	0.567													62	143	---	---	---	---	PASS
TXNDC2	84203	broad.mit.edu	37	18	9887416	9887416	+	Missense_Mutation	SNP	A	C	C	rs2240909	byFrequency	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9887416A>C	uc002koi.3	+	2	1389	c.940A>C	c.(940-942)ATC>CTC	p.I314L	TXNDC2_uc010wzq.1_Intron|TXNDC2_uc002koh.3_Missense_Mutation_p.I247L	NM_001098529	NP_001091999	Q86VQ3	TXND2_HUMAN	thioredoxin domain-containing 2 isoform 2	314	14.|22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation|cell redox homeostasis|glycerol ether metabolic process|multicellular organismal development|spermatogenesis	cytoplasm	electron carrier activity|nutrient reservoir activity|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity			ovary(1)|pancreas(1)	2						GGAGGGTGACATCCCCAAGTC	0.597													12	182	---	---	---	---	PASS
TCEB3C	162699	broad.mit.edu	37	18	44554961	44554961	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44554961C>T	uc010xdb.1	-	1	1489	c.1253G>A	c.(1252-1254)CGG>CAG	p.R418Q	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	418	Activation domain (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0						GTCCCGAAGCCGCAGGTACAG	0.557													13	122	---	---	---	---	PASS
FECH	2235	broad.mit.edu	37	18	55233773	55233773	+	Silent	SNP	A	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55233773A>G	uc002lgq.3	-	5	621	c.504T>C	c.(502-504)CCT>CCC	p.P168P	FECH_uc002lgp.3_Silent_p.P174P|FECH_uc002lgr.3_Silent_p.P26P	NM_000140	NP_000131	P22830	HEMH_HUMAN	ferrochelatase isoform b precursor	168					generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding			central_nervous_system(1)	1		Colorectal(73;0.227)				CTTCTGTTAAAGGATGGACGT	0.428													239	308	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74563827	74563827	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74563827G>A	uc002lmi.2	+	3	487	c.289G>A	c.(289-291)GTG>ATG	p.V97M	ZNF236_uc002lmj.2_RNA|ZNF236_uc002lmk.1_Missense_Mutation_p.V97M	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	97	C2H2-type 3.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TACCTGCCCTGTGTGTAACAA	0.418													21	331	---	---	---	---	PASS
ZNF559	84527	broad.mit.edu	37	19	9449198	9449198	+	5'UTR	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9449198T>C	uc002mlg.2	+	4					ZNF559_uc002mlf.2_5'UTR|ZNF559_uc010dwl.1_5'UTR|ZNF559_uc010xkn.1_Intron|ZNF559_uc010dwm.1_5'UTR|ZNF559_uc002mle.3_Silent_p.L55L|ZNF559_uc010dwk.1_5'UTR|ZNF559_uc002mld.2_Silent_p.L55L|ZNF559_uc010dwo.1_Silent_p.L19L|ZNF559_uc002mlh.1_RNA|ZNF177_uc002mli.2_5'UTR|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTTTCTGTCTTCATGAGTCAA	0.393													6	580	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20828137	20828137	+	Intron	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20828137T>C	uc002npb.1	-						ZNF626_uc002npc.1_Intron|ZNF626_uc002npd.1_3'UTR	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TTTTAGTTTCTCAAAATCATG	0.189													6	162	---	---	---	---	PASS
SLC7A9	11136	broad.mit.edu	37	19	33359494	33359494	+	Intron	SNP	G	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33359494G>T	uc002ntv.3	-						SLC7A9_uc002ntt.3_5'Flank|SLC7A9_uc002ntu.3_5'UTR|SLC7A9_uc002ntw.3_5'UTR	NM_001126335	NP_001119807	P82251	BAT1_HUMAN	solute carrier family 7, member 9						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding			skin(1)	1	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GCTAAATCTTGGTTCAGCAGC	0.572													17	71	---	---	---	---	PASS
RFPL4A	342931	broad.mit.edu	37	19	56274095	56274095	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56274095G>A	uc010yge.1	+	3	462	c.418G>A	c.(418-420)GTC>ATC	p.V140I		NM_001145014	NP_001138486	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	140	B30.2/SPRY.						zinc ion binding				0						TGCCCTGTGCGTCCTGGGCAC	0.562													18	54	---	---	---	---	PASS
CPXM1	56265	broad.mit.edu	37	20	2779142	2779142	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2779142T>C	uc002wgu.2	-	3	446	c.382A>G	c.(382-384)AGC>GGC	p.S128G	CPXM1_uc010gas.2_Missense_Mutation_p.S128G	NM_019609	NP_062555	Q96SM3	CPXM1_HUMAN	carboxypeptidase X, member 1 precursor	128	F5/8 type C.				cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4						TCAAGCCGGCTATCTGAAACT	0.602													12	10	---	---	---	---	PASS
ATRN	8455	broad.mit.edu	37	20	3605190	3605190	+	Silent	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3605190C>T	uc002wim.2	+	25	3924	c.3834C>T	c.(3832-3834)GAC>GAT	p.D1278D		NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1	1278	Extracellular (Potential).				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						ATTTTATGGACCTGGTACAGT	0.403													5	554	---	---	---	---	PASS
ESF1	51575	broad.mit.edu	37	20	13714441	13714441	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13714441T>C	uc002woj.2	-	10	1985	c.1877A>G	c.(1876-1878)AAG>AGG	p.K626R		NM_016649	NP_057733	Q9H501	ESF1_HUMAN	ABT1-associated protein	626	Lys-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1						CAGTTTATCCTTTCCTTCCAA	0.313													7	751	---	---	---	---	PASS
C20orf79	140856	broad.mit.edu	37	20	18794966	18794966	+	3'UTR	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18794966T>C	uc002wrk.2	+	1					uc002wrj.1_Intron	NM_178483	NP_848578	Q9UJQ7	CT079_HUMAN	hypothetical protein LOC140856								sterol binding			skin(3)	3						TTCTCTTCGATGATAATGTCG	0.343													24	58	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70340935	70340935	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70340935C>A	uc004dyy.2	+	5	867	c.668C>A	c.(667-669)CCC>CAC	p.P223H	MED12_uc011mpq.1_Missense_Mutation_p.P223H|MED12_uc004dyz.2_Missense_Mutation_p.P223H|MED12_uc004dza.2_Missense_Mutation_p.P70H	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	223					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GGGCCCTTGCCCCATGATGTA	0.552													6	98	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107939571	107939571	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107939571G>A	uc004enz.1	+	52	5241	c.5039G>A	c.(5038-5040)CGA>CAA	p.R1680Q	COL4A5_uc011mso.1_Missense_Mutation_p.R1677Q|COL4A5_uc011msp.1_Missense_Mutation_p.R356Q	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	1674	Collagen IV NC1.		Missing (in APSX).		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	p.R1674Q(1)		ovary(3)|central_nervous_system(1)	4						TTGAGGACACGAATTAGCCGA	0.338									Alport_syndrome_with_Diffuse_Leiomyomatosis				7	215	---	---	---	---	PASS
FAM122B	159090	broad.mit.edu	37	X	133919974	133919974	+	Silent	SNP	T	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133919974T>C	uc004exr.2	-	7	594	c.444A>G	c.(442-444)AGA>AGG	p.R148R	FAM122B_uc004exq.2_Silent_p.R167R|FAM122B_uc004exs.2_Silent_p.R149R|FAM122B_uc004ext.2_Silent_p.R96R|FAM122B_uc004exu.2_RNA|FAM122B_uc011mvp.1_Silent_p.R115R|FAM122B_uc004exv.2_Silent_p.R167R	NM_145284	NP_660327	Q7Z309	F122B_HUMAN	hypothetical protein LOC159090	148											0	Acute lymphoblastic leukemia(192;0.000127)					GACTCTGACTTCTCCTGCTTT	0.313													6	362	---	---	---	---	PASS
PNMA5	114824	broad.mit.edu	37	X	152159503	152159503	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152159503C>T	uc010ntw.2	-	3	979	c.640G>A	c.(640-642)GTG>ATG	p.V214M	PNMA5_uc004fha.3_Missense_Mutation_p.V214M|PNMA5_uc010ntx.2_Missense_Mutation_p.V214M|PNMA5_uc004fgy.3_Missense_Mutation_p.V214M	NM_001103151	NP_001096621	Q96PV4	PNMA5_HUMAN	paraneoplastic antigen like 5	214					apoptosis					ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GCCTGGAGCACCCGCATGATT	0.527													10	59	---	---	---	---	PASS
IL9R	3581	broad.mit.edu	37	X	155231025	155231025	+	Intron	SNP	C	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155231025C>G	uc004fnv.1	+						IL9R_uc010nvn.2_5'UTR|IL9R_uc004fnu.1_Intron	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCTGCCCTCACATATCCCAAG	0.587													7	180	---	---	---	---	PASS
ESPN	83715	broad.mit.edu	37	1	6512263	6512263	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6512263delT	uc001amy.2	+						ESPN_uc001amz.2_Intron	NM_031475	NP_113663	B1AK53	ESPN_HUMAN	espin						sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		Attttctttcttttttttttt	0.328													4	2	---	---	---	---	
PER3	8863	broad.mit.edu	37	1	7846510	7846510	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7846510delA	uc001aoo.2	+						PER3_uc009vmg.1_Intron|PER3_uc009vmh.1_Intron|PER3_uc001aop.2_Intron|PER3_uc010nzw.1_Intron|PER3_uc001aon.2_Intron	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CTCCCCCCGCAAAAAAATTGT	0.358													4	2	---	---	---	---	
TMEM82	388595	broad.mit.edu	37	1	16073788	16073788	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16073788delA	uc001axc.2	+							NM_001013641	NP_001013663	A0PJX8	TMM82_HUMAN	transmembrane protein 82							integral to membrane				breast(1)|central_nervous_system(1)	2		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ctccatctccaaaaaaaaaaa	0.279													4	2	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17200409	17200412	+	Intron	DEL	CTTC	-	-	rs144786506		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17200409_17200412delCTTC	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GTTTACATGGCTTCCTTGTCTCTT	0.377													4	4	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39689857	39689857	+	Intron	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39689857delC	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc010oit.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			tccccctactcccccccatac	0.060													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39833676	39833676	+	Intron	DEL	T	-	-	rs111840698		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39833676delT	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTTTGTTTGTTTTTTTTAAA	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68499208	68499209	+	Intron	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68499208_68499209insT	uc001deb.1	+						uc001dec.1_Intron					Homo sapiens cDNA FLJ38762 fis, clone KIDNE2013801.																		cctctgcagcatttttttcctc	0.000													4	2	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	85992847	85992848	+	Intron	DEL	CT	-	-	rs142998762		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85992847_85992848delCT	uc001dlc.2	-							NM_001134445	NP_001127917	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	CTGCTGGAAACTCTGCCTCACT	0.421													7	6	---	---	---	---	
LMO4	8543	broad.mit.edu	37	1	87806074	87806074	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87806074delA	uc001dmi.2	+						LMO4_uc001dmj.2_Intron	NM_006769	NP_006760	P61968	LMO4_HUMAN	LIM domain only 4						neural tube closure|transcription from RNA polymerase II promoter	transcription factor complex	sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding				0		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		CTTTCTAGTTAAAAAAAAAAT	0.303													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	90415161	90415161	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90415161delA								LRRC8D (13174 upstream) : GEMIN8P4 (43665 downstream)																							CCTGTACCTTAAAAAAAAAAG	0.214													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	98639662	98639662	+	IGR	DEL	C	-	-	rs78841292		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98639662delC								MIR137 (127935 upstream) : SNX7 (487574 downstream)																							atcagatatacttatatatct	0.000													2	4	---	---	---	---	
PALMD	54873	broad.mit.edu	37	1	100122778	100122779	+	Intron	DEL	AG	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100122778_100122779delAG	uc001dsg.2	+						PALMD_uc001dsf.2_Intron	NM_017734	NP_060204	Q9NP74	PALMD_HUMAN	palmdelphin						regulation of cell shape	cytoplasm|membrane				ovary(2)|pancreas(1)	3		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		CCAACTGCCTAGCAGATAATTC	0.411													4	2	---	---	---	---	
NGF	4803	broad.mit.edu	37	1	115873067	115873067	+	Intron	DEL	A	-	-	rs140603728	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115873067delA	uc001efu.1	-							NM_002506	NP_002497	P01138	NGF_HUMAN	nerve growth factor, beta polypeptide precursor						activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	AATAAATGGTAAAAGAAAAGA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142607969	142607970	+	IGR	INS	-	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142607969_142607970insA								None (None upstream) : None (None downstream)																							agggacacaacaaaaaaagaaa	0.000													2	4	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144861469	144861472	+	Intron	DEL	TCTT	-	-	rs67499823		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144861469_144861472delTCTT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTCCTCTCTCTCTTTCTCAACCCA	0.333			T	PDGFRB	MPD								5	3	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148001285	148001286	+	Intron	INS	-	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148001285_148001286insA	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						CATCATTTTTGAAAAGAGTATT	0.277													4	2	---	---	---	---	
F5	2153	broad.mit.edu	37	1	169515419	169515420	+	Intron	DEL	AC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169515419_169515420delAC	uc001ggg.1	-							NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	ATGTCTGTGTacacacacacac	0.361													3	3	---	---	---	---	
DNM3	26052	broad.mit.edu	37	1	171910489	171910489	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171910489delT	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						AGTATAACCCTTTTAATGCTT	0.368													4	2	---	---	---	---	
C1orf27	54953	broad.mit.edu	37	1	186355518	186355518	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186355518delA	uc001grw.2	+						C1orf27_uc010poq.1_Intron|C1orf27_uc010por.1_Intron	NM_017847	NP_060317	Q5SWX8	ODR4_HUMAN	odorant response abnormal 4 isoform 1							integral to membrane	oxidoreductase activity|zinc ion binding			ovary(1)	1						tacaaatttgaaaaagctatt	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189317765	189317765	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189317765delA								None (None upstream) : FAM5C (749032 downstream)																							CACTAAAAGGAAAAAAAAATT	0.353													4	2	---	---	---	---	
LHX9	56956	broad.mit.edu	37	1	197897809	197897809	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197897809delT	uc001guk.1	+						LHX9_uc001gui.1_Intron|LHX9_uc001guj.1_Intron	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1						motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						TATTTCCCCCTTTTTATCACC	0.403													4	2	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202173358	202173359	+	Intron	DEL	CA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202173358_202173359delCA	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						cacacacctccacacacacaca	0.218													6	3	---	---	---	---	
MAPKAPK2	9261	broad.mit.edu	37	1	206906624	206906625	+	3'UTR	DEL	TA	-	-	rs143757666	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206906624_206906625delTA	uc001hem.1	+	10					MAPKAPK2_uc001hel.1_3'UTR	NM_032960	NP_116584	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated						activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GGAgtgagtgtatgtgtgtgtg	0.450													4	2	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234394328	234394328	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234394328delA	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			catcctgaacaaggagcgaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	234918511	234918512	+	IGR	INS	-	GT	GT	rs146753231		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234918511_234918512insGT								IRF2BP2 (173240 upstream) : TOMM20 (354148 downstream)																							TGGTTTTTGTAGTGTGTGTGTG	0.401													4	2	---	---	---	---	
MTR	4548	broad.mit.edu	37	1	236969731	236969731	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236969731delT	uc001hyi.3	+						MTR_uc010pxv.1_Intron|MTR_uc010pxw.1_Intron|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Intron	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	AACTGGCTTCTTTTATGGGCA	0.383													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5612969	5612972	+	IGR	DEL	CAAA	-	-	rs78511787		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5612969_5612972delCAAA								None (None upstream) : SOX11 (219827 downstream)																							ACCTGAGGCCCAAACAGAGTCAGA	0.495													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5624515	5624515	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5624515delG								None (None upstream) : SOX11 (208284 downstream)																							AAGAATTGAAGAAAAAACAGG	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23371840	23371840	+	IGR	DEL	A	-	-	rs1449969	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23371840delA								None (None upstream) : KLHL29 (383615 downstream)																							TCAACTGTTTAAAAAAAAAAA	0.358													4	2	---	---	---	---	
KLHL29	114818	broad.mit.edu	37	2	23907533	23907535	+	Intron	DEL	CTC	-	-	rs66787697		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23907533_23907535delCTC	uc002reg.2	+						KLHL29_uc010ykg.1_Intron			Q96CT2	KLH29_HUMAN	RecName: Full=Kelch-like protein 29; AltName: Full=Kelch repeat and BTB domain-containing protein 9;											ovary(1)|lung(1)	2						GTAGCCATCTctcctcctcctcc	0.512													9	5	---	---	---	---	
RBKS	64080	broad.mit.edu	37	2	28062041	28062041	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28062041delG	uc002rlo.1	-						RBKS_uc010ezi.1_Intron|RBKS_uc010ymg.1_Intron	NM_022128	NP_071411	Q9H477	RBSK_HUMAN	ribokinase						D-ribose metabolic process		ATP binding|ribokinase activity			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					GCTATGTGCTGGACAATGTCA	0.413													4	2	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28193640	28193640	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28193640delA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					ggtcacacttaaaaaatgttt	0.000													4	2	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29165470	29165470	+	Intron	DEL	T	-	-	rs67816126		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29165470delT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					TTATGGAAGATtttttttttc	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	57987642	57987642	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57987642delT								None (None upstream) : VRK2 (147144 downstream)																							TTTTGCACACTTTTTTTTTTC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	66976898	66976898	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66976898delA								MEIS1 (177008 upstream) : ETAA1 (647544 downstream)																							AGGATAATATAAACATGGATT	0.358													4	2	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71845281	71845281	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845281delG	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						tggtagaggtggtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	75148694	75148695	+	IGR	DEL	TT	-	-	rs11471161		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75148694_75148695delTT								HK2 (28220 upstream) : POLE4 (37080 downstream)																							TCCCAGACTCTTTCCTTTTCCT	0.515													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	77920469	77920469	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77920469delA								LRRTM4 (170967 upstream) : SNAR-H (261564 downstream)																							cctttgggttatctttgctta	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89159868	89159868	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89159868delT	uc010ytr.1	-						uc002sti.1_RNA|uc002stj.1_Intron					Parts of antibodies, mostly variable regions.																		TTAGTTACACTTTTTTTTTTT	0.299													3	3	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91812966	91812977	+	Intron	DEL	CAGGGATTAATA	-	-	rs139939247		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91812966_91812977delCAGGGATTAATA	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						gttaaggtctcagggattaatacagggaatac	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106186599	106186600	+	IGR	DEL	CT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106186599_106186600delCT								FHL2 (131369 upstream) : NCK2 (174754 downstream)																							ccgagatcccctctctcagaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114078433	114078433	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114078433delT								PAX8 (41935 upstream) : CBWD2 (116835 downstream)																							gagcacctacttagtatgagg	0.199													4	2	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125665985	125665985	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125665985delA	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		aaaACAAAACAAAAAAACAGA	0.085													4	2	---	---	---	---	
YSK4	80122	broad.mit.edu	37	2	135779044	135779045	+	Intron	DEL	AC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135779044_135779045delAC	uc002tue.1	-						YSK4_uc010fne.1_Intron|YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Intron|YSK4_uc010zbg.1_Intron|YSK4_uc002tui.3_Intron	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1								ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		acacacacatacacacacacac	0.114													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139848053	139848053	+	IGR	DEL	A	-	-	rs141461018		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139848053delA								NXPH2 (310242 upstream) : None (None downstream)																							GTTTTGCTGGAAAAAAAAAAG	0.289													4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141625542	141625542	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625542delA	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGGGGCAAGCAAAAAAAAAAT	0.274										TSP Lung(27;0.18)			12	6	---	---	---	---	
GTDC1	79712	broad.mit.edu	37	2	144994191	144994191	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144994191delA	uc002tvp.2	-						GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron|GTDC1_uc002tvt.1_Intron	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		TAACTCATCCAAAAAGGACCA	0.338													4	2	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153250626	153250626	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153250626delT	uc002tye.2	+							NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						TTTAGATAAATTTTTTAGGCC	0.204													4	2	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	160044757	160044757	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160044757delT	uc002uag.2	+						TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						ATTAAGGAACTTTTTTTAGAG	0.318													4	2	---	---	---	---	
TANK	10010	broad.mit.edu	37	2	162023070	162023070	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162023070delT	uc002ubr.1	+						TANK_uc002ubq.1_Intron|TANK_uc002ubs.2_Intron	NM_004180	NP_004171	Q92844	TANK_HUMAN	TRAF interacting protein TANK isoform a							cytosol	metal ion binding|protein binding			ovary(1)	1						TGTTGACTGATTTTTTTGCTT	0.313													4	2	---	---	---	---	
SLC4A10	57282	broad.mit.edu	37	2	162721676	162721676	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162721676delT	uc002ubx.3	+						SLC4A10_uc010fpa.1_Intron|SLC4A10_uc010zcr.1_Intron|SLC4A10_uc002uby.3_Intron|SLC4A10_uc010zcs.1_Intron	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						TTTCATTGCATTTTTTTTTCA	0.284													3	3	---	---	---	---	
DPP4	1803	broad.mit.edu	37	2	162868099	162868099	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162868099delT	uc002ubz.2	-						DPP4_uc010fpb.2_Intron	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	TAGGAAATGCTTTTTTTTTGA	0.308													3	3	---	---	---	---	
SCN1A	6323	broad.mit.edu	37	2	166895709	166895712	+	Intron	DEL	TGAG	-	-	rs6147014		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166895709_166895712delTGAG	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AAATAGCAACTGAGTAATACGTTA	0.260													3	3	---	---	---	---	
MAP1D	254042	broad.mit.edu	37	2	172935959	172935959	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172935959delA	uc002uhk.2	+						MAP1D_uc010zdw.1_Intron	NM_199227	NP_954697	Q6UB28	AMP1D_HUMAN	methionine aminopeptidase 1D precursor						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CCCTGAGTTGAAAAAAAAAAA	0.328													8	5	---	---	---	---	
TTC30B	150737	broad.mit.edu	37	2	178415367	178415367	+	3'UTR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178415367delT	uc002uln.2	-	1					TTC30B_uc010zfc.1_3'UTR	NM_152517	NP_689730	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B						cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			TTTTAGCTACTTTTTTTTTTA	0.294													7	4	---	---	---	---	
ORC2L	4999	broad.mit.edu	37	2	201807843	201807844	+	Intron	DEL	GT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201807843_201807844delGT	uc002uwr.2	-						ORC2L_uc010zhj.1_Intron	NM_006190	NP_006181	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0						TTGATGGGGGGTGAGAAAGAAG	0.361													4	2	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	205990084	205990085	+	Intron	INS	-	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205990084_205990085insC	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CAGTCCAGTTTCCCCCACATAA	0.396													4	2	---	---	---	---	
NRP2	8828	broad.mit.edu	37	2	206641240	206641243	+	Intron	DEL	CGCA	-	-	rs139470132	byFrequency	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206641240_206641243delCGCA	uc002vaw.2	+						NRP2_uc002vau.2_Frame_Shift_Del_p.S904fs|NRP2_uc002vav.2_Frame_Shift_Del_p.S899fs|NRP2_uc002vax.2_Intron|NRP2_uc002vay.2_Intron	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor						angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						GACCGTGGCTCGCACTGCTGAGGG	0.529											OREG0015157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	9	---	---	---	---	
NRP2	8828	broad.mit.edu	37	2	206641245	206641246	+	Intron	INS	-	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206641245_206641246insA	uc002vaw.2	+						NRP2_uc002vau.2_Frame_Shift_Ins_p.C906fs|NRP2_uc002vav.2_Frame_Shift_Ins_p.C901fs|NRP2_uc002vax.2_Intron|NRP2_uc002vay.2_Intron	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor						angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						TGGCTCGCACTGCTGAGGGCCG	0.530											OREG0015157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	11	---	---	---	---	
SPAG16	79582	broad.mit.edu	37	2	214973207	214973208	+	Intron	INS	-	A	A	rs139529621	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214973207_214973208insA	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		acacacacccccacacacacCC	0.252													4	5	---	---	---	---	
RQCD1	9125	broad.mit.edu	37	2	219447957	219447966	+	Intron	DEL	TCTCTCTCTC	-	-	rs2918013		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219447957_219447966delTCTCTCTCTC	uc010zkh.1	+						RQCD1_uc002vih.1_Intron|RQCD1_uc010zki.1_Intron	NM_005444	NP_005435	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		tgtgtgtgtgtctctctctctctctctctc	0.214													6	5	---	---	---	---	
SP100	6672	broad.mit.edu	37	2	231297729	231297730	+	Intron	INS	-	G	G	rs139204553	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231297729_231297730insG	uc002vqt.2	+						SP100_uc002vqs.2_Intron|SP100_uc002vqu.1_Intron|SP100_uc010zmb.1_Intron|SP100_uc002vqq.1_Intron|SP100_uc002vqr.1_Intron|SP100_uc010zmc.1_Intron|SP100_uc002vqv.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		aaaatgaaaatggggggatcct	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236046749	236046750	+	IGR	INS	-	AAA	AAA	rs144156334	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236046749_236046750insAAA								SH3BP4 (82393 upstream) : AGAP1 (355986 downstream)																							AATCGTACATGAAAATCAGCCT	0.426													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	6376795	6376796	+	IGR	DEL	GT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6376795_6376796delGT								None (None upstream) : GRM7 (526006 downstream)																							GCTGGTATAAGTGTGTGTGTGT	0.431													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188294	10188295	+	Frame_Shift_Ins	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188294_10188295insT	uc003bvc.2	+	2	650_651	c.437_438insT	c.(436-438)CCTfs	p.P146fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	146	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.P146fs*13(3)|p.P146P(2)|p.Q145fs*12(1)|p.P146A(1)|p.P146fs*12(1)|p.P146fs*23(1)|p.G144fs*19(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GACGGACAGCCTATTTTTGCCA	0.411		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				158	79	---	---	---	---	
SLC6A11	6538	broad.mit.edu	37	3	10884837	10884837	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10884837delA	uc003bvz.2	+							NM_014229	NP_055044	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.229)		GTTTGACTTTAAAGGAACACA	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	20456273	20456273	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20456273delT								SGOL1 (228590 upstream) : VENTXP7 (990945 downstream)																							TTCCAGGCCCTTTTAGTCACA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	46893410	46893410	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46893410delA								PRSS42 (17825 upstream) : MYL3 (5947 downstream)																							AATAACCCCCAAAAGTGGGTG	0.552													4	2	---	---	---	---	
ACY1	95	broad.mit.edu	37	3	52009600	52009601	+	Intron	DEL	TG	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52009600_52009601delTG	uc011bea.1	+						ABHD14B_uc010hly.2_5'Flank|ABHD14B_uc003dcm.2_5'Flank|ABHD14B_uc011bdy.1_5'Flank|ABHD14B_uc003dcn.2_Intron|ABHD14B_uc011bdz.1_5'Flank|ABHD14A_uc010hlz.2_Intron|ABHD14A_uc003dco.2_Intron	NM_000666	NP_000657	Q03154	ACY1_HUMAN	aminoacylase 1						cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	L-Aspartic Acid(DB00128)	tctgggggtttgtgtgtgtgtg	0.173													4	2	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52649440	52649440	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52649440delT	uc003des.2	-	15	1863	c.1851delA	c.(1849-1851)TTAfs	p.L617fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.L617fs|PBRM1_uc003der.2_Frame_Shift_Del_p.L585fs|PBRM1_uc003det.2_Frame_Shift_Del_p.L632fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.L632fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.L617fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.L617fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.L617fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.L617fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.L530fs|PBRM1_uc003dfc.2_5'UTR	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	617					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.L617*(2)|p.L617fs*(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCTCCTTGAGTAACTTCTCCA	0.368			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								107	101	---	---	---	---	
SUCLG2	8801	broad.mit.edu	37	3	67659682	67659699	+	Intron	DEL	CACCATGTGATTCCTGCA	-	-	rs71830786		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67659682_67659699delCACCATGTGATTCCTGCA	uc003dna.3	-							NM_003848	NP_003839	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming beta subunit						succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity			central_nervous_system(1)|skin(1)	2		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	ACGCTGCAGTCACCATGTGATTCCTGCACACTTACACA	0.486													5	4	---	---	---	---	
ZPLD1	131368	broad.mit.edu	37	3	101840494	101840494	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101840494delT	uc003dvs.1	+							NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						gcttggtatctttttttgtga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	104407667	104407668	+	IGR	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104407667_104407668insT								None (None upstream) : ALCAM (678045 downstream)																							gcttttatgacttttttcattg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107230830	107230831	+	IGR	DEL	CT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107230830_107230831delCT								CCDC54 (133349 upstream) : BBX (10952 downstream)																							ttacagctgcctctgctactag	0.054													4	2	---	---	---	---	
MORC1	27136	broad.mit.edu	37	3	108762438	108762438	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108762438delA	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						catcataatgaaaaaaaAAGA	0.164													4	2	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124201359	124201360	+	Intron	DEL	CT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124201359_124201360delCT	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron|KALRN_uc003ehh.1_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TACCTTATTGCTCTCTTTTCTA	0.401													4	2	---	---	---	---	
SNX4	8723	broad.mit.edu	37	3	125188586	125188587	+	Intron	INS	-	T	T	rs140653507	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125188586_125188587insT	uc003eib.2	-						SNX4_uc011bkf.1_Intron	NM_003794	NP_003785	O95219	SNX4_HUMAN	sorting nexin 4						cell communication|endocytic recycling|endocytosis|protein transport	cytoplasmic dynein complex|early endosome membrane	phosphatidylinositol binding|protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4						TAAGCGGAAGGTAAGTATCATA	0.243													2	5	---	---	---	---	
MCM2	4171	broad.mit.edu	37	3	127338244	127338244	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127338244delA	uc003ejp.2	+						MCM2_uc011bkm.1_Intron|MCM2_uc010hsl.2_Intron|MCM2_uc011bkn.1_Intron	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4						GGGAGGCATTAAAAAAAAAAT	0.303													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	129717844	129717844	+	IGR	DEL	G	-	-	rs139899778		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129717844delG								TRH (21068 upstream) : ALG1L2 (82830 downstream)																							AAAAAAAAAAGGAAGcagtct	0.184													6	3	---	---	---	---	
ZIC4	84107	broad.mit.edu	37	3	147118649	147118649	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147118649delT	uc003ewd.1	-						ZIC4_uc011bno.1_Intron	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4							nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						GCTCTTCAGATTTTTTTTCCA	0.443													4	3	---	---	---	---	
CP	1356	broad.mit.edu	37	3	148910280	148910281	+	Intron	INS	-	A	A	rs144013296	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148910280_148910281insA	uc003ewy.3	-						CP_uc011bnr.1_Intron|CP_uc003ewx.3_Intron|CP_uc003ewz.2_Intron|CP_uc010hvf.1_Intron	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor						cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	atacaaaaggcaaaaaaaaaag	0.035													4	3	---	---	---	---	
MED12L	116931	broad.mit.edu	37	3	151011751	151011762	+	Intron	DEL	GCCATTAACCCT	-	-	rs67834444		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151011751_151011762delGCCATTAACCCT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAGACTTCCAGCCATTAACCCTGCCATTCACC	0.443													5	4	---	---	---	---	
MED12L	116931	broad.mit.edu	37	3	151085773	151085773	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151085773delA	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGTCTGTTTTAAGGAAGCACC	0.299													4	2	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	158944611	158944611	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158944611delT	uc003fcq.1	+						IQCJ_uc003fco.2_Intron|IQCJ_uc010hvy.1_Intron|IQCJ_uc003fcp.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			caaagttctattttttgattg	0.050													4	2	---	---	---	---	
USP13	8975	broad.mit.edu	37	3	179479203	179479203	+	Intron	DEL	T	-	-	rs74695249		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179479203delT	uc003fkh.2	+							NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TTTCTTCTTCTTTTTTTTTTT	0.249													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191307641	191307642	+	IGR	INS	-	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191307641_191307642insA								PYDC2 (128398 upstream) : FGF12 (552042 downstream)																							tttgagctgacaaaaatgaaga	0.000													4	2	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194865765	194865766	+	Intron	DEL	TA	-	-	rs144929834		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194865765_194865766delTA	uc003fum.3	-						C3orf21_uc003ful.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		GAGCTGCAATTATACATCATCA	0.411													5	5	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	50564	50564	+	5'Flank	DEL	C	-	-	rs112480187		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:50564delC	uc003fzv.1	+						ZNF595_uc003fzu.1_5'Flank|ZNF718_uc003fzt.3_5'Flank|ZNF595_uc010iay.1_5'Flank|ZNF595_uc011bus.1_5'Flank|ZNF595_uc011but.1_5'Flank	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TGacttagagccacttagagc	0.159													2	4	---	---	---	---	
ZNF718	255403	broad.mit.edu	37	4	109420	109420	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109420delG	uc003fzt.3	+						ZNF595_uc003fzu.1_Intron	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		AGAACTTCCTGGGGTTAAGGC	0.368													4	2	---	---	---	---	
HTT	3064	broad.mit.edu	37	4	3116717	3116717	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3116717delT	uc011bvq.1	+							NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin						establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CATTTGTTGATTTTTTTTTAA	0.458													4	2	---	---	---	---	
TMEM128	85013	broad.mit.edu	37	4	4241134	4241134	+	Intron	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4241134delC	uc003ghr.1	-						TMEM128_uc003ghq.1_Intron|TMEM128_uc003ghs.2_3'UTR|TMEM128_uc011bvv.1_Intron|TMEM128_uc011bvw.1_Intron	NM_032927	NP_116316	Q5BJH2	TM128_HUMAN	transmembrane protein 128							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		atggaagaatcccaaactata	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	6723858	6723859	+	IGR	DEL	GT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6723858_6723859delGT								CNO (4471 upstream) : KIAA0232 (60600 downstream)																							GATGGAAGGGgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21554773	21554773	+	Intron	DEL	T	-	-	rs35807339		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21554773delT	uc003gqh.1	-						KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				AAGGGGGGGGTCATAAAAGAG	0.398													3	3	---	---	---	---	
ATP8A1	10396	broad.mit.edu	37	4	42609858	42609859	+	Intron	DEL	AA	-	-	rs142557858		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42609858_42609859delAA	uc003gwr.2	-						ATP8A1_uc003gws.2_Intron|ATP8A1_uc011byz.1_Intron	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),						ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	GGAAAGCGTTAAGAGCCTAGAG	0.431													2	4	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48515517	48515517	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48515517delA	uc003gyh.1	-						FRYL_uc003gyf.1_Intron|FRYL_uc003gyg.1_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						ACTCTCAGCCAAAAAAAGGAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49152417	49152417	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49152417delT								CWH43 (88324 upstream) : None (None downstream)																							attcctttcctctcgggttga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49237605	49237606	+	5'Flank	DEL	AT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49237605_49237606delAT	uc003gyy.2	-											DQ587539																		CTGAACTGACATGTGTATATAC	0.371													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	55707641	55707642	+	IGR	DEL	TC	-	-	rs111355909		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55707641_55707642delTC								KIT (100762 upstream) : KDR (236785 downstream)																							GCTGTAGGTGTCTGCATGATTT	0.406													2	4	---	---	---	---	
GC	2638	broad.mit.edu	37	4	72637053	72637053	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72637053delT	uc003hge.2	-						GC_uc003hgd.2_5'Flank|GC_uc010iie.2_Intron|GC_uc010iif.2_Intron	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor						hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	AAGGGTTGTATTTTTTTTTTT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	76290563	76290565	+	IGR	DEL	ACA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76290563_76290565delACA								PARM1 (315240 upstream) : RCHY1 (113790 downstream)																							TACCTGACTGACAACAACAACAA	0.414													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	82932235	82932235	+	IGR	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82932235delC								RASGEF1B (539174 upstream) : HNRNPD (342232 downstream)																							GGACTGCCTTCTAGATATACT	0.343													4	2	---	---	---	---	
COQ2	27235	broad.mit.edu	37	4	84200474	84200474	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84200474delA	uc003hog.2	-						COQ2_uc011ccp.1_Intron|COQ2_uc003hof.2_5'Flank|COQ2_uc003hoh.1_Intron	NM_015697	NP_056512	Q96H96	COQ2_HUMAN	para-hydroxybenzoate-polyprenyltransferase,						glycerol metabolic process|isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrial membrane	4-hydroxybenzoate decaprenyltransferase activity|4-hydroxybenzoate nonaprenyltransferase activity			ovary(1)|central_nervous_system(1)	2		Hepatocellular(203;0.114)				cagtccaattaaaaaagacaa	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	88179070	88179070	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88179070delT								KLHL8 (37396 upstream) : HSD17B13 (45871 downstream)																							ttttgtttAATTTTTTTTTTC	0.348													4	2	---	---	---	---	
PPP3CA	5530	broad.mit.edu	37	4	101950511	101950530	+	Intron	DEL	AAAAAAAAAAAAAAAAAAAG	-	-	rs34620032		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101950511_101950530delAAAAAAAAAAAAAAAAAAAG	uc011cen.1	-						PPP3CA_uc003hvu.2_Intron|PPP3CA_uc010ilj.2_Intron|PPP3CA_uc003hvt.2_Intron|PPP3CA_uc003hvs.2_Intron|PPP3CA_uc010ilk.2_Intron	NM_000944	NP_000935	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha						protein dephosphorylation	calcineurin complex|cytosol|nucleus	calcium ion binding|calmodulin binding			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		TGCTaaaaaaaaaaaaaaaaaaaaaaaaagaaaaaaaaTG	0.291													8	4	---	---	---	---	
NHEDC1	150159	broad.mit.edu	37	4	103870262	103870263	+	Intron	INS	-	AT	AT			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103870262_103870263insAT	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN	Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)		GAGCTGTACACACACACACACA	0.238													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	117192839	117192839	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117192839delT								None (None upstream) : MIR1973 (28042 downstream)																							ttttgttttgtttttttgcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	142530231	142530233	+	IGR	DEL	AGA	-	-	rs79012366		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142530231_142530233delAGA								ZNF330 (374383 upstream) : IL15 (27521 downstream)																							agagagagagagaAAAAAAAATC	0.251													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	162012654	162012654	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162012654delT								None (None upstream) : FSTL5 (292397 downstream)																							CTTTCTCAGATTTGGGCACTG	0.403													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165767199	165767200	+	IGR	INS	-	A	A	rs140501484	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165767199_165767200insA								MARCH1 (461997 upstream) : TRIM61 (108400 downstream)																							CATCTCCTAAGATCGAGACATT	0.292													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190511909	190511912	+	IGR	DEL	AGAC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190511909_190511912delAGAC								None (None upstream) : FRG1 (350062 downstream)																							AAGACGAAAAAGACAGACTCAGAT	0.387													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190594035	190594036	+	IGR	INS	-	T	T	rs141542782		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190594035_190594036insT								None (None upstream) : FRG1 (267938 downstream)																							cagcaattacattttttgtcgt	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190643092	190643093	+	IGR	DEL	TG	-	-	rs10534841		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190643092_190643093delTG								None (None upstream) : FRG1 (218881 downstream)																							TCACCAAAACTGTGCTCTCAGT	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	191044164	191044165	+	IGR	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:191044164_191044165insT								LOC653545 (33988 upstream) : None (None downstream)																							tagggttagggtagggttaggg	0.000													4	2	---	---	---	---	
NSUN2	54888	broad.mit.edu	37	5	6610179	6610179	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6610179delT	uc003jdu.2	-						NSUN2_uc003jdt.2_Intron|NSUN2_uc011cmk.1_Intron|NSUN2_uc003jdv.2_Intron	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2							cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TAAACTTAAAttttttttttt	0.164													4	2	---	---	---	---	
SPEF2	79925	broad.mit.edu	37	5	35644819	35644820	+	Intron	DEL	CT	-	-	rs140309566		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35644819_35644820delCT	uc003jjo.2	+						SPEF2_uc003jjn.1_Intron|SPEF2_uc003jjq.3_Intron	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTCTTGCTGACTCTCACCTCTA	0.485													5	4	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64595644	64595644	+	Intron	DEL	A	-	-	rs3832321		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64595644delA	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CTATATGAAGAAAAAAAAATT	0.308													5	4	---	---	---	---	
C5orf44	80006	broad.mit.edu	37	5	64956976	64956977	+	Intron	INS	-	T	T	rs150012123	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64956976_64956977insT	uc003jtz.3	+						C5orf44_uc003jua.3_Intron|C5orf44_uc003juc.3_Intron|C5orf44_uc010iwv.2_Intron	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2											ovary(1)	1						TAAAATAACTGTTATTAAGTGT	0.342													3	3	---	---	---	---	
MARVELD2	153562	broad.mit.edu	37	5	68737186	68737186	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68737186delA	uc003jwq.2	+						MARVELD2_uc010ixf.2_Intron|MARVELD2_uc003jwr.1_Intron|MARVELD2_uc003jws.1_Intron	NM_001038603	NP_001033692	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2 isoform 1						sensory perception of sound	integral to membrane|tight junction					0		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		aaactgctctaaaaaaaaaag	0.199													4	3	---	---	---	---	
TNPO1	3842	broad.mit.edu	37	5	72161232	72161233	+	Intron	INS	-	CACT	CACT	rs145457980	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72161232_72161233insCACT	uc003kck.3	+						TNPO1_uc011csi.1_Intron|TNPO1_uc011csj.1_Intron|TNPO1_uc003kch.2_Intron|TNPO1_uc003kci.3_Intron|TNPO1_uc003kcg.3_Intron	NM_002270	NP_002261	Q92973	TNPO1_HUMAN	transportin 1 isoform 1						interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		tggtgccactgccagcctgggc	0.084													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77157928	77157929	+	IGR	DEL	GA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77157928_77157929delGA								TBCA (85743 upstream) : AP3B1 (140222 downstream)																							CCTCCTCCTGGAGAGAGAGCGA	0.525													4	2	---	---	---	---	
MSH3	4437	broad.mit.edu	37	5	80171531	80171531	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80171531delT	uc003kgz.2	+							NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CTCCCAGCAATTTCATTTATT	0.388								MMR					89	42	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92724407	92724407	+	IGR	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92724407delC								None (None upstream) : FLJ42709 (20658 downstream)																							atcatctgagcccaggaggat	0.000													4	2	---	---	---	---	
LNPEP	4012	broad.mit.edu	37	5	96339487	96339488	+	Intron	DEL	TG	-	-	rs27997	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96339487_96339488delTG	uc003kmv.1	+						LNPEP_uc003kmw.1_Intron	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1						cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		GGTAGCCAGTTGTTTTTTTTTT	0.307													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105296077	105296077	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105296077delA								RAB9BP1 (860279 upstream) : None (None downstream)																							TGCAGAAAGGAAAAAAAAGAG	0.358													4	2	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115824838	115824840	+	Intron	DEL	GCT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115824838_115824840delGCT	uc010jck.2	-						SEMA6A_uc003krx.3_Intron	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TCCAAGAGTCGCTGGGAAAACTC	0.399													4	7	---	---	---	---	
HSD17B4	3295	broad.mit.edu	37	5	118867259	118867260	+	Intron	DEL	GG	-	-	rs112037211		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118867259_118867260delGG	uc003ksj.2	+						HSD17B4_uc011cwg.1_Intron|HSD17B4_uc011cwh.1_Intron|HSD17B4_uc011cwi.1_Intron|HSD17B4_uc003ksk.3_Intron|HSD17B4_uc011cwj.1_Intron|HSD17B4_uc010jcn.1_Intron|HSD17B4_uc010jco.1_Intron	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)	AATGTCCAAAGGGGGgtgtgtg	0.257													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	121070023	121070023	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121070023delA								None (None upstream) : FTMT (117627 downstream)																							CCATAAATATAAACAAGGTAA	0.368													4	2	---	---	---	---	
GRAMD3	65983	broad.mit.edu	37	5	125759524	125759525	+	Intron	INS	-	CT	CT	rs138390386	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125759524_125759525insCT	uc003ktu.2	+						GRAMD3_uc011cwt.1_Intron|GRAMD3_uc011cwv.1_Intron|GRAMD3_uc011cww.1_Intron|GRAMD3_uc011cwx.1_Intron|GRAMD3_uc011cwu.1_Intron	NM_023927	NP_076416	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3 isoform 2											central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		tctgtctctcactctctctctc	0.361													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	128008005	128008005	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128008005delA								FBN2 (134089 upstream) : SLC27A6 (293205 downstream)																							TTAGCAAAAGAAAAAAAAAAG	0.294													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	136222062	136222062	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136222062delA								TRPC7 (528989 upstream) : SPOCK1 (88926 downstream)																							CAACAACAACAAAAAaaaaca	0.179													4	3	---	---	---	---	
CDC23	8697	broad.mit.edu	37	5	137524389	137524389	+	3'UTR	DEL	A	-	-	rs79925684		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137524389delA	uc003lcl.2	-	16						NM_004661	NP_004652	Q9UJX2	CDC23_HUMAN	cell division cycle protein 23						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G1 phase of mitotic cell cycle|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase plate congression|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of exit from mitosis	anaphase-promoting complex|cytosol|nucleoplasm	binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTTGGGGGCCAAAAAAAAAAA	0.423													3	3	---	---	---	---	
ANXA6	309	broad.mit.edu	37	5	150509258	150509259	+	Intron	INS	-	TTTGTTTG	TTTGTTTG	rs144537590	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150509258_150509259insTTTGTTTG	uc003ltl.1	-						ANXA6_uc011dcp.1_Intron|ANXA6_uc003ltm.1_Intron|ANXA6_uc003ltn.1_Intron|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1							melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTCTTACTGTtttgtttgttt	0.163													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163876058	163876058	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163876058delT	uc003lzn.2	+											Homo sapiens, clone IMAGE:4479080, mRNA, partial cds.																		CTTTGGTCAGTTTTTTTTTGG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166062866	166062867	+	IGR	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166062866_166062867insT								None (None upstream) : ODZ2 (648976 downstream)																							ttttgtttttgttttttttttA	0.262													4	4	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168525317	168525318	+	Intron	DEL	TA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168525317_168525318delTA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACGTGTGTGTATACACACAGT	0.421													4	2	---	---	---	---	
BNIP1	662	broad.mit.edu	37	5	172586043	172586043	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172586043delT	uc003mcj.3	+						BNIP1_uc003mci.3_Intron|BNIP1_uc003mck.3_Intron|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1						anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AAATATTGAAttttttttttt	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174465510	174465510	+	IGR	DEL	C	-	-	rs2135053	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174465510delC								MSX2 (307609 upstream) : DRD1 (402166 downstream)																							TTCACCTCTGCCCCTCATGCT	0.483													4	2	---	---	---	---	
ZNF354A	6940	broad.mit.edu	37	5	178152857	178152857	+	Intron	DEL	T	-	-	rs77240047		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178152857delT	uc003mjj.2	-							NM_005649	NP_005640	O60765	Z354A_HUMAN	zinc finger protein 354A						regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		CTGACTCCGCtttttttttct	0.174													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178909439	178909439	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178909439delA								ADAMTS2 (137110 upstream) : RUFY1 (68132 downstream)																							ACCTTTGCTCAACCAGAAACT	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	179640794	179640795	+	IGR	DEL	TG	-	-	rs10586643		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179640794_179640795delTG								RASGEF1C (4664 upstream) : MAPK9 (19802 downstream)																							gctctgcctatgtgtgtggtgc	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8438105	8438105	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8438105delG	uc003mye.2	+						SLC35B3_uc003myc.2_5'Flank|SLC35B3_uc010joe.2_5'Flank|SLC35B3_uc003myb.2_5'Flank|SLC35B3_uc011did.1_5'Flank|SLC35B3_uc003myd.2_5'Flank|SLC35B3_uc010jof.2_5'Flank|SLC35B3_uc011die.1_5'Flank					Homo sapiens, clone IMAGE:5539086, mRNA.																		acttggttgtggggggcagtt	0.015													4	2	---	---	---	---	
C6orf105	84830	broad.mit.edu	37	6	11735554	11735555	+	Intron	DEL	GA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11735554_11735555delGA	uc003nab.2	-						C6orf105_uc003naa.2_Intron|C6orf105_uc011dip.1_Intron	NM_032744	NP_116133	Q96IZ2	CF105_HUMAN	hypothetical protein LOC84830 isoform 2							integral to membrane					0	Ovarian(93;0.0848)|Breast(50;0.0871)	all_hematologic(90;0.135)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.193)			AATTCTTCACGAGAGAGAGAGG	0.421													4	2	---	---	---	---	
TRERF1	55809	broad.mit.edu	37	6	42384844	42384845	+	Intron	DEL	AA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42384844_42384845delAA	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ACAGACTCACAAAAAAAGAGGA	0.520													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57224687	57224687	+	Intron	DEL	G	-	-	rs5876538		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57224687delG	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CTGCTTAAAAGTTAGCTGAGA	0.358													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57375667	57375668	+	Intron	INS	-	G	G	rs150523374		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57375667_57375668insG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGTAACCTTGTATAACGCCTTT	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57559053	57559054	+	IGR	INS	-	G	G	rs143848127		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57559053_57559054insG								PRIM2 (45678 upstream) : GUSBL2 (687105 downstream)																							gtcttggtgattttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	84707018	84707018	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84707018delA								CYB5R4 (36874 upstream) : MRAP2 (36402 downstream)																							TTGAATATGGAAAAAAATGGC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85267942	85267942	+	IGR	DEL	C	-	-	rs113433118	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85267942delC								KIAA1009 (330607 upstream) : TBX18 (129139 downstream)																							caaaacaaaacaaaacCTGCC	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	87093761	87093761	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87093761delT								SNHG5 (705310 upstream) : HTR1E (553263 downstream)																							TACCTggtagtttttttggct	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	96250904	96250904	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96250904delA								MANEA (193578 upstream) : FUT9 (212941 downstream)																							GAGGGAGCAGAAGATTGTCTT	0.368													4	2	---	---	---	---	
ATG5	9474	broad.mit.edu	37	6	106753420	106753423	+	Intron	DEL	TTCT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106753420_106753423delTTCT	uc003prf.2	-						ATG5_uc010kdb.2_Intron|ATG5_uc003prg.2_Intron|ATG5_uc010kdc.2_Intron	NM_004849	NP_004840	Q9H1Y0	ATG5_HUMAN	APG5 autophagy 5-like						apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding			large_intestine(1)	1	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		TCAATTTCTGTTCTTTCTTCCCTC	0.348													1	5	---	---	---	---	
ESR1	2099	broad.mit.edu	37	6	152327975	152327975	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152327975delT	uc003qom.3	+						ESR1_uc010kin.2_Intron|ESR1_uc010kio.2_Intron|ESR1_uc010kip.2_Intron|ESR1_uc003qon.3_Intron|ESR1_uc003qoo.3_Intron|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Intron|ESR1_uc010kit.1_Intron|ESR1_uc011eey.1_Intron	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	GAAACCAATATTTTTTTTTCC	0.373													4	2	---	---	---	---	
LPAL2	80350	broad.mit.edu	37	6	160914198	160914198	+	Intron	DEL	T	-	-	rs146778738		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160914198delT	uc003qtj.2	-						LPAL2_uc011efy.1_Intron	NR_028093				Homo sapiens cDNA FLJ43922 fis, clone TESTI4012406.												0		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		AGATTTTAACTTTTTTTTTTA	0.348													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	3318636	3318636	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3318636delG								CARD11 (235057 upstream) : SDK1 (22444 downstream)																							gacttgtacagggaccagaat	0.000													4	2	---	---	---	---	
THSD7A	221981	broad.mit.edu	37	7	11539692	11539692	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11539692delA	uc003ssf.3	-							NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A							integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		aaaggcagctaaagagtaaga	0.000										HNSCC(18;0.044)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15025626	15025626	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15025626delT								DGKB (83076 upstream) : TMEM195 (214317 downstream)																							TGTGGGATTCTTTTTTTTTTT	0.308													7	5	---	---	---	---	
CRHR2	1395	broad.mit.edu	37	7	30702683	30702684	+	Intron	INS	-	T	T	rs74855732		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30702683_30702684insT	uc003tbn.2	-						CRHR2_uc010kvw.1_Intron|CRHR2_uc010kvx.1_Intron|CRHR2_uc010kvy.1_Intron|CRHR2_uc003tbo.2_Intron|CRHR2_uc003tbp.2_Intron	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2						G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4						gggccaacgtgttttttttaac	0.000													4	2	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	37081929	37081929	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37081929delT	uc003tfk.1	-						ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						AGAGCCATGGTTTTTTTTTAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53779186	53779187	+	IGR	INS	-	CG	CG			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53779186_53779187insCG								POM121L12 (674569 upstream) : HPVC1 (489730 downstream)																							ttatgcacacacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56699457	56699457	+	IGR	DEL	A	-	-	rs78077053		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56699457delA								DKFZp434L192 (134480 upstream) : ZNF479 (487871 downstream)																							TTCATAGTCCAAAAAAAAAAT	0.294													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61804142	61804142	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61804142delT								None (None upstream) : LOC643955 (947530 downstream)																							ATTTAAATTCTTTTTTGCTCA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63317424	63317425	+	IGR	DEL	AA	-	-	rs35870556		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63317424_63317425delAA								LOC100287704 (505273 upstream) : ZNF727 (188396 downstream)																							actctgcctcaaaaaaaaaaaa	0.193													5	3	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70617081	70617082	+	Intron	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70617081_70617082insT	uc003tvy.2	+							NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ATCCACTTTAATTTTTTTTTTC	0.342													4	2	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	77933936	77933936	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77933936delT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron|MAGI2_uc010ldy.1_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				caaacatccctttgtttcatg	0.000													4	2	---	---	---	---	
CLDN12	9069	broad.mit.edu	37	7	90030727	90030727	+	Intron	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90030727delC	uc003ukp.2	+						CLDN12_uc003ukq.2_Intron|CLDN12_uc010leq.2_5'Flank|CLDN12_uc003ukr.2_5'Flank	NM_012129	NP_036261	P56749	CLD12_HUMAN	claudin 12						calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						aGGGGAAAAACccctgctgac	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	121377295	121377295	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121377295delG								FAM3C (340873 upstream) : PTPRZ1 (135864 downstream)																							aataggatttgggaggtagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128736164	128736164	+	IGR	DEL	T	-	-	rs66837005		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128736164delT								TPI1P2 (38871 upstream) : LOC407835 (30161 downstream)																							GGAATGAATCttttttttttt	0.174													3	3	---	---	---	---	
TMEM209	84928	broad.mit.edu	37	7	129821786	129821786	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129821786delT	uc003vpn.2	-						TMEM209_uc010lmc.1_Intron	NM_032842	NP_116231	Q96SK2	TM209_HUMAN	transmembrane protein 209							integral to membrane				ovary(2)|large_intestine(1)	3	Melanoma(18;0.0435)					CTTACATTCCttttttttttt	0.154													3	3	---	---	---	---	
SVOPL	136306	broad.mit.edu	37	7	138363995	138363995	+	5'Flank	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138363995delT	uc011kqh.1	-							NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						CAGCTCAGTGTTTTTTTTCCC	0.134													4	2	---	---	---	---	
ARHGEF5	7984	broad.mit.edu	37	7	144071639	144071640	+	Intron	DEL	GT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144071639_144071640delGT	uc003wel.2	+						ARHGEF5_uc003wek.2_Intron|ARHGEF5_uc003wem.2_Intron	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5						intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					GACAGTGGTAGTTAGAGGGTTC	0.480													5	6	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147523830	147523830	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147523830delT	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGGCTTGGAATTTTTTTGAAG	0.318										HNSCC(39;0.1)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148347109	148347109	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148347109delA								C7orf33 (34158 upstream) : CUL1 (47897 downstream)																							accctgtctcaaaaaaaaaaa	0.204													4	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4472138	4472139	+	Intron	DEL	CA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4472138_4472139delCA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGAGTATGACcacacacacacg	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	4918816	4918816	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4918816delA								CSMD1 (66488 upstream) : None (None downstream)																							TTAATTTCGGAAAAAAAAAAT	0.318													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	15864763	15864764	+	IGR	DEL	AG	-	-	rs145480211	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15864763_15864764delAG								TUSC3 (242770 upstream) : MSR1 (100624 downstream)																							taaagtaaaaagaaaaaaaaaA	0.233													4	2	---	---	---	---	
INTS9	55756	broad.mit.edu	37	8	28628716	28628716	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28628716delT	uc003xha.2	-						INTS9_uc011lav.1_Intron|INTS9_uc011law.1_Intron|INTS9_uc011lax.1_Intron|INTS9_uc010lvc.2_Intron	NM_018250	NP_060720	Q9NV88	INT9_HUMAN	integrator complex subunit 9 isoform 1						snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AGGTAAACAAttttttttttt	0.323													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30824575	30824576	+	IGR	INS	-	C	C			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30824575_30824576insC								TEX15 (78353 upstream) : PURG (28745 downstream)																							GTGTGTTCTTTCCAAAAAAAGT	0.381													4	2	---	---	---	---	
WRN	7486	broad.mit.edu	37	8	30998669	30998669	+	Intron	DEL	T	-	-	rs76871007		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30998669delT	uc003xio.3	+						WRN_uc010lvk.2_Intron	NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein						base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		AAGCTAAGTGTTCCAAACACA	0.328			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	32765066	32765066	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32765066delT								NRG1 (142508 upstream) : FUT10 (463280 downstream)																							ATCATCTTTGTTTTTTTTTTC	0.294													4	2	---	---	---	---	
ADAM32	203102	broad.mit.edu	37	8	39068431	39068432	+	Intron	DEL	TG	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39068431_39068432delTG	uc003xmt.3	+						ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			attggattactgtgtgtgtgtg	0.168													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58405964	58405965	+	IGR	INS	-	CT	CT	rs143417552	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58405964_58405965insCT								C8orf71 (208676 upstream) : FAM110B (501148 downstream)																							aaccaattgccgtttccagccc	0.094													3	3	---	---	---	---	
NSMAF	8439	broad.mit.edu	37	8	59543849	59543849	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59543849delT	uc003xtt.2	-						NSMAF_uc011lee.1_Intron|NSMAF_uc003xtu.2_Intron	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				TTTTAGGCACTTTTTTTTTTA	0.259													5	3	---	---	---	---	
GGH	8836	broad.mit.edu	37	8	63948834	63948834	+	Intron	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63948834delC	uc003xuw.2	-							NM_003878	NP_003869	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase precursor						glutamine metabolic process	extracellular space|lysosome|melanosome	gamma-glutamyl-peptidase activity				0	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|L-Glutamic Acid(DB00142)	TCTTAAGAAACCCCCCCAAGC	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64871299	64871300	+	IGR	INS	-	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64871299_64871300insA								YTHDF3 (745954 upstream) : MIR124-2 (420406 downstream)																							AGCAGGAACTTTGGAGGTGTAG	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	72780343	72780344	+	Intron	DEL	GT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72780343_72780344delGT	uc011lff.1	+						uc003xyy.2_Intron					Homo sapiens cDNA FLJ41321 fis, clone BRAMY2045299.																		tgggggctgggtgtgtgtgtgg	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	80244371	80244371	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80244371delT								IL7 (526613 upstream) : STMN2 (279009 downstream)																							CAGAAAGACATTATGTAAACA	0.323													4	2	---	---	---	---	
STMN2	11075	broad.mit.edu	37	8	80553864	80553865	+	Intron	DEL	CA	-	-	rs12675728		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80553864_80553865delCA	uc003ybj.2	+						STMN2_uc010lzp.2_Intron|STMN2_uc011lfn.1_Intron	NM_007029	NP_008960	Q93045	STMN2_HUMAN	superiorcervical ganglia, neural specific 10						intracellular signal transduction|negative regulation of microtubule depolymerization|negative regulation of microtubule polymerization|negative regulation of neuron projection development|neuron differentiation|positive regulation of microtubule depolymerization|positive regulation of neuron projection development	axon|growth cone|membrane|membrane fraction|perinuclear region of cytoplasm|soluble fraction	protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			cacatgcacgcacacacacaca	0.351													13	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	82774998	82774998	+	IGR	DEL	G	-	-	rs35855348		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82774998delG								SNX16 (20477 upstream) : None (None downstream)																							tggcacacaagggacctttat	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	114814790	114814790	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114814790delT								CSMD3 (365548 upstream) : None (None downstream)																							TCATTTAGTATTTTTTTTGAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128518317	128518317	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128518317delG								LOC727677 (23933 upstream) : MYC (229448 downstream)																							tttttgggttggggggtgggc	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136984213	136984214	+	IGR	DEL	TT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136984213_136984214delTT								KHDRBS3 (324367 upstream) : None (None downstream)																							TGGAGACATCTTTGACTGGAAA	0.460													4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139774852	139774853	+	Intron	INS	-	ACACACA	ACACACA	rs149851445	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139774852_139774853insACACACA	uc003yvd.2	-						COL22A1_uc011ljo.1_5'Flank	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			cacacacacacaACAGCCCTag	0.267										HNSCC(7;0.00092)			6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1162704	1162704	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1162704delA								DMRT2 (105151 upstream) : SMARCA2 (852638 downstream)																							ATACAATATCAAAAAAAAGCT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1918320	1918321	+	IGR	DEL	AC	-	-	rs113386828		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1918320_1918321delAC								DMRT2 (860767 upstream) : SMARCA2 (97021 downstream)																							CAacatacagacacacacacac	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	17976514	17976515	+	IGR	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17976514_17976515insT								SH3GL2 (179394 upstream) : ADAMTSL1 (497589 downstream)																							tctcaaaacaatttttttttat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	19827144	19827145	+	IGR	DEL	AC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19827144_19827145delAC								SLC24A2 (38336 upstream) : MLLT3 (517823 downstream)																							AGGGACACTAACACACACACAA	0.446													4	4	---	---	---	---	
MTAP	4507	broad.mit.edu	37	9	21967163	21967163	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21967163delA	uc003zpi.1	+						C9orf53_uc011lnm.1_RNA	NM_002451	NP_002442	Q13126	MTAP_HUMAN	5'-methylthioadenosine phosphorylase						nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity			central_nervous_system(1)	1		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	Adenine(DB00173)	CGTGTACCCTAAAAAAAAAAA	0.303													4	3	---	---	---	---	
MELK	9833	broad.mit.edu	37	9	36581972	36581972	+	Intron	DEL	T	-	-	rs112247634		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36581972delT	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			cttttatttcttttttttttt	0.075													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44799721	44799722	+	IGR	INS	-	C	C	rs141633865	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44799721_44799722insC								None (None upstream) : FAM27C (190514 downstream)																							agtaaaatgctcaacaccaagg	0.000													3	3	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66502883	66502884	+	RNA	DEL	AT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66502883_66502884delAT	uc004aed.1	+	3		c.2976_2977delAT								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						TTAGTGGCAAATATTTTTTTTT	0.307													4	2	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66502886	66502886	+	RNA	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66502886delT	uc004aed.1	+	3		c.2979delT								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						GTGGCAAATATTTTTTTTTTG	0.313													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66534672	66534672	+	Intron	DEL	A	-	-	rs7867774		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66534672delA	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																		TCAGCGGAATAAAAAAAAAGT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68397605	68397606	+	IGR	INS	-	T	T	rs146336066		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68397605_68397606insT								FAM27B (603416 upstream) : MIR1299 (604633 downstream)																							CTCTTTTGTGATTTTTTTTTTT	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70837214	70837214	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70837214delA								CBWD3 (337151 upstream) : FOXD4L3 (80569 downstream)																							tggaattcagaagccatatag	0.000													4	4	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73569998	73569998	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73569998delT	uc004aid.2	-						TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						acttgaagcatttttttcccc	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	85098796	85098796	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85098796delA								FLJ46321 (488626 upstream) : RASEF (498521 downstream)																							TAATTGCAAGAAAAAAAAATC	0.398													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87082288	87082289	+	IGR	INS	-	GTGT	GTGT			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87082288_87082289insGTGT								SLC28A3 (98875 upstream) : NTRK2 (201177 downstream)																							ctgtgcgtgtggtgtgtggtgt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	103712851	103712853	+	IGR	DEL	GAA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103712851_103712853delGAA								MURC (362680 upstream) : LPPR1 (78178 downstream)																							AAAACAAAAGGAAGAAGAAGAGA	0.379													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	106269040	106269040	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106269040delT								CYLC2 (488270 upstream) : SMC2 (587501 downstream)																							TCTCCATTAGTTTTTTTCCCA	0.393													4	2	---	---	---	---	
SMC2	10592	broad.mit.edu	37	9	106888729	106888729	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106888729delT	uc004bbv.2	+						SMC2_uc004bbw.2_Intron|SMC2_uc011lvl.1_Intron|SMC2_uc004bbx.2_Intron|SMC2_uc004bby.2_5'Flank	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2						cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						TTACACATACTTTTTTTTTTG	0.323													4	2	---	---	---	---	
PTGR1	22949	broad.mit.edu	37	9	114354959	114354959	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114354959delT	uc004bfh.2	-						PTGR1_uc011lwr.1_Intron|PTGR1_uc004bfi.3_Intron|PTGR1_uc004bfj.3_Intron|PTGR1_uc010mue.2_Intron	NM_012212	NP_036344	Q14914	PTGR1_HUMAN	prostaglandin reductase 1 isoform 1						leukotriene metabolic process	cytoplasm	15-oxoprostaglandin 13-oxidase activity|2-alkenal reductase activity|alcohol dehydrogenase (NAD) activity|zinc ion binding				0						GGACAAATACTTTTTTTTTTT	0.209													3	3	---	---	---	---	
GAPVD1	26130	broad.mit.edu	37	9	128089106	128089106	+	Intron	DEL	A	-	-	rs75364733		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128089106delA	uc010mwx.2	+						GAPVD1_uc011lzs.1_Intron|GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc010mwy.1_Intron	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CCAGCTGCCCAAAAAAAAAAA	0.353													3	4	---	---	---	---	
GARNL3	84253	broad.mit.edu	37	9	130076035	130076035	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130076035delA	uc011mae.1	+						GARNL3_uc011mad.1_Intron	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						TGGCCTTTTGAAAAAAAAAAA	0.244													4	4	---	---	---	---	
UBAC1	10422	broad.mit.edu	37	9	138824581	138824582	+	Intron	INS	-	C	C	rs145697296	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138824581_138824582insC	uc004cgs.1	-							NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1							Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		GGCGGAGGCAGCCGTGCTTGGG	0.455													6	4	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	326762	326763	+	Intron	INS	-	AT	AT			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:326762_326763insAT	uc001ifp.2	-							NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TCCCATGTCTCATGTTACTTCC	0.401													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8121082	8121082	+	IGR	DEL	A	-	-	rs75045270		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8121082delA								GATA3 (3920 upstream) : None (None downstream)																							aaaataaattaaaaaaaaaaa	0.174													4	2	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32310434	32310434	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32310434delT	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				GTTTGTTTGGTTTTTTTTTTT	0.363													6	6	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	35106639	35106639	+	5'Flank	DEL	T	-	-	rs76981437		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35106639delT	uc010qej.1	-						PARD3_uc010qek.1_5'Flank|PARD3_uc010qel.1_5'Flank|PARD3_uc010qem.1_5'Flank|PARD3_uc010qen.1_5'Flank|PARD3_uc010qeo.1_5'Flank|PARD3_uc010qep.1_5'Flank|PARD3_uc010qeq.1_5'Flank|PARD3_uc001ixq.1_5'Flank|PARD3_uc001ixr.1_5'Flank|PARD3_uc001ixu.1_5'Flank	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				tcagtctttctttttttttga	0.000													4	2	---	---	---	---	
FRMPD2	143162	broad.mit.edu	37	10	49400634	49400634	+	Intron	DEL	A	-	-	rs74923642		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49400634delA	uc001jgi.2	-						FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		actcagtctcaaaaaaaaaat	0.214													7	4	---	---	---	---	
CHAT	1103	broad.mit.edu	37	10	50831854	50831854	+	Intron	DEL	T	-	-	rs73319032	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50831854delT	uc001jhz.2	+						CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_Intron|CHAT_uc001jhy.1_Intron|CHAT_uc001jia.2_Intron|CHAT_uc010qgs.1_Intron	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2						neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	cccttgcaccttcatgtaacc	0.000													4	2	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	52763519	52763520	+	Intron	DEL	AG	-	-	rs111551625		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52763519_52763520delAG	uc001jjm.2	+						PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CTTTATATGTAGAGAGAGAACT	0.267													4	2	---	---	---	---	
FAM13C	220965	broad.mit.edu	37	10	61029485	61029486	+	Intron	INS	-	CAATGGCAT	CAATGGCAT	rs146306829	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61029485_61029486insCAATGGCAT	uc001jkn.2	-						FAM13C_uc001jko.2_Intron|FAM13C_uc010qid.1_Intron|FAM13C_uc010qie.1_Intron|FAM13C_uc010qif.1_Intron|FAM13C_uc001jkp.2_Intron	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1											ovary(2)	2						ATCAAGGCCTGCAATGGCATCC	0.436													7	4	---	---	---	---	
PPA1	5464	broad.mit.edu	37	10	71989550	71989550	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71989550delT	uc001jqv.1	-							NM_021129	NP_066952	Q15181	IPYR_HUMAN	pyrophosphatase 1						diphosphate metabolic process|tRNA aminoacylation for protein translation	cytosol	inorganic diphosphatase activity|magnesium ion binding			breast(1)	1						TAATTTTTTCTTTTTTTTTTC	0.303													3	3	---	---	---	---	
ADK	132	broad.mit.edu	37	10	75920697	75920697	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75920697delA	uc001jwi.2	+						ADK_uc010qlb.1_Intron	NM_006721	NP_006712	P55263	ADK_HUMAN	adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)	CTCCCCTTCCAAAAAACCCGA	0.388													4	2	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	80989312	80989312	+	Intron	DEL	G	-	-	rs111340991	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80989312delG	uc001kaf.2	+							NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			AGGAATTACTGGGGGGAAACA	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	85620166	85620166	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85620166delG								NRG3 (873231 upstream) : GHITM (279019 downstream)																							attgtatcctgggctttgtga	0.000													4	2	---	---	---	---	
MINPP1	9562	broad.mit.edu	37	10	89287429	89287429	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89287429delT	uc001keu.2	+						MINPP1_uc009xtf.1_Intron|MINPP1_uc001kev.2_Intron	NM_004897	NP_004888	Q9UNW1	MINP1_HUMAN	multiple inositol polyphosphate histidine						bone mineralization|polyphosphate metabolic process	endoplasmic reticulum lumen	acid phosphatase activity|bisphosphoglycerate 3-phosphatase activity|multiple inositol-polyphosphate phosphatase activity|phosphohistidine phosphatase activity			urinary_tract(1)	1		Colorectal(252;0.122)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00123)		tctaaaattctttttttttgt	0.000													4	2	---	---	---	---	
RNLS	55328	broad.mit.edu	37	10	90223587	90223588	+	Intron	DEL	TG	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90223587_90223588delTG	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_Intron	NM_001031709	NP_001026879	Q5VYX0	RNLS_HUMAN	renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1						tgtttatctctgtgtgtgtgtg	0.243													4	2	---	---	---	---	
TBC1D12	23232	broad.mit.edu	37	10	96234262	96234262	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96234262delA	uc001kjr.2	+							NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12							intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)				CTCCACCTCCAAAAAAAAAAC	0.149													6	3	---	---	---	---	
TM9SF3	56889	broad.mit.edu	37	10	98349495	98349496	+	5'Flank	DEL	TT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98349495_98349496delTT	uc001kmm.3	-						TM9SF3_uc010qot.1_5'Flank	NM_020123	NP_064508	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3 precursor							integral to membrane	binding				0		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		ATAAATGGCATTAGGTGATACA	0.282													4	2	---	---	---	---	
DNMBP	23268	broad.mit.edu	37	10	101730337	101730338	+	Intron	DEL	GT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101730337_101730338delGT	uc001kqj.2	-							NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein						intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		ctaagatcaagtgaagaatGAA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	105629375	105629375	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105629375delA								SH3PXD2A (14211 upstream) : OBFC1 (7945 downstream)																							CAACTGTGGGAAAAATAACGT	0.458													4	2	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112654477	112654478	+	Intron	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112654477_112654478insT	uc001kzh.2	+						PDCD4_uc001kzg.2_Intron|PDCD4_uc010qre.1_Intron	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		ACACTGCAGTGTTTTTTTTTTT	0.277													4	3	---	---	---	---	
ATRNL1	26033	broad.mit.edu	37	10	117184377	117184377	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117184377delG	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		cagttagataggaatcacact	0.104													4	2	---	---	---	---	
INPP5F	22876	broad.mit.edu	37	10	121565651	121565651	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121565651delT	uc001leo.2	+							NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F								phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		tgcaccccagttttttttttt	0.055													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132330308	132330309	+	IGR	INS	-	T	T	rs140484513	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132330308_132330309insT								GLRX3 (347524 upstream) : TCERG1L (560347 downstream)																							GAATGTTTCCGTTTTTTTTTTC	0.287													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135400708	135400709	+	IGR	DEL	TT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135400708_135400709delTT								SYCE1 (17246 upstream) : FRG2B (37895 downstream)																							catacaagtctttttacacgca	0.000													4	2	---	---	---	---	
SYT9	143425	broad.mit.edu	37	11	7290398	7290398	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7290398delG	uc001mfe.2	+						SYT9_uc001mfd.2_Intron|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ttgtgctattgtgaCATGGCA	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	14402148	14402149	+	IGR	INS	-	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14402148_14402149insG								RRAS2 (21419 upstream) : COPB1 (76900 downstream)																							caacaacaacaaaaaaaaactt	0.000													4	2	---	---	---	---	
PDE3B	5140	broad.mit.edu	37	11	14854498	14854498	+	Intron	DEL	T	-	-	rs80137325		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14854498delT	uc001mln.2	+						PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TGAAAttttcttttttttttt	0.129													5	4	---	---	---	---	
NUCB2	4925	broad.mit.edu	37	11	17291889	17291891	+	Intron	DEL	TGT	-	-	rs72030929		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17291889_17291891delTGT	uc001mms.1	+						NUCB2_uc001mmt.1_Intron|NUCB2_uc009ygw.1_Intron|uc001mmu.1_Intron	NM_005013	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2 precursor							cytosol|ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|plasma membrane	calcium ion binding|DNA binding				0						CTATGGTTTCtgttgttgttgtt	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30149918	30149918	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30149918delT								KCNA4 (111430 upstream) : FSHB (102645 downstream)																							TGCTGACTCATTTTCTGAATT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30921689	30921689	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30921689delG	uc001mss.1	-						uc009yjk.1_Intron|uc009yjj.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		ATTCCAGTAAGAAAAAAACAG	0.313													4	2	---	---	---	---	
RCN1	5954	broad.mit.edu	37	11	32017172	32017173	+	Intron	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32017172_32017173insT	uc010rea.1	+							NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					GACTTAAAATCTTTTCCCATGA	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44874076	44874077	+	IGR	INS	-	GAAA	GAAA	rs139799846	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44874076_44874077insGAAA								CD82 (232763 upstream) : TSPAN18 (7802 downstream)																							TGTTGGCTTCTGAGTTAATTCA	0.351													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50519491	50519491	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50519491delT								LOC646813 (139688 upstream) : OR4A5 (891957 downstream)																							AATTTTCAGCTttttttttta	0.149													4	2	---	---	---	---	
TMEM223	79064	broad.mit.edu	37	11	62558503	62558503	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62558503delT	uc001nve.2	-							NM_001080501	NP_001073970	A0PJW6	TM223_HUMAN	transmembrane protein 223							integral to membrane					0						TACTGAGCGCttttttttttg	0.264													6	3	---	---	---	---	
MEN1	4221	broad.mit.edu	37	11	64573234	64573234	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64573234delT	uc001obj.2	-	8	1146	c.1073delA	c.(1072-1074)TACfs	p.Y358fs	MAP4K2_uc001obh.2_5'Flank|MAP4K2_uc001obi.2_5'Flank|MAP4K2_uc010rnp.1_5'Flank|MEN1_uc001obk.2_Frame_Shift_Del_p.Y358fs|MEN1_uc001obl.2_Frame_Shift_Del_p.Y318fs|MEN1_uc001obm.2_Frame_Shift_Del_p.Y353fs|MEN1_uc001obn.2_Frame_Shift_Del_p.Y358fs|MEN1_uc001obo.2_Frame_Shift_Del_p.Y358fs|MEN1_uc001obp.2_Frame_Shift_Del_p.Y353fs|MEN1_uc001obq.2_Frame_Shift_Del_p.Y358fs|MEN1_uc001obr.2_Frame_Shift_Del_p.Y358fs	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1	358	Interaction with FANCD2.		Y -> D (in MEN1).		DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding	p.E358*(1)		parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						TTCCCGGCAGTAGTTGTAGCT	0.612			D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				51	29	---	---	---	---	
RBM4	5936	broad.mit.edu	37	11	66410772	66410772	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66410772delT	uc009yrj.2	+						RBM4_uc009yrk.2_Intron|RBM4_uc001oiw.1_Intron|RBM4_uc001oix.1_Intron|RBM4_uc010rpj.1_Intron|RBM4_uc001oiy.1_Intron|RBM4_uc001oiz.1_Intron	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4						circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		ATGTTGAGTCTTTTTTTTTTT	0.343													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69796910	69796910	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69796910delA								FGF3 (162718 upstream) : ANO1 (127498 downstream)																							TCACCACAATAAAAAAAAGTG	0.517													4	2	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76904299	76904301	+	Intron	DEL	TGG	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76904299_76904301delTGG	uc001oyb.2	+						MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						atgttagtgatggtggtggtggt	0.000													2	4	---	---	---	---	
TYR	7299	broad.mit.edu	37	11	88926325	88926326	+	Intron	DEL	CT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88926325_88926326delCT	uc001pcs.2	+							NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor						eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	AACAACAGTACTCAGAATGCTG	0.386									Oculocutaneous_Albinism				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	98800127	98800127	+	IGR	DEL	G	-	-	rs113906355		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98800127delG								None (None upstream) : CNTN5 (91744 downstream)																							ggacttccaaggaggtttgct	0.005													0	6	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	103120396	103120398	+	Intron	DEL	TGT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103120396_103120398delTGT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		tgtgtactcctgttgaacataaa	0.000													4	2	---	---	---	---	
AASDHPPT	60496	broad.mit.edu	37	11	105961622	105961625	+	Intron	DEL	TACT	-	-	rs138293505		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105961622_105961625delTACT	uc001pjc.1	+						AASDHPPT_uc010rvn.1_Intron|AASDHPPT_uc001pjd.1_Intron	NM_015423	NP_056238	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde						macromolecule biosynthetic process|pantothenate metabolic process	cytosol	holo-[acyl-carrier-protein] synthase activity|magnesium ion binding|protein binding				0		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		AGTTAGAAAGTACTTACTTAAAGC	0.225													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	107770526	107770526	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107770526delT								SLC35F2 (40612 upstream) : RAB39 (28751 downstream)																							agtgttgggattacaggcatg	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	120071439	120071439	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120071439delT								TRIM29 (62576 upstream) : OAF (10308 downstream)																							ATACACAAGGTTTTTTTATAT	0.393													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	120878026	120878026	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120878026delA								GRIK4 (21057 upstream) : TBCEL (16777 downstream)																							atacaggaggaaaactaaaaa	0.000													4	2	---	---	---	---	
TECTA	7007	broad.mit.edu	37	11	121022249	121022250	+	Intron	DEL	AC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121022249_121022250delAC	uc010rzo.1	+							NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor						cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ttatgtgcaTACACACACACAC	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	124144175	124144175	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124144175delT								OR8G2 (47865 upstream) : OR8D1 (35562 downstream)																							CCATCATTCCTTTTTTTTTTT	0.413													8	4	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126715860	126715860	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126715860delA	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		aaaaaaacacaaaaaacctct	0.020													4	2	---	---	---	---	
NTF3	4908	broad.mit.edu	37	12	5553836	5553836	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5553836delT	uc001qnk.3	+							NM_001102654	NP_001096124	P20783	NTF3_HUMAN	neurotrophin 3 isoform 1 preproprotein						signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1						GGGAGCTTACTTtttttttcc	0.289													3	3	---	---	---	---	
CDCA3	83461	broad.mit.edu	37	12	6955786	6955787	+	3'UTR	DEL	CA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6955786_6955787delCA	uc001qre.2	-	5					GNB3_uc001qrc.2_Intron|GNB3_uc001qrd.2_Intron|GNB3_uc009zfe.2_Intron|uc001qrf.1_Intron	NM_031299	NP_112589	Q99618	CDCA3_HUMAN	cell division cycle associated 3						cell division|mitosis	cytosol					0						AGcacacatgcacacacacacg	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	14245689	14245689	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14245689delA								GRIN2B (112667 upstream) : ATF7IP (272922 downstream)																							aaattcttctaaaaaaagaaa	0.000													4	2	---	---	---	---	
PIK3C2G	5288	broad.mit.edu	37	12	18488353	18488355	+	Intron	DEL	TTC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18488353_18488355delTTC	uc001rdt.2	+						PIK3C2G_uc010sia.1_Intron|PIK3C2G_uc010sib.1_Intron|PIK3C2G_uc010sic.1_Intron	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma						cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				TATCTTGCCTTTCTTAAAATTTG	0.320													4	2	---	---	---	---	
RBMS2	5939	broad.mit.edu	37	12	56980357	56980359	+	Intron	DEL	TAA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56980357_56980359delTAA	uc001sln.2	+						RBMS2_uc010sqp.1_Intron|RBMS2_uc010sqq.1_Intron|RBMS2_uc009zou.2_Intron	NM_002898	NP_002889	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting						RNA processing	nucleus	nucleotide binding|RNA binding				0						ttttttttactaatttttttagt	0.025													4	2	---	---	---	---	
MARS	4141	broad.mit.edu	37	12	57905262	57905262	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57905262delA	uc001sog.2	+						MARS_uc001sof.1_Intron|MARS_uc010srp.1_Intron|MARS_uc010srq.1_Intron|MARS_uc001soh.1_5'Flank	NM_004990	NP_004981	P56192	SYMC_HUMAN	methionyl-tRNA synthetase						methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	ggggaggttgaggtaggagga	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	58470040	58470040	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58470040delT								XRCC6BP1 (118989 upstream) : LRIG3 (795898 downstream)																							TTTTGTGGGGTTTTTTTTTGG	0.363													3	3	---	---	---	---	
ANKS1B	56899	broad.mit.edu	37	12	99167233	99167233	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99167233delT	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron|ANKS1B_uc010svd.1_Intron|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc009ztq.2_Intron|ANKS1B_uc010sve.1_Intron|ANKS1B_uc001tgh.3_Intron|ANKS1B_uc001tgi.2_Intron|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc009ztp.2_Intron|ANKS1B_uc010svf.1_Intron|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TGGCGGCCACtttttttttgt	0.214													4	2	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101768336	101768336	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101768336delA	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TTAAAAATGGAAAAAAAAATT	0.313													4	2	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	129621338	129621340	+	Intron	DEL	CAC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129621338_129621340delCAC	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		tcatcaccatcaccatcatcacc	0.000													4	2	---	---	---	---	
DKFZp686A1627	266695	broad.mit.edu	37	13	19661592	19661593	+	Intron	INS	-	C	C	rs144559378	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19661592_19661593insC	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0						GGCCACCCCCACCCCACCAACA	0.416													7	5	---	---	---	---	
BRCA2	675	broad.mit.edu	37	13	32921389	32921389	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32921389delT	uc001uub.1	+							NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset						cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		actaagatagtttttttaatg	0.010			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			4	2	---	---	---	---	
SETDB2	83852	broad.mit.edu	37	13	50026260	50026260	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50026260delT	uc001vcz.2	+						SETDB2_uc010adg.2_Intron|SETDB2_uc001vcy.3_Intron|SETDB2_uc010adh.2_Intron|SETDB2_uc001vda.2_Intron	NM_031915	NP_114121	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2 isoform a						cell division|chromosome segregation|heart looping|left/right axis specification|mitosis|negative regulation of transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone methyltransferase activity (H3-K9 specific)|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		tttttttttctttttttttgg	0.129													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	59551408	59551408	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59551408delG								None (None upstream) : DIAPH3 (688317 downstream)																							CTGTTGCTCTGGGTCATGAAT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	73231038	73231038	+	IGR	DEL	C	-	-	rs61412179		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73231038delC								DACH1 (789708 upstream) : C13orf37 (51457 downstream)																							GTCATGCGGTCTACTCTGAAC	0.408													4	7	---	---	---	---	
FAM155A	728215	broad.mit.edu	37	13	108487973	108487974	+	Intron	INS	-	CA	CA	rs149110002	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108487973_108487974insCA	uc001vql.2	-						uc001vqm.2_5'Flank	NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1						GGCACAAGACCCACACACACAC	0.376													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	110254516	110254518	+	IGR	DEL	TAT	-	-	rs140511241	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110254516_110254518delTAT								MYO16 (394161 upstream) : IRS2 (151668 downstream)																							TATAACTTCATATTATGTGTGAG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	30891391	30891391	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30891391delA								PRKD1 (494492 upstream) : G2E3 (136938 downstream)																							cactcacattaaaaaaaaatc	0.000													4	2	---	---	---	---	
GNG2	54331	broad.mit.edu	37	14	52417705	52417705	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52417705delA	uc001wzi.2	+						GNG2_uc001wzh.2_Intron|GNG2_uc010aoc.1_Intron|GNG2_uc001wzj.2_Intron|GNG2_uc001wzk.2_Intron	NM_053064	NP_444292	P59768	GBG2_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|platelet activation|synaptic transmission	heterotrimeric G-protein complex	protein binding|signal transducer activity				0	all_epithelial(31;0.0659)|Breast(41;0.0684)				Halothane(DB01159)	AACACAACACAAAAAAAAAAG	0.363													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	53764147	53764147	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53764147delA								DDHD1 (144101 upstream) : BMP4 (652310 downstream)																							AAGTAGAATGAAAAAAAATGG	0.443													4	2	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	68292456	68292456	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68292456delT	uc001xkf.1	+						RAD51L1_uc010aqq.2_Intron|RAD51L1_uc001xkd.2_Intron|RAD51L1_uc010aqr.2_Intron|RAD51L1_uc001xke.2_Intron|RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193	O15315	RA51B_HUMAN	RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		CATGTGAAAAttttttttttc	0.164			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					4	2	---	---	---	---	
SMOC1	64093	broad.mit.edu	37	14	70437087	70437087	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70437087delT	uc001xls.1	+						SMOC1_uc001xlt.1_Intron	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN	secreted modular calcium-binding protein 1						cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding			upper_aerodigestive_tract(1)|pancreas(1)	2				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		agtttcctcatttttgaagtg	0.219													4	2	---	---	---	---	
PAPLN	89932	broad.mit.edu	37	14	73717774	73717788	+	Intron	DEL	CCCTTCCTTGCCTGT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73717774_73717788delCCCTTCCTTGCCTGT	uc010ttx.1	+						PAPLN_uc001xnw.3_Intron|PAPLN_uc010arl.2_Intron|PAPLN_uc010ttw.1_Intron|PAPLN_uc010tty.1_Intron	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin							proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GTTGCCTGCCCCCTTCCTTGCCTGTCCCTTCCTTG	0.623													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	77525099	77525100	+	Intron	INS	-	A	A	rs79270224		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77525099_77525100insA	uc001xsz.2	-											Homo sapiens cDNA clone IMAGE:5271982.																		TGGCAAATTAGAAAAAAAAAAA	0.297													4	3	---	---	---	---	
TRAF3	7187	broad.mit.edu	37	14	103244934	103244935	+	Intron	INS	-	TGTG	TGTG	rs140127814	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103244934_103244935insTGTG	uc001ymc.1	+						TRAF3_uc001yme.1_Intron|TRAF3_uc001ymd.1_Intron|TRAF3_uc010txy.1_Intron	NM_145725	NP_663777	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3 isoform 1						apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		GTGTGTGTGCCTGTGTGTGTGT	0.431													2	4	---	---	---	---	
KIAA0125	9834	broad.mit.edu	37	14	106385222	106385222	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106385222delG	uc001ysq.2	+						ADAM6_uc010tyt.1_Intron|KIAA0125_uc001ysr.2_Intron|KIAA0125_uc001yss.2_Intron|KIAA0125_uc001yst.2_Intron					SubName: Full=HCG2029388, isoform CRA_d; SubName: Full=FAM30A protein;												0						GTGGGGTTCAGTGGGGACTCC	0.672													18	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20573457	20573457	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20573457delG								None (None upstream) : GOLGA6L6 (163637 downstream)																							cccaggggctgggggagaggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20861682	20861682	+	IGR	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20861682delC								GOLGA8C (80656 upstream) : BCL8 (8374 downstream)																							GCAGCTGATACCCATATTCTG	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20867625	20867628	+	IGR	DEL	GAGT	-	-	rs61049442		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20867625_20867628delGAGT								GOLGA8C (86599 upstream) : BCL8 (2428 downstream)																							AAGAAAATAAGAGTAAGTTTAATG	0.157													7	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	46663756	46663756	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46663756delG								SQRDL (680278 upstream) : SEMA6D (812647 downstream)																							aatgtagcatggggctagaCT	0.129													4	2	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	47827267	47827267	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47827267delA	uc001zvw.2	+							NM_020858	NP_065909	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AGAATGTGacaaaaaaaaaaa	0.264													4	5	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48002078	48002078	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48002078delA	uc001zvw.2	+							NM_020858	NP_065909	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AAAAACTGGCAAAAAAAAAAA	0.328													5	3	---	---	---	---	
ATP8B4	79895	broad.mit.edu	37	15	50212678	50212678	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50212678delA	uc001zxu.2	-						ATP8B4_uc010ber.2_Intron|ATP8B4_uc010ufd.1_Intron|ATP8B4_uc010ufe.1_Intron	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CAACAAAAATAATTGGTGAGA	0.378													31	20	---	---	---	---	
MYO5A	4644	broad.mit.edu	37	15	52635118	52635119	+	Intron	INS	-	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52635118_52635119insA	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010ugd.1_Intron|MYO5A_uc002abz.1_5'Flank|MYO5A_uc002aca.1_Intron|MYO5A_uc002acb.1_Intron|MYO5A_uc002acc.1_Intron	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		gtctaaaaaagaaaaaaaaaaa	0.144													4	4	---	---	---	---	
GCOM1	145781	broad.mit.edu	37	15	57975999	57975999	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57975999delT	uc002aei.2	+						GCOM1_uc002aej.2_Intron|GCOM1_uc002aek.2_Intron|GCOM1_uc002ael.2_Intron|GCOM1_uc002aem.2_Intron|GCOM1_uc002aeq.2_Intron|GCOM1_uc002aen.2_Intron|GCOM1_uc010bfy.2_Intron|GCOM1_uc002aeo.2_Intron|GCOM1_uc002aep.2_Intron|GCOM1_uc010bfx.2_Intron|GCOM1_uc002aer.1_Intron|GRINL1A_uc002aes.2_Intron	NM_001018100	NP_001018110	P0CAP1	GCOM1_HUMAN	GRINL1A upstream protein isoform 7						intracellular signal transduction	extrinsic to internal side of plasma membrane|I band				ovary(1)	1						ggggcctctcttttttttttt	0.000													4	2	---	---	---	---	
CLPX	10845	broad.mit.edu	37	15	65454599	65454600	+	Intron	INS	-	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65454599_65454600insA	uc002aom.2	-						CLPX_uc010uiu.1_Intron|CLPX_uc010bhg.1_Intron	NM_006660	NP_006651	O76031	CLPX_HUMAN	ClpX caseinolytic protease X homolog precursor						protein folding|proteolysis involved in cellular protein catabolic process	mitochondrial endopeptidase Clp complex|mitochondrial inner membrane|mitochondrial nucleoid	ATP binding|ATPase activity|metal ion binding|peptidase activator activity|unfolded protein binding				0						TTCATAAATACAAAAAAAACCA	0.416													4	2	---	---	---	---	
ANP32A	8125	broad.mit.edu	37	15	69102753	69102754	+	Intron	DEL	GT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69102753_69102754delGT	uc002arl.2	-							NM_006305	NP_006296	P39687	AN32A_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32						intracellular signal transduction|mRNA metabolic process|nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm	protein binding				0						aggatcatgagtgtgtgtgtgt	0.203													4	2	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	72040554	72040554	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72040554delT	uc002atb.1	+						THSD4_uc002ate.2_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						ttatttttagtttacaGTAGG	0.249													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	91977747	91977748	+	IGR	DEL	TG	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91977747_91977748delTG								SV2B (139099 upstream) : SLCO3A1 (419190 downstream)																							gttttgtgtatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93158012	93158020	+	IGR	DEL	GGTGGTGCC	-	-	rs111288397		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93158012_93158020delGGTGGTGCC								LOC100144604 (42519 upstream) : FAM174B (2661 downstream)																							tggtggtgctggtggtgccggtggtgcca	0.010													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	100094188	100094188	+	IGR	DEL	T	-	-	rs35607558		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100094188delT								LRRC28 (166908 upstream) : MEF2A (11945 downstream)																							CCATTTTGTCTAAGCAAGGAG	0.483													3	3	---	---	---	---	
XYLT1	64131	broad.mit.edu	37	16	17358023	17358024	+	Intron	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17358023_17358024insT	uc002dfa.2	-							NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						gtctctatggcttcttcattgt	0.064													4	2	---	---	---	---	
HS3ST4	9951	broad.mit.edu	37	16	25925504	25925505	+	Intron	DEL	GT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25925504_25925505delGT	uc002dof.2	+							NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		GGAGGGTATGgtgtgtgtgtgg	0.059													4	2	---	---	---	---	
NSMCE1	197370	broad.mit.edu	37	16	27249864	27249865	+	Intron	DEL	TT	-	-	rs71272473		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27249864_27249865delTT	uc002doi.1	-						NSMCE1_uc002doj.1_Intron	NM_145080	NP_659547	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog						DNA recombination|DNA repair|intracellular signal transduction	nucleus	zinc ion binding				0						GCCTTTTTTCTTTTTTTTTTTT	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28377218	28377218	+	5'Flank	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28377218delA	uc010vcr.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		attctgtttcaaaaaaaaaaa	0.244													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32851409	32851409	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32851409delA								TP53TG3B (162531 upstream) : SLC6A10P (37388 downstream)																							tgctgaggagagctttacttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33051594	33051595	+	IGR	INS	-	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33051594_33051595insG								SLC6A10P (155131 upstream) : MIR1826 (913913 downstream)																							ttcctttgattggtcctaattt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33941513	33941513	+	IGR	DEL	G	-	-	rs140215358		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33941513delG								None (None upstream) : MIR1826 (23995 downstream)																							GGTCTACAAAGCATTTGATTT	0.308													9	5	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58622984	58622985	+	Intron	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58622984_58622985insT	uc002env.2	-						CNOT1_uc002enw.2_Intron|CNOT1_uc002enu.3_Intron|CNOT1_uc002enx.2_Intron|CNOT1_uc002enz.1_Intron	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TTATAACTCAAtttttttttta	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60652584	60652585	+	IGR	DEL	AC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60652584_60652585delAC								None (None upstream) : None (None downstream)																							atcagctaatacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73364014	73364015	+	IGR	INS	-	GCAG	GCAG	rs149184529	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73364014_73364015insGCAG								HTA (236344 upstream) : PSMD7 (966666 downstream)																							AGTCAGTATGAGCAGGCGCTCC	0.535													3	3	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77359576	77359576	+	Intron	DEL	A	-	-	rs36036462		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77359576delA	uc002ffc.3	-						ADAMTS18_uc010chc.1_Intron|ADAMTS18_uc002ffe.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						TTATAGGGGGAAAAAAAAAAA	0.378													4	2	---	---	---	---	
CDH15	1013	broad.mit.edu	37	16	89254413	89254429	+	Intron	DEL	GGGTGGGAGGGGAGGGT	-	-	rs138367841		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89254413_89254429delGGGTGGGAGGGGAGGGT	uc002fmt.2	+							NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		GCAGGAGGGAGGGTGGGAGGGGAGGGTGGGCTGAGGG	0.645													9	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	8179724	8179726	+	IGR	DEL	AAC	-	-	rs142597246		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8179724_8179726delAAC								PFAS (5916 upstream) : SLC25A35 (11356 downstream)																							actctagaaaaacaacaatattt	0.103													7	4	---	---	---	---	
GAS7	8522	broad.mit.edu	37	17	10035622	10035623	+	Intron	INS	-	C	C	rs147679677	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10035622_10035623insC	uc002gmg.1	-							NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						TGGCACCTTCTCCCCTGAAGAA	0.446			T	MLL	AML*								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16502885	16502885	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16502885delT								ZNF287 (30365 upstream) : ZNF624 (21163 downstream)																							aagccttttgtttataaatta	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21233549	21233550	+	IGR	INS	-	ATCAGA	ATCAGA	rs71291786		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21233549_21233550insATCAGA								MAP2K3 (15000 upstream) : KCNJ12 (46149 downstream)																							gaggcaactagatcagaatcct	0.173													4	2	---	---	---	---	
NLK	51701	broad.mit.edu	37	17	26500329	26500329	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26500329delA	uc010crj.2	+						NLK_uc010cri.1_Intron	NM_016231	NP_057315	Q9UBE8	NLK_HUMAN	nemo like kinase						intracellular protein kinase cascade|negative regulation of Wnt receptor signaling pathway|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|serine phosphorylation of STAT3 protein|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|MAP kinase activity|SH2 domain binding|transcription factor binding|ubiquitin protein ligase binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		ATAAGACTTGAACAGGATGAC	0.363													4	2	---	---	---	---	
SUPT6H	6830	broad.mit.edu	37	17	27008731	27008732	+	Intron	DEL	AA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27008731_27008732delAA	uc002hby.2	+						SUPT6H_uc010crt.2_Intron	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog						chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					gctgtgtctcaaaaaaaaaaaa	0.208													6	3	---	---	---	---	
RHOT1	55288	broad.mit.edu	37	17	30470028	30470029	+	Intron	INS	-	C	C	rs149838766	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30470028_30470029insC	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron|RHOT1_uc002hgv.2_Intron	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				GTCCCTATTAGCCCTAACCGCC	0.629													4	2	---	---	---	---	
BRCA1	672	broad.mit.edu	37	17	41299026	41299026	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41299026delT	uc010whp.1	-						NBR2_uc002idh.2_Intron	NM_007298	NP_009229	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 4						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GCCTCATGGCttttttttttt	0.264			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51166566	51166567	+	IGR	INS	-	A	A			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51166566_51166567insA								CA10 (929189 upstream) : KIF2B (733672 downstream)																							aaagcttttagaaaaaaaagtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	53776878	53776878	+	IGR	DEL	T	-	-	rs76490471		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53776878delT								MMD (277537 upstream) : TMEM100 (20112 downstream)																							GCAGAATTGATTTTTTTTTCC	0.463													6	4	---	---	---	---	
BRIP1	83990	broad.mit.edu	37	17	59874666	59874666	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59874666delA	uc002izk.1	-							NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						aagaaatgataaaaaaaaatg	0.000			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	63322670	63322670	+	IGR	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63322670delC								RGS9 (98851 upstream) : AXIN2 (202015 downstream)																							agaacctgaaccaggtctcct	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72129027	72129027	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72129027delT								C17orf54 (304351 upstream) : RPL38 (70768 downstream)																							GATCCTGGGGTTTGCAGCTCC	0.403													4	2	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80867385	80867385	+	Intron	DEL	C	-	-	rs3841647		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80867385delC	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kgb.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TGTCACCTGGCCCACTGTGGG	0.642													10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	1711315	1711315	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1711315delT								C18orf2 (304134 upstream) : METTL4 (826210 downstream)																							AATTACTATGTTTAGGCGGAG	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22202411	22202412	+	IGR	DEL	GA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22202411_22202412delGA								HRH4 (142491 upstream) : ZNF521 (439476 downstream)																							tacatttgctgaggagagtttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22280037	22280037	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22280037delT								HRH4 (220117 upstream) : ZNF521 (361851 downstream)																							GCCTTGCGGCTTTAGTACCAG	0.507													4	2	---	---	---	---	
KLHL14	57565	broad.mit.edu	37	18	30280343	30280343	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30280343delA	uc002kxm.1	-						KLHL14_uc010dmd.1_Intron	NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14							cytosol|endoplasmic reticulum membrane				ovary(1)	1						ATACAATCTTAAAAAAAAAGG	0.363													4	2	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	34915446	34915449	+	Intron	DEL	GTGT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34915446_34915449delGTGT	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						agtgcatgcagtgtgtgtgtgtgt	0.157											OREG0024928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49083366	49083366	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49083366delT	uc010xdq.1	+											Homo sapiens cDNA FLJ37617 fis, clone BRCOC2012229.																		tttgaggggattttttttttt	0.000													4	2	---	---	---	---	
TCF4	6925	broad.mit.edu	37	18	53038788	53038788	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53038788delT	uc002lfz.2	-						TCF4_uc010xdu.1_Intron|TCF4_uc010xdv.1_Intron|TCF4_uc002lfx.2_Intron|TCF4_uc010xdw.1_Intron|TCF4_uc002lfy.2_Intron|TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc010dpi.2_Intron|TCF4_uc002lgc.3_Intron	NM_003199	NP_003190	P15884	ITF2_HUMAN	transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		cattcacttatttttttttaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	56835677	56835677	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56835677delT								SEC11C (9616 upstream) : GRP (51723 downstream)																							tgaaagaaagttttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60082857	60082857	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60082857delA								TNFRSF11A (29355 upstream) : ZCCHC2 (107801 downstream)																							CTCTTCCCCTAAGTGTTTCTG	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	71438904	71438905	+	IGR	INS	-	A	A	rs150317580	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71438904_71438905insA								NETO1 (904094 upstream) : FBXO15 (301683 downstream)																							TAGCACGAAAGAAAAAAAAAAG	0.406													3	3	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4209930	4209932	+	Intron	DEL	GCT	-	-	rs66925038		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4209930_4209932delGCT	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGAGGCAGGGGCTGCTGGTTCCA	0.586													9	4	---	---	---	---	
FCER2	2208	broad.mit.edu	37	19	7762654	7762655	+	Intron	DEL	TA	-	-	rs151220343		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7762654_7762655delTA	uc002mhn.2	-						FCER2_uc010xjs.1_Intron|FCER2_uc010xjt.1_Intron|FCER2_uc002mhm.2_Intron|FCER2_uc010dvo.2_Intron	NM_002002	NP_001993	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor						positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding				0						TATAATGAACTACTGTGTACCT	0.426													8	4	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17757078	17757079	+	Intron	INS	-	TGTT	TGTT	rs142508123	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17757078_17757079insTGTT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						Ggttttttgtgtgtttgtttgt	0.272													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20441860	20441860	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20441860delT								LOC284441 (71357 upstream) : ZNF826 (9218 downstream)																							ATTCATGttattttttttttt	0.164													3	4	---	---	---	---	
ZNF100	163227	broad.mit.edu	37	19	21940836	21940836	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21940836delA	uc002nqi.2	-							NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						acactgtcttaaaaaaaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24560226	24560226	+	IGR	DEL	G	-	-	rs74182437		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24560226delG								LOC100101266 (213977 upstream) : None (None downstream)																							cttttcttttgactgagcagt	0.000													3	3	---	---	---	---	
GRAMD1A	57655	broad.mit.edu	37	19	35485015	35485017	+	5'Flank	DEL	TAC	-	-	rs72324814		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35485015_35485017delTAC	uc002nxi.1	+							NM_020895	NP_065946	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A isoform 1							integral to membrane					0	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			ccttggggaatactaccagcttt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37033757	37033757	+	IGR	DEL	A	-	-	rs111369761		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37033757delA								ZNF260 (14587 upstream) : ZNF529 (761 downstream)																							agttgcaggcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41073446	41073451	+	Intron	DEL	CTTTTT	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41073446_41073451delCTTTTT	uc002ony.2	+						SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGACACCTTGCTTTTTCAAGGAACTG	0.539													4	2	---	---	---	---	
ARHGEF1	9138	broad.mit.edu	37	19	42423665	42423666	+	Intron	DEL	AC	-	-	rs72008716		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42423665_42423666delAC	uc002osc.2	+									Q92888	ARHG1_HUMAN	SubName: Full=ARHGEF1 protein; SubName: Full=Rho guanine nucleotide exchange factor (GEF) 1, isoform CRA_g;						cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GTGCACGCGTacacacacacac	0.455													4	2	---	---	---	---	
ZC3H4	23211	broad.mit.edu	37	19	47571148	47571148	+	Intron	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47571148delG	uc002pga.3	-						ZC3H4_uc002pgb.1_Intron	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4								nucleic acid binding|zinc ion binding			skin(4)|ovary(2)	6		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		CAGAGGAGCAGGGAGGGGTGA	0.587													4	2	---	---	---	---	
SPHK2	56848	broad.mit.edu	37	19	49124033	49124034	+	Intron	INS	-	GG	GG			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49124033_49124034insGG	uc002pjr.2	+						RPL18_uc002pjp.1_5'Flank|RPL18_uc002pjq.1_5'Flank|RPL18_uc010xzs.1_5'Flank|SPHK2_uc010xzt.1_Intron|SPHK2_uc002pjs.2_Intron|SPHK2_uc002pjt.2_Intron	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		atacaaaaattagccaggcatg	0.000													4	2	---	---	---	---	
FCGRT	2217	broad.mit.edu	37	19	50016971	50016972	+	Intron	INS	-	TCTCTCTCTC	TCTCTCTCTC	rs139316391	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50016971_50016972insTCTCTCTCTC	uc002poe.2	+						FCGRT_uc002pod.2_Intron|FCGRT_uc002pog.2_Intron|FCGRT_uc002pof.1_5'UTR|FCGRT_uc010yax.1_Intron|FCGRT_uc002poh.1_5'Flank	NM_001136019	NP_001129491	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha						antigen processing and presentation|female pregnancy|immune response	integral to membrane|MHC class I protein complex	IgG binding|receptor activity			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		tgggtctcttgtctctctctct	0.208													9	5	---	---	---	---	
RCN3	57333	broad.mit.edu	37	19	50046226	50046227	+	Intron	INS	-	AG	AG	rs140477388	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50046226_50046227insAG	uc002poj.2	+							NM_020650	NP_065701	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain							endoplasmic reticulum lumen	calcium ion binding|protein binding			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		gggaccaagacggggacagatt	0.213													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	7746865	7746867	+	IGR	DEL	CAA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7746865_7746867delCAA								BMP2 (985955 upstream) : HAO1 (116764 downstream)																							tgacaaaaggcaacaacaacaac	0.000													4	2	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8814320	8814320	+	Intron	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8814320delC	uc002wnb.2	+						PLCB1_uc002wna.2_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						aggagtgtggccctgctgaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	8917496	8917496	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8917496delT								PLCB1 (51951 upstream) : PLCB4 (132205 downstream)																							TTTTCTTTTCTTTTTTTTTTT	0.388													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12680130	12680130	+	IGR	DEL	C	-	-	rs17226077		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12680130delC								BTBD3 (772888 upstream) : SPTLC3 (309497 downstream)																							AGACTGGAAACAGATTCTAAG	0.289													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29635994	29635994	+	Intron	DEL	A	-	-	rs149967851		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29635994delA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TAACCAAAGGAAAAGCTCCCT	0.149													6	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29636110	29636111	+	Intron	INS	-	TTG	TTG	rs71163345		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29636110_29636111insTTG	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						aacacaactgattattttaatt	0.045													3	3	---	---	---	---	
TPX2	22974	broad.mit.edu	37	20	30348186	30348186	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30348186delT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			TAACATAGAAttttttttttt	0.139													4	3	---	---	---	---	
RBM39	9584	broad.mit.edu	37	20	34301240	34301240	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34301240delT	uc002xeb.2	-						RBM39_uc002xdz.2_Intron|RBM39_uc002xea.2_Intron|RBM39_uc010gfn.2_Intron|RBM39_uc010zvm.1_Intron|RBM39_uc002xeg.2_Intron|RBM39_uc002xec.2_Intron|RBM39_uc002xed.2_Intron|RBM39_uc002xee.2_Intron|RBM39_uc002xef.2_Intron|RBM39_uc010zvn.1_Intron	NM_184234	NP_909122	Q14498	RBM39_HUMAN	RNA binding motif protein 39 isoform a						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	centrosome|nuclear speck	nucleotide binding|protein binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					tgaaactctcttttttttttg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37701736	37701736	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37701736delT								DHX35 (33373 upstream) : LOC339568 (140688 downstream)																							TTCATAAAGATTTTtttttta	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38305257	38305258	+	IGR	INS	-	AC	AC	rs147573310	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38305257_38305258insAC								LOC339568 (451866 upstream) : None (None downstream)																							CTTTCCAACTGacacacacaca	0.173													4	2	---	---	---	---	
ZNF335	63925	broad.mit.edu	37	20	44586695	44586695	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44586695delT	uc002xqw.2	-						ZNF335_uc010zxk.1_Intron	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				accacttttcttttttttttt	0.075													4	2	---	---	---	---	
TMEM189	387521	broad.mit.edu	37	20	48741400	48741400	+	3'UTR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48741400delA	uc002xvg.2	-	6					TMEM189-UBE2V1_uc002xvf.2_Intron|TMEM189_uc010zyq.1_RNA|TMEM189_uc010gif.2_3'UTR|TMEM189_uc010zyp.1_3'UTR	NM_199129	NP_954580	A5PLL7	TM189_HUMAN	transmembrane protein 189 isoform 1							endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(9;3.02e-07)			GGGGCCGAGGAAAAAAAAAAA	0.547													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	51480593	51480593	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51480593delA								ZFP64 (672069 upstream) : TSHZ2 (108284 downstream)																							ATCAACATCTAGCACATAATA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54412113	54412113	+	IGR	DEL	G	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54412113delG								None (None upstream) : CBLN4 (160384 downstream)																							CTCAAATCCTGGGCCATTAAC	0.294													4	2	---	---	---	---	
CASS4	57091	broad.mit.edu	37	20	55001150	55001150	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55001150delA	uc002xxp.2	+						CASS4_uc002xxq.3_Intron|CASS4_uc002xxr.2_Intron|CASS4_uc010zze.1_Intron|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a						cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						TGTATCTGCTAAGATGTCCAC	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10734267	10734268	+	IGR	INS	-	A	A	rs148376367		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10734267_10734268insA								None (None upstream) : TPTE (172475 downstream)																							actatcaaaagaaaggtttaac	0.000													5	3	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10913230	10913231	+	Intron	DEL	AC	-	-	rs111503636		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10913230_10913231delAC	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGCATAATCAACAGAGATTGAT	0.455													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11050665	11050666	+	Intron	DEL	TT	-	-	rs145256306		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11050665_11050666delTT	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTAtttttcctttttttttttt	0.124													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11059163	11059163	+	Intron	DEL	G	-	-	rs141258961		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11059163delG	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATCTCTCTGTGGGAAATGACT	0.368													6	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11066363	11066363	+	Intron	DEL	T	-	-	rs151040810		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11066363delT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		agaggttaaatttccttgttc	0.060													4	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11087107	11087108	+	Intron	INS	-	A	A	rs147866849		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11087107_11087108insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gactccatctcaaaaaaaaatt	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11094184	11094184	+	Intron	DEL	G	-	-	rs2775396		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11094184delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTTTTATAAAGATAACTACCT	0.393													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11155113	11155113	+	IGR	DEL	A	-	-	rs149249762		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11155113delA								BAGE (56176 upstream) : None (None downstream)																							TGTAGATCTGAAAAAAAATGA	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11178962	11178965	+	IGR	DEL	AAAG	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11178962_11178965delAAAG								BAGE (80025 upstream) : None (None downstream)																							ctgtattcttaaagaaagagaaaa	0.000													4	2	---	---	---	---	
TMPRSS15	5651	broad.mit.edu	37	21	19731869	19731870	+	Intron	DEL	AA	-	-	rs77477929		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19731869_19731870delAA	uc002ykw.2	-							NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						AGGAGAGGACAATGTTAAAACG	0.233													3	4	---	---	---	---	
KRTAP13-2	337959	broad.mit.edu	37	21	31744777	31744777	+	5'Flank	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31744777delT	uc002ynz.3	-							NM_181621	NP_853652	Q52LG2	KR132_HUMAN	keratin associated protein 13-2							intermediate filament					0						AGCCACTCAGTTTTTTTTTTT	0.333													4	2	---	---	---	---	
HLCS	3141	broad.mit.edu	37	21	38278001	38278002	+	Intron	INS	-	G	G			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38278001_38278002insG	uc010gnb.2	-						HLCS_uc002yvs.2_Intron	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase						cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	aaggaatcttaaaaaaaaaaat	0.124													4	2	---	---	---	---	
IGSF5	150084	broad.mit.edu	37	21	41142758	41142758	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41142758delA	uc002yyo.2	+							NM_001080444	NP_001073913	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily 5 like							integral to membrane|tight junction					0		Prostate(19;5.35e-06)				AGCAAAACTTaaaaaaaaaaa	0.333													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42456632	42456632	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42456632delT								DSCAM (237593 upstream) : C21orf130 (56795 downstream)																							CTTTTTTCCCTTTTCATCTCA	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	18883954	18883954	+	IGR	DEL	G	-	-	rs62232330		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18883954delG								GGT3P (90962 upstream) : DGCR6 (9587 downstream)																							tttaaaggaagaaaaatttca	0.000													3	4	---	---	---	---	
C22orf28	51493	broad.mit.edu	37	22	32791930	32791930	+	Intron	DEL	C	-	-	rs67901881		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32791930delC	uc003amm.2	-							NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493						cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						ttgtgatccgccccccctcgg	0.075													3	4	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	32997812	32997812	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32997812delA	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						GTGGTGACTGAAGGGCCAGGG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	44714164	44714164	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44714164delT								KIAA1644 (5433 upstream) : LDOC1L (174286 downstream)																							GTAAATGGTATTATGGAAGTC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48024693	48024694	+	5'Flank	DEL	GA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48024693_48024694delGA	uc003bik.1	+						uc003bii.2_Intron|uc011ard.1_Intron|uc011are.1_Intron|uc003bij.2_5'Flank					Homo sapiens cDNA FLJ35788 fis, clone TESTI2005683.																		gggagtgtgtgagagtgtgtgg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	51082538	51082541	+	IGR	DEL	CTTA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51082538_51082541delCTTA								ARSA (15931 upstream) : SHANK3 (30529 downstream)																							ctgcgctgatcttacttaggagca	0.034													3	3	---	---	---	---	
ASMT	438	broad.mit.edu	37	X	1749037	1749038	+	Intron	INS	-	T	T			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1749037_1749038insT	uc004cqd.2	+						ASMT_uc010ncy.2_Intron|ASMT_uc004cqe.2_Intron	NM_004043	NP_004034	P46597	HIOM_HUMAN	acetylserotonin O-methyltransferase						melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity			skin(1)	1		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				tttttcttttctttttttaaga	0.000													9	4	---	---	---	---	
ARSD	414	broad.mit.edu	37	X	2840278	2840279	+	Intron	DEL	CA	-	-	rs113934022		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2840278_2840279delCA	uc004cqy.2	-						ARSD_uc004cqz.1_Intron|ARSD_uc004cra.1_Intron|ARSD_uc004crb.3_Intron	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor							lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ctctctctctcacacacacaca	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	11104681	11104682	+	Intron	DEL	TC	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11104681_11104682delTC	uc004cuh.2	-						uc004cui.1_Intron					Homo sapiens clone IMAGE:4081578, mRNA sequence.																		tttgctttgttctctctctctc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	40480324	40480324	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40480324delT								ATP6AP2 (14437 upstream) : CXorf38 (7961 downstream)																							ATGTCCAAAGttttttttttc	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	63724276	63724276	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63724276delA								MTMR8 (108965 upstream) : ZC4H2 (411986 downstream)																							cctaccaatgaaaaaaaagcc	0.000													4	2	---	---	---	---	
DACH2	117154	broad.mit.edu	37	X	85862363	85862363	+	Intron	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85862363delT	uc004eew.2	+						DACH2_uc004eex.2_Intron|DACH2_uc010nmq.2_Intron|DACH2_uc011mra.1_Intron|DACH2_uc010nmr.2_Intron	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						tgttgtcatattttttggttt	0.000													4	2	---	---	---	---	
PCDH19	57526	broad.mit.edu	37	X	99551562	99551562	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99551562delC	uc010nmz.2	-	6	4836	c.3160delG	c.(3160-3162)GAGfs	p.E1054fs	PCDH19_uc004efw.3_Frame_Shift_Del_p.E1006fs|PCDH19_uc004efx.3_Frame_Shift_Del_p.E1007fs	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	1054	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						TTGCCTGCCTCCCGGATAACG	0.597													50	28	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	102504575	102504597	+	IGR	DEL	ATGATGATGACGATGACGCTGAC	-	-	rs57029375		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102504575_102504597delATGATGATGACGATGACGCTGAC								BEX4 (32455 upstream) : TCEAL8 (3327 downstream)																							tgacgctgagatgatgatgacgatgacgctgacataatgatga	0.126													4	4	---	---	---	---	
NRK	203447	broad.mit.edu	37	X	105144878	105144878	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105144878delA	uc004emd.2	+						NRK_uc010npc.1_Intron	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase								ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GTGGGTATATAAATCAGCTTG	0.383										HNSCC(51;0.14)			13	10	---	---	---	---	
CXorf56	63932	broad.mit.edu	37	X	118679154	118679155	+	Intron	INS	-	A	A	rs143469981		TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118679154_118679155insA	uc004erk.1	-						CXorf56_uc004erj.1_Intron|CXorf56_uc011mtu.1_Intron	NM_022101	NP_071384	Q9H5V9	CX056_HUMAN	hypothetical protein LOC63932								protein binding				0						ctgtctctactaaaatacaaaa	0.000													3	5	---	---	---	---	
AKAP14	158798	broad.mit.edu	37	X	119047385	119047385	+	Intron	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119047385delA	uc004ese.2	+						AKAP14_uc004esf.2_Intron	NM_178813	NP_848928	Q86UN6	AKA28_HUMAN	A kinase (PRKA) anchor protein 14 isoform a							cytoplasm					0						CAATTAATTGAACCTGCCTCC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	121637121	121637121	+	IGR	DEL	C	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:121637121delC								None (None upstream) : GRIA3 (680975 downstream)																							tggtacagtgccttcacatag	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	125487275	125487275	+	IGR	DEL	G	-	-	rs1773590	by1000genomes	TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125487275delG								DCAF12L2 (187341 upstream) : DCAF12L1 (196093 downstream)																							TACTTTTTTTGTTTTTCTGTG	0.373													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	136243236	136243237	+	IGR	DEL	GA	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136243236_136243237delGA								GPR101 (129403 upstream) : ZIC3 (405109 downstream)																							CTTTGCTTTTGACAGCATGTTT	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	147032931	147032931	+	IGR	DEL	A	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147032931delA								FMR1 (292 upstream) : FMR1NB (29918 downstream)																							TCTATGAAGTAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13444848	13444848	+	IGR	DEL	T	-	-			TCGA-B0-5693-01A-11D-1534-10	TCGA-B0-5693-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13444848delT								None (None upstream) : None (None downstream)																							CTAGGCAGTATTTTTAGTGCA	0.303													5	3	---	---	---	---	
