Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TP73	7161	broad.mit.edu	37	1	3599704	3599704	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3599704T>C	uc001akp.2	+	3	256	c.146T>C	c.(145-147)ATG>ACG	p.M49T	TP73_uc001akq.2_Missense_Mutation_p.M49T	NM_005427	NP_005418	O15350	P73_HUMAN	tumor protein p73 isoform a	49	Asp/Glu-rich (acidic).				cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mismatch repair|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of JUN kinase activity|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|protein tetramerization|response to gamma radiation|response to X-ray	chromatin|cytosol|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|metal ion binding|p53 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|transcription repressor activity			ovary(1)|lung(1)	2	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		GATTCCAGCATGGACGTCTTC	0.587													21	60	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10412718	10412718	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10412718G>A	uc001aqx.3	+	38	4181	c.3979G>A	c.(3979-3981)GAA>AAA	p.E1327K	KIF1B_uc001aqw.3_Missense_Mutation_p.E1281K|KIF1B_uc001aqy.2_Missense_Mutation_p.E1301K|KIF1B_uc001aqz.2_Missense_Mutation_p.E1327K|KIF1B_uc001ara.2_Missense_Mutation_p.E1287K|KIF1B_uc001arb.2_Missense_Mutation_p.E1313K	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1327					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TGAGGTGGATGAAGCTGCAGT	0.423													149	291	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12313812	12313812	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12313812G>A	uc001atv.2	+	7	739	c.598G>A	c.(598-600)GTA>ATA	p.V200I	VPS13D_uc001atw.2_Missense_Mutation_p.V200I	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	200					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCAATTAGACGTAGCAGAATT	0.378													4	219	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16260060	16260060	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16260060A>T	uc001axk.1	+	11	7529	c.7325A>T	c.(7324-7326)GAG>GTG	p.E2442V	SPEN_uc010obp.1_Missense_Mutation_p.E2401V	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2442	RID.|Interaction with MSX2 (By similarity).|Pro-rich.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCGGTGGATGAGGAGCCTCAA	0.567													23	34	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39806216	39806216	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39806216C>G	uc010oiu.1	+	3	5709	c.5578C>G	c.(5578-5580)CAG>GAG	p.Q1860E	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3425					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTTGGTCAGTCAGGAGCTGGA	0.438													5	116	---	---	---	---	PASS
HSD3B1	3283	broad.mit.edu	37	1	120050234	120050234	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120050234G>C	uc001ehv.1	+	2	280	c.135G>C	c.(133-135)GAG>GAC	p.E45D	HSD3B1_uc001ehw.2_Missense_Mutation_p.E47D	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1	45					androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	AATTGAGAGAGGAATTTTCTA	0.483													86	150	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145323667	145323667	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145323667C>G	uc001end.3	+	29	3764	c.3729C>G	c.(3727-3729)GAC>GAG	p.D1243E	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oym.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyo.1_Intron|NBPF10_uc010oyp.1_5'Flank	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	1168											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TTAAAAAGGACGAAGAAGAGG	0.468													3	10	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285414	152285414	+	Missense_Mutation	SNP	G	T	T	rs149119521		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285414G>T	uc001ezu.1	-	3	1984	c.1948C>A	c.(1948-1950)CAG>AAG	p.Q650K	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	650	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTGCTCCTGAGCAGATCCA	0.557									Ichthyosis				8	142	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155629401	155629401	+	3'UTR	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155629401G>A	uc001fln.2	-	11					YY1AP1_uc001flg.2_3'UTR|YY1AP1_uc010pgg.1_3'UTR|YY1AP1_uc010pgh.1_3'UTR|YY1AP1_uc010pgi.1_3'UTR|YY1AP1_uc001flh.2_3'UTR|YY1AP1_uc009wqt.2_3'UTR|YY1AP1_uc001flk.2_3'UTR|YY1AP1_uc001fll.2_3'UTR|YY1AP1_uc009wqv.2_3'UTR|YY1AP1_uc001flm.2_3'UTR|YY1AP1_uc001fli.2_3'UTR|YY1AP1_uc009wqu.2_3'UTR|YY1AP1_uc001flj.2_3'UTR|YY1AP1_uc009wqw.2_3'UTR|YY1AP1_uc001flo.2_3'UTR|YY1AP1_uc001flp.2_3'UTR	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2						regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					ccaccaatcggaggccgaagt	0.184													4	46	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160788020	160788020	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160788020A>G	uc001fwu.2	+	6	1405	c.1355A>G	c.(1354-1356)AAC>AGC	p.N452S	LY9_uc001fwv.2_Missense_Mutation_p.N452S|LY9_uc001fww.2_Missense_Mutation_p.N362S|LY9_uc001fwx.2_Missense_Mutation_p.N362S|LY9_uc001fwy.1_Missense_Mutation_p.N264S|LY9_uc001fwz.2_Missense_Mutation_p.N104S	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	452	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CCTGAGAGAAACACAAAGCTT	0.458													7	364	---	---	---	---	PASS
CACYBP	27101	broad.mit.edu	37	1	174973753	174973753	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174973753C>T	uc001gkj.1	+	2	444	c.19C>T	c.(19-21)CAG>TAG	p.Q7*	CACYBP_uc001gki.1_5'UTR|CACYBP_uc010pmw.1_Nonsense_Mutation_p.Q7*	NM_014412	NP_055227	Q9HB71	CYBP_HUMAN	calcyclin binding protein isoform 1	7	Interaction with SIAH1.					beta-catenin destruction complex	protein homodimerization activity				0						AACACAGCTACAGAAAGATCT	0.358													26	125	---	---	---	---	PASS
C1orf107	27042	broad.mit.edu	37	1	210016905	210016905	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210016905T>C	uc001hhr.1	+	11	1967	c.1891T>C	c.(1891-1893)TTC>CTC	p.F631L	C1orf107_uc009xcu.1_Missense_Mutation_p.F346L	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN	digestive-organ expansion factor homolog	631					multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)		TCGAAATTACTTCAAGAAGGA	0.448													5	142	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220154791	220154791	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220154791G>C	uc001hly.1	-	24	3652	c.3382C>G	c.(3382-3384)CCT>GCT	p.P1128A		NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	1128	Prolyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	GCATATGCAGGATACATTACT	0.408													6	188	---	---	---	---	PASS
C1orf101	257044	broad.mit.edu	37	1	244780957	244780957	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244780957T>C	uc001iam.2	+	20	2676	c.2617T>C	c.(2617-2619)TTT>CTT	p.F873L	C1orf101_uc001ial.2_Intron|C1orf101_uc010pym.1_Missense_Mutation_p.F722L|C1orf101_uc010pyn.1_Missense_Mutation_p.F806L	NM_001130957	NP_001124429	Q5SY80	CA101_HUMAN	hypothetical protein LOC257044 isoform 1	873	Extracellular (Potential).					integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			AATGTATGTATTTCGTGTGAA	0.328													7	416	---	---	---	---	PASS
PRKCE	5581	broad.mit.edu	37	2	46313413	46313413	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46313413C>T	uc002rut.2	+	11	1701	c.1504C>T	c.(1504-1506)CGA>TGA	p.R502*		NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon	502	Protein kinase.				activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			TCAGCGCTCCCGAAAATTCGA	0.493													5	181	---	---	---	---	PASS
PAPOLG	64895	broad.mit.edu	37	2	61019416	61019416	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61019416A>T	uc002sai.2	+	17	1902	c.1671A>T	c.(1669-1671)GAA>GAT	p.E557D	PAPOLG_uc002saj.2_Missense_Mutation_p.E246D|PAPOLG_uc002sak.2_Missense_Mutation_p.E92D|PAPOLG_uc010fch.2_Missense_Mutation_p.E246D	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	557					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			CTGTAGGAGAAACAGAAAGGT	0.398													37	54	---	---	---	---	PASS
ST3GAL5	8869	broad.mit.edu	37	2	86071563	86071563	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86071563G>C	uc002sqq.1	-	6	1093	c.964C>G	c.(964-966)CTT>GTT	p.L322V	ST3GAL5_uc010fgq.1_Intron|ST3GAL5_uc002sqp.1_Missense_Mutation_p.L299V	NM_003896	NP_003887	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	322	Lumenal (Potential).				ganglioside biosynthetic process|protein glycosylation	integral to Golgi membrane|integral to plasma membrane	lactosylceramide alpha-2,3-sialyltransferase activity|neolactotetraosylceramide alpha-2,3-sialyltransferase activity				0						GAGTACTGAAGGATGTCAAAG	0.433													92	165	---	---	---	---	PASS
PLGLB2	5342	broad.mit.edu	37	2	87238234	87238234	+	3'UTR	SNP	C	A	A	rs141931224	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87238234C>A	uc002ssd.2	-	4					RMND5A_uc002srs.3_Intron|RGPD1_uc010fgv.2_Intron|RGPD1_uc002ssb.2_Intron|RGPD1_uc002ssc.2_Intron	NM_002665	NP_002656	Q02325	PLGB_HUMAN	plasminogen-like B2 precursor							extracellular region					0						CAGTAGTCATCTCTCTGTTCT	0.498													3	31	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97784153	97784153	+	Missense_Mutation	SNP	T	G	G	rs140488641	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97784153T>G	uc010yva.1	+	3	629	c.385T>G	c.(385-387)TTC>GTC	p.F129V	ANKRD36_uc002sxn.2_Missense_Mutation_p.F129V|ANKRD36_uc010yuz.1_RNA|ANKRD36_uc010fic.2_Translation_Start_Site|ANKRD36_uc002sxo.2_Missense_Mutation_p.F129V|ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	129											0						TATTACGGATTTCTTTGGAAG	0.418													5	82	---	---	---	---	PASS
RAB3GAP1	22930	broad.mit.edu	37	2	135926271	135926271	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135926271C>A	uc002tuj.2	+	24	2891	c.2866C>A	c.(2866-2868)CCT>ACT	p.P956T	RAB3GAP1_uc010fnf.2_Missense_Mutation_p.P963T|RAB3GAP1_uc010fng.2_Missense_Mutation_p.P781T|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	956						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		CAAAGCTCTGCCTCAGCGGAT	0.517													37	70	---	---	---	---	PASS
NR4A2	4929	broad.mit.edu	37	2	157182297	157182297	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157182297C>T	uc002tyz.3	-	8	2178	c.1756G>A	c.(1756-1758)GCA>ACA	p.A586T	NR4A2_uc002tyx.3_Missense_Mutation_p.A523T|NR4A2_uc010zcf.1_Missense_Mutation_p.A586T	NM_006186	NP_006177	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	586					cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						TCAATTATTGCTGGCGGTGGC	0.478													4	170	---	---	---	---	PASS
MYO1B	4430	broad.mit.edu	37	2	192288741	192288741	+	3'UTR	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192288741G>A	uc010fsg.2	+	31					MYO1B_uc002usq.2_3'UTR|MYO1B_uc002usr.2_3'UTR|MYO1B_uc002usu.2_3'UTR|MYO1B_uc002usv.2_3'UTR	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			GTGCAATTTGGTTTTGTTTTA	0.343													18	39	---	---	---	---	PASS
ATIC	471	broad.mit.edu	37	2	216211658	216211658	+	Silent	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216211658T>C	uc002vex.3	+	14	1671	c.1497T>C	c.(1495-1497)ATT>ATC	p.I499I	ATIC_uc010zjo.1_Silent_p.I440I|ATIC_uc002vey.3_Silent_p.I498I	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide	499					IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	CTGGAACCATTGGCGAGGTGA	0.418			T	ALK	ALCL								77	127	---	---	---	---	PASS
BCS1L	617	broad.mit.edu	37	2	219526609	219526609	+	Silent	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219526609T>C	uc002vio.2	+	4	1006	c.588T>C	c.(586-588)GGT>GGC	p.G196G	ZNF142_uc002vin.2_5'Flank|ZNF142_uc010fvt.2_5'Flank|ZNF142_uc002vim.2_5'Flank|BCS1L_uc002vip.2_Silent_p.G196G|BCS1L_uc002viq.2_Silent_p.G196G|BCS1L_uc010fvu.2_Silent_p.G196G|BCS1L_uc010fvv.2_Silent_p.G196G|BCS1L_uc002vir.2_Silent_p.G196G|BCS1L_uc002vis.2_Silent_p.G196G	NM_004328	NP_004319	Q9Y276	BCS1_HUMAN	BCS1-like	196	Mitochondrial matrix (Potential).				mitochondrial respiratory chain complex I assembly|mitochondrial respiratory chain complex III assembly|mitochondrial respiratory chain complex IV assembly	integral to membrane|mitochondrial respiratory chain complex III	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TACAACAGGGTCTGGCTGACC	0.547													4	69	---	---	---	---	PASS
PSMD1	5707	broad.mit.edu	37	2	231944857	231944857	+	Silent	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231944857T>C	uc002vrn.1	+	12	1373	c.1242T>C	c.(1240-1242)GGT>GGC	p.G414G	PSMD1_uc002vrm.1_Silent_p.G414G|PSMD1_uc010fxu.1_Silent_p.G278G	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1	414	PC 1.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	CTTTACAGGGTCATGAAAAAG	0.393													5	137	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191482	10191482	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191482A>T	uc003bvc.2	+	3	688	c.475A>T	c.(475-477)AAA>TAA	p.K159*	VHL_uc003bvd.2_Nonsense_Mutation_p.K118*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	159	Interaction with Elongin BC complex.		K -> E (in VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.T157_K159del(1)|p.L158_K159del(1)|p.L158fs*6(1)|p.K159fs*13(1)|p.Y156*(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTATACTCTGAAAGAGCGATG	0.507		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				38	38	---	---	---	---	PASS
IP6K2	51447	broad.mit.edu	37	3	48732607	48732607	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48732607G>T	uc003cup.2	-	2	362	c.118C>A	c.(118-120)CTG>ATG	p.L40M	IP6K2_uc003cuq.2_Missense_Mutation_p.L40M|IP6K2_uc011bbq.1_Missense_Mutation_p.L40M|IP6K2_uc011bbr.1_Missense_Mutation_p.L40M|IP6K2_uc003cur.2_Missense_Mutation_p.L40M|IP6K2_uc003cus.2_Missense_Mutation_p.L40M|IP6K2_uc003cut.2_RNA|IP6K2_uc011bbs.1_RNA|IP6K2_uc011bbt.1_Missense_Mutation_p.L95M|IP6K2_uc003cuv.1_3'UTR|IP6K2_uc011bbu.1_Missense_Mutation_p.L94M|IP6K2_uc011bbv.1_Missense_Mutation_p.L98M|IP6K2_uc003cuw.1_3'UTR	NM_001005909	NP_001005909	Q9UHH9	IP6K2_HUMAN	inositol hexaphosphate kinase 2 isoform a	40					negative regulation of cell growth|phosphatidylinositol phosphorylation|positive regulation of apoptosis|type I interferon-mediated signaling pathway	intermediate filament cytoskeleton|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity				0						GGCTTGCACAGGGTTGTCTCA	0.597													27	22	---	---	---	---	PASS
CD96	10225	broad.mit.edu	37	3	111297880	111297880	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111297880A>G	uc003dxw.2	+	5	768	c.598A>G	c.(598-600)AAT>GAT	p.N200D	CD96_uc003dxv.2_Missense_Mutation_p.N184D|CD96_uc003dxx.2_Missense_Mutation_p.N184D|CD96_uc010hpy.1_Missense_Mutation_p.N184D	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	200	Extracellular (Potential).|Ig-like V-type 2.				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						CCAGGAGGATAATGGAACTCA	0.244									Opitz_Trigonocephaly_syndrome				4	106	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160219837	160219837	+	3'UTR	SNP	C	T	T	rs139516169	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160219837C>T	uc003fdn.2	-	17						NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			tacacacacacatatatatat	0.303													3	10	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160219839	160219839	+	3'UTR	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160219839T>C	uc003fdn.2	-	17						NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			cacacacacatatatatatat	0.313													3	10	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180325584	180325584	+	Intron	SNP	T	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180325584T>G	uc003fkk.2	+						TTC14_uc003fkl.2_3'UTR|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a								RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AGAAATTTAGTGATATTTGAA	0.308													6	202	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184043719	184043719	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184043719C>T	uc003fnp.2	+	21	3400	c.3202C>T	c.(3202-3204)CGA>TGA	p.R1068*	EIF4G1_uc003fnt.2_Nonsense_Mutation_p.R779*|EIF4G1_uc003fnq.2_Nonsense_Mutation_p.R981*|EIF4G1_uc003fnr.2_Nonsense_Mutation_p.R904*|EIF4G1_uc010hxx.2_Nonsense_Mutation_p.R1075*|EIF4G1_uc003fns.2_Nonsense_Mutation_p.R1028*|EIF4G1_uc010hxy.2_Nonsense_Mutation_p.R1075*|EIF4G1_uc003fnv.3_Nonsense_Mutation_p.R1069*|EIF4G1_uc003fnu.3_Nonsense_Mutation_p.R1068*|EIF4G1_uc003fnw.2_Nonsense_Mutation_p.R1075*|EIF4G1_uc003fnx.2_Nonsense_Mutation_p.R873*|EIF4G1_uc003fny.3_Nonsense_Mutation_p.R872*|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1068	eIF3/EIF4A-binding.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGACACCTCACGACTCACCAA	0.517													4	127	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113540650	113540650	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113540650T>C	uc003iau.2	-	6	759	c.548A>G	c.(547-549)AAG>AGG	p.K183R	C4orf21_uc003iaw.2_Missense_Mutation_p.K183R	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		CTCCCTGTTCTTGTAAGTCAC	0.393													4	73	---	---	---	---	PASS
USP38	84640	broad.mit.edu	37	4	144106648	144106648	+	Silent	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144106648G>A	uc003ijb.2	+	1	579	c.45G>A	c.(43-45)CTG>CTA	p.L15L	USP38_uc003ija.3_Silent_p.L15L|USP38_uc003ijc.2_RNA	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	15					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)					CGCATCCCCTGCCCCTCAAGC	0.652													8	18	---	---	---	---	PASS
HAND2	9464	broad.mit.edu	37	4	174448290	174448290	+	3'UTR	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174448290A>T	uc003ith.1	-	2					HAND2_uc003itg.1_Missense_Mutation_p.C230S	NM_021973	NP_068808	P61296	HAND2_HUMAN	basic helix-loop-helix transcription factor						adult heart development|angiogenesis|apoptosis|cardiac neural crest cell development involved in outflow tract morphogenesis|heart looping|in utero embryonic development|negative regulation of cardiac muscle cell apoptosis|noradrenergic neuron differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|regulation of secondary heart field cardioblast proliferation|thymus development	nuclear chromatin|transcription factor complex	activating transcription factor binding|protein homodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|transcription coactivator activity			skin(1)	1		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		AGGAAATTGCACATAAATAAA	0.512													4	6	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41199870	41199870	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41199870C>T	uc003jmk.2	-	4	655	c.445G>A	c.(445-447)GGC>AGC	p.G149S	C6_uc003jml.1_Missense_Mutation_p.G149S	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	149	LDL-receptor class A.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				AATACATTACCACTGTCACAG	0.403													4	114	---	---	---	---	PASS
POLK	51426	broad.mit.edu	37	5	74889744	74889744	+	Silent	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74889744A>G	uc003kdw.2	+	12	1494	c.1398A>G	c.(1396-1398)GAA>GAG	p.E466E	POLK_uc003kdx.2_Intron|POLK_uc003kdy.2_Intron|POLK_uc010izq.2_Intron|POLK_uc003kec.2_Silent_p.E376E|POLK_uc010izr.2_RNA|POLK_uc010izs.2_Intron|POLK_uc003ked.2_Intron|POLK_uc003kee.2_Intron|POLK_uc003kef.2_Silent_p.E376E	NM_016218	NP_057302	Q9UBT6	POLK_HUMAN	DNA-directed DNA polymerase kappa	466					DNA replication|nucleotide-excision repair, DNA gap filling	nucleus	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|kidney(2)	4		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		TGAATTTTGAAGTAAAAACTC	0.254								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					6	281	---	---	---	---	PASS
SV2C	22987	broad.mit.edu	37	5	75469440	75469440	+	Intron	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75469440A>G	uc003kei.1	+						uc003kej.2_RNA	NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		CAGAGCTACAATGCATTTAGT	0.418													9	137	---	---	---	---	PASS
MEF2C	4208	broad.mit.edu	37	5	88018732	88018732	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88018732T>C	uc003kjj.2	-	11	1784	c.1111A>G	c.(1111-1113)AGC>GGC	p.S371G	MEF2C_uc003kji.2_Missense_Mutation_p.S363G|MEF2C_uc003kjk.2_Missense_Mutation_p.S371G|MEF2C_uc003kjm.2_Missense_Mutation_p.S361G|MEF2C_uc003kjl.2_Missense_Mutation_p.S381G	NM_002397	NP_002388	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C isoform 1	371	Transcription repressor.				apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		AAATGAGTGCTAGTGCAAGCT	0.468										HNSCC(66;0.2)			4	131	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127673799	127673799	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127673799T>A	uc003kuu.2	-	27	3927	c.3488A>T	c.(3487-3489)GAA>GTA	p.E1163V	FBN2_uc003kuv.2_Missense_Mutation_p.E1130V	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1163	EGF-like 17; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGGGTTACGTTCACATTCGTC	0.473													4	16	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176618916	176618916	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176618916A>G	uc003mfr.3	+	3	1097	c.959A>G	c.(958-960)AAG>AGG	p.K320R	NSD1_uc003mft.3_Missense_Mutation_p.K51R|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_5'UTR|NSD1_uc003mfp.2_Missense_Mutation_p.K320R	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	320					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ACGCCACTGAAGTATGAAGTT	0.383			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			5	177	---	---	---	---	PASS
SYCP2L	221711	broad.mit.edu	37	6	10912971	10912971	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10912971T>A	uc003mzo.2	+	13	1280	c.984T>A	c.(982-984)AGT>AGA	p.S328R	SYCP2L_uc011din.1_Missense_Mutation_p.S169R|SYCP2L_uc010jow.2_5'UTR	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	328						nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			GAAGTCAGAGTGTCACTTTTT	0.348													7	225	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47678502	47678502	+	Silent	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47678502C>T	uc003oza.1	+	4	438	c.180C>T	c.(178-180)TCC>TCT	p.S60S	GPR115_uc003oyz.1_Silent_p.S117S|GPR115_uc003ozb.1_Silent_p.S58S	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	60	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						TTTCTTCTTCCAACTGCAGCC	0.373													5	214	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117739636	117739636	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117739636G>T	uc003pxp.1	-	2	356	c.157C>A	c.(157-159)CTG>ATG	p.L53M	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	53	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GGTTCACTCAGATTATGTGGT	0.403			T	GOPC|ROS1	glioblastoma|NSCLC								8	125	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129588309	129588309	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129588309C>T	uc003qbn.2	+	16	2372	c.2267C>T	c.(2266-2268)CCA>CTA	p.P756L	LAMA2_uc003qbo.2_Missense_Mutation_p.P756L	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	756	Laminin EGF-like 5; second part.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATCTGTGAGCCATGTCAGTGC	0.473													63	157	---	---	---	---	PASS
RSPH3	83861	broad.mit.edu	37	6	159420742	159420742	+	Silent	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159420742A>T	uc003qrx.2	-	1	457	c.267T>A	c.(265-267)GGT>GGA	p.G89G	RSPH3_uc010kju.2_Silent_p.G89G|RSPH3_uc003qry.1_Silent_p.G89G	NM_031924	NP_114130	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog	89										ovary(1)|skin(1)	2		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		ACGGGAGGTTACCAGCGCAGG	0.647													35	82	---	---	---	---	PASS
FOXK1	221937	broad.mit.edu	37	7	4780487	4780487	+	Silent	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4780487C>T	uc003snc.1	+	2	589	c.579C>T	c.(577-579)CCC>CCT	p.P193P	FOXK1_uc003sna.1_Silent_p.P30P|FOXK1_uc003snb.1_Silent_p.P193P	NM_001037165	NP_001032242	P85037	FOXK1_HUMAN	forkhead box K1	193					cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			upper_aerodigestive_tract(1)|skin(1)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		TCCGGTTTCCCAGCACGGCCA	0.602													22	50	---	---	---	---	PASS
ANKMY2	57037	broad.mit.edu	37	7	16650201	16650201	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16650201T>C	uc003sti.2	-	6	919	c.719A>G	c.(718-720)GAG>GGG	p.E240G	ANKMY2_uc010ktz.2_RNA	NM_020319	NP_064715	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	240						cilium	zinc ion binding			central_nervous_system(1)	1	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		CAGTTTATTCTCTCCATCTTT	0.294													6	260	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20193894	20193894	+	Missense_Mutation	SNP	C	G	G	rs150032403		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20193894C>G	uc003sus.3	-	6	2577	c.2268G>C	c.(2266-2268)AAG>AAC	p.K756N	MACC1_uc010kug.2_Missense_Mutation_p.K756N	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	756					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						GTCGTACTAACTTTTCAGCTA	0.438													12	214	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66474585	66474585	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66474585C>A	uc003tvn.2	+	4	438	c.289C>A	c.(289-291)CTT>ATT	p.L97I	TYW1_uc010lai.2_RNA	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	97	Flavodoxin-like.				tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				CGCAACAGTTCTTGCTGAAGC	0.393													117	243	---	---	---	---	PASS
FGL2	10875	broad.mit.edu	37	7	76829078	76829078	+	Silent	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76829078T>C	uc003ugb.2	-	1	73	c.33A>G	c.(31-33)TCA>TCG	p.S11S	CCDC146_uc003ufz.1_Intron|CCDC146_uc003uga.2_Intron	NM_006682	NP_006673	Q14314	FGL2_HUMAN	fibrinogen-like 2 precursor	11					signal transduction	fibrinogen complex	receptor binding			skin(2)	2						CAAGAACAGCTGAGCTCAGCC	0.498													26	41	---	---	---	---	PASS
ZKSCAN1	7586	broad.mit.edu	37	7	99631591	99631591	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99631591C>G	uc003usk.1	+	6	1682	c.1463C>G	c.(1462-1464)CCC>CGC	p.P488R	ZKSCAN1_uc003usl.1_Missense_Mutation_p.P452R|ZKSCAN1_uc003usm.1_Missense_Mutation_p.P275R	NM_003439	NP_003430	P17029	ZKSC1_HUMAN	zinc finger protein 36	488					viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GGGGAGAAACCCTATGAATGT	0.468													10	39	---	---	---	---	PASS
ANKRD7	56311	broad.mit.edu	37	7	117874795	117874795	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117874795T>C	uc003vji.2	+	3	508	c.335T>C	c.(334-336)CTA>CCA	p.L112P		NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	112	ANK 2.				male gonad development						0						ACTATTCTTCTAAACTTTGGT	0.353													115	201	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133812165	133812165	+	Silent	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133812165T>C	uc003vrm.1	+	1	61	c.45T>C	c.(43-45)TCT>TCC	p.S15S		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	15							ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						GAGCTGCCTCTCTCCTGAGAG	0.602													14	35	---	---	---	---	PASS
TTC26	79989	broad.mit.edu	37	7	138822685	138822685	+	Silent	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138822685G>A	uc003vus.2	+	3	348	c.234G>A	c.(232-234)GAG>GAA	p.E78E	TTC26_uc003vuq.2_Silent_p.E78E|TTC26_uc011kqm.1_Silent_p.E78E|TTC26_uc003vur.3_Silent_p.E78E|TTC26_uc011kqn.1_Silent_p.E78E|TTC26_uc011kqo.1_Intron|TTC26_uc011kqp.1_5'UTR|TTC26_uc003vut.2_5'UTR|TTC26_uc011kqq.1_Silent_p.E78E	NM_024926	NP_079202	A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26 isoform 1	78	TPR 1.						binding			ovary(1)	1						GAGCTCTGGAGGTTAGTGTAA	0.313													150	242	---	---	---	---	PASS
LMBR1	64327	broad.mit.edu	37	7	156518213	156518213	+	Silent	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156518213A>G	uc003wmw.3	-	14	1289	c.1074T>C	c.(1072-1074)CTT>CTC	p.L358L	LMBR1_uc003wmv.3_Silent_p.L206L|LMBR1_uc003wmx.3_Silent_p.L206L|LMBR1_uc010lqn.2_Silent_p.L399L|LMBR1_uc011kvx.1_Silent_p.L337L	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein	358	Helical; (Potential).					integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		AGGACACCATAAGATAGCTGT	0.398													34	71	---	---	---	---	PASS
CLN8	2055	broad.mit.edu	37	8	1728492	1728492	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1728492T>A	uc003wpo.3	+	3	925	c.620T>A	c.(619-621)CTA>CAA	p.L207Q		NM_018941	NP_061764	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8	207	TLC.				cell death|ceramide biosynthetic process|cholesterol metabolic process|lipid transport|negative regulation of proteolysis|phospholipid metabolic process	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		CGCATGGTTCTAACCTACCAC	0.537													47	31	---	---	---	---	PASS
PPP3CC	5533	broad.mit.edu	37	8	22398404	22398404	+	3'UTR	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22398404C>T	uc003xbs.2	+	14					PPP3CC_uc011kzi.1_3'UTR|PPP3CC_uc003xbt.2_3'UTR|PPP3CC_uc011kzj.1_3'UTR|uc003xbu.1_RNA	NM_005605	NP_005596	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	cytosol	calmodulin binding|metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		CAACTCAAAACAACTTCAACG	0.313													4	5	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35579745	35579745	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35579745G>A	uc003xjr.1	+	9	1463	c.1135G>A	c.(1135-1137)GAC>AAC	p.D379N	UNC5D_uc003xjs.1_Missense_Mutation_p.D374N|UNC5D_uc003xju.1_5'Flank|UNC5D_uc003xjt.1_Missense_Mutation_p.D137N	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	379	Extracellular (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GAATGCCAGCGACATTGCTTT	0.502													4	148	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41798808	41798808	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41798808C>T	uc010lxb.2	-	16	3135	c.2591G>A	c.(2590-2592)CGG>CAG	p.R864Q	MYST3_uc010lxc.2_Missense_Mutation_p.R864Q|MYST3_uc003xon.3_Missense_Mutation_p.R864Q	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	864					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			GCGGCCCCTCCGAGATGGCTG	0.473													4	130	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53586507	53586507	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53586507A>T	uc003xre.3	-	7	1458	c.900T>A	c.(898-900)GAT>GAA	p.D300E	RB1CC1_uc003xrf.3_Missense_Mutation_p.D300E	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	300					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				AAAAGGGCAGATCACCATCTT	0.383													65	44	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100847487	100847487	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100847487C>G	uc003yiv.2	+	53	9863	c.9752C>G	c.(9751-9753)CCT>CGT	p.P3251R	VPS13B_uc003yiw.2_Missense_Mutation_p.P3226R	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3251					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TCAGAAGACCCTAGTCCTCGA	0.348													27	84	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113277756	113277756	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113277756A>G	uc003ynu.2	-	60	9731	c.9572T>C	c.(9571-9573)GTT>GCT	p.V3191A	CSMD3_uc003yns.2_Missense_Mutation_p.V2393A|CSMD3_uc003ynt.2_Missense_Mutation_p.V3151A|CSMD3_uc011lhx.1_Missense_Mutation_p.V3022A	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3191	Extracellular (Potential).|Sushi 24.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATTTTGTCCAACCACATAATC	0.428										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			6	214	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8500875	8500875	+	Silent	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8500875A>T	uc003zkk.2	-	23	2718	c.2007T>A	c.(2005-2007)ACT>ACA	p.T669T	PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Silent_p.T669T|PTPRD_uc003zkm.2_Silent_p.T656T|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	669	Fibronectin type-III 4.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GGTATTTGGTAGTGTCCGAAG	0.473										TSP Lung(15;0.13)			106	161	---	---	---	---	PASS
NFX1	4799	broad.mit.edu	37	9	33351750	33351750	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33351750A>G	uc003zsq.2	+	16	2678	c.2617A>G	c.(2617-2619)ACC>GCC	p.T873A	SUGT1P1_uc010mjq.1_Intron|NFX1_uc003zsp.1_Missense_Mutation_p.T873A|NFX1_uc010mjr.1_Missense_Mutation_p.T874A|NFX1_uc003zsr.2_Missense_Mutation_p.T874A	NM_002504	NP_002495	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	873	NF-X1-type 8.				inflammatory response|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|ligase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		ACCCTGCCATACCAGCTCACC	0.552													3	29	---	---	---	---	PASS
ERP44	23071	broad.mit.edu	37	9	102861304	102861304	+	5'UTR	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102861304C>G	uc004bam.2	-	1					ERP44_uc010msy.2_RNA|ERP44_uc010msz.2_5'UTR|INVS_uc010mta.1_5'Flank|INVS_uc011lve.1_5'Flank|INVS_uc004bao.1_5'Flank|INVS_uc004bap.1_5'Flank|INVS_uc004baq.1_5'Flank|INVS_uc004bar.1_5'Flank|INVS_uc010mtb.1_5'Flank	NM_015051	NP_055866	Q9BS26	ERP44_HUMAN	thioredoxin domain containing 4 (endoplasmic						cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity				0						TCCAGAGAGGCCTCTCACACC	0.647													4	9	---	---	---	---	PASS
GFI1B	8328	broad.mit.edu	37	9	135863634	135863634	+	Missense_Mutation	SNP	G	T	T	rs145562579		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135863634G>T	uc004ccg.2	+	4	440	c.289G>T	c.(289-291)GAC>TAC	p.D97Y	GFI1B_uc010mzy.2_Missense_Mutation_p.D97Y	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription	97	Interaction with ARIH2.				cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		TCCACTGTCCGACTCACCCCC	0.587													20	40	---	---	---	---	PASS
GBGT1	26301	broad.mit.edu	37	9	136029453	136029453	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136029453C>A	uc004ccw.2	-	7	836	c.555G>T	c.(553-555)GAG>GAT	p.E185D	RALGDS_uc011mcw.1_Intron|GBGT1_uc004ccx.2_Missense_Mutation_p.E138D|GBGT1_uc010nab.2_3'UTR|GBGT1_uc011mcx.1_Missense_Mutation_p.E168D|GBGT1_uc010nac.1_Missense_Mutation_p.E49D|GBGT1_uc004ccy.1_3'UTR	NM_021996	NP_068836	Q8N5D6	GBGT1_HUMAN	globoside	185	Lumenal (Potential).				carbohydrate metabolic process|glycolipid biosynthetic process	Golgi membrane|integral to membrane	metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		GGCTGATGGTCTCCATCCGGC	0.632													8	15	---	---	---	---	PASS
WDR5	11091	broad.mit.edu	37	9	137021656	137021656	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137021656T>C	uc004cey.2	+	13	1016	c.845T>C	c.(844-846)CTT>CCT	p.L282P	WDR5_uc004cez.2_Missense_Mutation_p.L282P	NM_017588	NP_060058	P61964	WDR5_HUMAN	WD repeat domain 5	282	WD 6.				histone H3 acetylation|histone H3-K4 methylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex|MLL1 complex|Set1C/COMPASS complex	protein binding				0		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		GAGGATAACCTTGTTTACATC	0.498													5	181	---	---	---	---	PASS
PLXDC2	84898	broad.mit.edu	37	10	20106053	20106053	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20106053G>A	uc001iqg.1	+	1	682	c.45G>A	c.(43-45)ATG>ATA	p.M15I	PLXDC2_uc001iqh.1_Missense_Mutation_p.M15I	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor	15						integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						CAGGAGTTATGTTACTTTGCC	0.597											OREG0020062	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	49	---	---	---	---	PASS
KIF5B	3799	broad.mit.edu	37	10	32311834	32311834	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32311834T>C	uc001iwe.3	-	16	2326	c.1856A>G	c.(1855-1857)AAC>AGC	p.N619S		NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B	619					stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				CATTTTTTTGTTGCTCTCAGT	0.358													8	460	---	---	---	---	PASS
HNRNPA3P1	10151	broad.mit.edu	37	10	44285141	44285141	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44285141C>T	uc010qfe.1	-	1	725	c.695G>A	c.(694-696)GGT>GAT	p.G232D		NR_002726				SubName: Full=cDNA FLJ52659, highly similar to Heterogeneous nuclear ribonucleoprotein A3; SubName: Full=cDNA, FLJ79333, highly similar to Heterogeneous nuclear ribonucleoprotein A3; SubName: Full=Heterogeneous nuclear ribonucleoprotein A3, isoform CRA_a;												0						acctccaccacctccaAAGTT	0.244													12	24	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112360237	112360237	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112360237G>C	uc001kze.2	+	22	2594	c.2468G>C	c.(2467-2469)GGT>GCT	p.G823A		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	823	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AAATTAGAAGGTATTATTACT	0.323													47	79	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112360239	112360239	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112360239A>T	uc001kze.2	+	22	2596	c.2470A>T	c.(2470-2472)ATT>TTT	p.I824F		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	824	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		ATTAGAAGGTATTATTACTCG	0.323													48	76	---	---	---	---	PASS
DOCK1	1793	broad.mit.edu	37	10	129055617	129055617	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129055617T>C	uc001ljt.2	+	29	2969	c.2905T>C	c.(2905-2907)TTC>CTC	p.F969L	DOCK1_uc010qun.1_Missense_Mutation_p.F990L	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	969					apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AATGGAAACATTCATCATGTT	0.368													5	146	---	---	---	---	PASS
SYCE1	93426	broad.mit.edu	37	10	135367707	135367707	+	3'UTR	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135367707G>A	uc009ybn.2	-	13					CYP2E1_uc001lnl.1_Intron|SYCE1_uc001lnm.2_3'UTR|SYCE1_uc001lnn.2_3'UTR	NM_001143763	NP_001137235	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1						cell division	central element				ovary(1)	1		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TAGAGAACTCGTCTGTCCTGG	0.353													4	89	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1092948	1092948	+	Silent	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1092948C>G	uc001lsx.1	+	31	11880	c.11853C>G	c.(11851-11853)ACC>ACG	p.T3951T		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	3951						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tcaccaccaccactacggtga	0.124													21	408	---	---	---	---	PASS
OSBPL5	114879	broad.mit.edu	37	11	3109542	3109542	+	Missense_Mutation	SNP	G	A	A	rs150730024		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3109542G>A	uc001lxk.2	-	22	2691	c.2533C>T	c.(2533-2535)CGG>TGG	p.R845W	OSBPL5_uc010qxq.1_Missense_Mutation_p.R756W|OSBPL5_uc009ydw.2_Missense_Mutation_p.R777W|OSBPL5_uc001lxl.2_Missense_Mutation_p.R777W|OSBPL5_uc001lxj.2_Missense_Mutation_p.R299W	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform	845					cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGTGCTGCCCGTGCCGTGGAG	0.642													16	31	---	---	---	---	PASS
TRIM5	85363	broad.mit.edu	37	11	5699642	5699642	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5699642G>C	uc001mbm.1	-	4	793	c.536C>G	c.(535-537)ACC>AGC	p.T179S	TRIM5_uc001mbq.1_Missense_Mutation_p.T179S|TRIM5_uc001mbl.1_RNA|TRIM5_uc001mbn.2_Missense_Mutation_p.T179S|TRIM5_uc001mbo.2_Missense_Mutation_p.T179S|TRIM5_uc001mbp.2_Missense_Mutation_p.T179S	NM_033034	NP_149023	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform alpha	179	Potential.				interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		CAAGACGTTGGTTTTGTCATA	0.463													42	103	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17544964	17544964	+	Splice_Site	SNP	A	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17544964A>C	uc001mnf.2	-	10	928	c.819_splice	c.e10+1	p.E273_splice	USH1C_uc001mne.2_Splice_Site_p.E273_splice|USH1C_uc009yhb.2_Splice_Site_p.E273_splice|USH1C_uc001mng.2_Splice_Site|USH1C_uc001mnd.2_Splice_Site_p.E237_splice	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a						equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						CCCACATCTCACCTCCTTGTG	0.552													22	51	---	---	---	---	PASS
LDHAL6A	160287	broad.mit.edu	37	11	18478173	18478173	+	Intron	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18478173A>G	uc001mop.1	+						LDHAL6A_uc001moq.2_5'UTR	NM_001144071	NP_001137543	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A						glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	AGCCATTTCCAATTCCAGGTC	0.478													32	38	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32636393	32636393	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32636393A>T	uc001mtv.2	-	16	1515	c.1471T>A	c.(1471-1473)TCC>ACC	p.S491T		NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	491										ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					TTATCTAAGGAGAGGGTTTTG	0.328													39	95	---	---	---	---	PASS
RAPSN	5913	broad.mit.edu	37	11	47470672	47470672	+	5'UTR	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47470672G>A	uc001nfi.1	-	1					RAPSN_uc001nfj.1_5'UTR|RAPSN_uc009yls.1_5'UTR	NM_005055	NP_005046	Q13702	RAPSN_HUMAN	43 kD receptor-associated protein of the synapse						synaptic transmission, cholinergic	cell junction|cytoskeleton|postsynaptic membrane	acetylcholine receptor binding|zinc ion binding			ovary(1)	1						ATGGAGAGCAGGCGCCACCCT	0.637													3	3	---	---	---	---	PASS
MMP3	4314	broad.mit.edu	37	11	102711251	102711251	+	Silent	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102711251T>C	uc001phj.1	-	5	764	c.699A>G	c.(697-699)GAA>GAG	p.E233E		NM_002422	NP_002413	P08254	MMP3_HUMAN	matrix metalloproteinase 3 preproprotein	233					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			lung(1)|kidney(1)	2		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)|Simvastatin(DB00641)	ACATCAAAGCTTCAGTGTTGG	0.443													6	235	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082514	8082514	+	Intron	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082514C>T	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		ATGTGCTGCCCCAAATTCATT	0.443													13	87	---	---	---	---	PASS
EPS8	2059	broad.mit.edu	37	12	15803757	15803757	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15803757C>G	uc009zif.2	-	14	1528	c.1434G>C	c.(1432-1434)GAG>GAC	p.E478D	EPS8_uc001rdb.2_Missense_Mutation_p.E478D|EPS8_uc009zig.2_Missense_Mutation_p.E218D|EPS8_uc010shv.1_Missense_Mutation_p.E218D	NM_004447	NP_004438	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway	478					cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		AAAAAACTACCTCTGTGGATA	0.353													25	69	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53442857	53442857	+	5'Flank	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53442857C>T	uc001sbp.2	+						uc001sbj.1_5'Flank|uc001sbk.1_Intron|TENC1_uc001sbl.2_Intron|TENC1_uc001sbm.2_5'UTR|TENC1_uc001sbn.2_5'UTR|TENC1_uc001sbo.1_5'Flank	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase						intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						TTTCAAGGCCCCATCCACCTC	0.597													3	38	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64812728	64812728	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812728A>G	uc001ssb.2	+	6	769	c.343A>G	c.(343-345)ACA>GCA	p.T115A	XPOT_uc009zqm.1_Missense_Mutation_p.T25A	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	115	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		GCTTTTTGTTACAGAGTATCT	0.433													6	217	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64812733	64812733	+	Silent	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812733G>A	uc001ssb.2	+	6	774	c.348G>A	c.(346-348)GAG>GAA	p.E116E	XPOT_uc009zqm.1_Silent_p.E26E	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	116	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		TTGTTACAGAGTATCTCACTA	0.438													4	224	---	---	---	---	PASS
GNPTAB	79158	broad.mit.edu	37	12	102163955	102163955	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102163955A>T	uc001tit.2	-	10	1307	c.1128T>A	c.(1126-1128)AAT>AAA	p.N376K	GNPTAB_uc001tiu.1_Missense_Mutation_p.N376K	NM_024312	NP_077288	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase	376					cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity			ovary(1)|skin(1)	2						AGTGGCTCAAATTTCGAAAAA	0.328													59	116	---	---	---	---	PASS
HVCN1	84329	broad.mit.edu	37	12	111089162	111089162	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111089162T>C	uc001trs.1	-	6	668	c.503A>G	c.(502-504)CAC>CGC	p.H168R	HVCN1_uc001trq.1_Missense_Mutation_p.H168R|HVCN1_uc001trt.1_Missense_Mutation_p.H168R|HVCN1_uc010syd.1_Missense_Mutation_p.H148R	NM_032369	NP_115745	Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	168	Cytoplasmic (Potential).				response to pH|response to zinc ion	integral to membrane	voltage-gated proton channel activity			skin(1)	1						CTCAAACTTGTGGTGAAAGAA	0.483													43	85	---	---	---	---	PASS
GLT1D1	144423	broad.mit.edu	37	12	129373288	129373288	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129373288A>G	uc010tbh.1	+	3	298	c.289A>G	c.(289-291)AGA>GGA	p.R97G	GLT1D1_uc001uhx.1_Missense_Mutation_p.R108G|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	108					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		TGAGGAAGCCAGGTAATACCT	0.438													5	105	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23913839	23913839	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23913839C>A	uc001uon.2	-	10	4765	c.4176G>T	c.(4174-4176)ATG>ATT	p.M1392I	SACS_uc001uoo.2_Missense_Mutation_p.M1245I|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1392					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GAATTGGCTTCATGATAAGTT	0.373													9	398	---	---	---	---	PASS
CDADC1	81602	broad.mit.edu	37	13	49852634	49852634	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49852634A>C	uc001vcu.2	+	7	1275	c.1199A>C	c.(1198-1200)GAA>GCA	p.E400A	CDADC1_uc010tgk.1_Missense_Mutation_p.E202A|CDADC1_uc001vcv.2_RNA	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	400		Proton donor (By similarity).					hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		ATACATGCGGAACAGAATGCC	0.348													7	179	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92470128	92470128	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92470128G>T	uc001xzy.2	-	11	4980	c.4192C>A	c.(4192-4194)CTA>ATA	p.L1398I	TRIP11_uc010auf.1_Missense_Mutation_p.L1134I	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1398	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		TTCTCCTTTAGCTGCTTGATT	0.368			T	PDGFRB	AML								119	217	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92470129	92470129	+	Silent	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92470129C>T	uc001xzy.2	-	11	4979	c.4191G>A	c.(4189-4191)CAG>CAA	p.Q1397Q	TRIP11_uc010auf.1_Silent_p.Q1133Q	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1397	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		TCTCCTTTAGCTGCTTGATTT	0.368			T	PDGFRB	AML								117	219	---	---	---	---	PASS
MIR329-2	574409	broad.mit.edu	37	14	101493473	101493473	+	RNA	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101493473C>G	hsa-mir-329-2|MI0001726	+			c.37C>G			MIR494_hsa-mir-494|MI0003134_5'Flank|uc010txm.1_5'Flank|hsa-mir-1193|MI0014205_5'Flank																	0						GTTTCTGTTTCTTTATTGAGG	0.473													8	532	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106471315	106471315	+	RNA	SNP	G	A	A	rs113102957		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106471315G>A	uc010tyt.1	-	1891		c.36794C>T								Parts of antibodies, mostly variable regions.												0						CTGTGCTCGCGGATGTGTCCC	0.517													25	118	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28387457	28387457	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28387457C>A	uc001zbj.2	-	76	11733	c.11627G>T	c.(11626-11628)AGG>ATG	p.R3876M		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3876					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CATGCAGTACCTCCGGAACCA	0.532													23	20	---	---	---	---	PASS
NEDD4	4734	broad.mit.edu	37	15	56208589	56208589	+	Silent	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56208589A>G	uc002adj.2	-	1	741	c.441T>C	c.(439-441)TGT>TGC	p.C147C	NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Silent_p.C147C|NEDD4_uc010ugj.1_Silent_p.C147C|NEDD4_uc010bfm.2_Silent_p.C147C|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	147	Ser-rich.				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		GGCTACCACTACAAATGGCTG	0.413													23	75	---	---	---	---	PASS
LOC645752	645752	broad.mit.edu	37	15	78208251	78208251	+	Silent	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78208251C>T	uc010bky.2	-	15	1682	c.918G>A	c.(916-918)CCG>CCA	p.P306P	LOC645752_uc010umq.1_5'Flank|uc002bcw.1_5'Flank|uc002bcx.1_5'Flank	NR_027024				SubName: Full=GOLGA6 protein; Flags: Fragment;												0						CCTTCTCCTTCGGGAGGTCCG	0.592													55	117	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	82635117	82635117	+	RNA	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82635117T>C	uc002bgx.2	-	5		c.463A>G						A6NI86	GG6LA_HUMAN	Homo sapiens cDNA FLJ40113 fis, clone TESTI2008621.												0						TTTTTCAATTTCTTGACCCGC	0.383													4	42	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85053188	85053188	+	RNA	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85053188C>G	uc002bkm.2	-	9		c.1859G>C			uc002bkl.1_5'Flank	NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						CCCTGTTCTCCGCAGCCCGAA	0.488													14	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	90835610	90835610	+	IGR	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90835610G>A								TTLL13 (20167 upstream) : GABARAPL3 (54155 downstream)																							GCGGGTGGCTGCTGATTGCTT	0.567													37	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	53404208	53404208	+	Intron	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53404208C>T	uc002ehh.2	-											Homo sapiens mRNA; cDNA DKFZp313P036 (from clone DKFZp313P036).																		TTTTACCTGACTAAAATAAAA	0.274													3	51	---	---	---	---	PASS
LOC283922	283922	broad.mit.edu	37	16	74372753	74372753	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74372753T>A	uc002fcr.2	-	9	1552	c.206A>T	c.(205-207)CAG>CTG	p.Q69L	LOC283922_uc010vms.1_RNA					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						CCTACCGGTCTGGAAGTCCCA	0.502													26	54	---	---	---	---	PASS
MKS1	54903	broad.mit.edu	37	17	56284467	56284467	+	Silent	SNP	T	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56284467T>C	uc002ivr.1	-	15	1461	c.1386A>G	c.(1384-1386)GTA>GTG	p.V462V	MKS1_uc010wnq.1_Silent_p.V259V|MKS1_uc002ivs.1_Intron	NM_017777	NP_060247	Q9NXB0	MKS1_HUMAN	Meckel syndrome type 1 protein isoform 1	462					cilium assembly	centrosome|cilium|microtubule basal body	protein binding			ovary(1)	1						CTGGTATCCGTACATAGGAGA	0.527													7	93	---	---	---	---	PASS
AATK	9625	broad.mit.edu	37	17	79094705	79094705	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79094705G>T	uc010dia.2	-	11	3111	c.3031C>A	c.(3031-3033)CCA>ACA	p.P1011T	AATK_uc010dhz.2_RNA	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1011						integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TTCTTCTCTGGGCCTGAGGTG	0.662													3	7	---	---	---	---	PASS
PIK3C3	5289	broad.mit.edu	37	18	39535250	39535250	+	Translation_Start_Site	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39535250C>T	uc002lap.2	+	1	52	c.-6C>T	c.(-8--4)GACGG>GATGG		PIK3C3_uc010xcl.1_Translation_Start_Site|PIK3C3_uc002lao.2_Translation_Start_Site	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3						cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						CCTTTGCAGACGGTGCGATGG	0.507										TSP Lung(28;0.18)			4	159	---	---	---	---	PASS
BRD4	23476	broad.mit.edu	37	19	15353711	15353711	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15353711C>T	uc002nar.2	-	14	3391	c.3169G>A	c.(3169-3171)GGT>AGT	p.G1057S		NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long	1057					interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GACCACTTACCGGTTGAGTAG	0.612			T	NUT|C15orf55	lethal midline carcinoma of young people								3	69	---	---	---	---	PASS
ZNF101	94039	broad.mit.edu	37	19	19791040	19791040	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19791040A>T	uc002nni.1	+	4	1352	c.1242A>T	c.(1240-1242)AGA>AGT	p.R414S	ZNF101_uc010ecg.1_Missense_Mutation_p.R294S|ZNF101_uc002nnj.1_Missense_Mutation_p.R294S	NM_033204	NP_149981	Q8IZC7	ZN101_HUMAN	zinc finger protein 101	414	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TTCATGAAAGAACTCATTTGG	0.234													8	172	---	---	---	---	PASS
ANKRD27	84079	broad.mit.edu	37	19	33130248	33130248	+	Intron	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33130248G>A	uc002ntn.1	-						ANKRD27_uc002nto.1_Missense_Mutation_p.P377L	NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					GCCAGGGCAGGGGTGAGATCT	0.527													39	56	---	---	---	---	PASS
LIPE	3991	broad.mit.edu	37	19	42930828	42930828	+	Silent	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42930828C>T	uc002otr.2	-	1	751	c.474G>A	c.(472-474)GCG>GCA	p.A158A	uc010eif.1_Intron|uc002ott.1_Intron|uc010eig.1_Intron|uc010eih.1_Intron|LIPE_uc002ots.1_5'Flank	NM_005357	NP_005348	Q05469	LIPS_HUMAN	hormone-sensitive lipase	158					cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding			ovary(1)|breast(1)	2		Prostate(69;0.00682)				TAGCCTGGGCCGCAGGTGTTG	0.567													45	59	---	---	---	---	PASS
CA11	770	broad.mit.edu	37	19	49147826	49147826	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49147826C>G	uc002pjz.1	-	3	705	c.143G>C	c.(142-144)GGG>GCG	p.G48A	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron	NM_001217	NP_001208	O75493	CAH11_HUMAN	carbonic anhydrase XI precursor	48						extracellular region					0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)		GAAAGGAGGCCCTGGGGGTGG	0.517													23	30	---	---	---	---	PASS
IZUMO1	284359	broad.mit.edu	37	19	49249008	49249008	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49249008C>A	uc002pkj.2	-	2	657	c.109G>T	c.(109-111)GAG>TAG	p.E37*	IZUMO1_uc010eme.2_RNA|IZUMO1_uc010emf.2_RNA	NM_182575	NP_872381	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1 precursor	37	Extracellular (Potential).				fusion of sperm to egg plasma membrane	integral to membrane				ovary(1)	1		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		TAATCTTTCTCCAGGGACTTT	0.547													56	81	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58342420	58342420	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58342420G>A	uc002yau.2	+	5	1188	c.721G>A	c.(721-723)GCA>ACA	p.A241T	PHACTR3_uc002yat.2_Missense_Mutation_p.A238T|PHACTR3_uc010zzw.1_Missense_Mutation_p.A200T|PHACTR3_uc002yav.2_Missense_Mutation_p.A200T|PHACTR3_uc002yaw.2_Missense_Mutation_p.A200T|PHACTR3_uc002yax.2_Intron	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	241						nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GCCACCCAAGGCAAGCTCCAA	0.517													5	10	---	---	---	---	PASS
YTHDF1	54915	broad.mit.edu	37	20	61834018	61834018	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61834018A>G	uc002yeh.2	-	4	1568	c.1274T>C	c.(1273-1275)TTC>TCC	p.F425S	YTHDF1_uc011aaq.1_Missense_Mutation_p.F375S	NM_017798	NP_060268	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	425	YTH.									ovary(2)	2						CATGCAGCGGAAGGCGCTGTC	0.572													18	25	---	---	---	---	PASS
CLIC6	54102	broad.mit.edu	37	21	36081036	36081036	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36081036C>G	uc010gmt.1	+	5	1703	c.1703C>G	c.(1702-1704)TCC>TGC	p.S568C	CLIC6_uc002yuf.1_Missense_Mutation_p.S550C	NM_053277	NP_444507	Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	568	GST C-terminal.					chloride channel complex|cytoplasm|plasma membrane	voltage-gated chloride channel activity			ovary(1)|central_nervous_system(1)	2						GAATCTAATTCCGCAGGAAAT	0.403													24	36	---	---	---	---	PASS
PFKL	5211	broad.mit.edu	37	21	45742915	45742915	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45742915G>A	uc002zel.2	+	15	1539	c.1480G>A	c.(1480-1482)GTG>ATG	p.V494M	PFKL_uc002zek.2_Missense_Mutation_p.V541M|PFKL_uc002zem.2_Missense_Mutation_p.V81M|PFKL_uc002zen.2_Missense_Mutation_p.V81M	NM_002626	NP_002617	P17858	K6PL_HUMAN	liver phosphofructokinase	494					fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)		CGCCCTGCTGGTGGTCGGTGG	0.602													34	23	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21081564	21081564	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21081564G>A	uc002zsz.3	-	41	4952	c.4721C>T	c.(4720-4722)CCT>CTT	p.P1574L	PI4KA_uc002zsy.3_Missense_Mutation_p.P384L	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	1574					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CGCCGTGAGAGGGTGCGGCGG	0.662													3	12	---	---	---	---	PASS
RFPL1	5988	broad.mit.edu	37	22	29835320	29835320	+	Intron	SNP	G	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29835320G>T	uc003afn.2	+						RFPL1S_uc003afm.1_RNA	NM_021026	NP_066306	O75677	RFPL1_HUMAN	ret finger protein-like 1								zinc ion binding				0						gaatcacctggtgatctccaa	0.149													3	3	---	---	---	---	PASS
SF3A1	10291	broad.mit.edu	37	22	30736281	30736281	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30736281C>G	uc003ahl.2	-	9	1411	c.1279G>C	c.(1279-1281)GAA>CAA	p.E427Q		NM_005877	NP_005868	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa isoform 1	427					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5						CGCATGTGTTCCTGCATTTTG	0.567													12	42	---	---	---	---	PASS
PES1	23481	broad.mit.edu	37	22	30976162	30976162	+	Silent	SNP	A	G	G	rs145325046	byFrequency	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30976162A>G	uc003aij.1	-	11	1121	c.1047T>C	c.(1045-1047)AGT>AGC	p.S349S	PES1_uc003aik.1_Silent_p.S344S|PES1_uc003ail.1_Silent_p.S332S|PES1_uc003aim.1_Silent_p.S349S|PES1_uc003ain.1_Silent_p.S210S|PES1_uc003aio.1_Silent_p.S210S	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	349	Sufficient for interaction with MAP1B (By similarity).|BRCT.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						CCCCACCAAAACTCCTACAGG	0.592													4	73	---	---	---	---	PASS
APOL5	80831	broad.mit.edu	37	22	36123112	36123112	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36123112G>T	uc003aof.2	+	3	997	c.997G>T	c.(997-999)GCT>TCT	p.A333S		NM_030642	NP_085145	Q9BWW9	APOL5_HUMAN	apolipoprotein L5	333					lipid metabolic process|lipid transport|lipoprotein metabolic process	cytoplasm|extracellular region	high-density lipoprotein particle binding|lipid binding|protein binding				0						GAGAGCACTTGCTAAGAAGCT	0.607													4	19	---	---	---	---	PASS
DNAJB7	150353	broad.mit.edu	37	22	41256863	41256863	+	3'UTR	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41256863C>T	uc003azj.2	-	1					XPNPEP3_uc011aox.1_Intron|XPNPEP3_uc003azh.2_Intron|XPNPEP3_uc003azi.2_Intron|XPNPEP3_uc011aoy.1_5'Flank|XPNPEP3_uc003azg.1_Intron|XPNPEP3_uc003azf.1_Intron|XPNPEP3_uc010gyh.1_5'Flank	NM_145174	NP_660157	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7						protein folding		heat shock protein binding|unfolded protein binding			ovary(1)	1						ctatactgcccaggcAAATTC	0.169													2	1	---	---	---	---	PASS
RPGR	6103	broad.mit.edu	37	X	38178216	38178216	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38178216C>T	uc004ded.1	-	5	503	c.335G>A	c.(334-336)GGT>GAT	p.G112D	RPGR_uc004deb.2_Missense_Mutation_p.G112D|RPGR_uc004dea.2_RNA|RPGR_uc004dec.2_RNA	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator isoform C	112	RCC1 2.				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						ATTATTTCCACCAGTTGCATA	0.408													4	167	---	---	---	---	PASS
GPRASP2	114928	broad.mit.edu	37	X	101970788	101970788	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101970788G>T	uc004ejk.2	+	4	2325	c.991G>T	c.(991-993)GAA>TAA	p.E331*	GPRASP2_uc004ejl.2_Nonsense_Mutation_p.E331*|GPRASP2_uc004ejm.2_Nonsense_Mutation_p.E331*|GPRASP2_uc011mrp.1_5'Flank	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	331						cytoplasm	protein binding			ovary(1)	1						ATCTGAGTCTGAAGATGAGTT	0.428													6	117	---	---	---	---	PASS
VSIG1	340547	broad.mit.edu	37	X	107304759	107304759	+	Intron	SNP	C	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107304759C>T	uc004eno.2	+						VSIG1_uc011msk.1_Silent_p.T105T	NM_182607	NP_872413	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2						GTAGCTGGACCTCTGAGGTAA	0.512													10	57	---	---	---	---	PASS
RBMXL3	139804	broad.mit.edu	37	X	114425790	114425790	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114425790G>A	uc011mte.1	+	1	1828	c.1786G>A	c.(1786-1788)GGC>AGC	p.G596S	LRCH2_uc010nqe.2_Intron|LRCH2_uc004epz.2_Intron	NM_001145346	NP_001138818	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	596	Gly-rich.						nucleotide binding|RNA binding				0						GGAGTACCGAGGCCGCTCCCT	0.682													4	25	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122769988	122769988	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122769988G>C	uc004etu.2	-	19	1992	c.1960C>G	c.(1960-1962)CCA>GCA	p.P654A	THOC2_uc011muh.1_Missense_Mutation_p.P579A	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	654					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						AGATCAATTGGATATTTACGA	0.323													103	290	---	---	---	---	PASS
GABRA3	2556	broad.mit.edu	37	X	151376611	151376611	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151376611A>G	uc010ntk.1	-	7	880	c.640T>C	c.(640-642)TAT>CAT	p.Y214H		NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3	214	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GCTGTTGTATAGGCATCTAAG	0.413													4	197	---	---	---	---	PASS
PLEKHG5	57449	broad.mit.edu	37	1	6571379	6571379	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6571379delG	uc001anp.1	-						PLEKHG5_uc001anq.1_Intron	NM_198681	NP_941374	O94827	PKHG5_HUMAN	pleckstrin homology domain containing family G						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		CTGCTGGGGTGGGGGATGGAC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	13180769	13180770	+	IGR	INS	-	T	T	rs142704943	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13180769_13180770insT								PRAMEF5 (63018 upstream) : LOC440563 (2191 downstream)																							CTCTCTTTCTCTCCTTTTTTGG	0.297													4	4	---	---	---	---	
EPHA2	1969	broad.mit.edu	37	1	16458077	16458077	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16458077delA	uc001aya.1	-							NM_004431	NP_004422	P29317	EPHA2_HUMAN	ephrin receptor EphA2 precursor						activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding			lung(3)|central_nervous_system(3)|stomach(2)|ovary(2)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)	ctccgtctccaaaaaaaaaaa	0.199													3	4	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16940622	16940622	+	5'Flank	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16940622delT	uc009vos.1	-						NBPF1_uc001aza.3_5'Flank|NBPF1_uc001azb.1_5'Flank|NBPF1_uc001azc.1_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AAAGAAAAACTTTTTTTTTCA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20487739	20487740	+	IGR	DEL	CC	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20487739_20487740delCC								PLA2G2F (10860 upstream) : PLA2G2C (2744 downstream)																							tagattttttCCCCCCTCTCTC	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20487751	20487751	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20487751delT								PLA2G2F (10872 upstream) : PLA2G2C (2733 downstream)																							CCCCTCTCTCTTTTTTTTTTT	0.090													4	3	---	---	---	---	
HSPC157	29092	broad.mit.edu	37	1	22353618	22353618	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22353618delA	uc001bfm.3	+						HSPC157_uc001bfn.3_Intron	NR_023918				Homo sapiens HSPC157 mRNA, complete cds.												0						AAGAAGTAATAAAAGGGTGTT	0.393													4	2	---	---	---	---	
TRNAU1AP	54952	broad.mit.edu	37	1	28898712	28898713	+	Intron	DEL	TG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28898712_28898713delTG	uc001bqi.2	+						TRNAU1AP_uc001bqh.2_Intron|TRNAU1AP_uc010ofw.1_Intron	NM_017846	NP_060316	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine associated protein 1						selenocysteine incorporation	cytoplasm|nucleus	nucleotide binding|RNA binding				0						ACCCtttttttgtgtgtgtgtg	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30157988	30157989	+	IGR	DEL	AA	-	-	rs112624943		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30157988_30157989delAA								PTPRU (504673 upstream) : None (None downstream)																							cagggactagaaaagcaagaag	0.000													2	5	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34012330	34012330	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34012330delT	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCATCTGACCTTTTTTTTTTT	0.388													3	4	---	---	---	---	
MAP7D1	55700	broad.mit.edu	37	1	36644331	36644333	+	In_Frame_Del	DEL	GGA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36644331_36644333delGGA	uc001bzz.2	+	11	2148_2150	c.1932_1934delGGA	c.(1930-1935)GCGGAG>GCG	p.E645del	MAP7D1_uc001caa.2_In_Frame_Del_p.E613del|MAP7D1_uc001cab.2_In_Frame_Del_p.E608del|MAP7D1_uc001cac.2_In_Frame_Del_p.E345del|MAP7D1_uc001cad.2_In_Frame_Del_p.E182del	NM_018067	NP_060537	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	645	Potential.					cytoplasm|spindle				ovary(3)|breast(2)	5		Myeloproliferative disorder(586;0.0393)				AGGCCCGggcggagcgggaggcg	0.389													3	5	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39854520	39854520	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39854520delC	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGCAtttttctttttctttt	0.194													4	2	---	---	---	---	
KIAA0467	23334	broad.mit.edu	37	1	43897875	43897875	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43897875delA	uc001cjk.1	+							NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				tctcatgaggaagtgtaGCTC	0.274													23	13	---	---	---	---	
RNF220	55182	broad.mit.edu	37	1	44984562	44984562	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44984562delA	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						caaaaaaaacaaaaaaaaaaa	0.020													3	3	---	---	---	---	
TESK2	10420	broad.mit.edu	37	1	45858374	45858374	+	Intron	DEL	A	-	-	rs111558684		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45858374delA	uc001cns.1	-						TESK2_uc009vxr.1_Intron|TESK2_uc010olo.1_Intron|TESK2_uc009vxs.1_Intron	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2						actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					actctgtctcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
JAK1	3716	broad.mit.edu	37	1	65414028	65414028	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65414028delA	uc001dbu.1	-						JAK1_uc009wam.1_Intron	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		GAGTGTATCTAAAAAGCTATC	0.388			Mis		ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68137292	68137292	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68137292delA								SERBP1 (241169 upstream) : GADD45A (13591 downstream)																							TACAGAGTACAAAAAAATACT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	79216517	79216517	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79216517delT								IFI44 (86756 upstream) : ELTD1 (138934 downstream)																							CTTTGAAGTATTTTTTTTAAA	0.393													4	2	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	85990846	85990846	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85990846delT	uc001dlc.2	-							NM_001134445	NP_001127917	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	AGATGCTGACTTTTTTTTCTT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	112752544	112752544	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112752544delA								KCND3 (220767 upstream) : CTTNBP2NL (186256 downstream)																							gaatgcaactaaagttgtaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	113794677	113794677	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113794677delT								LRIG2 (127335 upstream) : MAGI3 (138798 downstream)																							acttctgctctttttttttta	0.010													3	3	---	---	---	---	
ZNF697	90874	broad.mit.edu	37	1	120180381	120180387	+	Intron	DEL	ACTTAAC	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120180381_120180387delACTTAAC	uc001ehy.1	-							NM_001080470	NP_001073939	Q5TEC3	ZN697_HUMAN	zinc finger protein 697						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GTGATGGCTGACTTAACAGGTTTTGGA	0.314													61	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142663441	142663442	+	Intron	INS	-	A	A	rs147458002		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142663441_142663442insA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		TCACTACAGGTCATTTCCCCTG	0.307													2	4	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145028541	145028541	+	Intron	DEL	G	-	-	rs66503271		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145028541delG	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TCTCAGATGTGTTTTTTTCCT	0.418			T	PDGFRB	MPD								3	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	146215418	146215418	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146215418delA	uc001emp.3	+							NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GTTAGAAAAGAAAAAGGACAG	0.353													4	2	---	---	---	---	
OTUD7B	56957	broad.mit.edu	37	1	149981891	149981892	+	Intron	DEL	CA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149981891_149981892delCA	uc001etn.2	-							NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CTCCCTCTCTcacacacacaca	0.356													4	2	---	---	---	---	
RIT1	6016	broad.mit.edu	37	1	155880760	155880761	+	Intron	INS	-	A	A	rs72508348		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155880760_155880761insA	uc001fmh.1	-						RIT1_uc010pgr.1_Intron	NM_006912	NP_008843	Q92963	RIT1_HUMAN	Ras-like without CAAX 1						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			breast(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			AGAAACCCCCCCATCTTCACCC	0.460													3	5	---	---	---	---	
SEMA4A	64218	broad.mit.edu	37	1	156143903	156143903	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156143903delA	uc001fnl.2	+						SEMA4A_uc009wrq.2_Intron|SEMA4A_uc001fnm.2_Intron|SEMA4A_uc001fnn.2_Intron|SEMA4A_uc001fno.2_Intron	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor						axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					aatccgtctcaaaaaaaaaaa	0.080													2	5	---	---	---	---	
IQGAP3	128239	broad.mit.edu	37	1	156499845	156499846	+	Intron	DEL	CA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156499845_156499846delCA	uc001fpf.2	-							NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TATATGcacgcacacacacaca	0.460													3	3	---	---	---	---	
LMX1A	4009	broad.mit.edu	37	1	165247767	165247767	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165247767delT	uc001gcy.1	-						LMX1A_uc001gcz.1_Intron	NM_177398	NP_796372	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)					CTGCCACAAGTTTTTTTTTCC	0.458													4	2	---	---	---	---	
ADCY10	55811	broad.mit.edu	37	1	167817454	167817454	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167817454delT	uc001ger.2	-						ADCY10_uc009wvk.2_Intron|ADCY10_uc010plj.1_Intron|ADCY10_uc009wvl.2_Intron	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10						intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						gcctggctaatttttttgtat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181803312	181803312	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181803312delA								CACNA1E (32599 upstream) : ZNF648 (220395 downstream)																							tagctagactaaaaaaggggg	0.000													4	2	---	---	---	---	
NR5A2	2494	broad.mit.edu	37	1	200000277	200000277	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200000277delA	uc001gvb.2	+						NR5A2_uc001gvc.2_Intron|NR5A2_uc009wzg.1_Intron	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2						embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					GTCCATCTCCAAAACAGTGCT	0.413													4	2	---	---	---	---	
CACNA1S	779	broad.mit.edu	37	1	201025776	201025776	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201025776delT	uc001gvv.2	-							NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TGGGCAACTGTTTTTTGATTT	0.542													4	2	---	---	---	---	
PPP2R5A	5525	broad.mit.edu	37	1	212507641	212507641	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212507641delT	uc001hjb.2	+						PPP2R5A_uc010ptd.1_Intron	NM_006243	NP_006234	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B						negative regulation of establishment of protein localization in plasma membrane|negative regulation of lipid kinase activity|positive regulation of protein dephosphorylation|signal transduction	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex	kinase binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		ttttctttcctttttttttga	0.020													4	2	---	---	---	---	
RPS6KC1	26750	broad.mit.edu	37	1	213417437	213417438	+	Intron	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213417437_213417438insT	uc010ptr.1	+						RPS6KC1_uc001hkd.2_Intron|RPS6KC1_uc010pts.1_Intron|RPS6KC1_uc010ptt.1_Intron|RPS6KC1_uc010ptu.1_Intron|RPS6KC1_uc010ptv.1_Intron|RPS6KC1_uc001hke.2_Intron	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide						cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		GCACACTTACATTTTTTTTTCT	0.282													4	2	---	---	---	---	
PTPN14	5784	broad.mit.edu	37	1	214531544	214531547	+	Intron	DEL	CAAA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214531544_214531547delCAAA	uc001hkk.1	-							NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TTTTATGCATCAAACAGTTTATAT	0.387													11	7	---	---	---	---	
IARS2	55699	broad.mit.edu	37	1	220277248	220277248	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220277248delT	uc001hmc.2	+							NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	CGATACATAATTTTAATAAAG	0.174													4	2	---	---	---	---	
OBSCN	84033	broad.mit.edu	37	1	228429545	228429545	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228429545delA	uc009xez.1	+						OBSCN_uc001hsn.2_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				tgtggaatccaaaaatgttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	228728527	228728527	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228728527delG								RNF187 (44639 upstream) : DUSP5P (52130 downstream)																							gggtcagctaggaatctctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	1551633	1551634	+	IGR	DEL	CA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1551633_1551634delCA								TPO (5135 upstream) : PXDN (84026 downstream)																							caccacccaccacacacacaca	0.094													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	3028413	3028413	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3028413delA	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																		AGTTTCCGGGAATCGTGTGGA	0.572													4	2	---	---	---	---	
YWHAQ	10971	broad.mit.edu	37	2	9727383	9727384	+	Intron	DEL	AA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9727383_9727384delAA	uc002qzw.2	-						YWHAQ_uc002qzx.2_Intron	NM_006826	NP_006817	P27348	1433T_HUMAN	tyrosine 3/tryptophan 5 -monooxygenase						negative regulation of transcription, DNA-dependent	centrosome|nucleus	protein N-terminus binding			breast(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.241)		ATTCAACTTGAAAACCTGCCTA	0.337													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23592331	23592331	+	IGR	DEL	A	-	-	rs75825710		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23592331delA								None (None upstream) : KLHL29 (163124 downstream)																							agccagatacaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23940662	23940662	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23940662delA								KLHL29 (9181 upstream) : ATAD2B (30879 downstream)																							CAACACAAGCAAAAGGGCATG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	27403107	27403107	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27403107delT								TCF23 (27374 upstream) : SLC5A6 (19352 downstream)																							TTGAAGAGAATTTTTTTTTTA	0.229													4	2	---	---	---	---	
TTC27	55622	broad.mit.edu	37	2	33042315	33042315	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33042315delA	uc002rom.2	+						TTC27_uc010ymx.1_Intron|TTC27_uc002ron.2_Intron	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1						cctgtatcttaaaaaaaaaaa	0.119													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	39961343	39961343	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39961343delA								TMEM178 (16242 upstream) : THUMPD2 (1857 downstream)																							caaaagccccatggtcaaggt	0.000													4	2	---	---	---	---	
TTC7A	57217	broad.mit.edu	37	2	47187572	47187572	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47187572delC	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc002rvn.1_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GGGGTACAGACCCATCCCTCT	0.453													4	2	---	---	---	---	
BCL11A	53335	broad.mit.edu	37	2	60767269	60767270	+	Intron	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60767269_60767270insT	uc002sae.1	-						BCL11A_uc002sab.2_Intron|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Intron|BCL11A_uc002saf.1_Intron	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1						negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			AAGTTAGAATCTTTTTTTTTAA	0.302			T	IGH@	B-CLL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64904375	64904375	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64904375delT								SERTAD2 (23329 upstream) : SLC1A4 (311204 downstream)																							GTTACAGCACTTTTTTTTTTC	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67777895	67777897	+	IGR	DEL	TCC	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67777895_67777897delTCC								ETAA1 (140362 upstream) : C1D (491436 downstream)																							TCCAGCTCAGTCCTCCTCCTCCT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	72059539	72059539	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72059539delC								DYSF (145647 upstream) : CYP26B1 (296828 downstream)																							agcttctcttcccctcctcct	0.000													4	2	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77144453	77144453	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77144453delA	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		ATCCTTTAATATTTTTTTAAA	0.244													4	2	---	---	---	---	
PTCD3	55037	broad.mit.edu	37	2	86333630	86333630	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86333630delT	uc002sqw.2	+						POLR1A_uc002sqs.2_5'Flank|POLR1A_uc002sqv.2_5'Flank|PTCD3_uc010ytc.1_Intron	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor							mitochondrion	protein binding			ovary(1)	1						GAGGTGGCCCTTTGAAATAGG	0.463													4	2	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91828280	91828281	+	Intron	INS	-	T	T	rs146552335	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91828280_91828281insT	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						tctattctctatatGGGCCTCA	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91973492	91973493	+	IGR	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91973492_91973493insA								GGT8P (3339 upstream) : FKSG73 (155666 downstream)																							ccatcaaaagcaaagatacaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92105903	92105904	+	IGR	INS	-	C	C	rs150556462	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92105903_92105904insC								GGT8P (135750 upstream) : FKSG73 (23255 downstream)																							ggaccttgctacaatcactaca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96162034	96162041	+	IGR	DEL	TTTCCAAT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96162034_96162041delTTTCCAAT								FAHD2A (83156 upstream) : TRIM43 (95725 downstream)																							GTCTCTTCTCTTTCCAATAATTGTTACA	0.452													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	98305936	98305939	+	Intron	DEL	CATG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98305936_98305939delCATG	uc002syc.1	+											Homo sapiens cDNA clone IMAGE:5271446.																		AGAAATGACACATGTGAAGAACAC	0.363													4	2	---	---	---	---	
MAP4K4	9448	broad.mit.edu	37	2	102380337	102380338	+	Intron	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102380337_102380338insA	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						TAATCTGACTTAAAAAAAAATC	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106116078	106116078	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106116078delG								FHL2 (60848 upstream) : NCK2 (245276 downstream)																							AGCTctgcctggggacctttg	0.214													4	2	---	---	---	---	
ACTR3	10096	broad.mit.edu	37	2	114700908	114700908	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114700908delG	uc002tkx.1	+						ACTR3_uc010yyc.1_Intron|ACTR3_uc010yyd.1_Intron	NM_005721	NP_005712	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog						cellular component movement|cilium morphogenesis	Arp2/3 protein complex	actin binding|ATP binding			skin(1)	1						tgagagtgctggaaagaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134807080	134807080	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134807080delC								NCKAP5 (481049 upstream) : MGAT5 (204750 downstream)																							aatcaaagaactaaataaatg	0.000													4	2	---	---	---	---	
MGAT5	4249	broad.mit.edu	37	2	135016190	135016191	+	Intron	DEL	TG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135016190_135016191delTG	uc002ttv.1	+							NM_002410	NP_002401	Q09328	MGT5A_HUMAN	N-acetylglucosaminyltransferase V						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)		TACTGGATTTTGTGTGTGTGTG	0.327													4	2	---	---	---	---	
ZEB2	9839	broad.mit.edu	37	2	145227077	145227077	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145227077delT	uc002tvu.2	-						ZEB2_uc002tvv.2_Intron|ZEB2_uc010zbm.1_Intron|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Intron|ZEB2_uc002tvw.2_Intron|ZEB2_uc002tvx.1_Intron	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b							cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		CATAACAGGCTTTTTTTCCCT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	145668128	145668128	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145668128delG	uc002twc.2	+											Homo sapiens hypothetical gene supported by BC043549; BX648102, mRNA (cDNA clone IMAGE:5172341).																		ATGATTTCATGGTGGGTGGGG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	154398883	154398883	+	IGR	DEL	C	-	-	rs58650927		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154398883delC								RPRM (63561 upstream) : GALNT13 (329543 downstream)																							aaaAAAAAAACCGGAAGTAGA	0.045													2	4	---	---	---	---	
PKP4	8502	broad.mit.edu	37	2	159515783	159515783	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159515783delC	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron|PKP4_uc002uaa.2_Intron|uc002uab.1_RNA|PKP4_uc002uac.2_5'Flank	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						GCCAGCTCCTCCTAATTCAGA	0.572										HNSCC(62;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	171536808	171536809	+	Intron	DEL	AA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171536808_171536809delAA	uc002ugc.1	-											Homo sapiens cDNA FLJ25833 fis, clone TST08193.																		GAGGGAGGTGAAAAAAAAAAGA	0.351													4	2	---	---	---	---	
RAPGEF4	11069	broad.mit.edu	37	2	173723625	173723625	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173723625delG	uc002uhv.3	+						RAPGEF4_uc002uhu.2_Intron|RAPGEF4_uc002uhw.3_Intron|RAPGEF4_uc010zec.1_5'Flank|RAPGEF4_uc010zed.1_5'Flank	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			ttctgTTTTTGGGGGGTGCGG	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	193588746	193588746	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193588746delA								TMEFF2 (529102 upstream) : PCGEM1 (25825 downstream)																							atttataaagaaaagtaattt	0.000													4	2	---	---	---	---	
HSPD1	3329	broad.mit.edu	37	2	198351641	198351641	+	3'UTR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198351641delT	uc002uui.2	-	12					HSPD1_uc002uuj.2_3'UTR|HSPD1_uc010zgx.1_3'UTR|HSPD1_uc010fsm.2_3'UTR|HSPD1_uc002uuk.2_3'UTR	NM_002156	NP_002147	P10809	CH60_HUMAN	chaperonin						'de novo' protein folding|activation of caspase activity|B cell cytokine production|B cell proliferation|chaperone-mediated protein complex assembly|interspecies interaction between organisms|isotype switching to IgG isotypes|MyD88-dependent toll-like receptor signaling pathway|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of interferon-alpha production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of macrophage activation|positive regulation of T cell activation|positive regulation of T cell mediated immune response to tumor cell|protein maturation|protein refolding|protein stabilization|response to unfolded protein|T cell activation	cell surface|coated pit|coated vesicle|cytosol|early endosome|extracellular space|lipopolysaccharide receptor complex|mitochondrial inner membrane|mitochondrial matrix|stored secretory granule	ATP binding|ATPase activity|cell surface binding|chaperone binding|DNA replication origin binding|lipopolysaccharide binding|p53 binding|single-stranded DNA binding				0			Epithelial(96;0.225)			TAACTGATGGTTATAGTGATT	0.353													4	2	---	---	---	---	
NRP2	8828	broad.mit.edu	37	2	206575169	206575169	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206575169delA	uc002vaw.2	+						NRP2_uc002vat.2_Intron|NRP2_uc002vau.2_Intron|NRP2_uc002vav.2_Intron|NRP2_uc002vax.2_Intron|NRP2_uc002vay.2_Intron|NRP2_uc010fud.2_Intron	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor						angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						cctggcccatagtaaatgctc	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	222212032	222212032	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222212032delA								None (None upstream) : EPHA4 (70717 downstream)																							AGGCTGAGTCAAAAAAAACTC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	13259528	13259529	+	IGR	INS	-	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13259528_13259529insC								IQSEC1 (144911 upstream) : NUP210 (98208 downstream)																							TCACATGCTAGCCCCCCACCTA	0.411													4	2	---	---	---	---	
XPC	7508	broad.mit.edu	37	3	14187742	14187742	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14187742delC	uc011ave.1	-						XPC_uc011avf.1_Intron|XPC_uc011avg.1_Intron	NM_004628	NP_004619	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C						nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal	cytoplasm|nucleoplasm|XPC complex	bubble DNA binding|damaged DNA binding|loop DNA binding|protein binding|single-stranded DNA binding			ovary(2)|breast(1)	3						GCAGCAAGTTCCCAGCCTGCC	0.607			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		NER	Xeroderma_Pigmentosum				4	2	---	---	---	---	
GRIP2	80852	broad.mit.edu	37	3	14538073	14538073	+	Intron	DEL	A	-	-	rs74739633		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14538073delA	uc011avi.1	-						GRIP2_uc010heh.2_Intron|GRIP2_uc011avh.1_Intron	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1						GGATGCCTGCAAGGAACACGG	0.463													9	5	---	---	---	---	
SLC4A7	9497	broad.mit.edu	37	3	27515044	27515044	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27515044delA	uc011aww.1	-						SLC4A7_uc011awu.1_Intron|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011awx.1_Intron|SLC4A7_uc011awy.1_Intron|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Intron|SLC4A7_uc010hfm.2_Intron	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate							apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						ccaaaaatacaaaaaattagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	28129884	28129884	+	IGR	DEL	A	-	-	rs76586322		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28129884delA								EOMES (365678 upstream) : CMC1 (153240 downstream)																							ACAAGTGCTGAAAAAAAAATG	0.294													4	2	---	---	---	---	
CNOT10	25904	broad.mit.edu	37	3	32727432	32727433	+	Intron	DEL	TT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32727432_32727433delTT	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN	CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2						TAAAAACCACttttttttttct	0.233													4	2	---	---	---	---	
C3orf63	23272	broad.mit.edu	37	3	56655847	56655848	+	3'UTR	DEL	AA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56655847_56655848delAA	uc003did.3	-	23					C3orf63_uc003dib.3_3'UTR|C3orf63_uc003dic.3_3'UTR|C3orf63_uc003die.3_3'UTR	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b											ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		GCTTAGTAGTAAAAAAAAAAAA	0.302													4	2	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69376126	69376126	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69376126delA	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dny.2_Intron	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		ATAAAAAAACAAAAAAATGGG	0.408													4	2	---	---	---	---	
KIAA1524	57650	broad.mit.edu	37	3	108298713	108298717	+	Intron	DEL	TTAAA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108298713_108298717delTTAAA	uc003dxb.3	-						KIAA1524_uc003dxc.1_Intron|KIAA1524_uc010hpw.1_Intron	NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen							cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						AGAGATAAATTTAAATTCAAAAATT	0.268													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112530473	112530473	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112530473delA								CCDC80 (170496 upstream) : CD200R1L (4083 downstream)																							AGAATGATGGAAAATGTTACA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	118301982	118301982	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118301982delA	uc011biu.1	-											Homo sapiens clone HA_003061 mRNA sequence.																		AACAATATTTAaaaaagcacc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	122008226	122008226	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122008226delA								CASR (2883 upstream) : CSTA (35785 downstream)																							CAGATCATGGAAAAAAAACAT	0.488													4	2	---	---	---	---	
PARP14	54625	broad.mit.edu	37	3	122411630	122411631	+	Intron	DEL	GA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122411630_122411631delGA	uc003efq.3	+						PARP14_uc010hrk.2_5'Flank	NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		GTGTGTGACTGAGAGAGAGAGA	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142015938	142015940	+	IGR	DEL	AGA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142015938_142015940delAGA								GK5 (71510 upstream) : XRN1 (9511 downstream)																							TGCTTATTCTAGACTGATTGCTG	0.429													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142902442	142902442	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142902442delT								CHST2 (60632 upstream) : SLC9A9 (81623 downstream)																							CTGTTTGACATTTTAGAGTGA	0.428													4	2	---	---	---	---	
LOC201651	201651	broad.mit.edu	37	3	151502565	151502566	+	RNA	INS	-	AG	AG	rs138882854	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151502565_151502566insAG	uc003ezd.2	+	3		c.1172_1173insAG				NR_026915				Homo sapiens, Similar to arylacetamide deacetylase, clone IMAGE:3934567, mRNA.												0						TGTAAAATGCCAGTTTTAGTCA	0.302													3	3	---	---	---	---	
SI	6476	broad.mit.edu	37	3	164765631	164765632	+	Intron	INS	-	T	T	rs138530288	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164765631_164765632insT	uc003fei.2	-							NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	AATTAAGAAGATTTTTTTTTTA	0.272										HNSCC(35;0.089)			2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184351414	184351417	+	IGR	DEL	TGTG	-	-	rs71950851		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184351414_184351417delTGTG								EPHB3 (51219 upstream) : MAGEF1 (76739 downstream)																							tgtgtgcatatgtgtgtgtgtgtg	0.451													3	3	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184603583	184603583	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184603583delT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc010hye.1_5'Flank	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TTCATATTTCTTTTTTTTTCT	0.234													4	2	---	---	---	---	
IGF2BP2	10644	broad.mit.edu	37	3	185414735	185414735	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185414735delG	uc003fpo.2	-						IGF2BP2_uc010hyi.2_Intron|IGF2BP2_uc010hyj.2_Intron|IGF2BP2_uc010hyk.2_Intron|IGF2BP2_uc010hyl.2_Intron|IGF2BP2_uc003fpp.2_Intron|IGF2BP2_uc003fpq.2_Intron	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CATGATGGTTGGAACACACTA	0.343													4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	186036514	186036514	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186036514delT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	ctgggatggatcccttctcca	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186213918	186213918	+	5'Flank	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186213918delA	uc003fqd.1	-											Homo sapiens cDNA FLJ32735 fis, clone TESTI2001229.																		ggcttctcttaaaaagccaga	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193440131	193440132	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193440131_193440132insT								OPA1 (24532 upstream) : LOC100128023 (270752 downstream)																							aactgctttaattttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3628942	3628943	+	IGR	INS	-	GGTGATAGTTGGTTT	GGTGATAGTTGGTTT	rs34489741		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3628942_3628943insGGTGATAGTTGGTTT								LRPAP1 (94718 upstream) : ADRA2C (139132 downstream)																							ttaaatgcatgggtgATGTGTG	0.238													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7305047	7305048	+	Intron	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7305047_7305048insA	uc003gkb.3	+							NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TTCAAGGAGTTATTAATGGATG	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	15319074	15319075	+	IGR	DEL	TT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15319074_15319075delTT								CPEB2 (247300 upstream) : C1QTNF7 (22485 downstream)																							CCTCTGACAGTTAAGACAACCT	0.426													4	2	---	---	---	---	
GPR125	166647	broad.mit.edu	37	4	22446406	22446406	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22446406delA	uc003gqm.1	-						GPR125_uc010ieo.1_Intron|GPR125_uc003gqn.1_5'Flank|GPR125_uc003gqo.2_Intron	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor						neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				AAGACAACTGAAAAAAAAAAG	0.328													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	27211543	27211544	+	IGR	INS	-	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27211543_27211544insG								STIM2 (185735 upstream) : None (None downstream)																							TGGCTGTACCAGGGGGAGGATG	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	36495289	36495289	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36495289delT								MIR1255B-1 (67239 upstream) : KIAA1239 (751401 downstream)																							AGCCTGGAAGTTTTTTTTCTT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	37452348	37452348	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37452348delT								KIAA1239 (1262 upstream) : C4orf19 (3204 downstream)																							cagagagacatttcaggtaaa	0.095													4	2	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48555678	48555679	+	Intron	INS	-	C	C	rs9992072		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48555678_48555679insC	uc003gyh.1	-						FRYL_uc003gyk.2_Intron|FRYL_uc003gyg.1_Intron|FRYL_uc003gyi.1_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TTaaaaaaaaaaaaaaaaaaaa	0.287													4	2	---	---	---	---	
C4orf22	255119	broad.mit.edu	37	4	81678853	81678853	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81678853delT	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983	Q6V702	CD022_HUMAN	hypothetical protein LOC255119											skin(2)	2						AGgttttttgttttttttgtt	0.209													4	2	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83785932	83785932	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83785932delT	uc003hnf.2	-						SEC31A_uc003hne.2_Intron|SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				ggttttttggttttttttttt	0.159													4	2	---	---	---	---	
PPA2	27068	broad.mit.edu	37	4	106307586	106307587	+	Intron	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106307586_106307587insA	uc003hxl.2	-						PPA2_uc003hxm.2_Intron|PPA2_uc003hxn.2_Intron|PPA2_uc003hxo.2_Intron|PPA2_uc003hxp.2_Intron|PPA2_uc003hxq.2_Intron|PPA2_uc003hxr.2_Intron	NM_176869	NP_789845	Q9H2U2	IPYR2_HUMAN	inorganic pyrophosphatase 2 isoform 1 precursor						diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)		ATTACAGAAATAGATTTCAAGG	0.267													25	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111674833	111674834	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111674833_111674834insT								PITX2 (111716 upstream) : MIR297 (106904 downstream)																							TTCCAACTTCATTTTTTTTTAC	0.361													4	2	---	---	---	---	
PCDH10	57575	broad.mit.edu	37	4	134076376	134076376	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134076376delA	uc003iha.2	+							NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		TTGGAGAGTTAATGTTAGGAA	0.333													4	2	---	---	---	---	
ARHGAP10	79658	broad.mit.edu	37	4	148831168	148831168	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148831168delT	uc003ilf.2	+						ARHGAP10_uc003ilg.2_Intron	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10						apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		ttttcttttctttttttttga	0.209													5	3	---	---	---	---	
RXFP1	59350	broad.mit.edu	37	4	159442840	159442841	+	5'Flank	INS	-	TGTGTGTG	TGTGTGTG	rs34191976		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159442840_159442841insTGTGTGTG	uc003ipz.2	+						RXFP1_uc010iqj.1_5'Flank|RXFP1_uc011cja.1_5'Flank|RXFP1_uc010iqo.2_5'Flank|RXFP1_uc011cjb.1_5'Flank|RXFP1_uc010iqk.2_5'Flank|RXFP1_uc011cjc.1_5'Flank|RXFP1_uc011cjd.1_5'Flank|RXFP1_uc010iql.2_5'Flank|RXFP1_uc011cje.1_5'Flank|RXFP1_uc010iqm.2_5'Flank|RXFP1_uc011cjf.1_5'Flank|RXFP1_uc010iqn.2_5'Flank	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1							integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		CTTTTCAGCTTTGTGTGTGTGT	0.342													1	9	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186242257	186242258	+	Intron	DEL	AT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186242257_186242258delAT	uc003ixh.2	+						SNX25_uc010ish.2_Intron|SNX25_uc003ixi.2_Intron	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		AAGAGATTGAATTTAGTTTTGG	0.292													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	96239	96239	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96239delG								None (None upstream) : PLEKHG4B (44134 downstream)																							ACAGTGGTTTGGGATTCAGGC	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4273886	4273886	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4273886delA								IRX1 (672370 upstream) : LOC340094 (760586 downstream)																							TCCAAATTGTAAGGTTCCGCT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8102903	8102903	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8102903delC								MTRR (201670 upstream) : SEMA5A (932235 downstream)																							cttcttattaccttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	9917498	9917498	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9917498delC								LOC285692 (13562 upstream) : FAM173B (308940 downstream)																							GTACAGGTCGCCACTGACTGA	0.507													4	2	---	---	---	---	
ROPN1L	83853	broad.mit.edu	37	5	10442973	10442973	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10442973delC	uc003jex.3	+							NM_031916	NP_114122	Q96C74	ROP1L_HUMAN	ropporin 1-like						ciliary or flagellar motility|signal transduction	cytoplasm|motile cilium	cAMP-dependent protein kinase regulator activity|protein binding			ovary(1)	1						CACAAACATTCCAACACTTGC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13507598	13507599	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13507598_13507599insT								None (None upstream) : DNAH5 (182838 downstream)																							gcaggaaaaGATtttttttcac	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17025195	17025195	+	IGR	DEL	T	-	-	rs66913986		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17025195delT								MYO10 (88810 upstream) : LOC285696 (104942 downstream)																							GTCATCACTGTTGATGGCTTC	0.413													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	27532390	27532390	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27532390delA								CDH9 (493701 upstream) : None (None downstream)																							ccattccctcaagtttcagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	35822916	35822916	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35822916delC								SPEF2 (8204 upstream) : IL7R (34075 downstream)																							CCTTGCTGTGCCCCCACAAAC	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	37287011	37287011	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37287011delT								C5orf42 (37481 upstream) : NUP155 (4930 downstream)																							TCTGCATCAAttttttttttg	0.194													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39766322	39766322	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39766322delT								DAB2 (340987 upstream) : PTGER4 (913710 downstream)																							ATATATACACTTTTTTTTAAC	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	86721388	86721388	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86721388delC								CCNH (12552 upstream) : TMEM161B (769636 downstream)																							ccatcttccaccccacagcac	0.050													4	2	---	---	---	---	
LOC645323	645323	broad.mit.edu	37	5	87852641	87852641	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87852641delT	uc011cua.1	-							NR_015436				Homo sapiens cDNA FLJ34037 fis, clone FCBBF2005439.												0						TGTGTTCTACTTTTTTTTTGC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	89248897	89248898	+	IGR	DEL	TG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89248897_89248898delTG								None (None upstream) : CETN3 (440633 downstream)																							tggcaaggtttgtagagggaag	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	121529679	121529679	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121529679delT								ZNF474 (40422 upstream) : SNCAIP (117707 downstream)																							aaattcttaatttttttttta	0.020													4	2	---	---	---	---	
SNX24	28966	broad.mit.edu	37	5	122278643	122278644	+	Intron	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122278643_122278644insT	uc011cwo.1	+						SNX24_uc003ktf.2_Intron|SNX24_uc010jcy.2_Intron	NM_014035	NP_054754	Q9Y343	SNX24_HUMAN	SBBI31 protein						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		GATCTTCTAAATTTTTTTTAAA	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122785081	122785082	+	IGR	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122785081_122785082insA								CEP120 (25829 upstream) : CSNK1G3 (62711 downstream)																							catggatgctgaaaaaaagaca	0.025													4	2	---	---	---	---	
VDAC1	7416	broad.mit.edu	37	5	133316325	133316326	+	Intron	INS	-	A	A	rs55708320		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133316325_133316326insA	uc003kyp.1	-						VDAC1_uc003kyq.1_Intron|VDAC1_uc003kyr.1_Intron	NM_003374	NP_003365	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1						apoptosis|interspecies interaction between organisms	mitochondrial nucleoid|mitochondrial outer membrane|plasma membrane|pore complex	porin activity|protein binding|voltage-gated anion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	TGGGCTTTCttaaaaaaaaaaa	0.446													5	4	---	---	---	---	
MYOT	9499	broad.mit.edu	37	5	137093938	137093938	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137093938delT	uc011cye.1	+							NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b						muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			agctcagggatttttttgtgg	0.000													4	2	---	---	---	---	
CYFIP2	26999	broad.mit.edu	37	5	156788234	156788235	+	Intron	DEL	TG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156788234_156788235delTG	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			tgcctgtgtttgtgtgtgtgtg	0.317													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157823586	157823586	+	IGR	DEL	A	-	-	rs113839353		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157823586delA								CLINT1 (537418 upstream) : EBF1 (299338 downstream)																							GAAAAAAATTAAAAAAAAAAT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159895498	159895502	+	Intron	DEL	CTTAT	-	-	rs3217222		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159895498_159895502delCTTAT	uc003lyl.3	+											Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 2005635.																		TTATTATGTACTTATCTTCTGTTTG	0.341													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175070496	175070497	+	IGR	INS	-	TG	TG			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175070496_175070497insTG								SFXN1 (114875 upstream) : HRH2 (14543 downstream)																							gtgtgtgtgcatgtgtgtgtgt	0.045													4	2	---	---	---	---	
RNF44	22838	broad.mit.edu	37	5	175958155	175958155	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175958155delG	uc003mek.1	-						RNF44_uc011dfo.1_Intron|RNF44_uc003mel.1_5'Flank	NM_014901	NP_055716	Q7L0R7	RNF44_HUMAN	ring finger protein 44								zinc ion binding				0	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAACCCTGTGGAAGGCCCAT	0.622													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	176172757	176172758	+	IGR	INS	-	GT	GT	rs146835685	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176172757_176172758insGT								TSPAN17 (86699 upstream) : UNC5A (64802 downstream)																							AAGCCGTGGGAgtgtgtgtgtg	0.470													5	3	---	---	---	---	
RASGEF1C	255426	broad.mit.edu	37	5	179562045	179562046	+	Intron	INS	-	C	C	rs149596700	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179562045_179562046insC	uc003mlq.2	-						RASGEF1C_uc003mlr.2_Intron|RASGEF1C_uc003mlp.3_Intron	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCTGTCCCCACCCCCCCCGTC	0.406													6	3	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	529405	529409	+	Intron	DEL	AAAGA	-	-	rs10608942		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:529405_529409delAAAGA	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GAGGGCTGGCAAAGAAAAGTCTTCT	0.483													5	4	---	---	---	---	
SNRNP48	154007	broad.mit.edu	37	6	7611128	7611128	+	3'UTR	DEL	C	-	-	rs10717454		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7611128delC	uc003mxr.2	+	9					SNRNP48_uc003mxs.2_RNA	NM_152551	NP_689764	Q6IEG0	SNR48_HUMAN	U11/U12 snRNP 48K						mRNA processing	cytoplasm|U12-type spliceosomal complex	metal ion binding				0						atcagcgtgacccctgtgcct	0.144													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11175968	11175968	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11175968delA								LOC221710 (37004 upstream) : NEDD9 (7563 downstream)																							acactactttaggatgcgcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	13517794	13517797	+	IGR	DEL	AAAT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13517794_13517797delAAAT								GFOD1 (30007 upstream) : SIRT5 (56995 downstream)																							CTTGACAAACAAATTTAGCCTGAT	0.324													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27822646	27822646	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27822646delT								HIST1H2BN (2672 upstream) : HIST1H2AL (10461 downstream)																							GGTGTTGTACTTTGGCAGTGG	0.403													4	2	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38827845	38827845	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38827845delG	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						ccccgctcctggtggccctgg	0.000													4	2	---	---	---	---	
CYP39A1	51302	broad.mit.edu	37	6	46599961	46599961	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46599961delA	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						tttttaaaggaaaaaatgaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	48399975	48399975	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48399975delA								C6orf138 (321032 upstream) : MUT (999019 downstream)																							cagtacctacaagggagcaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	74606110	74606110	+	IGR	DEL	T	-	-	rs143726285		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74606110delT								CD109 (68070 upstream) : None (None downstream)																							TTTTCTTACCTTTTTTTTACT	0.453													3	5	---	---	---	---	
ME1	4199	broad.mit.edu	37	6	84140689	84140691	+	5'UTR	DEL	CGG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84140689_84140691delCGG	uc003pjy.2	-	1					ME1_uc011dzb.1_5'UTR|ME1_uc011dzc.1_5'UTR	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1						carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)	GCGCCGGGTTcggcggcggggtc	0.340													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	86403524	86403526	+	IGR	DEL	TGT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86403524_86403526delTGT								SNHG5 (15073 upstream) : None (None downstream)																							agggagTTGCTGTTGACATCCAT	0.276													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	99809534	99809535	+	IGR	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99809534_99809535insA								C6orf168 (12003 upstream) : COQ3 (7814 downstream)																							agggcatatttttaaggacact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	104514005	104514005	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104514005delC								None (None upstream) : HACE1 (661963 downstream)																							gctttaaacaccatcgacaca	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	114774443	114774443	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114774443delA								HS3ST5 (110903 upstream) : None (None downstream)																							TACTGCCTGTAGAGCTCTAAG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116788489	116788490	+	IGR	INS	-	CAG	CAG	rs148790414	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116788489_116788490insCAG								FAM26F (3556 upstream) : BET3L (29163 downstream)																							TGAGTCAGCCCCAGCAGCAGCA	0.475													3	4	---	---	---	---	
NCOA7	135112	broad.mit.edu	37	6	126170688	126170688	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126170688delT	uc010kes.2	+						NCOA7_uc003qae.3_Intron|NCOA7_uc003qah.2_Intron|NCOA7_uc003qai.2_Intron|NCOA7_uc010ket.2_Intron|NCOA7_uc003qaf.2_Intron|NCOA7_uc003qag.2_Intron|NCOA7_uc003qaj.2_Intron	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1						cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		AGTCTTATTCTTTTTTTGCAC	0.328													4	2	---	---	---	---	
SAMD3	154075	broad.mit.edu	37	6	130611372	130611372	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130611372delG	uc003qbx.2	-							NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3 isoform											ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		tatgcggactggcaagtctga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153626515	153626517	+	IGR	DEL	CTC	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153626515_153626517delCTC								RGS17 (174126 upstream) : OPRM1 (705119 downstream)																							ccttccccttctcctcctccttc	0.000													5	3	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162065174	162065174	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162065174delA	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		GAGGGGTTCTAACTCTTGGCT	0.468													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168653012	168653013	+	IGR	INS	-	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168653012_168653013insG								FRMD1 (173173 upstream) : DACT2 (54573 downstream)																							TGCGAGCTTGTGGGAAAGCTTG	0.470													4	2	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6840334	6840334	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6840334delT	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		TATAAAGTCATTTTTTTTTTT	0.204													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	25754896	25754897	+	IGR	INS	-	T	T	rs144826874	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25754896_25754897insT								NPVF (486791 upstream) : MIR148A (234642 downstream)																							CAGCTTTGTGCTTTCCAACCCA	0.510													4	2	---	---	---	---	
BBS9	27241	broad.mit.edu	37	7	33435473	33435473	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33435473delT	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc003tdr.1_Intron|BBS9_uc003tds.1_Intron|BBS9_uc003tdt.2_Intron	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			AGAGGCCCACTTTCCTCATTG	0.398									Bardet-Biedl_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	45254736	45254736	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45254736delT								RAMP3 (30889 upstream) : ADCY1 (359003 downstream)																							CTGTCCTCTCTCCTCTGCTCA	0.537													4	2	---	---	---	---	
SEPT7P2	641977	broad.mit.edu	37	7	45776689	45776689	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45776689delA	uc003tnh.2	-						SEPT7P2_uc003tnf.3_Intron	NR_024271				Homo sapiens mRNA; cDNA DKFZp313J1114 (from clone DKFZp313J1114).												0						AAAGTAGAATAAAAAATAAGC	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47122377	47122377	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47122377delG								None (None upstream) : TNS3 (192376 downstream)																							GAGAAGTGATGGGAAAACATC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52320113	52320113	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52320113delA								COBL (935598 upstream) : POM121L12 (783236 downstream)																							agcaaataagaaaaaaaaatg	0.010													4	2	---	---	---	---	
TPST1	8460	broad.mit.edu	37	7	65706477	65706477	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65706477delT	uc003tuw.2	+						TPST1_uc010kzy.2_Intron|TPST1_uc010kzz.2_Intron|TPST1_uc010laa.2_Intron	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1						inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						TTATACTTCATTTTTTCATTT	0.348													4	2	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76627231	76627232	+	Intron	INS	-	GT	GT	rs143036674		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76627231_76627232insGT	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						gaagtgtgcaggtgtggaggtg	0.079													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	85846496	85846496	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85846496delA								None (None upstream) : GRM3 (426734 downstream)																							TTCCCTTGGGAAAGGTCCATC	0.483													4	2	---	---	---	---	
PEX1	5189	broad.mit.edu	37	7	92123284	92123284	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92123284delT	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TGTATCAGAGTTTTTTTTTTG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	101431647	101431647	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101431647delT								MYL10 (159071 upstream) : CUX1 (27645 downstream)																							GCCCAATCCATTCCTGCCCAC	0.522													4	2	---	---	---	---	
NAPEPLD	222236	broad.mit.edu	37	7	102744162	102744162	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102744162delT	uc003vbc.2	-						NAPEPLD_uc003vbd.2_Intron|NAPEPLD_uc011klj.1_Intron|NAPEPLD_uc003vbe.2_Intron	NM_198990	NP_945341	Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D						phospholipid catabolic process	membrane	metal ion binding			skin(1)	1						CATTTTCTAATACAGTTTTGA	0.333													4	2	---	---	---	---	
NAPEPLD	222236	broad.mit.edu	37	7	102744164	102744164	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102744164delC	uc003vbc.2	-						NAPEPLD_uc003vbd.2_Intron|NAPEPLD_uc011klj.1_Intron|NAPEPLD_uc003vbe.2_Intron	NM_198990	NP_945341	Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D						phospholipid catabolic process	membrane	metal ion binding			skin(1)	1						TTTTCTAATACAGTTTTGAGT	0.338													4	2	---	---	---	---	
ATG9B	285973	broad.mit.edu	37	7	150709314	150709314	+	3'UTR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150709314delT	uc011kvc.1	-	19					NOS3_uc003wif.2_Intron|NOS3_uc011kuy.1_Intron|ATG9B_uc003wig.3_RNA	NM_173681	NP_775952	Q674R7	ATG9B_HUMAN	ATG9 autophagy related 9 homolog B						autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane				ovary(1)	1	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ttgttttttgtttttttttta	0.393													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151986074	151986074	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151986074delA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aatgagaactaaaaattagtc	0.000			N		medulloblastoma								4	2	---	---	---	---	
HTR5A	3361	broad.mit.edu	37	7	154876817	154876818	+	3'UTR	DEL	AC	-	-	rs34932101		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154876817_154876818delAC	uc003wlu.1	+	2						NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A							integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		acacgaacatacacacacacac	0.332													3	3	---	---	---	---	
LPL	4023	broad.mit.edu	37	8	19809198	19809198	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19809198delT	uc003wzk.3	+							NM_000237	NP_000228	P06858	LIPL_HUMAN	lipoprotein lipase precursor						fatty acid biosynthetic process|lipoprotein metabolic process|phospholipid metabolic process|positive regulation of cholesterol storage|positive regulation of sequestering of triglyceride|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	anchored to membrane|chylomicron|plasma membrane|very-low-density lipoprotein particle	heparin binding|lipoprotein lipase activity|phospholipase activity|receptor binding|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	Clofibrate(DB00636)|Gemfibrozil(DB01241)|Orlistat(DB01083)	GTTTTTTCCATTTCATGCAGG	0.398													46	71	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	38537858	38537858	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38537858delT								RNF5P1 (79083 upstream) : TACC1 (47846 downstream)																							tggcagactcttaggtcccac	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49560500	49560500	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49560500delT								UBE2V2 (586048 upstream) : EFCAB1 (62851 downstream)																							AGATGATGGATGGAGAGAGGC	0.552													4	2	---	---	---	---	
REXO1L1	254958	broad.mit.edu	37	8	86786026	86786026	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86786026delA	uc011lfx.1	-						REXO1L1_uc010mah.2_Intron	NM_172239	NP_758439	Q8IX06	GOR_HUMAN	exonuclease GOR							cytoplasm|nucleus	exonuclease activity|nucleic acid binding				0						ggattcattgattttttgaag	0.000													4	2	---	---	---	---	
WDR67	93594	broad.mit.edu	37	8	124141116	124141116	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124141116delA	uc003ypp.1	+						WDR67_uc011lig.1_Intron|WDR67_uc011lih.1_Intron|WDR67_uc003ypq.1_Intron|WDR67_uc003yps.1_Intron|WDR67_uc003ypt.1_Intron|WDR67_uc003ypu.1_Intron	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1							centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			acttcatctcaaaaaaaaaaa	0.104													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134607376	134607377	+	IGR	DEL	GA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134607376_134607377delGA								ST3GAL1 (23193 upstream) : ZFAT (882656 downstream)																							agagaagctggagagagagaga	0.015													4	2	---	---	---	---	
C9orf93	203238	broad.mit.edu	37	9	15777577	15777577	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15777577delT	uc003zmd.2	+						C9orf93_uc003zme.2_Intron|C9orf93_uc011lmu.1_Intron|C9orf93_uc003zmf.1_Intron	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238												0				GBM - Glioblastoma multiforme(50;4.84e-07)		TTTTTGTGCCTTTTTTTCTTT	0.299													36	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	38625582	38625582	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38625582delT								C9orf122 (2307 upstream) : CNTNAP3 (447184 downstream)																							ctcttcttcatccccttctcc	0.080													4	2	---	---	---	---	
APBA1	320	broad.mit.edu	37	9	72070936	72070936	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72070936delT	uc004ahh.2	-							NM_001163	NP_001154	Q02410	APBA1_HUMAN	amyloid beta A4 precursor protein-binding,						axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1						cactacccaattttacattaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	78460985	78460985	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78460985delA								OSTF1 (698872 upstream) : PCSK5 (44575 downstream)																							CGGTATACAGAAAAAAAAAAG	0.388													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	84409059	84409059	+	IGR	DEL	G	-	-	rs632299	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84409059delG								TLE1 (105463 upstream) : FLJ43950 (119293 downstream)																							GATTCTCCCTGGGGctccagt	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	84815028	84815029	+	IGR	INS	-	A	A	rs11388828		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84815028_84815029insA								FLJ46321 (204858 upstream) : RASEF (782288 downstream)																							TCTCATTTAGGAAAAAAAAAAA	0.203													4	2	---	---	---	---	
AGTPBP1	23287	broad.mit.edu	37	9	88327180	88327180	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88327180delA	uc011ltd.1	-						AGTPBP1_uc010mqc.2_Intron|AGTPBP1_uc011lte.1_Intron	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1						C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						attccgtctcaaaaaaaaaag	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93916981	93916981	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93916981delG								SYK (256148 upstream) : AUH (59118 downstream)																							TAGTTGAGGAGGACTCAGTGG	0.552													4	2	---	---	---	---	
WNK2	65268	broad.mit.edu	37	9	95996899	95996899	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95996899delC	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_5'Flank|WNK2_uc010mrc.1_Intron|WNK2_uc010mrd.1_Intron	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						ACTTTTGGAACCCTGTCTGTA	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110469861	110469861	+	IGR	DEL	C	-	-	rs35760940		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110469861delC								KLF4 (217814 upstream) : None (None downstream)																							CATCTTTCAACCCAGTGACCC	0.428													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111302000	111302001	+	IGR	DEL	CT	-	-	rs72037124		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111302000_111302001delCT								None (None upstream) : ACTL7B (314870 downstream)																							GATCATTTTCCTCTTTGTCCAG	0.322													3	3	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119262125	119262125	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119262125delC	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_Intron|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CTGGTCAGTGCCCCTACCTTC	0.448													4	2	---	---	---	---	
ASS1	445	broad.mit.edu	37	9	133364632	133364632	+	Intron	DEL	A	-	-	rs543048	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133364632delA	uc004bzm.2	+						ASS1_uc004bzn.2_Intron|ASS1_uc010mza.2_Intron|ASS1_uc004bzo.2_Intron|ASS1_uc010mzb.2_Intron|ASS1_uc004bzp.2_Intron|ASS1_uc010mzc.2_Intron	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1						arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	tattattattatttttttttt	0.443													9	5	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140524525	140524525	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140524525delC	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AGGCCACTTTCCCAGGAACAT	0.383													4	2	---	---	---	---	
CACNA1B	774	broad.mit.edu	37	9	140777551	140777552	+	Intron	INS	-	GGAA	GGAA	rs140080287	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140777551_140777552insGGAA	uc004cog.2	+						uc004cof.1_Intron	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TTCTCGCTGACGGATCACAGTG	0.614													4	2	---	---	---	---	
FAM171A1	221061	broad.mit.edu	37	10	15318181	15318181	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15318181delT	uc001iob.2	-							NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor							integral to membrane				ovary(2)|breast(1)|skin(1)	4						AGAAGttttcttttttttttc	0.149													4	2	---	---	---	---	
ANKRD30A	91074	broad.mit.edu	37	10	37436568	37436568	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37436568delA	uc001iza.1	+							NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TAGAGAGTGCAAAAAAAACAA	0.338													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42719482	42719483	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42719482_42719483insT								None (None upstream) : LOC441666 (107832 downstream)																							tattcaaaatcttttatttatt	0.000													4	2	---	---	---	---	
NDST2	8509	broad.mit.edu	37	10	75564396	75564396	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75564396delA	uc001jvk.2	-						NDST2_uc010qks.1_Intron|NDST2_uc010qkt.1_Intron|NDST2_uc001jvl.1_5'Flank|NDST2_uc009xro.2_Intron|NDST2_uc010qku.1_Intron	NM_003635	NP_003626	P52849	NDST2_HUMAN	heparan glucosaminyl							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			ovary(1)	1	Prostate(51;0.0112)					ctcttatctcaaaaaaaaaaa	0.144													5	3	---	---	---	---	
MYST4	23522	broad.mit.edu	37	10	76663601	76663601	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76663601delG	uc001jwn.1	+						MYST4_uc001jwm.1_Intron|MYST4_uc001jwo.1_Intron|MYST4_uc001jwp.1_Intron	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic						histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					tatcaagggtggagctgtctc	0.010			T	CREBBP	AML								4	2	---	---	---	---	
ARL3	403	broad.mit.edu	37	10	104439027	104439027	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104439027delC	uc001kwa.2	-							NM_004311	NP_004302	P36405	ARL3_HUMAN	ADP-ribosylation factor-like 3						cell cycle|cytokinesis|small GTPase mediated signal transduction	centrosome|cytoplasmic microtubule|Golgi membrane|midbody|nucleus|photoreceptor connecting cilium|spindle microtubule	GDP binding|GTP binding|metal ion binding|microtubule binding				0		Colorectal(252;0.122)		Epithelial(162;4.88e-09)|all cancers(201;1.29e-07)|BRCA - Breast invasive adenocarcinoma(275;0.22)		CAAGCTGCCTCCTGGAAAGGA	0.343													4	2	---	---	---	---	
XPNPEP1	7511	broad.mit.edu	37	10	111665540	111665540	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111665540delT	uc001kyp.1	-						XPNPEP1_uc009xxt.1_Intron|XPNPEP1_uc001kyq.1_Intron|XPNPEP1_uc010qrb.1_Intron	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,						bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		AACAAATATATTTTTTGTAGA	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113810861	113810862	+	IGR	DEL	AA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113810861_113810862delAA								ADRA2A (970201 upstream) : GPAM (98760 downstream)																							CAGGACAATGAAAAAAGAGGAA	0.495													4	2	---	---	---	---	
GPR26	2849	broad.mit.edu	37	10	125435640	125435640	+	Intron	DEL	C	-	-	rs67647506		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125435640delC	uc001lhh.2	+							NM_153442	NP_703143	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26						activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				ctcacaggagccccctgtgga	0.000													5	3	---	---	---	---	
RRM1	6240	broad.mit.edu	37	11	4177969	4177969	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4177969delT	uc009yej.2	+							NM_001033		P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	TGTGGATGCCTTTttctctcc	0.219													4	2	---	---	---	---	
GALNTL4	374378	broad.mit.edu	37	11	11447164	11447164	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11447164delT	uc001mjo.2	-							NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		CAAAGAAAACTTTTTTTTTTT	0.393													3	3	---	---	---	---	
USP47	55031	broad.mit.edu	37	11	11880572	11880573	+	Intron	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11880572_11880573insT	uc001mjq.1	+						USP47_uc001mjr.2_Intron|USP47_uc001mjs.2_Intron	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47						base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		ggcagtgtcagttttttttaag	0.000													4	2	---	---	---	---	
TEAD1	7003	broad.mit.edu	37	11	12889263	12889263	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12889263delG	uc001mkj.3	+							NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		AGGTCATCATGGGGTCAGGCT	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15906716	15906716	+	IGR	DEL	C	-	-	rs5789925		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15906716delC								INSC (637964 upstream) : SOX6 (81280 downstream)																							CAGAGAGAAACAAGCCTGGCC	0.428													2	4	---	---	---	---	
LDHAL6A	160287	broad.mit.edu	37	11	18477953	18477954	+	Intron	INS	-	CT	CT	rs138754091	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18477953_18477954insCT	uc001mop.1	+						LDHAL6A_uc001moq.2_5'UTR	NM_001144071	NP_001137543	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A						glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	CTGTTCCTTTCCTCTCTCTCTC	0.554													4	3	---	---	---	---	
LUZP2	338645	broad.mit.edu	37	11	24759548	24759549	+	Intron	INS	-	A	A	rs150287288	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24759548_24759549insA	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2						TAAGGTTATTTAAAAAAAAATC	0.307													4	2	---	---	---	---	
ABTB2	25841	broad.mit.edu	37	11	34377191	34377191	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34377191delT	uc001mvl.1	-							NM_145804	NP_665803	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing								DNA binding			central_nervous_system(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				TTCCACTGCCTGCTTATTTGC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61937188	61937188	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61937188delC								INCENP (16553 upstream) : SCGB1D1 (20522 downstream)																							GGAGCCCTGGCCAAGAAGCCA	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	66051993	66051994	+	IGR	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66051993_66051994insA								CNIH2 (310 upstream) : YIF1A (58 downstream)																							GGGCAATGCAGAGGCGCAGAGG	0.525													4	2	---	---	---	---	
SYT12	91683	broad.mit.edu	37	11	66807146	66807146	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66807146delA	uc009yrl.2	+						SYT12_uc001oju.2_Intron	NM_177963	NP_808878	Q8IV01	SYT12_HUMAN	synaptotagmin XII							cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1						CTTCCTAGCTAAGGGATGCAG	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	67990640	67990640	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67990640delA								SUV420H1 (9572 upstream) : C11orf24 (38165 downstream)																							actctgtctcaaaaaaaaaga	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69317378	69317379	+	IGR	DEL	CC	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69317378_69317379delCC								MYEOV (160929 upstream) : CCND1 (138494 downstream)																							AACTCACACACCCCACTCTGGC	0.614													4	2	---	---	---	---	
KRTAP5-11	440051	broad.mit.edu	37	11	71294045	71294045	+	5'Flank	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71294045delT	uc001oqu.2	-							NM_001005405	NP_001005405	Q6L8G4	KR511_HUMAN	keratin associated protein 5-11							keratin filament					0						CAGAGCTCTATTTTTTTCCTC	0.458													4	2	---	---	---	---	
FCHSD2	9873	broad.mit.edu	37	11	72559515	72559515	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72559515delC	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			tcccaatgatccaggtagaat	0.000													4	2	---	---	---	---	
ALG8	79053	broad.mit.edu	37	11	77824769	77824769	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77824769delA	uc001oza.1	-						ALG8_uc001oyz.1_Intron|ALG8_uc009yux.1_Intron	NM_024079	NP_076984	Q9BVK2	ALG8_HUMAN	dolichyl pyrophosphate Glc1Man9GlcNAc2						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity|dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|pancreas(1)	3	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			aaacaaaaacaaaaaaaaaaa	0.164													5	3	---	---	---	---	
PRCP	5547	broad.mit.edu	37	11	82549744	82549747	+	Intron	DEL	CGCC	-	-	rs111897175	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82549744_82549747delCGCC	uc001ozs.2	-						PRCP_uc001ozr.2_Intron	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein						blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1						gcagcttcaacgccctgttcttta	0.147													9	4	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	84793294	84793294	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84793294delT	uc001pak.2	-							NM_001142699	NP_001136171	Q15700	DLG2_HUMAN	chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				AAAATACTGCTTTTTTTAAAa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	108885032	108885032	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108885032delT								DDX10 (73386 upstream) : C11orf87 (407843 downstream)																							tatcattaactttttttatat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116262555	116262555	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116262555delA								CADM1 (887314 upstream) : BUD13 (356333 downstream)																							AGCTCAAAGTAAAGCAAAGGG	0.443													4	2	---	---	---	---	
TRIM29	23650	broad.mit.edu	37	11	119994445	119994446	+	Intron	INS	-	CT	CT			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119994445_119994446insCT	uc001pwz.2	-						TRIM29_uc001pwx.2_5'Flank|TRIM29_uc001pwy.2_Intron|TRIM29_uc010rzi.1_Intron|TRIM29_uc010rzj.1_Intron|TRIM29_uc001pxa.2_Intron	NM_012101	NP_036233	Q14134	TRI29_HUMAN	tripartite motif protein TRIM29						transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		CCTGTCCTTCCCTCTCTCTCTC	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123586212	123586212	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123586212delC								SCN3B (60897 upstream) : ZNF202 (8785 downstream)																							CAGATGATGACCACAGCATTT	0.398													4	2	---	---	---	---	
ERC1	23085	broad.mit.edu	37	12	1340838	1340838	+	Intron	DEL	T	-	-	rs111550176		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1340838delT	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc010sdv.1_Intron|ERC1_uc009zdp.2_Intron|ERC1_uc001qje.2_Intron	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			gaagaacaacttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	11596746	11596746	+	IGR	DEL	A	-	-	rs35092836		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11596746delA								PRB2 (48248 upstream) : ETV6 (206042 downstream)																							CACAGGTGGCAAAAAAAAAAG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	14437630	14437630	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14437630delC								GRIN2B (304608 upstream) : ATF7IP (80981 downstream)																							TTAGCTGCCTCCACTATCAGG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	22872919	22872919	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22872919delC								ETNK1 (29312 upstream) : SOX5 (812313 downstream)																							ATGTACTCTGCCCACTACAGT	0.239													4	2	---	---	---	---	
PPFIBP1	8496	broad.mit.edu	37	12	27697148	27697148	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27697148delG	uc001ric.1	+						PPFIBP1_uc001rhy.1_Intron|PPFIBP1_uc001rhz.1_Intron|PPFIBP1_uc010sjr.1_Intron|PPFIBP1_uc001rib.1_Intron|PPFIBP1_uc001ria.2_Intron|PPFIBP1_uc001rid.1_Intron	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1						cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					GTGGACATTTGGAGGCAGAGG	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33698346	33698346	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33698346delG								SYT10 (105592 upstream) : ALG10 (476870 downstream)																							CACAAATTGAGGAGCTTCCCA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	43253879	43253879	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43253879delT								PRICKLE1 (270307 upstream) : ADAMTS20 (494134 downstream)																							tcttcttccctttccttccct	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47049588	47049588	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47049588delA								SLC38A2 (282943 upstream) : SLC38A4 (108956 downstream)																							AGGTCCATTTAAAAAAAGAGA	0.393													4	2	---	---	---	---	
KRT71	112802	broad.mit.edu	37	12	52940438	52940438	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52940438delG	uc001sao.2	-							NM_033448	NP_258259	Q3SY84	K2C71_HUMAN	keratin 71								structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.194)		AGCCCCTTCTGGGGCTGGCAC	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55736624	55736625	+	IGR	INS	-	A	A	rs140301148	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55736624_55736625insA								OR6C3 (10205 upstream) : OR6C75 (22270 downstream)																							GATCAGCAATGAAAAACTACAC	0.287													1	5	---	---	---	---	
LEMD3	23592	broad.mit.edu	37	12	65612564	65612565	+	Intron	DEL	TT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65612564_65612565delTT	uc001ssl.1	+						LEMD3_uc009zqo.1_Intron	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3						negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		attgttcaactttttttttttt	0.119													4	2	---	---	---	---	
RAB3IP	117177	broad.mit.edu	37	12	70134919	70134919	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70134919delG	uc001svp.2	+						uc001svj.1_5'Flank|uc001svk.2_5'Flank|RAB3IP_uc001svl.1_Intron|RAB3IP_uc001svm.2_Intron|RAB3IP_uc001svn.2_Intron|RAB3IP_uc001svo.2_Intron|RAB3IP_uc001svq.2_Intron|RAB3IP_uc001svr.2_Intron|RAB3IP_uc001svs.2_Intron	NM_175623	NP_783322	Q96QF0	RAB3I_HUMAN	RAB3A interacting protein isoform alpha 2						cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			TTAGAGATGTGGGGAAGGGGA	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	94359266	94359268	+	IGR	DEL	CAT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94359266_94359268delCAT								CRADD (70650 upstream) : PLXNC1 (183231 downstream)																							atgtccaagccatcatcatcatc	0.108													4	2	---	---	---	---	
NEDD1	121441	broad.mit.edu	37	12	97329244	97329244	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97329244delC	uc001teu.3	+						NEDD1_uc001tev.3_Intron|NEDD1_uc010svc.1_Intron|NEDD1_uc001tew.2_Intron|NEDD1_uc001tex.2_Intron	NM_152905	NP_690869	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally						cell division|G2/M transition of mitotic cell cycle|mitosis	cytosol					0						AGCATCTTTTCCACAATATGA	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	103160456	103160457	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103160456_103160457insT								IGF1 (286078 upstream) : PAH (71647 downstream)																							TGCCTCCTGCCTTGCCATGAAA	0.421													4	2	---	---	---	---	
MVK	4598	broad.mit.edu	37	12	110020121	110020125	+	Intron	DEL	TTTTG	-	-	rs67502370		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110020121_110020125delTTTTG	uc001toy.3	+						MVK_uc009zvk.2_Intron|MVK_uc010sxr.1_Intron|MVK_uc001toz.3_Intron|MVK_uc001tpc.3_Intron	NM_001114185	NP_001107657	Q03426	KIME_HUMAN	mevalonate kinase						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|peroxisome	ATP binding|identical protein binding|mevalonate kinase activity				0						AGCTTGgtttttttgtttgtttgtt	0.205													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114791704	114791704	+	IGR	DEL	A	-	-	rs145772162		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114791704delA								RBM19 (387528 upstream) : TBX5 (32 downstream)																							AAAGAACAGGAAAAAAAAAAA	0.383													4	3	---	---	---	---	
TMEM233	387890	broad.mit.edu	37	12	120078664	120078665	+	3'UTR	INS	-	AG	AG	rs111558498		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120078664_120078665insAG	uc010szd.1	+	3						NM_001136534	NP_001130006	B4DJY2	TM233_HUMAN	hypothetical protein LOC387890						response to biotic stimulus	integral to membrane					0						TGAACAAGAAAAAAAAAAAAAA	0.391													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126647524	126647524	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126647524delT								TMEM132B (503935 upstream) : LOC100128554 (279503 downstream)																							ACAGTAGCTATTAATCAAGTA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127323042	127323042	+	IGR	DEL	A	-	-	rs71095293		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127323042delA								LOC100128554 (365712 upstream) : None (None downstream)																							gctgagagtgagcagttcccc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127746316	127746316	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127746316delC								LOC100128554 (788986 upstream) : None (None downstream)																							CTGATAGTCACCCCACAATAT	0.418													4	2	---	---	---	---	
TMEM132C	92293	broad.mit.edu	37	12	129096946	129096946	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129096946delT	uc001uhs.3	+							NM_001136103	NP_001129575	Q8N3T6	T132C_HUMAN	transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1						GAAACTTGTATTTTTTTTTCC	0.478													4	2	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	130197951	130197951	+	Intron	DEL	T	-	-	rs67383447		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130197951delT	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTTTTTGTTGttttttttttt	0.333													4	2	---	---	---	---	
FGF9	2254	broad.mit.edu	37	13	22246487	22246488	+	Intron	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22246487_22246488insA	uc001uog.2	+							NM_002010	NP_002001	P31371	FGF9_HUMAN	fibroblast growth factor 9 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|male gonad development|positive regulation of cell division	extracellular space	growth factor activity|heparin binding				0		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		TGCCAGCTCCGAAAAAAAAATG	0.421													4	2	---	---	---	---	
SPATA13	221178	broad.mit.edu	37	13	24827603	24827603	+	Intron	DEL	T	-	-	rs142853641		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24827603delT	uc001upg.1	+						SPATA13_uc001upd.1_Intron|C1QTNF9_uc001upe.2_Intron|SPATA13_uc010tcy.1_Intron|SPATA13_uc010tcz.1_Intron	NM_153023	NP_694568	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		TCAGCGTTGATTAACTAGAGG	0.473													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	30992189	30992190	+	IGR	DEL	TT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30992189_30992190delTT								LOC100188949 (44153 upstream) : HMGB1 (40691 downstream)																							GGCTAATCTCTTTAGGAGAGAA	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31608051	31608051	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31608051delG								C13orf26 (58900 upstream) : HSPH1 (102714 downstream)																							TGCCTCAGGTGCCATCCTTGG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31610735	31610735	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31610735delC								C13orf26 (61584 upstream) : HSPH1 (100030 downstream)																							ctgcacactaccccacccggg	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	37968393	37968393	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37968393delC								CSNK1A1L (288592 upstream) : POSTN (168327 downstream)																							ggggggagatcccctatgtgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	39134952	39134952	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39134952delA								UFM1 (197810 upstream) : FREM2 (126221 downstream)																							AGTGTAGAGGAAAAAAAATGA	0.308													4	2	---	---	---	---	
FREM2	341640	broad.mit.edu	37	13	39328844	39328844	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39328844delA	uc001uwv.2	+							NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2						cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CAGAGTCGCCAAGGCTGAGCT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	47082539	47082539	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47082539delT								C13orf18 (70214 upstream) : LRCH1 (44757 downstream)																							CTTCAGGCCCTTTTCACCCCT	0.423													4	2	---	---	---	---	
LRCH1	23143	broad.mit.edu	37	13	47286357	47286358	+	Intron	DEL	GT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47286357_47286358delGT	uc001vbj.2	+						LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		AATGGATATAGTGTGTGTGTGT	0.391													4	2	---	---	---	---	
TDRD3	81550	broad.mit.edu	37	13	61058253	61058253	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61058253delT	uc001via.2	+						TDRD3_uc010aef.2_Intron|TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		TGGGAGAGGGTTTTTTTTTGA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	61500232	61500232	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61500232delT	uc001vic.1	+											Homo sapiens cDNA FLJ40497 fis, clone TESTI2044892.																		ggccatctgctttatgcagtc	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	74048964	74048964	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74048964delT								KLF5 (397289 upstream) : KLF12 (211186 downstream)																							GAAGTGCTTATTCAGGAATCG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80611179	80611180	+	IGR	DEL	TT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80611179_80611180delTT								NDFIP2 (480974 upstream) : SPRY2 (298934 downstream)																							ctcacaaacctttacgtataac	0.000													4	2	---	---	---	---	
HS6ST3	266722	broad.mit.edu	37	13	96888743	96888744	+	Intron	DEL	CA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96888743_96888744delCA	uc001vmw.2	+							NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					actctctcttcactttcctcca	0.079													4	2	---	---	---	---	
CLYBL	171425	broad.mit.edu	37	13	100273606	100273607	+	Intron	DEL	CT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100273606_100273607delCT	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531	Q8N0X4	CLYBL_HUMAN	citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ATGCCCCACACTCTCGAGTCAT	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	105292150	105292162	+	IGR	DEL	ATTCCACTGTTAC	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105292150_105292162delATTCCACTGTTAC								None (None upstream) : DAOA (826054 downstream)																							gtagaaatgtattccactgttacacggcactca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19664815	19664818	+	Intron	DEL	GGTT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19664815_19664818delGGTT	uc001vvk.1	+						uc001vvl.3_Intron					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																		AGTACTGCAGGGTTATAAGATTAT	0.382													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20637112	20637113	+	IGR	INS	-	TC	TC			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20637112_20637113insTC								OR4N5 (24292 upstream) : OR11G2 (28382 downstream)																							GCTAATTTTTTTCTCCAGCAAA	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22520533	22520534	+	Intron	INS	-	TGTGTG	TGTGTG			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22520533_22520534insTGTGTG	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTTTGCAGATCTGTGTGTGTGT	0.223													6	3	---	---	---	---	
STXBP6	29091	broad.mit.edu	37	14	25377858	25377859	+	Intron	INS	-	C	C	rs138835078	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25377858_25377859insC	uc001wpu.2	-						STXBP6_uc001wpv.2_Intron|STXBP6_uc001wpw.2_Intron|STXBP6_uc001wpx.1_Intron	NM_014178	NP_054897	Q8NFX7	STXB6_HUMAN	amisyn						vesicle-mediated transport	cytoplasm|integral to membrane					0				GBM - Glioblastoma multiforme(265;0.0296)		tctcAGGTCTTCCTCCACAAAT	0.252													3	3	---	---	---	---	
COCH	1690	broad.mit.edu	37	14	31357121	31357122	+	Intron	DEL	TT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31357121_31357122delTT	uc001wqr.2	+						COCH_uc001wqp.2_Intron|COCH_uc001wqq.3_Intron|uc001wqs.2_Intron|COCH_uc001wqt.1_Intron	NM_004086	NP_004077	O43405	COCH_HUMAN	cochlin precursor						sensory perception of sound	proteinaceous extracellular matrix				pancreas(1)|central_nervous_system(1)|skin(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		GAACTTATAGTTAACAGGATTG	0.322													4	2	---	---	---	---	
RTN1	6252	broad.mit.edu	37	14	60074292	60074292	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60074292delG	uc001xen.1	-						RTN1_uc001xem.1_Intron|RTN1_uc001xek.1_Intron|RTN1_uc001xel.1_RNA|RTN1_uc010apl.1_Intron	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A						neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		ACCAAGCTGTGGTTGCTGTGG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	84579494	84579494	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84579494delC								None (None upstream) : None (None downstream)																							gaaacttaatccccagacggg	0.080													4	2	---	---	---	---	
TRIP11	9321	broad.mit.edu	37	14	92505758	92505759	+	Intron	DEL	GT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92505758_92505759delGT	uc001xzy.2	-						TRIP11_uc001xzz.3_Intron	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11						transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		GCAAGAGGAGGTGTGTGAAGAA	0.495			T	PDGFRB	AML								15	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	100660863	100660864	+	IGR	INS	-	A	A	rs139176465	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100660863_100660864insA								DEGS2 (34851 upstream) : YY1 (44238 downstream)																							TCAGACATGTGAAAAGTCCTTT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20463264	20463265	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20463264_20463265insT								None (None upstream) : GOLGA6L6 (273829 downstream)																							tacctgcctaattttttttttt	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22517937	22517938	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22517937_22517938insT								MIR1268 (4657 upstream) : GOLGA8DP (184347 downstream)																							aaactcttcactgtaGTAAAGC	0.238													4	2	---	---	---	---	
FMN1	342184	broad.mit.edu	37	15	33221510	33221510	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33221510delA	uc001zhf.3	-							NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CAGGTTTCTCAAAACCAACTA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	35009502	35009503	+	IGR	DEL	AA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35009502_35009503delAA								GOLGA8B (181280 upstream) : GJD2 (35176 downstream)																							TTCCAGCCTTAAAAATATAGTT	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	35286449	35286450	+	IGR	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35286449_35286450insA								ZNF770 (5995 upstream) : LOC723972 (243077 downstream)																							TAGAGTCTACCAAAAAAAAAAA	0.431													4	4	---	---	---	---	
EIF2AK4	440275	broad.mit.edu	37	15	40291265	40291265	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40291265delA	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Intron	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TTAGCTGTTGAAAAAAAAAAA	0.338													4	3	---	---	---	---	
AP4E1	23431	broad.mit.edu	37	15	51275948	51275948	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51275948delT	uc001zyx.1	+							NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1						intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		CCTAATTGAGTTTTTTTTTAG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	52273988	52273988	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52273988delG								LEO1 (10030 upstream) : MAPK6 (37423 downstream)																							AAAGAAAGGAGGATGGGGTAC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	59710469	59710469	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59710469delG								MYO1E (45398 upstream) : FAM81A (19903 downstream)																							AATGAGCTATGGGGGCAGAGG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63380307	63380308	+	IGR	INS	-	A	A	rs150860625	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63380307_63380308insA								TPM1 (16196 upstream) : LACTB (33724 downstream)																							gaaaaggaaagaaaaaaaaaga	0.218													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	67299575	67299575	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67299575delG								SMAD6 (225240 upstream) : SMAD3 (58620 downstream)																							tgacagatgtgggtggacgaa	0.134													4	2	---	---	---	---	
LOC145837	145837	broad.mit.edu	37	15	69791831	69791831	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69791831delG	uc002asf.1	+						LOC145837_uc002asg.1_Intron|LOC145837_uc010bij.1_Intron					Homo sapiens cDNA clone IMAGE:5189446.												0						CAAGGCCCCCGGCAGGGTGTG	0.353													4	2	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	71922082	71922082	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71922082delT	uc002atb.1	+						THSD4_uc002atd.1_Intron|THSD4_uc010ukg.1_Intron|THSD4_uc002ate.2_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						TCTTTGTTTATTTACCTCCCT	0.463													4	2	---	---	---	---	
PML	5371	broad.mit.edu	37	15	74297800	74297801	+	Intron	INS	-	T	T	rs151124961	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74297800_74297801insT	uc002awv.2	+						PML_uc002awm.2_Intron|PML_uc002awl.2_Intron|PML_uc002awj.1_Intron|PML_uc002awk.2_Intron|PML_uc002awn.2_Intron|PML_uc002awo.2_Intron|PML_uc002awp.2_Intron|PML_uc002awq.2_Intron|PML_uc002awr.2_Intron|PML_uc002aws.2_Intron|PML_uc002awt.2_Intron|PML_uc002awu.2_Intron|PML_uc010ule.1_Intron|PML_uc002aww.1_Intron	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5						TGTTGCTTTGCTTTTTTCCCCG	0.356			T	RARA|PAX5	APL|ALL								3	6	---	---	---	---	
CSPG4	1464	broad.mit.edu	37	15	75967625	75967625	+	3'UTR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75967625delC	uc002baw.2	-	10						NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor						angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						CAAACCAGCTCCAGGGCAGGA	0.597													4	2	---	---	---	---	
NRG4	145957	broad.mit.edu	37	15	76247638	76247638	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76247638delC	uc002bbo.2	-						NRG4_uc010bkm.1_Intron|NRG4_uc002bbn.2_Intron|NRG4_uc010bkn.2_Intron|NRG4_uc010bko.2_Intron	NM_138573	NP_612640	Q8WWG1	NRG4_HUMAN	neuregulin 4							extracellular region|integral to membrane|plasma membrane	growth factor activity				0						agcctggggtcccccaccttg	0.000													4	2	---	---	---	---	
SEMA4B	10509	broad.mit.edu	37	15	90763301	90763302	+	Intron	DEL	GA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90763301_90763302delGA	uc002boy.2	+						SEMA4B_uc002boz.2_Intron|SEMA4B_uc010uqd.1_Intron|SEMA4B_uc002bpa.2_Intron|SEMA4B_uc010bnv.1_5'Flank	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			GCGCAGCCCTGACAGCCATGTC	0.624											OREG0023468	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
SEMA4B	10509	broad.mit.edu	37	15	90763305	90763306	+	Intron	INS	-	CC	CC			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90763305_90763306insCC	uc002boy.2	+						SEMA4B_uc002boz.2_Intron|SEMA4B_uc010uqd.1_Intron|SEMA4B_uc002bpa.2_Intron|SEMA4B_uc010bnv.1_5'Flank	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			AGCCCTGACAGCCATGTCTCCC	0.629													4	3	---	---	---	---	
ST8SIA2	8128	broad.mit.edu	37	15	93010431	93010431	+	3'UTR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93010431delA	uc002bra.2	+	6					ST8SIA2_uc002brb.2_3'UTR	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			ATCTACCCTGAAAATCTCTTC	0.527													4	2	---	---	---	---	
LRRC28	123355	broad.mit.edu	37	15	99845853	99845853	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99845853delT	uc002bva.1	+						LRRC28_uc010urs.1_Intron|LRRC28_uc002bvb.1_Intron|LRRC28_uc010urt.1_Intron|LRRC28_uc002bvc.1_Intron|LRRC28_uc010uru.1_Intron|LRRC28_uc002bvd.1_Intron	NM_144598	NP_653199	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28												0	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			AGCTACTATCTTTTTTTAAAA	0.259													4	2	---	---	---	---	
MEF2A	4205	broad.mit.edu	37	15	100214964	100214964	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100214964delT	uc010urw.1	+						MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Intron|MEF2A_uc002bve.2_Intron|MEF2A_uc002bvg.2_Intron|MEF2A_uc002bvi.2_Intron|MEF2A_uc010bot.2_Intron	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1						apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			TTTTAAAGTATTTTTTTGAAA	0.328													4	2	---	---	---	---	
RPL3L	6123	broad.mit.edu	37	16	1995372	1995372	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1995372delA	uc002cnh.2	-						SEPX1_uc010uvs.1_5'Flank	NM_005061	NP_005052	Q92901	RL3L_HUMAN	ribosomal protein L3-like						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome				0						taaaataaataaaaaaaaaag	0.284													4	2	---	---	---	---	
PDPK1	5170	broad.mit.edu	37	16	2637519	2637519	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2637519delT	uc002cqs.2	+						PDPK1_uc002cqt.2_Intron|PDPK1_uc010bsn.2_Intron|PDPK1_uc002cqu.2_Intron	NM_002613	NP_002604	O15530	PDPK1_HUMAN	3-phosphoinositide dependent protein kinase-1						actin cytoskeleton organization|activation of protein kinase B activity|insulin receptor signaling pathway|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|peptidyl-threonine phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|synaptic transmission|T cell costimulation|T cell receptor signaling pathway	cytosol|nucleoplasm|plasma membrane	3-phosphoinositide-dependent protein kinase activity|ATP binding			central_nervous_system(2)|ovary(1)	3		Ovarian(90;0.17)			Celecoxib(DB00482)	attttgcatctttttttttga	0.149													4	2	---	---	---	---	
ITFG1	81533	broad.mit.edu	37	16	47462448	47462449	+	Intron	DEL	AT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47462448_47462449delAT	uc002eet.2	-						ITFG1_uc010vgh.1_Intron	NM_030790	NP_110417	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1							extracellular region|integral to membrane				ovary(1)|central_nervous_system(1)	2		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				AGCAGGCAACATGTGCTGAAAT	0.233													7	4	---	---	---	---	
FTO	79068	broad.mit.edu	37	16	54093483	54093483	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54093483delA	uc002ehr.2	+						FTO_uc010vha.1_Intron|FTO_uc010cbz.2_Intron|FTO_uc002ehs.2_Intron	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AAGGGGCTGTAAAAGCTCGGT	0.507													4	2	---	---	---	---	
GNAO1	2775	broad.mit.edu	37	16	56247816	56247817	+	Intron	DEL	AG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56247816_56247817delAG	uc002eit.3	+						GNAO1_uc002eiu.3_Intron	NM_138736	NP_620073	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha						dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)				CACTAAAGACAGGGGCGGGAAA	0.450													3	4	---	---	---	---	
SLC12A3	6559	broad.mit.edu	37	16	56921123	56921123	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56921123delT	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	GAGCCCCAACttttttttttt	0.289													4	2	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58631379	58631379	+	Intron	DEL	A	-	-	rs35732148		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58631379delA	uc002env.2	-						CNOT1_uc002enw.2_Intron|CNOT1_uc002enu.3_Intron|CNOT1_uc002enx.2_Intron|CNOT1_uc002enz.1_Intron	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		actctgtctcaaaaaaaaaag	0.114													4	2	---	---	---	---	
CIRH1A	84916	broad.mit.edu	37	16	69171590	69171590	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69171590delT	uc002ews.3	+						CIRH1A_uc002ewr.2_Intron|CIRH1A_uc002ewt.3_Intron|CIRH1A_uc010cfi.2_Intron	NM_032830	NP_116219	Q969X6	CIR1A_HUMAN	cirhin							nucleolus	protein binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.125)		AACTGATAGCTTTAAGGAGGA	0.358													72	44	---	---	---	---	
AARS	16	broad.mit.edu	37	16	70296355	70296355	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70296355delC	uc002eyn.1	-	12	1675	c.1565delG	c.(1564-1566)GGCfs	p.G522fs	AARS_uc010vlu.1_Frame_Shift_Del_p.G352fs	NM_001605	NP_001596	P49588	SYAC_HUMAN	alanyl-tRNA synthetase	522					alanyl-tRNA aminoacylation|tRNA processing	cytosol|soluble fraction	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			pancreas(1)	1		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)	L-Alanine(DB00160)	ACACTCCTGGCCTGTGGACAC	0.532													81	45	---	---	---	---	
KIAA0182	23199	broad.mit.edu	37	16	85698610	85698610	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85698610delT	uc002fix.2	+						KIAA0182_uc002fiw.2_Intron|KIAA0182_uc002fiy.2_Intron|KIAA0182_uc002fiz.2_Intron|KIAA0182_uc010cho.2_Intron	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1								protein binding			large_intestine(3)|ovary(1)|skin(1)	5						CTCAGGCTGCTTTTCTCATAG	0.517													46	32	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	5109688	5109688	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5109688delT	uc002gbf.1	+						uc002gbg.1_Intron					Homo sapiens cDNA FLJ11816 fis, clone HEMBA1006416.																		TCCTTAtttcttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	7033092	7033092	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7033092delA								ASGR2 (14800 upstream) : ASGR1 (43660 downstream)																							actcagtcctaaatccccagc	0.114													4	2	---	---	---	---	
SHISA6	388336	broad.mit.edu	37	17	11374084	11374085	+	Intron	DEL	TG	-	-	rs140386799		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11374084_11374085delTG	uc002gna.3	+						SHISA6_uc002gnb.3_Intron|SHISA6_uc010com.2_Intron	NM_207386	NP_997269	Q6ZSJ9	SHSA6_HUMAN	shisa homolog 6							integral to membrane				breast(1)	1						CCCTGACAAATGTGTGCAGCAT	0.327													4	2	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15571211	15571212	+	Intron	INS	-	TC	TC	rs11320843		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15571211_15571212insTC	uc002gox.2	-						TRIM16_uc002goy.2_Intron	NM_006470	NP_006461	O95361	TRI16_HUMAN	tripartite motif-containing 16						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		ttttttttttttctagtgtcct	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21226865	21226865	+	IGR	DEL	G	-	-	rs67907688		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21226865delG								MAP2K3 (8316 upstream) : KCNJ12 (52834 downstream)																							CGTCGGAGGTGGGGAAAAGGA	0.597													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	27348180	27348180	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27348180delT								SEZ6 (14722 upstream) : PIPOX (21738 downstream)																							tttcttttccttttttttttt	0.239													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39160546	39160547	+	IGR	INS	-	T	T	rs11403146		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39160546_39160547insT								KRTAP3-2 (4408 upstream) : KRTAP3-1 (4227 downstream)																							CCATGGTAGCATTTTTTTTCCC	0.361													4	2	---	---	---	---	
SLC35B1	10237	broad.mit.edu	37	17	47779078	47779078	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47779078delA	uc002iph.1	-						SLC35B1_uc002ipi.1_Intron|SLC35B1_uc002ipj.1_Intron	NM_005827	NP_005818	P78383	S35B1_HUMAN	solute carrier family 35, member B1							endoplasmic reticulum membrane|integral to membrane|microsome	UDP-galactose transmembrane transporter activity				0						gtatctatataaatatatcta	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	52213159	52213159	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52213159delT								KIF2B (310586 upstream) : TOM1L1 (764893 downstream)																							ATTAAGCCAATTTTTCCCCAA	0.119													4	2	---	---	---	---	
BPTF	2186	broad.mit.edu	37	17	65920895	65920895	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65920895delT	uc002jgf.2	+						BPTF_uc002jge.2_Intron	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTGGTGtttatttttttgaga	0.199													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68520864	68520864	+	IGR	DEL	T	-	-	rs5821785		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68520864delT								KCNJ2 (344683 upstream) : None (None downstream)																							GTTTTTGAGATTTTTTTTTTT	0.338													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75858508	75858509	+	IGR	DEL	AC	-	-	rs113002041		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75858508_75858509delAC								SEPT9 (361832 upstream) : FLJ45079 (16600 downstream)																							atgtgcacatacacacacacac	0.252													3	3	---	---	---	---	
BAIAP2	10458	broad.mit.edu	37	17	79070806	79070807	+	Intron	INS	-	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79070806_79070807insG	uc002jzg.2	+						BAIAP2_uc002jyz.3_Intron|BAIAP2_uc002jza.2_Intron|BAIAP2_uc002jzc.2_Intron|BAIAP2_uc002jzb.2_Intron|BAIAP2_uc002jzd.2_Intron|BAIAP2_uc002jzf.2_Intron|BAIAP2_uc002jze.2_Intron|BAIAP2_uc010wuh.1_Intron|BAIAP2_uc002jzh.2_Intron|BAIAP2_uc010wui.1_5'Flank	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2						axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			gCAGCGGCAGTGGGGGTGGCGG	0.381													4	2	---	---	---	---	
AZI1	22994	broad.mit.edu	37	17	79186570	79186571	+	Intron	INS	-	G	G	rs2659003	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79186570_79186571insG	uc002jzp.1	-						AZI1_uc002jzn.1_Intron|AZI1_uc002jzo.1_Intron|AZI1_uc010wum.1_Intron	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a						cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			tcagcaagcgtcgggggggcga	0.000													1	5	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80153493	80153494	+	Intron	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80153493_80153494insA	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			tgtcgctacagaaaaaaaaaag	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10269	10270	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10269_10270insT								None (None upstream) : USP14 (148213 downstream)																							aaccctaaccctaaccctaacc	0.000													4	2	---	---	---	---	
LOC642597	642597	broad.mit.edu	37	18	5182982	5182982	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5182982delT	uc010wzc.1	-							NM_001145194	NP_001138666	P0CW23	CR042_HUMAN	hypothetical protein LOC642597												0						AGTGCACATATTTTTTTTTGT	0.353													4	2	---	---	---	---	
C18orf45	85019	broad.mit.edu	37	18	20976829	20976829	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20976829delA	uc002kuf.2	-						C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_Intron|C18orf45_uc002kug.2_Intron|C18orf45_uc002kuh.2_Intron	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)					aatgtcttgcaaaaaaaaaaa	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	41259109	41259109	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41259109delA								SYT4 (401494 upstream) : None (None downstream)																							cctaagcaagaaaaaaaaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	61191357	61191357	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61191357delT								SERPINB5 (19040 upstream) : SERPINB12 (32036 downstream)																							aaagaaaaacttttttttttg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	63656147	63656148	+	IGR	DEL	CA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63656147_63656148delCA								CDH7 (107973 upstream) : CDH19 (515173 downstream)																							GTTCCAAAATCACACACACACA	0.351													4	2	---	---	---	---	
ZFR2	23217	broad.mit.edu	37	19	3811457	3811457	+	Intron	DEL	G	-	-	rs10413220	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3811457delG	uc002lyw.2	-							NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GCCCCTCGACGCttttttttt	0.328													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6516308	6516308	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6516308delG								TUBB4 (13978 upstream) : TNFSF9 (14702 downstream)																							GAATGACCGTGGGGTAGGGGA	0.587											OREG0025201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ZNF823	55552	broad.mit.edu	37	19	11834750	11834751	+	Intron	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11834750_11834751insT	uc002msm.2	-						ZNF823_uc010xmd.1_Intron|ZNF823_uc010dyi.1_Intron	NM_001080493	NP_001073962	P16415	ZN823_HUMAN	ZFP-36 for a zinc finger protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CCTCGGGAAAAtttttttttat	0.158										HNSCC(68;0.2)			4	2	---	---	---	---	
CLEC17A	388512	broad.mit.edu	37	19	14703486	14703487	+	Intron	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14703486_14703487insT	uc010dzn.1	+						CLEC17A_uc002mzh.1_Intron|CLEC17A_uc010xnt.1_Intron|CLEC17A_uc010xnu.1_Intron|CLEC17A_uc010dzo.1_Intron			Q6ZS10	CL17A_HUMAN	SubName: Full=CLEC17A protein;							cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity				0						ttctttttttctttttttttga	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29213766	29213766	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29213766delT	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																		GACAGCCTGATTTTTTTAAAG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32456203	32456203	+	IGR	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32456203delG								TSHZ3 (616013 upstream) : ZNF507 (380311 downstream)																							CTTGCAGCGAGGTTCTGTGCC	0.413													4	2	---	---	---	---	
ZNF793	390927	broad.mit.edu	37	19	38024110	38024111	+	Intron	INS	-	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38024110_38024111insC	uc010efm.2	+						ZNF793_uc010xts.1_Intron|ZNF793_uc010efo.2_Intron	NM_001013659	NP_001013681	Q6ZN11	ZN793_HUMAN	zinc finger protein 793						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTAGTCCCCTCCCAAGTATAA	0.500													25	15	---	---	---	---	
SUPT5H	6829	broad.mit.edu	37	19	39966566	39966566	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39966566delC	uc002olo.3	+						SUPT5H_uc002olp.3_Intron|SUPT5H_uc002olq.3_Intron|SUPT5H_uc002oln.3_Intron|SUPT5H_uc002olr.3_Intron	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a						cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCACCACAGGCCCCAGGCCTT	0.557													4	2	---	---	---	---	
LRRC4B	94030	broad.mit.edu	37	19	51066959	51066959	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51066959delC	uc002pss.2	-							NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor							cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CTGTGGCCCACCCCAGCCATC	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4830531	4830531	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4830531delT								RASSF2 (26240 upstream) : SLC23A2 (2471 downstream)																							atctcattccttttacatcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	8917496	8917496	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8917496delT								PLCB1 (51951 upstream) : PLCB4 (132205 downstream)																							TTTTCTTTTCTTTTTTTTTTT	0.388													4	2	---	---	---	---	
SPTLC3	55304	broad.mit.edu	37	20	12989653	12989653	+	5'UTR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12989653delT	uc002wod.1	+	1					SPTLC3_uc002wob.1_RNA|SPTLC3_uc002woc.2_5'UTR	NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base						sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	GACAATCTCCTTTACAGTTTC	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25098531	25098532	+	IGR	INS	-	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25098531_25098532insG								VSX1 (35764 upstream) : LOC284798 (22902 downstream)																							aaaaaggcaaaggaaacagtag	0.000													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29652944	29652945	+	3'UTR	DEL	AT	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29652944_29652945delAT	uc010ztl.1	+	4					FRG1B_uc010ztj.1_RNA|FRG1B_uc010ztk.1_3'UTR					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						atctgtccaaatttaaattaac	0.000													5	3	---	---	---	---	
ITCH	83737	broad.mit.edu	37	20	33053846	33053847	+	Intron	INS	-	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33053846_33053847insC	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron|MIR644_hsa-mir-644|MI0003659_5'Flank	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						ctgttagatttttatatgtgcc	0.000													2	4	---	---	---	---	
CTNNBL1	56259	broad.mit.edu	37	20	36407392	36407392	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36407392delT	uc010zvw.1	+						CTNNBL1_uc002xhh.2_Intron|CTNNBL1_uc002xhi.2_Intron|CTNNBL1_uc002xhj.2_Intron	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				GTGTTTTGGCTTTTTTTTTTG	0.318													7	4	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41695050	41695050	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41695050delT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TAAAATGAGATTAACCCAAGA	0.423													4	2	---	---	---	---	
PKIG	11142	broad.mit.edu	37	20	43164614	43164614	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43164614delC	uc002xmg.2	+						PKIG_uc002xmh.2_Intron|PKIG_uc002xmi.2_Intron	NM_181805	NP_861521	Q9Y2B9	IPKG_HUMAN	cAMP-dependent protein kinase inhibitor gamma								cAMP-dependent protein kinase inhibitor activity|protein binding				0		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.001)|COAD - Colon adenocarcinoma(18;0.00189)			atttccgcctccccaccagcc	0.000													4	2	---	---	---	---	
NTSR1	4923	broad.mit.edu	37	20	61341783	61341783	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61341783delT	uc002ydf.2	+							NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1							endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			atctgtgtgatggggtagtga	0.189													4	2	---	---	---	---	
COL20A1	57642	broad.mit.edu	37	20	61956557	61956557	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61956557delA	uc011aau.1	+						COL20A1_uc011aav.1_Intron	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					TGTGACCCAGAGGGGCCACAG	0.662													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62076856	62076857	+	Intron	INS	-	CCCCAAAGGG	CCCCAAAGGG	rs138698925	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62076856_62076857insCCCCAAAGGG	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	GCAAGCTGACCCCCCCACCCCT	0.678													5	3	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10909809	10909810	+	Intron	INS	-	TT	TT			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10909809_10909810insTT	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aaacctaactctctttccagtc	0.000													11	5	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10909812	10909813	+	Intron	INS	-	A	A			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10909812_10909813insA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		cctaactctctttccagtcagt	0.000													10	5	---	---	---	---	
HUNK	30811	broad.mit.edu	37	21	33312758	33312759	+	Intron	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33312758_33312759insT	uc002yph.2	+							NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase						multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						GACCTTTTGTAGAATTTATTTT	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44593841	44593842	+	IGR	INS	-	CACTC	CACTC	rs72034234		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44593841_44593842insCACTC								CRYAA (928 upstream) : SIK1 (240556 downstream)																							cacactccacacacacacacca	0.312													4	2	---	---	---	---	
PI4KA	5297	broad.mit.edu	37	22	21063975	21063976	+	Intron	INS	-	AT	AT	rs67808752		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21063975_21063976insAT	uc002zsz.3	-						PI4KA_uc010gsp.2_Intron|PI4KA_uc002zsy.3_Intron	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CCTTGACATAAAGAGGCCCCTG	0.609													4	2	---	---	---	---	
TOP3B	8940	broad.mit.edu	37	22	22326532	22326532	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22326532delA	uc002zvs.2	-						TOP3B_uc010gtl.2_Intron|TOP3B_uc002zvt.3_Intron	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TTTTTGGACCAAAAAAAAAAG	0.289													7	4	---	---	---	---	
ADORA2A	135	broad.mit.edu	37	22	24837536	24837537	+	3'UTR	DEL	AG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24837536_24837537delAG	uc002zzx.2	+	5					ADORA2A_uc002zzy.3_3'UTR|ADORA2A_uc011ajs.1_3'UTR|ADORA2A_uc010gup.2_3'UTR|ADORA2A_uc010guq.2_3'UTR|ADORA2A_uc003aab.2_3'UTR|ADORA2A_uc003aac.2_3'UTR|C22orf45_uc003aad.1_Intron	NM_000675	NP_000666	P29274	AA2AR_HUMAN	adenosine A2a receptor						apoptosis|blood coagulation|cAMP biosynthetic process|cellular defense response|inflammatory response|nerve growth factor receptor signaling pathway|phagocytosis|sensory perception	integral to plasma membrane|membrane fraction	enzyme binding				0	Colorectal(2;0.196)				Caffeine(DB00201)|Defibrotide(DB04932)|Pegademase bovine(DB00061)|Theophylline(DB00277)	CGTTGGGAGAAGAGAGAGAGTG	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	31085600	31085600	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31085600delT								SLC35E4 (20598 upstream) : OSBP2 (4169 downstream)																							gatttttctatttttggattt	0.000													4	2	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31129598	31129599	+	Intron	DEL	GA	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31129598_31129599delGA	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						ttaaatggaggagagagagagg	0.079													4	2	---	---	---	---	
SELM	140606	broad.mit.edu	37	22	31501340	31501340	+	Intron	DEL	G	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31501340delG	uc011ali.1	-						SELM_uc011alj.1_Intron|INPP5J_uc010gwf.2_5'Flank	NM_080430	NP_536355	Q8WWX9	SELM_HUMAN	selenoprotein M precursor							endoplasmic reticulum|Golgi apparatus|nucleus|perinuclear region of cytoplasm					0						CCTTACTGATGGGAACAGCAT	0.562													15	13	---	---	---	---	
PVALB	5816	broad.mit.edu	37	22	37205135	37205135	+	Intron	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37205135delA	uc010gwz.2	-						PVALB_uc003apx.2_Intron	NM_002854	NP_002845	P20472	PRVA_HUMAN	parvalbumin								calcium ion binding			skin(1)	1						TCAGAAGGACAAACAGAGCAG	0.488													4	2	---	---	---	---	
DMC1	11144	broad.mit.edu	37	22	38964457	38964458	+	Intron	DEL	TG	-	-	rs11570378		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38964457_38964458delTG	uc003avz.1	-						DMC1_uc011anv.1_5'Flank|DMC1_uc003awa.1_Intron	NM_007068	NP_008999	Q14565	DMC1_HUMAN	DMC1 dosage suppressor of mck1 homolog						reciprocal meiotic recombination	condensed nuclear chromosome	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding			ovary(1)	1	Melanoma(58;0.0286)					CATTATTTCTtgtgtgtgtgtg	0.366								Homologous_recombination					8	4	---	---	---	---	
RPL3	6122	broad.mit.edu	37	22	39714115	39714116	+	Intron	INS	-	C	C			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39714115_39714116insC	uc003axi.2	-						RPL3_uc003axh.2_Intron|RPL3_uc003axj.2_Intron|RPL3_uc011aoj.1_Intron|RPL3_uc010gxx.2_Intron|RPL3_uc003axg.2_Intron|RPL3_uc003axk.1_Intron	NM_000967	NP_000958	P39023	RL3_HUMAN	ribosomal protein L3 isoform a						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			breast(1)|kidney(1)	2	Melanoma(58;0.04)					AGCAGCTCCAACCCCCCACACT	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	13106402	13106402	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13106402delT								FAM9C (43602 upstream) : ATXN3L (230368 downstream)																							TCTCTTCCCCTTTGTTAACCC	0.547													4	2	---	---	---	---	
GPR64	10149	broad.mit.edu	37	X	19124612	19124613	+	Intron	DEL	TG	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19124612_19124613delTG	uc004cyx.2	-						GPR64_uc004cyy.2_Intron|GPR64_uc004cyz.2_Intron|GPR64_uc004czb.2_Intron|GPR64_uc004czc.2_Intron|GPR64_uc004czd.2_Intron|GPR64_uc004cze.2_Intron|GPR64_uc004czf.2_Intron|GPR64_uc004cza.2_Intron	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1						neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					Agtgtgtgtttgtgtgtgtgtg	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	25206969	25206970	+	IGR	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:25206969_25206970insT								ARX (172904 upstream) : MAGEB18 (949493 downstream)																							gatccttggagttttttttcaa	0.079													4	2	---	---	---	---	
IL1RAPL1	11141	broad.mit.edu	37	X	29624876	29624876	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29624876delT	uc004dby.2	+							NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						tggtactagattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	38295667	38295667	+	IGR	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38295667delC								OTC (14965 upstream) : TSPAN7 (125064 downstream)																							gtagctcagacccccatgtca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	42051078	42051078	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42051078delA								CASK (268791 upstream) : PPP1R2P9 (585541 downstream)																							tccatatgccaggcagagatg	0.000													4	2	---	---	---	---	
PPP1R2P9	80316	broad.mit.edu	37	X	42637261	42637261	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42637261delA	uc004dfv.2	-	1	226	c.70delT	c.(70-72)TCGfs	p.S24fs		NR_002191				RecName: Full=Putative type-1 protein phosphatase inhibitor 4;          Short=I-4; AltName: Full=Protein phosphatase 1, regulatory subunit 2 pseudogene 9;												0						GTCGCCACCGAGGAACCCGAC	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	44728033	44728034	+	IGR	INS	-	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44728033_44728034insG								DUSP21 (23901 upstream) : KDM6A (4389 downstream)																							actgatacaatggggggggtgg	0.000													4	2	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101097235	101097236	+	Intron	INS	-	TTT	TTT	rs5986863	by1000genomes	TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101097235_101097236insTTT	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						tttctttcttccatttctttct	0.144													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	101765927	101765927	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101765927delA								NXF2B (184294 upstream) : TMSB15A (2684 downstream)																							CAGATGTTGTAAAAAAATATG	0.343													4	2	---	---	---	---	
IL1RAPL2	26280	broad.mit.edu	37	X	103893697	103893697	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103893697delT	uc004elz.1	+							NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2						central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						TCTATTCCCCTTTTTTGCTAT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	117003165	117003165	+	IGR	DEL	A	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117003165delA								None (None upstream) : KLHL13 (28612 downstream)																							tcagagttgtaaaatcagttt	0.090													4	2	---	---	---	---	
KIAA1210	57481	broad.mit.edu	37	X	118215667	118215668	+	Intron	INS	-	G	G			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118215667_118215668insG	uc004era.3	-							NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481											ovary(4)|skin(1)	5						AGTATGTCAAAGGGGTAAAATC	0.495													4	2	---	---	---	---	
MCTS1	28985	broad.mit.edu	37	X	119739640	119739640	+	Intron	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119739640delT	uc004esx.2	+						MCTS1_uc011mub.1_Intron	NM_014060	NP_054779	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1 isoform 1						cell cycle|positive regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm	RNA binding				0						GAGTTAAATGTTTTAGTTCAG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	136261622	136261622	+	IGR	DEL	T	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136261622delT								GPR101 (147789 upstream) : ZIC3 (386724 downstream)																							ggtgatttcattttcagcctc	0.010													4	2	---	---	---	---	
SPANXN2	494119	broad.mit.edu	37	X	142803121	142803121	+	Intron	DEL	C	-	-			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142803121delC	uc004fbz.2	-							NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein											ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					aagtccgtcaccccctgcttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	151041034	151041034	+	IGR	DEL	T	-	-	rs11306132		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151041034delT								CNGA2 (126998 upstream) : MAGEA4 (39962 downstream)																							GTGCAACATGTATGTTGAGCA	0.478													2	4	---	---	---	---	
MAGEA4	4103	broad.mit.edu	37	X	151090151	151090152	+	Intron	INS	-	T	T			TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151090151_151090152insT	uc004fez.2	+						MAGEA4_uc004ffa.2_Intron|MAGEA4_uc004ffb.2_Intron|MAGEA4_uc004ffc.2_Intron|MAGEA4_uc004ffd.2_Intron	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4								protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTCAACCCCGGGAAGACCTG	0.574													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59003486	59003487	+	IGR	INS	-	T	T	rs76126364		TCGA-B0-5695-01A-11D-1534-10	TCGA-B0-5695-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59003486_59003487insT								None (None upstream) : None (None downstream)																							ATAAATGTGTGTTCATAGTTAC	0.233													4	2	---	---	---	---	
