Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
WASH7P	653635	broad.mit.edu	37	1	17519	17519	+	5'Flank	SNP	G	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17519G>T	uc009vis.2	-						WASH7P_uc009vit.2_RNA|WASH7P_uc001aae.3_Intron|WASH7P_uc009viu.2_RNA|WASH7P_uc001aab.3_Intron|WASH7P_uc001aah.3_Intron|WASH7P_uc009vir.2_RNA|WASH7P_uc009viq.2_Intron|WASH7P_uc001aac.3_Intron|WASH7P_uc009viv.2_Intron|WASH7P_uc009viw.2_RNA|WASH7P_uc009vix.2_Intron|WASH7P_uc009vjd.2_Intron|WASH7P_uc009viz.2_Intron|WASH7P_uc009viy.2_Intron|WASH7P_uc009vjc.1_RNA|WASH7P_uc001aai.1_Intron|WASH7P_uc010nxs.1_Intron|WASH7P_uc009vjb.1_Intron|WASH7P_uc009vje.2_RNA					Homo sapiens cDNA FLJ31670 fis, clone NT2RI2004984.												0						TGGCCTATGTGCTGTACCTGT	0.677													3	13	---	---	---	---	PASS
EXOSC10	5394	broad.mit.edu	37	1	11159937	11159937	+	5'UTR	SNP	A	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11159937A>G	uc001asa.2	-	1					EXOSC10_uc001asb.2_5'UTR|EXOSC10_uc009vmy.1_5'UTR	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN	exosome component 10 isoform 1						CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		GGCCGAGGAGACGGGACGCGT	0.682													4	22	---	---	---	---	PASS
NKAIN1	79570	broad.mit.edu	37	1	31656721	31656721	+	Silent	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31656721G>A	uc010ogd.1	-	4	420	c.414C>T	c.(412-414)TGC>TGT	p.C138C	NKAIN1_uc001bsn.2_Silent_p.C94C|NKAIN1_uc010ogc.1_Silent_p.C67C	NM_024522	NP_078798	Q4KMZ8	NKAI1_HUMAN	Na+/K+ transporting ATPase interacting 1	138	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|Breast(348;0.141)|all_neural(195;0.146)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0184)|READ - Rectum adenocarcinoma(331;0.148)		AGTCAAGCAGGCAGCCAGTGA	0.597											OREG0004725	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	28	120	---	---	---	---	PASS
NKAIN1	79570	broad.mit.edu	37	1	31656722	31656722	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31656722C>T	uc010ogd.1	-	4	419	c.413G>A	c.(412-414)TGC>TAC	p.C138Y	NKAIN1_uc001bsn.2_Missense_Mutation_p.C94Y|NKAIN1_uc010ogc.1_Missense_Mutation_p.C67Y	NM_024522	NP_078798	Q4KMZ8	NKAI1_HUMAN	Na+/K+ transporting ATPase interacting 1	138	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|Breast(348;0.141)|all_neural(195;0.146)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0184)|READ - Rectum adenocarcinoma(331;0.148)		GTCAAGCAGGCAGCCAGTGAC	0.597											OREG0004725	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	128	---	---	---	---	PASS
ATG4C	84938	broad.mit.edu	37	1	63284999	63284999	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63284999A>G	uc001dat.2	+	5	880	c.718A>G	c.(718-720)ATT>GTT	p.I240V	ATG4C_uc001dau.2_Missense_Mutation_p.I240V	NM_178221	NP_835739	Q96DT6	ATG4C_HUMAN	APG4 autophagy 4 homolog C isoform 8	240					autophagic vacuole assembly|protein targeting to membrane|proteolysis	cytosol|extracellular region	cysteine-type endopeptidase activity			ovary(1)	1						GGTTGCTCACATTTTAAGGTA	0.358													4	17	---	---	---	---	PASS
ST6GALNAC3	256435	broad.mit.edu	37	1	77042635	77042635	+	Intron	SNP	C	G	G	rs41291518	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77042635C>G	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_3'UTR|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						aagaaagaaacaaacaaacaa	0.338													4	8	---	---	---	---	PASS
KCNA3	3738	broad.mit.edu	37	1	111216456	111216456	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111216456T>C	uc001dzv.1	-	1	1200	c.976A>G	c.(976-978)AAC>GAC	p.N326D		NM_002232	NP_002223	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related	326						voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(4)|pancreas(1)	5		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCATGATGTTTCGCGAGAAG	0.532													19	36	---	---	---	---	PASS
CD53	963	broad.mit.edu	37	1	111441858	111441858	+	3'UTR	SNP	G	A	A	rs12030938	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111441858G>A	uc001dzw.2	+	9					CD53_uc001dzx.2_3'UTR|CD53_uc010owa.1_3'UTR|CD53_uc001dzy.2_3'UTR	NM_001040033	NP_001035122	P19397	CD53_HUMAN	CD53 antigen						signal transduction	integral to membrane|plasma membrane					0		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		TTTCATCTCCGGAAATGCAAA	0.468													6	66	---	---	---	---	PASS
CGN	57530	broad.mit.edu	37	1	151492916	151492916	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151492916G>A	uc009wmw.2	+	4	1145	c.1001G>A	c.(1000-1002)AGG>AAG	p.R334K		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	328	Interacts with ZO-2.|Head.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACCTCTGTGAGGAGGAAGGTT	0.493													71	191	---	---	---	---	PASS
OR6Y1	391112	broad.mit.edu	37	1	158517543	158517543	+	Missense_Mutation	SNP	A	T	T	rs138738485	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158517543A>T	uc010pil.1	-	1	353	c.353T>A	c.(352-354)ATC>AAC	p.I118N		NM_001005189	NP_001005189	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					AGCAAGAAGGATGTACTCAGT	0.453													4	21	---	---	---	---	PASS
OR10J3	441911	broad.mit.edu	37	1	159284210	159284210	+	Silent	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159284210G>C	uc010piu.1	-	1	240	c.240C>G	c.(238-240)CCC>CCG	p.P80P		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	80	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)					AAAGCATATGGGGAATGATGG	0.493													21	98	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183100479	183100479	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183100479C>G	uc001gpy.3	+	20	3789	c.3532C>G	c.(3532-3534)CTT>GTT	p.L1178V		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1178	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAACATGACTCTTTTGGCAGA	0.378													44	200	---	---	---	---	PASS
TSEN15	116461	broad.mit.edu	37	1	184042058	184042058	+	3'UTR	SNP	T	C	C	rs11549003	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184042058T>C	uc001gqt.3	+	5					TSEN15_uc009wyg.2_RNA|TSEN15_uc001gqu.3_3'UTR	NM_052965	NP_443197	Q8WW01	SEN15_HUMAN	tRNA splicing endonuclease 15 isoform 1						mRNA processing|tRNA processing	nucleolus	protein binding				0						ATCTTTTATCTCAGAAATAGG	0.383													5	22	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769204	247769204	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769204C>T	uc010pyz.1	+	1	317	c.317C>T	c.(316-318)GCA>GTA	p.A106V		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	106	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATTTCTCTGGCACTGGGCTCC	0.488													8	110	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8871011	8871011	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8871011G>C	uc002qzc.2	-	30	5337	c.5155C>G	c.(5155-5157)CCC>GCC	p.P1719A	KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Missense_Mutation_p.P1620A|KIDINS220_uc002qzb.2_Missense_Mutation_p.P573A	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	1719	Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTTGGGTTGGGACTGGAACTA	0.448													40	156	---	---	---	---	PASS
SMC6	79677	broad.mit.edu	37	2	17927275	17927275	+	Intron	SNP	C	T	T	rs12474069	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17927275C>T	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron|SMC6_uc002rcp.1_5'Flank|SMC6_uc002rcq.2_Intron|SMC6_uc002rcr.1_5'UTR	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ATATTAAACTCAACAAAATAA	0.284													6	15	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50280533	50280533	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50280533G>A	uc010fbp.2	-	4	1616	c.809C>T	c.(808-810)ACA>ATA	p.T270I	NRXN1_uc002rxb.3_Missense_Mutation_p.T1007I|NRXN1_uc010fbq.2_Missense_Mutation_p.T1375I|NRXN1_uc002rxe.3_Missense_Mutation_p.T1305I	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	270	Extracellular (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGACTCAGTTGTCATAGAGGA	0.488													10	43	---	---	---	---	PASS
ANKRD20B	729171	broad.mit.edu	37	2	95488771	95488771	+	RNA	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95488771C>T	uc010fhp.2	-	10		c.947G>A				NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0						CTTTTCACTTCTTTCATGCCT	0.343													14	54	---	---	---	---	PASS
BCL2L11	10018	broad.mit.edu	37	2	111886332	111886332	+	Intron	SNP	C	T	T	rs13429049	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111886332C>T	uc002tgv.1	+						BCL2L11_uc002tgt.1_3'UTR|BCL2L11_uc002tgu.1_Intron|BCL2L11_uc002tgw.1_Intron|BCL2L11_uc002tgx.1_Intron|BCL2L11_uc010fkd.1_Intron|BCL2L11_uc002tgy.1_Intron|BCL2L11_uc002tgz.1_Intron|BCL2L11_uc010fke.1_Intron|BCL2L11_uc002tha.1_Intron|BCL2L11_uc002thb.1_Intron|BCL2L11_uc002thc.1_Intron|BCL2L11_uc002thd.1_Intron	NM_138621	NP_619527	O43521	B2L11_HUMAN	BCL2-like 11 isoform 1						activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria	cytosol|endomembrane system|mitochondrial outer membrane|plasma membrane	protein binding|protein binding				0						ctcatgatacctttttatagc	0.065													8	119	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163046232	163046232	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163046232C>T	uc002ucd.2	-	18	1691	c.1483G>A	c.(1483-1485)GAA>AAA	p.E495K	FAP_uc010fpc.2_Missense_Mutation_p.E44K|FAP_uc010zct.1_Missense_Mutation_p.E470K|FAP_uc010fpd.2_5'UTR	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	495	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						AAAGCATTTTCCAATTCCTTG	0.244													7	26	---	---	---	---	PASS
FASTKD1	79675	broad.mit.edu	37	2	170387991	170387991	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170387991C>A	uc002uev.3	-	13	2586	c.2198G>T	c.(2197-2199)TGT>TTT	p.C733F	FASTKD1_uc002uew.3_RNA|FASTKD1_uc002uex.3_Missense_Mutation_p.C676F	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	733					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(4)	4						ATCCAAGATACACTCAAAATC	0.303													19	75	---	---	---	---	PASS
CERKL	375298	broad.mit.edu	37	2	182413259	182413259	+	Intron	SNP	A	G	G	rs12997453	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182413259A>G	uc002unx.2	-						CERKL_uc002uny.2_Intron|CERKL_uc010zfm.1_Intron|CERKL_uc002unz.2_Intron|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_Intron|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_Intron|CERKL_uc002uod.1_Intron|CERKL_uc002uoe.2_3'UTR|CERKL_uc002unw.2_5'Flank	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TATTACATTGAGTTTTTACCT	0.294													11	199	---	---	---	---	PASS
NEUROD1	4760	broad.mit.edu	37	2	182542478	182542478	+	3'UTR	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182542478G>A	uc002uof.2	-	2					CERKL_uc002uod.1_Intron	NM_002500	NP_002491	Q13562	NDF1_HUMAN	neurogenic differentiation 1						amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGTAAGCACAGTGGGTTCGTT	0.443													12	19	---	---	---	---	PASS
SSFA2	6744	broad.mit.edu	37	2	182763586	182763586	+	Intron	SNP	G	A	A	rs3731693	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182763586G>A	uc002uoi.2	+						SSFA2_uc002uoh.2_Intron|SSFA2_uc002uoj.2_Intron|SSFA2_uc002uok.2_Intron|SSFA2_uc010zfo.1_Intron|SSFA2_uc002uol.2_5'UTR	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1							cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TGTGCTCTACGTTTATTGTTT	0.289													8	27	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201507439	201507439	+	Missense_Mutation	SNP	G	A	A	rs56199635		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201507439G>A	uc002uvx.2	+	25	2863	c.2762G>A	c.(2761-2763)CGT>CAT	p.R921H	AOX1_uc010zhf.1_Missense_Mutation_p.R477H|AOX1_uc010fsu.2_Missense_Mutation_p.R287H	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	921					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	ACAGCTTTTCGTGGGTTTGGC	0.488													13	49	---	---	---	---	PASS
ALS2CR12	130540	broad.mit.edu	37	2	202153252	202153252	+	3'UTR	SNP	A	C	C	rs700636	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202153252A>C	uc010ftg.2	-	15					ALS2CR12_uc002uya.3_3'UTR|ALS2CR12_uc010fth.2_RNA	NM_139163	NP_631902	Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)						regulation of GTPase activity		protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						AGACATTCAGAGAGTCAGAGC	0.428													4	25	---	---	---	---	PASS
UNC80	285175	broad.mit.edu	37	2	210860277	210860277	+	Silent	SNP	G	A	A	rs138970658	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210860277G>A	uc010zjc.1	+	64	9815	c.9735G>A	c.(9733-9735)GAG>GAA	p.E3245E	UNC80_uc010zjd.1_Silent_p.E672E	NM_032504	NP_115893	Q8N2C7	UNC80_HUMAN	chromosome 2 open reading frame 21 isoform 1	3245						integral to membrane					0						CTCCCACTGAGCTGGGGAAAA	0.443													4	25	---	---	---	---	PASS
ABCA12	26154	broad.mit.edu	37	2	215797332	215797332	+	3'UTR	SNP	C	T	T	rs17426207	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215797332C>T	uc002vew.2	-	53					ABCA12_uc002vev.2_3'UTR|ABCA12_uc010zjn.1_3'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATTGGTCACACGCTGAGATTG	0.388													6	12	---	---	---	---	PASS
SETMAR	6419	broad.mit.edu	37	3	4345099	4345099	+	Silent	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4345099G>A	uc011asp.1	+	1	112	c.45G>A	c.(43-45)GCG>GCA	p.A15A	SUMF1_uc003bps.1_Intron|SETMAR_uc003bpw.3_Silent_p.A2A|SETMAR_uc003bpy.3_5'UTR|SETMAR_uc011asq.1_Silent_p.A2A|SETMAR_uc011asr.1_5'UTR|SETMAR_uc010hbx.2_5'Flank	NM_006515	NP_006506	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion	2	Histone-lysine N-methyltransferase.				DNA integration|DNA repair|transposition, DNA-mediated	chromosome|nucleus	DNA binding|endonuclease activity|histone-lysine N-methyltransferase activity|transposase activity|zinc ion binding			ovary(1)	1		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		GTGGGATGGCGGAGTTTAAGG	0.542								Chromatin_Structure|Direct_reversal_of_damage					25	63	---	---	---	---	PASS
ZNF860	344787	broad.mit.edu	37	3	32030544	32030544	+	5'UTR	SNP	C	T	T	rs11129475	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32030544C>T	uc011axg.1	+	2						NM_001137674	NP_001131146	A6NHJ4	ZN860_HUMAN	zinc finger protein 860						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GAAGGTCACACTGCAGCACTA	0.333													3	5	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33576805	33576805	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33576805T>C	uc003cfu.2	-	33	4061	c.3707A>G	c.(3706-3708)TAT>TGT	p.Y1236C	CLASP2_uc003cfs.2_Missense_Mutation_p.Y443C|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Missense_Mutation_p.Y836C	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2	1245										ovary(3)|central_nervous_system(1)	4						GCTATCTGAATAGTTATATGG	0.443													7	88	---	---	---	---	PASS
DLEC1	9940	broad.mit.edu	37	3	38153788	38153788	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38153788T>G	uc003cho.1	+	25	3623	c.3602T>G	c.(3601-3603)CTG>CGG	p.L1201R	DLEC1_uc003chp.1_Missense_Mutation_p.L1201R|DLEC1_uc010hgv.1_Missense_Mutation_p.L1204R|DLEC1_uc003chr.1_Intron|DLEC1_uc010hgx.1_RNA	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	1201					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TACCAGCAGCTGTGCATTGAC	0.567													34	97	---	---	---	---	PASS
GLT8D1	55830	broad.mit.edu	37	3	52728804	52728804	+	3'UTR	SNP	C	T	T	rs6976	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52728804C>T	uc003dfi.3	-	10					GLT8D1_uc003dfj.2_3'UTR|GLT8D1_uc003dfk.2_3'UTR|GLT8D1_uc003dfl.2_3'UTR|GLT8D1_uc003dfm.2_3'UTR|GLT8D1_uc003dfn.2_3'UTR|GLT8D1_uc003dfo.1_3'UTR	NM_152932	NP_690909	Q68CQ7	GL8D1_HUMAN	glycosyltransferase 8 domain containing 1							integral to membrane|mitochondrion	transferase activity, transferring glycosyl groups				0				BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TTACTTCCCACGCATGCTATC	0.433													6	22	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113152496	113152496	+	Missense_Mutation	SNP	C	G	G	rs34121482		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113152496C>G	uc003eae.1	-	2	62	c.16G>C	c.(16-18)GAT>CAT	p.D6H		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	6										central_nervous_system(1)	1						GTATCCTGATCATCTGGTTCC	0.353													7	58	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129284742	129284742	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129284742G>A	uc003emx.2	-	24	4410	c.4310C>T	c.(4309-4311)GCG>GTG	p.A1437V	PLXND1_uc011blb.1_Missense_Mutation_p.A105V	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1437	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						GTCGCGCACCGCAAAGTCCTT	0.582													44	137	---	---	---	---	PASS
ACPP	55	broad.mit.edu	37	3	132086844	132086844	+	3'UTR	SNP	T	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132086844T>C	uc003eop.3	+	11						NM_001134194	NP_001127666	P15309	PPAP_HUMAN	acid phosphatase, prostate long isoform							extracellular region|lysosomal membrane	5'-nucleotidase activity|acid phosphatase activity			ovary(1)	1						GGATGAACACTCAGGCTACCT	0.517													2	0	---	---	---	---	PASS
CCDC149	91050	broad.mit.edu	37	4	24878249	24878249	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24878249G>C	uc011bxr.1	-	3	278	c.134C>G	c.(133-135)ACC>AGC	p.T45S	CCDC149_uc003grc.2_Missense_Mutation_p.T45S|CCDC149_uc003grb.2_RNA|CCDC149_uc003grd.2_Missense_Mutation_p.T45S|CCDC149_uc003gre.2_5'UTR	NM_173463	NP_775734	B4DZG3	B4DZG3_HUMAN	coiled-coil domain containing 149 isoform 1	45											0		Breast(46;0.173)				CTGTTGACAGGTGTCCAGCTC	0.512													31	117	---	---	---	---	PASS
DTHD1	401124	broad.mit.edu	37	4	36340753	36340753	+	Missense_Mutation	SNP	G	A	A	rs9654132	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36340753G>A	uc011bxy.1	+	8	1881	c.1490G>A	c.(1489-1491)CGT>CAT	p.R497H	DTHD1_uc003gsv.2_Intron	NM_001136536	NP_001130008	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	662					signal transduction						0						TTAATCAACCGTCCACAGAGT	0.348													15	33	---	---	---	---	PASS
KLF3	51274	broad.mit.edu	37	4	38698924	38698924	+	3'UTR	SNP	C	T	T	rs36023504	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38698924C>T	uc003gth.3	+	6						NM_016531	NP_057615	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)						multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						CCCCACTCACCTGGCTCTCTC	0.473													6	49	---	---	---	---	PASS
GC	2638	broad.mit.edu	37	4	72629131	72629131	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72629131C>T	uc003hge.2	-	6	848	c.695G>A	c.(694-696)AGG>AAG	p.R232K	GC_uc003hgd.2_Missense_Mutation_p.R110K|GC_uc010iie.2_Missense_Mutation_p.R232K|GC_uc010iif.2_Missense_Mutation_p.R251K	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	232	Albumin 2.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	TTACCTGAGCCTTGATTTCTT	0.358													9	35	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73414406	73414406	+	Missense_Mutation	SNP	T	C	C	rs147882384		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73414406T>C	uc003hgk.1	-	3	330	c.293A>G	c.(292-294)AAC>AGC	p.N98S		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	98					collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TAGTTGAGTGTTGGGCTTTAG	0.478													4	28	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155407595	155407595	+	Nonstop_Mutation	SNP	C	A	A	rs140554741	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155407595C>A	uc011cik.1	-	2	2553	c.2130G>T	c.(2128-2130)TAG>TAT	p.*710Y	DCHS2_uc003inx.2_Intron	NM_001142553	NP_001136025	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 3	710	Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TACAGGAAATCTAGGCAAGAT	0.353													8	97	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186366520	186366520	+	3'UTR	SNP	T	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186366520T>C	uc003ixu.3	-	7					CCDC110_uc003ixv.3_3'UTR|C4orf47_uc003ixt.2_Intron|C4orf47_uc003ixs.2_Intron	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a							nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		AACCATTCTGTGCATAATTTT	0.388													5	47	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43609272	43609272	+	5'UTR	SNP	T	C	C	rs12187908	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43609272T>C	uc003joe.2	+	2					NNT_uc003jof.2_5'UTR	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	AACTGGGGAGTCAGAAAATTG	0.368													8	65	---	---	---	---	PASS
C5orf36	285600	broad.mit.edu	37	5	93753017	93753017	+	Missense_Mutation	SNP	C	T	T	rs29910	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93753017C>T	uc011cuk.1	-	15	2808	c.2551G>A	c.(2551-2553)GCC>ACC	p.A851T		NM_001145678	NP_001139150	Q8IV33	K0825_HUMAN	hypothetical protein LOC285600 isoform 1	851											0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)		TTAAAGATGGCTTCCATCAAG	0.353													5	48	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127497359	127497359	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127497359G>A	uc003kus.2	+	17	2647	c.2483G>A	c.(2482-2484)CGA>CAA	p.R828Q	SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Missense_Mutation_p.R828Q|SLC12A2_uc003kut.1_Missense_Mutation_p.R35Q	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12	828	Extracellular (Potential).				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	AAGGGTCCTCGAAGACAAGCC	0.328													3	10	---	---	---	---	PASS
HTR4	3360	broad.mit.edu	37	5	147856232	147856232	+	3'UTR	SNP	T	C	C	rs6580550	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147856232T>C	uc003lpk.2	-	7					HTR4_uc010jgu.1_Intron|HTR4_uc003lpi.1_Intron|HTR4_uc003lpj.1_Intron	NM_001040171	NP_001035261	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform d						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	aacttcagtgtacaaaaacct	0.154													7	59	---	---	---	---	PASS
PDE6A	5145	broad.mit.edu	37	5	149323840	149323840	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149323840C>T	uc003lrg.3	-	1	517	c.397G>A	c.(397-399)GTC>ATC	p.V133I		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	133	GAF 1.				cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			AAAGGGAAGACGATCTCTTGG	0.567													19	125	---	---	---	---	PASS
DCDC2	51473	broad.mit.edu	37	6	24278380	24278380	+	Silent	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24278380G>C	uc003ndx.2	-	7	1121	c.819C>G	c.(817-819)CCC>CCG	p.P273P	DCDC2_uc003ndy.2_Silent_p.P273P	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	273					cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				TCCTCTTCAGGGGCTGAGGAG	0.358													51	162	---	---	---	---	PASS
GLYATL3	389396	broad.mit.edu	37	6	49479750	49479750	+	Missense_Mutation	SNP	T	C	C	rs13193063	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49479750T>C	uc003ozi.2	+	2	160	c.47T>C	c.(46-48)ATG>ACG	p.M16T		NM_001010904	NP_001010904	Q5SZD4	GLYL3_HUMAN	glycine N-acyltransferase-like protein 3	16						mitochondrion	glycine N-acyltransferase activity				0						CTGGAGAAAATGTTGAAGAGT	0.318													15	75	---	---	---	---	PASS
GLYATL3	389396	broad.mit.edu	37	6	49489397	49489397	+	Missense_Mutation	SNP	C	A	A	rs9369905	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49489397C>A	uc003ozi.2	+	5	466	c.353C>A	c.(352-354)GCC>GAC	p.A118D		NM_001010904	NP_001010904	Q5SZD4	GLYL3_HUMAN	glycine N-acyltransferase-like protein 3	118						mitochondrion	glycine N-acyltransferase activity				0						AAAGCGGTTGCCAATTCAAAG	0.363													5	54	---	---	---	---	PASS
TRAM2	9697	broad.mit.edu	37	6	52365402	52365402	+	3'UTR	SNP	G	A	A	rs7771	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52365402G>A	uc003paq.2	-	11					EFHC1_uc011dwv.1_Intron	NM_012288	NP_036420	Q15035	TRAM2_HUMAN	translocation-associated membrane protein 2						collagen biosynthetic process|protein transport|transmembrane transport	integral to membrane	protein binding				0	Lung NSC(77;0.109)					AGCTGACCCCGGCCACTGGGC	0.498													4	26	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117663563	117663563	+	Missense_Mutation	SNP	C	T	T	rs150852319		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117663563C>T	uc003pxp.1	-	28	4868	c.4669G>A	c.(4669-4671)GTA>ATA	p.V1557I	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1557	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CATAACTTACCTCCATTTTTA	0.318			T	GOPC|ROS1	glioblastoma|NSCLC								10	49	---	---	---	---	PASS
TCP10	6953	broad.mit.edu	37	6	167789779	167789779	+	Intron	SNP	A	C	C	rs150210607	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167789779A>C	uc003qvv.1	-						TCP10_uc003qvu.2_Intron|TCP10_uc003qvw.2_3'UTR	NM_004610	NP_004601	Q12799	TCP10_HUMAN	t-complex 10							cytosol				breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GGAGCTCGGGAAAGTAATTGA	0.373													3	14	---	---	---	---	PASS
MPP6	51678	broad.mit.edu	37	7	24727267	24727267	+	3'UTR	SNP	C	T	T	rs1053430	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24727267C>T	uc003swx.2	+	13					MPP6_uc003swy.2_3'UTR|MPP6_uc010kur.2_3'UTR	NM_016447	NP_057531	Q9NZW5	MPP6_HUMAN	membrane protein, palmitoylated 6						protein complex assembly		protein binding				0						AAATTAAACTCTTAAAAAGTG	0.363													3	19	---	---	---	---	PASS
ZNF679	168417	broad.mit.edu	37	7	63721251	63721251	+	Missense_Mutation	SNP	A	G	G	rs12154540	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63721251A>G	uc003tsx.2	+	4	475	c.206A>G	c.(205-207)GAG>GGG	p.E69G		NM_153363	NP_699194	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	69	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						ACCTGTCTGGAGCAAAATAAA	0.383													11	132	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87195540	87195540	+	Missense_Mutation	SNP	T	C	C	rs60419673	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87195540T>C	uc003uiz.1	-	8	966	c.548A>G	c.(547-549)AAT>AGT	p.N183S	ABCB1_uc011khc.1_Missense_Mutation_p.N119S	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	183	ABC transmembrane type-1 1.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	AATTCCTTCATTAATCTTGGA	0.363													7	79	---	---	---	---	PASS
ADAM22	53616	broad.mit.edu	37	7	87785235	87785235	+	Silent	SNP	T	C	C	rs113535772	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87785235T>C	uc003ujn.2	+	22	1900	c.1821T>C	c.(1819-1821)AAT>AAC	p.N607N	ADAM22_uc003ujk.1_Silent_p.N607N|ADAM22_uc003ujl.1_Silent_p.N607N|ADAM22_uc003ujm.2_Silent_p.N607N|ADAM22_uc003ujo.2_Silent_p.N607N|ADAM22_uc003ujp.1_Silent_p.N659N	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1	607	Cys-rich.|Extracellular (Potential).				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TGTGTACCAATATTGGCAATA	0.363													8	51	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123610348	123610348	+	3'UTR	SNP	C	T	T	rs11975640	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123610348C>T	uc003vle.2	+	6					SPAM1_uc011koa.1_3'UTR	NM_003117	NP_003108	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 1						binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	ccttggcttacaggtgactat	0.000													7	24	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126079144	126079144	+	3'UTR	SNP	A	G	G	rs712723	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126079144A>G	uc003vlr.2	-	10					GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_3'UTR|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	CATATACCACATCTCTTCAGA	0.368										HNSCC(24;0.065)			9	101	---	---	---	---	PASS
TRYX3	136541	broad.mit.edu	37	7	141957653	141957653	+	5'UTR	SNP	G	A	A	rs35443843	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141957653G>A	uc003vxb.2	-	1					TRYX3_uc003vxc.3_Intron	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN	trypsin X3 precursor						proteolysis	extracellular region	serine-type endopeptidase activity				0	Melanoma(164;0.0272)					TATTTTAGTAGCAGGATTCAG	0.363													4	12	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154172154	154172154	+	Intron	SNP	G	A	A	rs3750042	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154172154G>A	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron|DPP6_uc010lqh.1_Silent_p.S101S|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ACAAGACATCGCTTCCCCATG	0.498													5	22	---	---	---	---	PASS
PCM1	5108	broad.mit.edu	37	8	17794868	17794868	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17794868A>G	uc003wyi.3	+	4	744	c.322A>G	c.(322-324)AAC>GAC	p.N108D	PCM1_uc011kyh.1_Missense_Mutation_p.N108D|PCM1_uc003wyj.3_Missense_Mutation_p.N108D|PCM1_uc003wyg.2_Missense_Mutation_p.N108D|PCM1_uc003wyh.2_Missense_Mutation_p.N108D|PCM1_uc010lta.1_Missense_Mutation_p.N108D	NM_006197	NP_006188	Q15154	PCM1_HUMAN	pericentriolar material 1	108					centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)		ACAGCGGATAAACTTCAGTGA	0.353			T	RET|JAK2	papillary thyroid|CML|MPD								3	5	---	---	---	---	PASS
TOX	9760	broad.mit.edu	37	8	59852017	59852017	+	Silent	SNP	G	A	A	rs75933966	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59852017G>A	uc003xtw.1	-	3	476	c.255C>T	c.(253-255)CAC>CAT	p.H85H		NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX	85						nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				CTTCATTCAGGTGCACCAGCG	0.483													5	36	---	---	---	---	PASS
DENND4C	55667	broad.mit.edu	37	9	19357230	19357230	+	Intron	SNP	C	G	G	rs36178701	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19357230C>G	uc003znq.2	+						DENND4C_uc011lnc.1_Intron|DENND4C_uc011lnd.1_Intron|DENND4C_uc003znr.2_Intron|DENND4C_uc003zns.2_Intron|DENND4C_uc003znt.2_3'UTR	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C							integral to membrane				ovary(1)|skin(1)	2						TAAAGACAACCTGACTCATAT	0.363													4	10	---	---	---	---	PASS
IFNA14	3448	broad.mit.edu	37	9	21239358	21239358	+	3'UTR	SNP	C	T	T	rs12156618	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21239358C>T	uc010mis.2	-	1					IFNA14_uc003zoo.1_RNA	NM_002172	NP_002163	P01570	IFN14_HUMAN	interferon, alpha 14 precursor						blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CCATGATGAACCAGTTTTCAA	0.398													6	59	---	---	---	---	PASS
C9orf11	54586	broad.mit.edu	37	9	27284779	27284779	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27284779A>G	uc003zql.2	-	8	911	c.827T>C	c.(826-828)ATC>ACC	p.I276T	NCRNA00032_uc010mjd.1_5'Flank|C9orf11_uc011lnq.1_Missense_Mutation_p.I247T	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1	276	Cytoplasmic (Potential).					acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		TATGGAAATGATATCCGTCAT	0.398													109	348	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109688830	109688830	+	Silent	SNP	C	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109688830C>A	uc004bcz.2	+	3	2926	c.2637C>A	c.(2635-2637)CCC>CCA	p.P879P	ZNF462_uc010mto.2_Silent_p.P727P|ZNF462_uc004bda.2_Silent_p.P727P	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	879					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TCTTGGACCCCAATGATCACA	0.473													31	129	---	---	---	---	PASS
C9orf5	23731	broad.mit.edu	37	9	111835614	111835614	+	Intron	SNP	T	C	C	rs11792149	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111835614T>C	uc004bdt.3	-						C9orf5_uc004bds.3_RNA|C9orf5_uc004bdr.3_Intron	NM_032012	NP_114401	Q9H330	CI005_HUMAN	hypothetical protein LOC23731							integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)		ATCTCTCTTCTTTTTCAAAAC	0.378													8	110	---	---	---	---	PASS
ODF2	4957	broad.mit.edu	37	9	131233658	131233658	+	Silent	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131233658G>A	uc011mbd.1	+	6	803	c.492G>A	c.(490-492)GAG>GAA	p.E164E	ODF2_uc011maz.1_Silent_p.E164E|ODF2_uc011mba.1_Intron|ODF2_uc010myb.2_Silent_p.E140E|ODF2_uc011mbb.1_Silent_p.E98E|ODF2_uc011mbc.1_Silent_p.E83E|ODF2_uc004bva.2_Silent_p.E117E|ODF2_uc004bvb.2_Silent_p.E140E|ODF2_uc011mbe.1_Silent_p.E159E|ODF2_uc004bvc.2_Silent_p.E140E|ODF2_uc010myc.2_Silent_p.E107E|ODF2_uc011mbf.1_Silent_p.E145E|ODF2_uc004bvd.3_Silent_p.E164E|ODF2_uc004bve.2_Silent_p.E145E	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1	164	Potential.				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						AGCTGGAGGAGGTGGCCCACG	0.582													68	216	---	---	---	---	PASS
SET	6418	broad.mit.edu	37	9	131456331	131456331	+	Intron	SNP	A	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131456331A>T	uc004bvt.3	+						SET_uc004bvu.3_Intron|SET_uc010myg.2_RNA|SET_uc011mbj.1_Intron	NM_001122821	NP_001116293	Q01105	SET_HUMAN	SET translocation (myeloid leukemia-associated)						DNA replication|mRNA metabolic process|negative regulation of histone acetylation|negative regulation of neuron apoptosis|negative regulation of transcription, DNA-dependent|nucleocytoplasmic transport|nucleosome assembly|nucleosome disassembly	cytosol|endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm|protein complex	histone binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity				0		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		ggtaaaagaaAATTTGGCTAA	0.154			T	NUP214	AML								25	70	---	---	---	---	PASS
PKN3	29941	broad.mit.edu	37	9	131479036	131479036	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131479036G>A	uc004bvw.2	+	16	2212	c.1819G>A	c.(1819-1821)GAG>AAG	p.E607K	PKN3_uc010myh.2_Missense_Mutation_p.E607K|PKN3_uc011mbk.1_Missense_Mutation_p.E157K	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta	607	Protein kinase.				signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						CCTGTACTGCGAGAAGCGGAT	0.597													38	114	---	---	---	---	PASS
RXRA	6256	broad.mit.edu	37	9	137321027	137321027	+	Silent	SNP	C	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137321027C>A	uc004cfb.2	+	7	1146	c.984C>A	c.(982-984)ACC>ACA	p.T328T	RXRA_uc004cfc.1_Silent_p.T231T	NM_002957	NP_002948	P19793	RXRA_HUMAN	retinoid X receptor, alpha	328	Ligand-binding.				cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)	TCCTGGCCACCGGGCTGCACG	0.687													4	39	---	---	---	---	PASS
PITRM1	10531	broad.mit.edu	37	10	3202466	3202466	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3202466T>G	uc010qah.1	-	7	784	c.752A>C	c.(751-753)GAA>GCA	p.E251A	PITRM1_uc001igr.1_Missense_Mutation_p.E283A|PITRM1_uc001igt.1_Missense_Mutation_p.E283A|PITRM1_uc009xhv.1_5'Flank|PITRM1_uc001igu.1_Missense_Mutation_p.E275A|PITRM1_uc010qai.1_Missense_Mutation_p.E254A|PITRM1_uc001igw.1_Missense_Mutation_p.E283A			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;	251					proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						GCTCAGTGCTTCCTCGTGAAT	0.428													60	238	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21157673	21157673	+	Missense_Mutation	SNP	C	T	T	rs137973321	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21157673C>T	uc001iqi.2	-	7	1001	c.604G>A	c.(604-606)GGA>AGA	p.G202R	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	202	Nebulin 5.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						TTCATTATTCCTTGTCCTTTC	0.333													4	48	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24909709	24909709	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24909709G>T	uc001isb.2	-	9	1602	c.1115C>A	c.(1114-1116)TCT>TAT	p.S372Y	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Missense_Mutation_p.S372Y|ARHGAP21_uc010qdc.1_Missense_Mutation_p.S207Y|ARHGAP21_uc001isc.1_Missense_Mutation_p.S362Y	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	371					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						GTGATTAACAGATACAGAGGG	0.393													39	131	---	---	---	---	PASS
PRKG1	5592	broad.mit.edu	37	10	53227601	53227601	+	Intron	SNP	G	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53227601G>T	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Missense_Mutation_p.K184N	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TCAAGAGTAAGACTATTTTCA	0.353													6	25	---	---	---	---	PASS
FAM160B1	57700	broad.mit.edu	37	10	116659253	116659253	+	Missense_Mutation	SNP	A	G	G	rs10885629	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116659253A>G	uc001lcc.2	+	17	2532	c.2197A>G	c.(2197-2199)ACG>GCG	p.T733A		NM_001135051	NP_001128523	Q5W0V3	F16B1_HUMAN	hypothetical protein LOC57700 isoform b	Error:Variant_position_missing_in_Q5W0V3_after_alignment										lung(1)	1						cctcaggcagacgttgccttc	0.050													11	151	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33589732	33589732	+	Silent	SNP	C	A	A	rs140561197	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33589732C>A	uc001mup.3	+	8	3440	c.3316C>A	c.(3316-3318)CGG>AGG	p.R1106R	C11orf41_uc001mun.1_Silent_p.R1106R	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	1100						integral to membrane				ovary(2)	2						ACAAGGCCGGCGGTTTAAACG	0.582													12	62	---	---	---	---	PASS
MUS81	80198	broad.mit.edu	37	11	65633318	65633318	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65633318G>C	uc001ofv.3	+	15	1895	c.1542G>C	c.(1540-1542)AAG>AAC	p.K514N	MUS81_uc001ofw.3_RNA|MUS81_uc001ofx.3_Missense_Mutation_p.K71N	NM_025128	NP_079404	Q96NY9	MUS81_HUMAN	MUS81 endonuclease homolog	514					DNA recombination|DNA repair	nucleolus	3'-flap endonuclease activity|DNA binding|metal ion binding|protein binding				0				READ - Rectum adenocarcinoma(159;0.166)		CCACCCCCAAGGAACAAGAGA	0.622								Homologous_recombination					41	124	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	74208214	74208214	+	Silent	SNP	G	A	A	rs656506	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74208214G>A	uc001ove.2	+	2	1055	c.264G>A	c.(262-264)ACG>ACA	p.T88T						SubName: Full=Similar to Cytochrome c, somatic;																		aacatcttacggaagagtatg	0.000													3	17	---	---	---	---	PASS
OR4D5	219875	broad.mit.edu	37	11	123810936	123810936	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123810936C>A	uc001pzk.1	+	1	613	c.613C>A	c.(613-615)CTG>ATG	p.L205M		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	205	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TAACAATGGCCTGGTGACCCT	0.507													102	344	---	---	---	---	PASS
GALNT8	26290	broad.mit.edu	37	12	4835701	4835701	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4835701A>G	uc001qne.1	+	2	307	c.215A>G	c.(214-216)GAA>GGA	p.E72G		NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	72	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4						TTTGCAGAAGAAAGTATGAAA	0.438													19	47	---	---	---	---	PASS
TAS2R50	259296	broad.mit.edu	37	12	11138813	11138813	+	Nonsense_Mutation	SNP	G	T	T	rs146930737		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11138813G>T	uc001qzl.2	-	1	699	c.647C>A	c.(646-648)TCG>TAG	p.S216*	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176890	NP_795371	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	216	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(2)	2						GAGATCTTGCGATCCTTCTCC	0.418													5	36	---	---	---	---	PASS
KRT6B	3854	broad.mit.edu	37	12	52845500	52845500	+	Silent	SNP	G	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52845500G>T	uc001sak.2	-	1	411	c.363C>A	c.(361-363)GGC>GGA	p.G121G		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	121	Head.			AGG -> LC (in Ref. 2; AAA59466).	ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)		GGCCCCCAAAGCCACCAGCAA	0.627													47	278	---	---	---	---	PASS
PTPRQ	374462	broad.mit.edu	37	12	80900348	80900348	+	Missense_Mutation	SNP	T	G	G	rs7965277	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80900348T>G	uc001sze.2	+	13	2456	c.2456T>G	c.(2455-2457)GTA>GGA	p.V819G		NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						TTCTCTTTAGTACTGAAGAAA	0.353													3	9	---	---	---	---	PASS
PTPRQ	374462	broad.mit.edu	37	12	81007527	81007527	+	Missense_Mutation	SNP	T	C	C	rs7963963	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81007527T>C	uc001sze.2	+	26	5075	c.5075T>C	c.(5074-5076)ATT>ACT	p.I1692T		NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						GCTGTCCAGATTCACAACCTC	0.378													6	10	---	---	---	---	PASS
TCP11L2	255394	broad.mit.edu	37	12	106704914	106704914	+	Missense_Mutation	SNP	T	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106704914T>A	uc001tln.2	+	2	235	c.61T>A	c.(61-63)TCC>ACC	p.S21T	TCP11L2_uc001tll.2_Missense_Mutation_p.S21T|TCP11L2_uc001tlm.2_Missense_Mutation_p.S21T|TCP11L2_uc001tlo.1_RNA	NM_152772	NP_689985	Q8N4U5	T11L2_HUMAN	t-complex 11 (mouse) like 2	21	Ser-rich.									ovary(3)	3						TTCTGATTCTTCCCGGTTTTC	0.512													14	81	---	---	---	---	PASS
PXN	5829	broad.mit.edu	37	12	120660442	120660442	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120660442G>A	uc001txt.2	-	5	736	c.605C>T	c.(604-606)CCT>CTT	p.P202L	PXN_uc001txv.2_Missense_Mutation_p.P69L|PXN_uc001txx.2_Missense_Mutation_p.P69L|PXN_uc001txy.2_Missense_Mutation_p.P202L|PXN_uc001txz.2_RNA|uc001tya.2_5'Flank	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1	202					cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding			ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATTCCGCTTAGGCTTCTCTTT	0.652													18	66	---	---	---	---	PASS
FAM124A	220108	broad.mit.edu	37	13	51855004	51855004	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51855004T>C	uc001vfg.1	+	4	1384	c.1253T>C	c.(1252-1254)CTG>CCG	p.L418P	FAM124A_uc001vff.1_Missense_Mutation_p.L454P	NM_145019	NP_659456	Q86V42	F124A_HUMAN	hypothetical protein LOC220108	418										central_nervous_system(1)	1		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		GACACAGGCCTGCGGCTGTCC	0.617													8	35	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76430713	76430713	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76430713G>A	uc001vjv.2	+	26	4794	c.4034G>A	c.(4033-4035)TGT>TAT	p.C1345Y	LMO7_uc010thv.1_Silent_p.L1332L|LMO7_uc010thw.1_Silent_p.L1258L|LMO7_uc001vjx.1_5'Flank	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	Error:Variant_position_missing_in_Q8WWI1_after_alignment						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ACCACCAACTGTACTGCAACG	0.458													68	194	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22309367	22309367	+	Intron	SNP	T	C	C	rs34529030	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22309367T>C	uc010tmf.1	+						uc001wbw.2_Intron|uc010tmg.1_5'UTR|uc001wbx.2_5'UTR|uc001wby.2_5'Flank					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		CTCTGCTATGTTCATTTCTTT	0.343													5	22	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22309397	22309397	+	Intron	SNP	C	G	G	rs36036881	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22309397C>G	uc010tmf.1	+						uc001wbw.2_Intron|uc010tmg.1_Translation_Start_Site|uc001wbx.2_Translation_Start_Site|uc001wby.2_5'Flank					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		AAATTTTAATCCTCAGTGAAC	0.353													4	31	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22963868	22963868	+	Intron	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22963868G>A	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001weh.1_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc010ajw.1_RNA|uc001wep.2_5'UTR|uc001weq.2_5'Flank|uc001wer.2_5'Flank|uc001wet.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GGTCACGCTCGGTAGGTAACA	0.468													12	25	---	---	---	---	PASS
DAAM1	23002	broad.mit.edu	37	14	59821977	59821977	+	Silent	SNP	T	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59821977T>G	uc001xdz.1	+	21	2606	c.2481T>G	c.(2479-2481)GGT>GGG	p.G827G	DAAM1_uc001xea.1_Silent_p.G817G|DAAM1_uc001xec.1_RNA	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	827	FH2.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TGAATAAAGGTCAAAGAGGGA	0.408													42	82	---	---	---	---	PASS
ADAM21P1	145241	broad.mit.edu	37	14	70713858	70713858	+	Missense_Mutation	SNP	T	C	C	rs61979492	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70713858T>C	uc010ttg.1	-	1	661	c.10A>G	c.(10-12)AGC>GGC	p.S4G		NR_003951				SubName: Full=ADAM21-like protein;												0						TCTGTTAAGCTACATCTCATA	0.448													4	23	---	---	---	---	PASS
GABRA5	2558	broad.mit.edu	37	15	27126102	27126102	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27126102C>A	uc001zbd.1	+	5	535	c.196C>A	c.(196-198)CCC>ACC	p.P66T	GABRB3_uc001zbb.2_Intron	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	66	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CAGACTTCGGCCCGGGCTGGG	0.517													20	142	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40917500	40917500	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40917500G>A	uc010bbs.1	+	11	5277	c.5116G>A	c.(5116-5118)GAT>AAT	p.D1706N	CASC5_uc010ucq.1_Missense_Mutation_p.D1530N|CASC5_uc001zme.2_Missense_Mutation_p.D1680N|CASC5_uc010bbt.1_Missense_Mutation_p.D1680N	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	1706					acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGACACAACTGATATAAATCA	0.398													10	50	---	---	---	---	PASS
CSNK1G1	53944	broad.mit.edu	37	15	64496767	64496767	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64496767C>T	uc002anf.2	-	9	1352	c.872G>A	c.(871-873)CGA>CAA	p.R291Q	CSNK1G1_uc002ane.2_RNA|CSNK1G1_uc002ang.1_Missense_Mutation_p.R291Q|CSNK1G1_uc002anh.1_Missense_Mutation_p.R291Q|CSNK1G1_uc002anj.2_Missense_Mutation_p.R273Q	NM_022048	NP_071331	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1	291	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0						CCTGACATATCGAAGGTAGGT	0.448													25	102	---	---	---	---	PASS
TBC1D24	57465	broad.mit.edu	37	16	2546483	2546483	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2546483G>C	uc002cql.2	+	2	474	c.334G>C	c.(334-336)GGG>CGG	p.G112R	TBC1D24_uc002cqk.2_Missense_Mutation_p.G112R|TBC1D24_uc002cqm.2_Missense_Mutation_p.G112R|TBC1D24_uc010bsm.2_5'Flank	NM_020705	NP_065756	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	112	Rab-GAP TBC.				neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity				0						ACGCGGCGAGGGGGCCGTGCG	0.677													6	16	---	---	---	---	PASS
ERI2	112479	broad.mit.edu	37	16	20809969	20809969	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20809969G>C	uc010vbb.1	-	9	1196	c.1153C>G	c.(1153-1155)CCA>GCA	p.P385A	ERI2_uc002dht.3_Missense_Mutation_p.P292A|ERI2_uc002dhs.2_Intron|ERI2_uc010bwh.2_Missense_Mutation_p.P292A|ERI2_uc010vbc.1_Missense_Mutation_p.P157A|ERI2_uc002dhu.1_Intron	NM_001142725	NP_001136197	A8K979	ERI2_HUMAN	exoribonuclease 2 isoform 1	385						intracellular	exonuclease activity|nucleic acid binding|zinc ion binding			large_intestine(1)	1						TGAACAGTTGGAACGGTGGTA	0.398													3	7	---	---	---	---	PASS
KIF22	3835	broad.mit.edu	37	16	29816529	29816529	+	Intron	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29816529C>T	uc002dts.3	+						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|KIF22_uc010vdv.1_Intron|KIF22_uc010vdw.1_Intron|KIF22_uc010bzf.2_Intron|KIF22_uc002dtt.1_3'UTR|KIF22_uc002frc.1_Intron|MAZ_uc002dtv.1_5'Flank|MAZ_uc010vdx.1_5'Flank|MAZ_uc002dtw.2_5'Flank|MAZ_uc002dtx.2_5'Flank|MAZ_uc002dty.2_5'Flank|MAZ_uc010bzg.2_5'Flank|MAZ_uc002dtz.1_5'Flank|MAZ_uc002dua.2_5'Flank|MAZ_uc010vdy.1_5'Flank	NM_007317	NP_015556	Q14807	KIF22_HUMAN	kinesin family member 22						blood coagulation|DNA repair|microtubule-based movement|mitosis	cytosol|kinetochore|microtubule|nucleus	ATP binding|DNA binding|microtubule motor activity|protein binding				0						CTCTGCCTGTCCTGCGCCCCG	0.667													12	48	---	---	---	---	PASS
FUS	2521	broad.mit.edu	37	16	31202822	31202822	+	3'UTR	SNP	T	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31202822T>A	uc002ebf.2	+	15					FUS_uc002ebh.2_3'UTR|FUS_uc002ebg.2_3'UTR|FUS_uc002ebi.2_3'UTR|FUS_uc002ebj.2_3'UTR	NM_004960	NP_004951	P35637	FUS_HUMAN	fusion (involved in t(12;16) in malignant						cell death|nuclear mRNA splicing, via spliceosome	nucleoplasm	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		FUS/DDIT3(623)|FUS/ERG(163)|FUS/CREB3L2(158)|FUS/CREB3L1(6)|FUS/ATF1(4)|FUS/FEV(2)	soft_tissue(791)|haematopoietic_and_lymphoid_tissue(153)|bone(12)|breast(2)	958		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		ACCCTCGTTATTTTGTAACCT	0.448			T	DDIT3|ERG|FEV|ATF1|CREB3L2|CREB3L1	liposarcoma|AML|Ewing sarcoma|angiomatoid fibrous histiocytoma|fibromyxoid sarcoma								32	110	---	---	---	---	PASS
CNOT1	23019	broad.mit.edu	37	16	58633316	58633316	+	5'UTR	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58633316C>T	uc002env.2	-	2					CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_5'UTR|CNOT1_uc002enx.2_5'UTR|CNOT1_uc002enz.1_5'UTR	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		ACCTCAGAGGCAGGTTAATGC	0.483													14	57	---	---	---	---	PASS
GP1BA	2811	broad.mit.edu	37	17	4836362	4836362	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4836362C>A	uc010vsq.1	+	2	538	c.463C>A	c.(463-465)CTG>ATG	p.L155M	uc002fzn.1_RNA	NM_000173	NP_000164	P07359	GP1BA_HUMAN	platelet glycoprotein Ib alpha polypeptide	155											0						GCTGAAGACCCTGCCCCCAGG	0.607													7	19	---	---	---	---	PASS
SGK494	124923	broad.mit.edu	37	17	26940650	26940650	+	Silent	SNP	A	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26940650A>G	uc002hbr.1	-	2	164	c.132T>C	c.(130-132)GGT>GGC	p.G44G	SGK494_uc010waq.1_Silent_p.G44G|SGK494_uc010war.1_RNA|uc010crq.1_5'Flank|uc002hbs.1_Intron	NM_144610	NP_653211			uncharacterized serine/threonine-protein kinase												0						TGGTTCCCAAACCTGTCCAGA	0.577											OREG0024279	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	96	---	---	---	---	PASS
SLFN12L	342615	broad.mit.edu	37	17	33802156	33802156	+	Missense_Mutation	SNP	T	G	G	rs3744372	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33802156T>G	uc002hjn.2	-	5	2519	c.1640A>C	c.(1639-1641)TAC>TCC	p.Y547S		NM_001145027	NP_001138499			schlafen family member 12-like											ovary(1)	1						AGGGCTCAAGTAGAAGATCTT	0.378													14	244	---	---	---	---	PASS
SLFN12L	342615	broad.mit.edu	37	17	33805180	33805180	+	Missense_Mutation	SNP	G	C	C	rs2304967	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33805180G>C	uc002hjn.2	-	4	2084	c.1205C>G	c.(1204-1206)GCA>GGA	p.A402G		NM_001145027	NP_001138499			schlafen family member 12-like											ovary(1)	1						TGATGTACTTGCTGGAGAGGG	0.393													5	36	---	---	---	---	PASS
HEXIM1	10614	broad.mit.edu	37	17	43226683	43226683	+	Silent	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43226683G>A	uc002iig.2	+	1	2000	c.126G>A	c.(124-126)GAG>GAA	p.E42E		NM_006460	NP_006451	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	42					negative regulation of cyclin-dependent protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding|snRNA binding			ovary(1)	1						GGGTGCCCGAGGAGGACAGTA	0.647											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	41	---	---	---	---	PASS
NFE2L1	4779	broad.mit.edu	37	17	46135808	46135808	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46135808T>G	uc002imz.3	+	6	1775	c.1124T>G	c.(1123-1125)TTC>TGC	p.F375C	NFE2L1_uc002ina.3_Missense_Mutation_p.F345C|NFE2L1_uc002inb.3_Missense_Mutation_p.F345C|NFE2L1_uc010wle.1_Missense_Mutation_p.F187C|NFE2L1_uc010wlf.1_Missense_Mutation_p.F219C	NM_003204	NP_003195	Q14494	NF2L1_HUMAN	nuclear factor erythroid 2-like 1	375					anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1						AGCCAGGACTTCTTACTCTTC	0.607													47	197	---	---	---	---	PASS
NFE2L1	4779	broad.mit.edu	37	17	46135809	46135809	+	Silent	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46135809C>T	uc002imz.3	+	6	1776	c.1125C>T	c.(1123-1125)TTC>TTT	p.F375F	NFE2L1_uc002ina.3_Silent_p.F345F|NFE2L1_uc002inb.3_Silent_p.F345F|NFE2L1_uc010wle.1_Silent_p.F187F|NFE2L1_uc010wlf.1_Silent_p.F219F	NM_003204	NP_003195	Q14494	NF2L1_HUMAN	nuclear factor erythroid 2-like 1	375					anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1						GCCAGGACTTCTTACTCTTCA	0.607													44	195	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61607841	61607841	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61607841G>A	uc002jay.2	+	4	693	c.613G>A	c.(613-615)GAG>AAG	p.E205K	KCNH6_uc002jax.1_Missense_Mutation_p.E205K|KCNH6_uc010wpl.1_Missense_Mutation_p.E82K|KCNH6_uc010wpm.1_Missense_Mutation_p.E205K|KCNH6_uc002jaz.1_Missense_Mutation_p.E205K	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	205	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	CACGGAGATTGAGATCATCGC	0.592													21	100	---	---	---	---	PASS
ANKRD29	147463	broad.mit.edu	37	18	21214030	21214030	+	Silent	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21214030G>A	uc002kun.2	-	5	571	c.414C>T	c.(412-414)ATC>ATT	p.I138I	ANKRD29_uc002kuo.2_Silent_p.I138I	NM_173505	NP_775776	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	138	ANK 4.									ovary(3)|breast(1)	4	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GTTGGTCATGGATGTTTGCTC	0.493													24	105	---	---	---	---	PASS
SLC44A2	57153	broad.mit.edu	37	19	10738597	10738597	+	Silent	SNP	C	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10738597C>G	uc002mpf.2	+	4	301	c.162C>G	c.(160-162)GCC>GCG	p.A54A	SLC44A2_uc002mpe.3_Silent_p.A52A	NM_020428	NP_065161	Q8IWA5	CTL2_HUMAN	solute carrier family 44, member 2 isoform 1	54	Helical; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane|plasma membrane	choline transmembrane transporter activity|signal transducer activity			ovary(1)	1			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	TTTCCACAGCCTGGACTCATG	0.587													34	108	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12502502	12502502	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12502502T>C	uc010dyt.2	-	4	860	c.710A>G	c.(709-711)TAC>TGC	p.Y237C	ZNF799_uc002mts.3_Intron	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN	zinc finger protein 799	237	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						ATAGGAACTGTAAAAAGAAAA	0.373													4	17	---	---	---	---	PASS
NR2C2AP	126382	broad.mit.edu	37	19	19313204	19313204	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19313204G>A	uc002nlx.2	-	4	608	c.239C>T	c.(238-240)TCA>TTA	p.S80L	NR2C2AP_uc010xqq.1_5'Flank|NR2C2AP_uc002nly.2_Missense_Mutation_p.H104Y	NM_176880	NP_795361	Q86WQ0	NR2CA_HUMAN	TR4 orphan receptor associated protein TRA16	80					cell adhesion|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm				ovary(1)	1			Epithelial(12;0.00235)			AGTGCCCTGTGAACCTTCAGC	0.582													41	184	---	---	---	---	PASS
WDR87	83889	broad.mit.edu	37	19	38378107	38378107	+	Silent	SNP	G	A	A	rs60704260	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38378107G>A	uc010efu.2	-	6	6312	c.6087C>T	c.(6085-6087)AGC>AGT	p.S2029S	WDR87_uc002ohj.2_Silent_p.S2068S	NM_031951	NP_114157	Q6ZQQ6	WDR87_HUMAN	NYD-SP11 protein	2029	Glu-rich.										0						TGGCAATTTCGCTTTCCTCCA	0.383													4	30	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385954	58385954	+	Silent	SNP	T	C	C	rs10412929	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385954T>C	uc002qqo.2	-	3	1076	c.804A>G	c.(802-804)AAA>AAG	p.K268K	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	268					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						CACATTCATGTTTTTTTTCAG	0.373													11	108	---	---	---	---	PASS
SPTLC3	55304	broad.mit.edu	37	20	12989901	12989901	+	5'UTR	SNP	T	C	C	rs3761896	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12989901T>C	uc002wod.1	+	1					SPTLC3_uc002wob.1_RNA|SPTLC3_uc002woc.2_5'UTR	NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base						sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	TCCCGGGCTCTGTCACTTCAC	0.507													5	38	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61511885	61511885	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61511885G>A	uc002ydr.1	-	16	5687	c.5423C>T	c.(5422-5424)CCT>CTT	p.P1808L	DIDO1_uc002yds.1_Missense_Mutation_p.P1808L	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	1808	Pro-rich.				apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					GAATAAGGAAGGGATGGGCCC	0.617													21	61	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10862818	10862818	+	IGR	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10862818G>C								None (None upstream) : TPTE (43925 downstream)																							CCTCAGTGAAGGTCTCCTGCA	0.577													21	209	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	C	C	rs142470496	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091840T>C	uc003adu.1	-	11	1189	c.1117A>G	c.(1117-1119)AAG>GAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				5	55	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	A	A	rs146546850	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091841G>A	uc003adu.1	-	11	1188	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	372	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				4	54	---	---	---	---	PASS
C22orf23	84645	broad.mit.edu	37	22	38340445	38340445	+	Silent	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38340445G>A	uc003auj.1	-	6	652	c.561C>T	c.(559-561)ATC>ATT	p.I187I	C22orf23_uc003auk.1_Silent_p.I187I	NM_032561	NP_115950	Q9BZE7	EVG1_HUMAN	hypothetical protein LOC84645	187											0	Melanoma(58;0.045)					CAGCAAGGATGATTCCTCGGT	0.557													74	284	---	---	---	---	PASS
LMF2	91289	broad.mit.edu	37	22	50941946	50941946	+	Silent	SNP	C	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50941946C>A	uc003blp.2	-	14	2029	c.1998G>T	c.(1996-1998)CTG>CTT	p.L666L	LMF2_uc010hba.2_Silent_p.L488L|LMF2_uc003blo.2_Silent_p.L641L	NM_033200	NP_149977	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	666						endoplasmic reticulum membrane|integral to membrane				breast(1)	1		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGACTGGTGCCAGCGGGGAGG	0.677													7	22	---	---	---	---	PASS
EIF1AX	1964	broad.mit.edu	37	X	20159910	20159910	+	5'UTR	SNP	G	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20159910G>A	uc004czt.2	-	1						NM_001412	NP_001403	P47813	IF1AX_HUMAN	X-linked eukaryotic translation initiation							cytosol	translation initiation factor activity			ovary(1)	1						TGGCGACCCAGCTCTTCAGAG	0.726													4	14	---	---	---	---	PASS
DCAF8L2	347442	broad.mit.edu	37	X	27766776	27766776	+	Silent	SNP	G	A	A	rs45553337	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27766776G>A	uc011mjy.1	+	1	1851	c.1764G>A	c.(1762-1764)ACG>ACA	p.T588T		NM_001136533	NP_001130005			DDB1 and CUL4 associated factor 8-like 2											central_nervous_system(1)|pancreas(1)	2						GTCACGTGACGCAGAGAGGTC	0.507													4	19	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	28807442	28807442	+	5'UTR	SNP	G	A	A	rs6526806	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:28807442G>A	uc004dby.2	+	2						NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TTTAGGGAACGGCCTTTAAGA	0.353													5	34	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50111937	50111937	+	3'UTR	SNP	G	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50111937G>C	uc010njr.1	-	29						NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					AGCTTTCAAGGGCTACAGTTG	0.403													8	97	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65428080	65428080	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65428080C>T	uc011moz.1	+	15	2624	c.2564C>T	c.(2563-2565)GCT>GTT	p.A855V	HEPH_uc004dwn.2_Missense_Mutation_p.A855V|HEPH_uc004dwo.2_Missense_Mutation_p.A585V|HEPH_uc010nkr.2_Missense_Mutation_p.A663V|HEPH_uc011mpa.1_Missense_Mutation_p.A855V|HEPH_uc010nks.2_Missense_Mutation_p.A144V	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	852	Extracellular (Potential).|Plastocyanin-like 5.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						CCACTGGCTGCTGAGCCTGGT	0.468													7	21	---	---	---	---	PASS
DGAT2L6	347516	broad.mit.edu	37	X	69397388	69397388	+	5'UTR	SNP	A	G	G	rs1199509	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69397388A>G	uc004dxx.1	+	1						NM_198512	NP_940914	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6						lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)	1						AGAAGTTTTGACCTTCTGGTT	0.433													7	67	---	---	---	---	PASS
ZNF449	203523	broad.mit.edu	37	X	134493747	134493747	+	Intron	SNP	A	T	T	rs4829778	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134493747A>T	uc004eys.2	+						ZNF449_uc004eyt.2_Intron|ZNF449_uc004eyu.2_5'UTR	NM_152695	NP_689908	Q6P9G9	ZN449_HUMAN	zinc finger protein 449						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CTGTCCAAGAAATCAGCCTAA	0.363													5	1	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	10978	10978	+	RNA	SNP	A	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:10978A>G	uc004cov.3	+	1		c.401A>G			uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		ACCTGACTCCTACCCCTCACA	0.438													4	22	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13896	13896	+	RNA	SNP	T	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13896T>C	uc004cox.3	+	1		c.1560T>C			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CTATGCACATTTTATTTCTCC	0.458													4	28	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1585903	1585903	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1585903delT	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						TCTCATCTtcttttttttatt	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	2577264	2577264	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2577264delT								MMEL1 (12783 upstream) : ACTRT2 (360782 downstream)																							TCAGAACCCCTTTTCTGAGGC	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	2876171	2876171	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2876171delG								MMEL1 (311690 upstream) : ACTRT2 (61875 downstream)																							ACTGACTTCTGACATGGGTGA	0.587													4	2	---	---	---	---	
THAP3	90326	broad.mit.edu	37	1	6687001	6687001	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6687001delG	uc001aoc.2	+						THAP3_uc001aod.2_Intron|THAP3_uc001aoe.1_Intron			Q8WTV1	THAP3_HUMAN	RecName: Full=THAP domain-containing protein 3;								DNA binding|metal ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		gtatgtacttggggatggagt	0.194													4	2	---	---	---	---	
DNAJC11	55735	broad.mit.edu	37	1	6698637	6698637	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6698637delC	uc001aof.2	-						DNAJC11_uc010nzt.1_Intron|DNAJC11_uc001aog.2_Intron|DNAJC11_uc010nzu.1_Intron	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11						protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		GATGGCTCTGCCCCACCTCCT	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9689987	9689987	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9689987delG								TMEM201 (15052 upstream) : PIK3CD (21803 downstream)																							AGGGGGGAGTGGGGGCGGAGG	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9978538	9978538	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9978538delG								CTNNBIP1 (8222 upstream) : LZIC (11240 downstream)																							actaatcaaagggtgaggaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11638359	11638360	+	IGR	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11638359_11638360delGA								PTCHD2 (40720 upstream) : FBXO2 (70090 downstream)																							GGACGGCCAGGAGAGAGAGCAG	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14764533	14764533	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14764533delC								PRDM2 (612961 upstream) : KAZ (160680 downstream)																							TTTCCCTTTTCTCTCCTTCTG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14764535	14764535	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14764535delC								PRDM2 (612963 upstream) : KAZ (160678 downstream)																							TCCCTTTTCTCTCCTTCTGCC	0.423													4	2	---	---	---	---	
FHAD1	114827	broad.mit.edu	37	1	15607756	15607757	+	Intron	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15607756_15607757insC	uc001awb.2	+						FHAD1_uc001awa.1_Intron	NM_052929	NP_443161	B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding											skin(1)	1						gtgcctcctttcccccttcttt	0.153													4	2	---	---	---	---	
PADI3	51702	broad.mit.edu	37	1	17609784	17609784	+	3'UTR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17609784delC	uc001bai.2	+	16						NM_016233	NP_057317	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(1)|breast(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	ATCTTCTCGGCCCCCCAAAAA	0.507													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	19833391	19833391	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19833391delT								CAPZB (21399 upstream) : C1orf151 (90076 downstream)																							aatgcccacctcctaatacct	0.000													4	2	---	---	---	---	
ALPL	249	broad.mit.edu	37	1	21886367	21886368	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21886367_21886368delAC	uc001bet.2	+						ALPL_uc010odn.1_Intron|ALPL_uc010odo.1_Intron|ALPL_uc010odp.1_Intron|ALPL_uc001beu.3_Intron	NM_000478	NP_000469	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase						response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)	TGGTTGCTGGACACACACACAC	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22503922	22503923	+	IGR	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22503922_22503923insG								WNT4 (33537 upstream) : ZBTB40 (274421 downstream)																							CTTGGGAAAGAGGGCACGTAGG	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	23282034	23282036	+	IGR	DEL	TTT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23282034_23282036delTTT								EPHB2 (40212 upstream) : KDM1A (63905 downstream)																							AACAAATCAGTTTTTTAAAAAAG	0.300													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25361913	25361914	+	IGR	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25361913_25361914delTG								RUNX3 (70301 upstream) : SYF2 (186853 downstream)																							tgtgtatgtatgtgtgtgtgtg	0.178													4	2	---	---	---	---	
RHD	6007	broad.mit.edu	37	1	25599374	25599376	+	Intron	DEL	GGG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25599374_25599376delGGG	uc001bjz.2	+						RHD_uc010oep.1_Intron|RHD_uc001bkc.2_Intron|RHD_uc009vrm.2_Intron|RHD_uc001bka.2_Intron|RHD_uc001bkb.2_Intron|RHD_uc009vrn.2_Intron|RHD_uc009vro.2_Intron|RHD_uc009vrp.2_Intron	NM_016124	NP_057208	Q02161	RHD_HUMAN	Rh blood group D antigen isoform 1							integral to plasma membrane				breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAAGCAGCCTGGGCATGCCCTCT	0.443													1	5	---	---	---	---	
SEPN1	57190	broad.mit.edu	37	1	26142381	26142382	+	3'UTR	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26142381_26142382delAG	uc010oer.1	+	16					SEPN1_uc010oes.1_3'UTR	NM_020451	NP_065184	Q9NZV5	SELN_HUMAN	selenoprotein N, 1 isoform 1 precursor							endoplasmic reticulum membrane|extracellular region	protein binding			ovary(2)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGGCGGGTAGACAAGGGATG	0.629													4	2	---	---	---	---	
ZBTB8OS	339487	broad.mit.edu	37	1	33092834	33092835	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33092834_33092835delGA	uc001bvp.2	-						ZBTB8OS_uc001bvo.1_Intron|ZBTB8OS_uc001bvq.2_Intron	NM_178547	NP_848642	Q8IWT0	ARCH_HUMAN	zinc finger and BTB domain containing 8 opposite												0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				tttattataggagaagaaataa	0.129													4	2	---	---	---	---	
DLGAP3	58512	broad.mit.edu	37	1	35334759	35334759	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35334759delA	uc001byc.2	-							NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated						cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				CACCCCAAGCAAAAAAAAGGA	0.488													4	2	---	---	---	---	
ZMYM4	9202	broad.mit.edu	37	1	35875816	35875816	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35875816delG	uc001byt.2	+						ZMYM4_uc009vuu.2_Intron|ZMYM4_uc001byu.2_Intron|ZMYM4_uc009vuv.2_Intron	NM_005095	NP_005086	Q5VZL5	ZMYM4_HUMAN	zinc finger protein 262						multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				tgagagatcagggccccactg	0.000													4	2	---	---	---	---	
KIAA0319L	79932	broad.mit.edu	37	1	35976870	35976870	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35976870delA	uc001byx.2	-						KIAA0319L_uc010ohw.1_Intron|KIAA0319L_uc001byz.2_Intron|KIAA0319L_uc010ohx.1_Intron	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TACTGGGGGGAAAAAAAAACA	0.383													4	2	---	---	---	---	
NCDN	23154	broad.mit.edu	37	1	36028373	36028374	+	Intron	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36028373_36028374insG	uc001bza.2	+						NCDN_uc001bzb.2_Intron|NCDN_uc001bzc.2_Intron	NM_001014839	NP_001014839	Q9UBB6	NCDN_HUMAN	neurochondrin isoform 1						neuron projection development	cytosol|dendrite|neuronal cell body				large_intestine(2)|pancreas(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ATTTCTGTTTTGGGGGGCTTGT	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37903738	37903739	+	IGR	DEL	CC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37903738_37903739delCC								GRIK3 (403894 upstream) : ZC3H12A (36380 downstream)																							gttccctccacccgaatcccta	0.153													4	2	---	---	---	---	
MEAF6	64769	broad.mit.edu	37	1	37981650	37981651	+	5'Flank	INS	-	T	T	rs141322415	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37981650_37981651insT	uc001cbg.1	-						MEAF6_uc001cbd.1_5'Flank|MEAF6_uc001cbe.1_5'Flank|MEAF6_uc009vvd.1_5'Flank|MEAF6_uc001cbf.1_5'Flank|MEAF6_uc001cbh.1_5'Flank	NM_022756	NP_073593	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6						histone H2A acetylation|histone H3-K14 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|NuA4 histone acetyltransferase complex|nucleolus	protein binding				0						attccttggaatttttacatag	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41934292	41934292	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41934292delG								SCMH1 (226504 upstream) : EDN2 (10157 downstream)																							AGGCAGGGGTGGGGTGGGTAG	0.527													4	2	---	---	---	---	
SLC6A9	6536	broad.mit.edu	37	1	44472413	44472414	+	Intron	DEL	CC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44472413_44472414delCC	uc001cll.2	-						SLC6A9_uc009vxe.2_Intron|SLC6A9_uc010okm.1_Intron|SLC6A9_uc001clm.2_Intron|SLC6A9_uc009vxd.2_Intron|SLC6A9_uc010okn.1_Intron|SLC6A9_uc001cln.2_Intron|SLC6A9_uc010oko.1_Intron|SLC6A9_uc010okp.1_Intron	NM_201649	NP_964012	P48067	SC6A9_HUMAN	solute carrier family 6 member 9 isoform 2							integral to plasma membrane|membrane fraction	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity				0	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	TCTGCCCATGCCCCTCTGGGGG	0.426													4	2	---	---	---	---	
NASP	4678	broad.mit.edu	37	1	46081689	46081690	+	Intron	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46081689_46081690delAG	uc001coi.1	+						NASP_uc001coh.1_Intron|NASP_uc001coj.1_Intron|NASP_uc010olr.1_Intron|NASP_uc001col.1_Intron	NM_002482	NP_002473	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein isoform 2						blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					TCCATCTCCAAGAACTCATTTG	0.376													4	2	---	---	---	---	
POMGNT1	55624	broad.mit.edu	37	1	46654439	46654439	+	3'UTR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46654439delG	uc001cpe.2	-	22					POMGNT1_uc010olx.1_3'UTR|POMGNT1_uc010oly.1_RNA|POMGNT1_uc010olz.1_3'UTR|POMGNT1_uc001cpg.2_Frame_Shift_Del_p.T733fs|POMGNT1_uc001cpf.2_3'UTR	NM_017739	NP_060209	Q8WZA1	PMGT1_HUMAN	O-linked mannose						protein N-linked glycosylation|protein O-linked glycosylation	Golgi membrane|integral to membrane|microsome	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					GAGGAGGCCTGGTCCAGTGTC	0.517													4	2	---	---	---	---	
MGC12982	84793	broad.mit.edu	37	1	47897873	47897873	+	RNA	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47897873delC	uc001crl.2	-	1		c.2441delG				NR_026878				Homo sapiens, clone IMAGE:3354505, mRNA.												0						GAACGGCATGCCCAGCATGCA	0.488											OREG0013471	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	50253388	50253389	+	Intron	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50253388_50253389insG	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		gaaaaccacacggggtgaagtc	0.000													4	2	---	---	---	---	
TMEM48	55706	broad.mit.edu	37	1	54268548	54268548	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54268548delT	uc001cvs.2	-						TMEM48_uc010onu.1_Intron|TMEM48_uc001cvt.2_Intron|TMEM48_uc009vzk.2_Intron|TMEM48_uc010onv.1_Intron	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48						mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						TTCTTCCTAATTTTTTTTTAA	0.214													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	54441387	54441387	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54441387delA								LRRC42 (7548 upstream) : LDLRAD1 (33119 downstream)																							TACCACCAACAAAAATTTTCT	0.413													9	4	---	---	---	---	
TMEM61	199964	broad.mit.edu	37	1	55451550	55451551	+	Intron	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55451550_55451551insC	uc001cyd.2	+							NM_182532	NP_872338	Q8N0U2	TMM61_HUMAN	transmembrane protein 61							integral to membrane					0						tcctgagatttcccagtcatgg	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59348475	59348475	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59348475delC	uc001czf.2	+						uc010oop.1_Intron					Homo sapiens cDNA FLJ30588 fis, clone BRAWH2008128.																		GCTGCCCCGGCAGCCTCTTGG	0.433													4	2	---	---	---	---	
NFIA	4774	broad.mit.edu	37	1	61771885	61771885	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61771885delC	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						CTCTGGTTCTCTACCTGCCTA	0.249													4	2	---	---	---	---	
NFIA	4774	broad.mit.edu	37	1	61771887	61771887	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61771887delA	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						CTGGTTCTCTACCTGCCTACC	0.249													4	2	---	---	---	---	
LRRC8D	55144	broad.mit.edu	37	1	90394301	90394301	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90394301delG	uc001dnm.2	+						LRRC8D_uc001dnn.2_Intron	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member							integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TCTATTTCCTGGGATCAAAGC	0.448													4	2	---	---	---	---	
TGFBR3	7049	broad.mit.edu	37	1	92331654	92331656	+	Intron	DEL	GCT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92331654_92331656delGCT	uc001doh.2	-						TGFBR3_uc010osy.1_Intron|TGFBR3_uc001doi.2_Intron|TGFBR3_uc001doj.2_Intron	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III						BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		ACCAAGATTAGCTGAAAAAATCC	0.429													4	2	---	---	---	---	
SLC25A24	29957	broad.mit.edu	37	1	108703625	108703625	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108703625delT	uc001dvn.3	-						SLC25A24_uc001dvm.2_Intron	NM_013386	NP_037518	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 member 24 isoform 1						transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)	1		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		gggagagCTGTTTTTTTTTGT	0.184													6	3	---	---	---	---	
SORT1	6272	broad.mit.edu	37	1	109858848	109858849	+	Intron	DEL	TT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109858848_109858849delTT	uc001dxm.1	-						SORT1_uc010ovi.1_Intron	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ACAGACAACCttttttttttgg	0.243													2	6	---	---	---	---	
PROK1	84432	broad.mit.edu	37	1	110995567	110995568	+	Intron	DEL	CC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110995567_110995568delCC	uc001dzs.2	+							NM_032414	NP_115790	P58294	PROK1_HUMAN	prokineticin 1 precursor						angiogenesis|positive regulation of cell division	extracellular region	growth factor activity				0		all_cancers(81;6.23e-06)|all_epithelial(167;2.12e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|all cancers(265;0.0699)|Epithelial(280;0.0753)|Colorectal(144;0.105)|LUSC - Lung squamous cell carcinoma(189;0.135)		GTGAGACGTGCCCTTGCTGGGC	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	111074717	111074719	+	IGR	DEL	GAG	-	-	rs71580539		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111074717_111074719delGAG								KCNA10 (12920 upstream) : KCNA2 (61484 downstream)																							GGGGTTCTCTGAGGAGTGAGCAT	0.532													4	6	---	---	---	---	
NRAS	4893	broad.mit.edu	37	1	115259015	115259015	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115259015delC	uc009wgu.2	-							NM_002524	NP_002515	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog						activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	Golgi membrane|plasma membrane	GTP binding|GTPase activity			haematopoietic_and_lymphoid_tissue(1008)|skin(956)|thyroid(334)|large_intestine(62)|NS(60)|soft_tissue(32)|lung(31)|upper_aerodigestive_tract(25)|urinary_tract(12)|liver(10)|adrenal_gland(9)|autonomic_ganglia(8)|testis(8)|central_nervous_system(8)|prostate(8)|breast(7)|biliary_tract(6)|ovary(6)|stomach(5)|pancreas(5)|endometrium(2)|kidney(2)|cervix(2)|eye(1)	2607	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGTCCTTGGGCCCCGCCCTCA	0.517		50	Mis		melanoma|MM|AML|thyroid				Noonan_syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)			4	2	---	---	---	---	
FAM46C	54855	broad.mit.edu	37	1	118152761	118152762	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118152761_118152762delCA	uc001ehe.2	+							NM_017709	NP_060179	Q5VWP2	FA46C_HUMAN	hypothetical protein LOC54855												0	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		CCACTGTCATCACTGACCTGGT	0.495										Multiple Myeloma(3;1.13e-06)			4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145006010	145006013	+	Intron	DEL	CTGT	-	-	rs137923806		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145006010_145006013delCTGT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTACATGTGCCTGTCTGTTCCAGT	0.333			T	PDGFRB	MPD								0	6	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145156714	145156714	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145156714delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						TGGTAAGTAGAAAAAAAATAA	0.299													5	3	---	---	---	---	
SETDB1	9869	broad.mit.edu	37	1	150924123	150924123	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150924123delT	uc001evu.2	+						SETDB1_uc001evv.2_Intron|SETDB1_uc009wmg.1_Intron	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCAAAACACATTTTTTTTCTT	0.269													6	3	---	---	---	---	
CRCT1	54544	broad.mit.edu	37	1	152485172	152485172	+	5'Flank	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152485172delC	uc001ezz.2	+							NM_019060	NP_061933	Q9UGL9	CRCT1_HUMAN	cysteine-rich C-terminal 1												0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TATGAAACGTCTGAGCACATT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152575274	152575274	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152575274delT								LCE3C (1712 upstream) : LCE3B (11013 downstream)																							CTTCCATCTGTTTTACACACA	0.522													4	2	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154708540	154708541	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154708540_154708541delGA	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			GTGAGgagttgagctgagccag	0.218													4	2	---	---	---	---	
NTRK1	4914	broad.mit.edu	37	1	156841200	156841200	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156841200delA	uc001fqh.1	+						NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron|NTRK1_uc001fqi.1_Intron|NTRK1_uc009wsk.1_Intron	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1						activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	aaCATAAAATAAAAAAAAAAT	0.229			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			1	6	---	---	---	---	
IGSF9	57549	broad.mit.edu	37	1	159910403	159910403	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159910403delA	uc001fur.2	-						IGSF9_uc001fuq.2_Intron	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a							cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			AAAGAAGTTCAAAAAATGGTG	0.483													4	2	---	---	---	---	
PBX1	5087	broad.mit.edu	37	1	164528905	164528905	+	5'UTR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164528905delT	uc001gct.2	+	1					PBX1_uc010pku.1_5'UTR|PBX1_uc010pkv.1_5'UTR|PBX1_uc001gcs.2_5'UTR	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						GGCAAAGGGATTTTTTTTTTC	0.413			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								4	3	---	---	---	---	
GPA33	10223	broad.mit.edu	37	1	167043471	167043472	+	Intron	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167043471_167043472delGG	uc001gea.1	-							NM_005814	NP_005805	Q99795	GPA33_HUMAN	transmembrane glycoprotein A33 precursor							integral to plasma membrane	receptor activity				0						cttcgagcctgggtgcacctgt	0.000													4	2	---	---	---	---	
CD247	919	broad.mit.edu	37	1	167454446	167454446	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167454446delC	uc001gei.3	-						CD247_uc001gej.3_Intron|CD247_uc001gek.2_Intron	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)			CTAAGGGGGGCATTTGAAAAT	0.383													4	2	---	---	---	---	
TBX19	9095	broad.mit.edu	37	1	168261413	168261413	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168261413delT	uc001gfl.2	+						TBX19_uc001gfj.3_Intron	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19						anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					CATGTGCCCCTTCTCTGATCT	0.527													4	2	---	---	---	---	
C1orf9	51430	broad.mit.edu	37	1	172506595	172506596	+	Intron	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172506595_172506596insT	uc001giq.3	+						C1orf9_uc010pmm.1_Intron|C1orf9_uc009wwd.2_Intron|C1orf9_uc010pmn.1_Intron|C1orf9_uc010pmo.1_Intron	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein						multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		tgcttgcattattaaattcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181171868	181171868	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181171868delG								IER5 (111891 upstream) : CACNA1E (280848 downstream)																							AACAGCTACAGGGACgccact	0.234													4	2	---	---	---	---	
C1orf14	81626	broad.mit.edu	37	1	182925065	182925066	+	5'Flank	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182925065_182925066insA	uc001gpu.2	-						C1orf14_uc001gpv.2_5'Flank|C1orf14_uc010pnz.1_5'Flank|C1orf14_uc001gpw.2_5'Flank	NM_030933	NP_112195	Q9BZQ2	SHP1L_HUMAN	chromosome 1 open reading frame 14												0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)		CATTCAGGGGGTTTTGGTCTCT	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	197768635	197768635	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197768635delG								DENND1B (24012 upstream) : C1orf53 (103047 downstream)																							agttggaggtggggactcaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200219216	200219216	+	IGR	DEL	C	-	-	rs61420783		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200219216delC								FAM58B (35573 upstream) : ZNF281 (156210 downstream)																							aaaaaaaaaacaaaacaaaac	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201315821	201315821	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201315821delG								PKP1 (13706 upstream) : TNNT2 (12322 downstream)																							CCCAAGCACTGGATTCGTAGA	0.532											OREG0014075	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	202004034	202004034	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202004034delC								ELF3 (17728 upstream) : GPR37L1 (87995 downstream)																							TCCCCACCCACCCGTGGCCTG	0.622													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	202997769	202997770	+	IGR	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202997769_202997770delGT								TMEM183A (3794 upstream) : PPFIA4 (5842 downstream)																							GTGGTATGGGgtgtgtgtgtgt	0.401													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	204150203	204150205	+	IGR	DEL	GTG	-	-	rs59943475		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204150203_204150205delGTG								REN (14738 upstream) : KISS1 (9265 downstream)																							gtgtgtgtgtgtggtgtgtAGGG	0.424													4	2	---	---	---	---	
LRRN2	10446	broad.mit.edu	37	1	204593381	204593382	+	Intron	INS	-	TG	TG	rs141427374	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204593381_204593382insTG	uc001hbe.1	-						MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Intron|LRRN2_uc009xbf.1_Intron|MDM4_uc001hbc.2_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor						cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			GACACTGTTCCTGTGTGTGTGT	0.634													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223222802	223222803	+	IGR	DEL	TG	-	-	rs72020592		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223222802_223222803delTG								DISP1 (43467 upstream) : TLR5 (60781 downstream)																							GGAAAGACACTGTGAAGGAGGT	0.530													4	5	---	---	---	---	
CNIH3	149111	broad.mit.edu	37	1	224902908	224902908	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224902908delC	uc001hos.1	+							NM_152495	NP_689708	Q8TBE1	CNIH3_HUMAN	cornichon homolog 3						intracellular signal transduction|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic shaft|postsynaptic membrane					0	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		ttagcagtgtctggcagccat	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	225634539	225634539	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225634539delA								LBR (18020 upstream) : ENAH (39995 downstream)																							TGCTGGCCCTAAAGCTCCAGA	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	226665193	226665193	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226665193delG								PARP1 (69392 upstream) : C1orf95 (71308 downstream)																							GAGGCTCCCTGGGGTGAGGGC	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	226993464	226993464	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226993464delC								ITPKB (66588 upstream) : PSEN2 (64809 downstream)																							gtttgaggagcaggatcacct	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229063001	229063001	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229063001delG								RHOU (180592 upstream) : RAB4A (343878 downstream)																							AGCTATACCTGGGTTCTCGCC	0.567													4	2	---	---	---	---	
NID1	4811	broad.mit.edu	37	1	236209907	236209907	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236209907delA	uc001hxo.2	-						NID1_uc009xgd.2_Intron	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	tactgcggataaaaaaaaaag	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	244895648	244895648	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244895648delT								PPPDE1 (23316 upstream) : FAM36A (102991 downstream)																							CTGTATTCCCTTTCATGGTCC	0.562													4	2	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	245978520	245978520	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245978520delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron|SMYD3_uc001ibi.2_Intron|SMYD3_uc001ibj.2_Intron	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		TCCCAACCAGAAAAAAACACA	0.433													4	2	---	---	---	---	
CNST	163882	broad.mit.edu	37	1	246748148	246748148	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246748148delT	uc001ibp.2	+						CNST_uc001ibo.3_Intron	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0						gtttctgctgtttttttcccc	0.149													6	5	---	---	---	---	
ZNF496	84838	broad.mit.edu	37	1	247465464	247465464	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247465464delG	uc001ico.2	-						ZNF496_uc009xgv.2_Intron|ZNF496_uc001icp.2_Intron	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496						positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			TCTAGAACTTGGGGGGAGTGA	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	247997247	247997247	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247997247delA								OR14A16 (18216 upstream) : OR11L1 (6983 downstream)																							ACATGACAGCAAAAGGAATAA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	862669	862669	+	Intron	DEL	G	-	-	rs111569772		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:862669delG	uc002qwn.1	-						uc002qwo.1_Intron					Homo sapiens cDNA clone IMAGE:5174186.																		CTCTTCCCAAGACCACCTTAG	0.567													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2668074	2668075	+	IGR	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2668074_2668075delCA								MYT1L (333029 upstream) : TSSC1 (524666 downstream)																							AAAACACTCTCACACACACAGA	0.530													3	3	---	---	---	---	
TSSC1	7260	broad.mit.edu	37	2	3287310	3287310	+	Intron	DEL	C	-	-	rs11364682		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3287310delC	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		CACGTTCACACCCCGGCACAC	0.602													4	10	---	---	---	---	
TSSC1	7260	broad.mit.edu	37	2	3291451	3291451	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3291451delC	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		AAAGCGCGTTCACCACGCTCC	0.507													4	2	---	---	---	---	
TSSC1	7260	broad.mit.edu	37	2	3317325	3317325	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3317325delG	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		ggacataaacgggcttcgaga	0.209													4	2	---	---	---	---	
SOX11	6664	broad.mit.edu	37	2	5835915	5835917	+	3'UTR	DEL	CAA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5835915_5835917delCAA	uc002qyj.2	+	1						NM_003108	NP_003099	P35716	SOX11_HUMAN	SRY-box 11						cardiac ventricle formation|closure of optic fissure|cornea development in camera-type eye|embryonic digestive tract morphogenesis|embryonic skeletal system morphogenesis|eyelid development in camera-type eye|glial cell proliferation|hard palate development|lens morphogenesis in camera-type eye|limb bud formation|lung morphogenesis|negative regulation of cell death|negative regulation of glial cell proliferation|negative regulation of lymphocyte proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|neural crest cell development|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|outflow tract morphogenesis|positive regulation of BMP signaling pathway|positive regulation of hippo signaling cascade|positive regulation of hormone secretion|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of ossification|positive regulation of osteoblast differentiation|positive regulation of stem cell proliferation|regulation of transforming growth factor beta receptor signaling pathway|signal transduction involved in G1/S transition checkpoint|soft palate development|somite development|spinal cord development|sympathetic nervous system development|ventricular septum morphogenesis	cytoplasm|nucleolus	enhancer sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity|translation factor activity, nucleic acid binding			central_nervous_system(3)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		GAAAAGTGTTCAATTAGCAGGCT	0.399													4	2	---	---	---	---	
LOC150622	150622	broad.mit.edu	37	2	6113786	6113786	+	RNA	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6113786delG	uc002qyk.2	+	2		c.5304delG				NR_026832				Homo sapiens cDNA FLJ30594 fis, clone BRAWH2008903.												0						GGTTTGGCCTGGGCAGTGGAG	0.328													4	2	---	---	---	---	
RNF144A	9781	broad.mit.edu	37	2	7132664	7132665	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7132664_7132665delCA	uc002qys.2	+						RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		AGTTAGGCTGCAGAGGAAACAT	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11264594	11264595	+	Intron	INS	-	ACCCCTGCCAGG	ACCCCTGCCAGG	rs140739591	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11264594_11264595insACCCCTGCCAGG	uc002raz.1	-						uc002rba.1_Intron					Homo sapiens cDNA FLJ33534 fis, clone BRAMY2007411.																		TTTAGAATGTCGCACCTGCCTG	0.569											OREG0014436	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	4	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11714886	11714886	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11714886delG	uc002rbk.1	+						GREB1_uc002rbl.2_Intron|GREB1_uc002rbm.2_Intron|GREB1_uc002rbn.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TGTCACTTGTGGGTTGAGATG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23347236	23347236	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23347236delG								None (None upstream) : KLHL29 (408219 downstream)																							GTTAACAGCTGAGACATTCCT	0.502													4	2	---	---	---	---	
KLHL29	114818	broad.mit.edu	37	2	23834167	23834167	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23834167delC	uc002reg.2	+						KLHL29_uc002ref.2_Intron			Q96CT2	KLH29_HUMAN	RecName: Full=Kelch-like protein 29; AltName: Full=Kelch repeat and BTB domain-containing protein 9;											ovary(1)|lung(1)	2						gagagctgagcagggcgcttg	0.000													4	2	---	---	---	---	
RBKS	64080	broad.mit.edu	37	2	28017891	28017892	+	Intron	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28017891_28017892delTG	uc002rlo.1	-						RBKS_uc010ezi.1_Intron	NM_022128	NP_071411	Q9H477	RBSK_HUMAN	ribokinase						D-ribose metabolic process		ATP binding|ribokinase activity			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)					TCCAGCGCCCTGTGCCAAGACC	0.460													4	2	---	---	---	---	
LBH	81606	broad.mit.edu	37	2	30474838	30474838	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30474838delC	uc002rne.2	+							NM_030915	NP_112177	Q53QV2	LBH_HUMAN	limb bud and heart development homolog						multicellular organismal development|transcription, DNA-dependent	cytoplasm|nucleolus					0	Acute lymphoblastic leukemia(172;0.155)					GCTTACTTTTCTACACAGTGG	0.463													4	2	---	---	---	---	
EHD3	30845	broad.mit.edu	37	2	31480922	31480923	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31480922_31480923delGA	uc002rnu.2	+						EHD3_uc010ymt.1_Intron	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3						blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					GGAGCAGGGGGAGAAGGCTCAG	0.327													4	2	---	---	---	---	
CDC42EP3	10602	broad.mit.edu	37	2	37872724	37872724	+	3'UTR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37872724delA	uc002rqi.1	-	2						NM_006449	NP_006440	Q9UKI2	BORG2_HUMAN	Cdc42 effector protein 3						regulation of cell shape|signal transduction	actin cytoskeleton|cytoplasm|endomembrane system|membrane	cytoskeletal regulatory protein binding				0		all_hematologic(82;0.172)				GAACATCACCAATGCCTCCTG	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	43232562	43232562	+	IGR	DEL	T	-	-	rs112033394		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43232562delT								HAAO (212811 upstream) : ZFP36L2 (216980 downstream)																							TATTTCTTCCTTTTTTTTTTT	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	53780779	53780779	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53780779delC								None (None upstream) : ASB3 (116339 downstream)																							TGGATGCCAGCCCACGGccag	0.328													4	2	---	---	---	---	
C2orf73	129852	broad.mit.edu	37	2	54586364	54586365	+	Intron	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54586364_54586365delTG	uc002rxt.1	+						C2orf73_uc010yor.1_Intron|C2orf73_uc002rxs.1_Intron|C2orf73_uc010yos.1_Intron	NM_001100396	NP_001093866	Q8N5S3	CB073_HUMAN	hypothetical protein LOC129852												0						CATAGTAAAATGTAAGGAATAA	0.149													4	2	---	---	---	---	
VRK2	7444	broad.mit.edu	37	2	58316516	58316516	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58316516delT	uc002rzo.2	+						VRK2_uc010fcb.2_Intron|VRK2_uc002rzs.2_Intron|VRK2_uc002rzr.2_Intron|VRK2_uc010fcc.2_Intron|VRK2_uc002rzv.2_Intron|VRK2_uc010fcd.2_Intron|VRK2_uc002rzp.2_Intron|VRK2_uc010ypg.1_Intron|VRK2_uc002rzq.2_Intron|VRK2_uc002rzu.2_Intron|VRK2_uc002rzt.2_Intron|VRK2_uc010yph.1_Intron	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2							integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						GGCATAAGCATTTTTGAATCT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	62467949	62467950	+	IGR	DEL	TT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62467949_62467950delTT								B3GNT2 (16085 upstream) : TMEM17 (259406 downstream)																							TCTTACGTCCTTAGGAGAGCTC	0.337													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65520339	65520339	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65520339delA								ACTR2 (21954 upstream) : SPRED2 (17647 downstream)																							AACGCaggagaaaaaaatcac	0.164													4	2	---	---	---	---	
MEIS1	4211	broad.mit.edu	37	2	66662369	66662369	+	5'Flank	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66662369delT	uc002sdu.2	+						MEIS1_uc002sdt.2_5'Flank|MEIS1_uc002sdv.2_5'Flank|MEIS1_uc010yqh.1_5'Flank	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0						CAGACAGACATTTTTTTTAAC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	68166221	68166222	+	IGR	DEL	CC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68166221_68166222delCC								ETAA1 (528688 upstream) : C1D (103111 downstream)																							AATGGTTCTTCCACCCCATCTC	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	69950515	69950515	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69950515delA								AAK1 (79538 upstream) : ANXA4 (18612 downstream)																							AGAAGGCTTCAAAAAAAAGAC	0.408													4	2	---	---	---	---	
EMX1	2016	broad.mit.edu	37	2	73158391	73158392	+	Intron	DEL	GC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73158391_73158392delGC	uc002sin.1	+						EMX1_uc002sim.1_Intron	NM_004097	NP_004088	Q04741	EMX1_HUMAN	empty spiracles homolog 1							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AGCCAGTGTTGCTAGTCAAGGG	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	74198382	74198384	+	IGR	DEL	TCA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74198382_74198384delTCA								DGUOK (12296 upstream) : TET3 (75066 downstream)																							GCAGTGAGCTTCATCTTTGGCTT	0.473													4	2	---	---	---	---	
C2orf65	130951	broad.mit.edu	37	2	74867591	74867591	+	Intron	DEL	T	-	-	rs78940725		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74867591delT	uc002smy.2	-						C2orf65_uc010ysa.1_Intron|C2orf65_uc002smz.2_Intron	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951						chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2						GGCCATCCTAttttttttttt	0.199													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	78725276	78725281	+	Intron	DEL	TCAACC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78725276_78725281delTCAACC	uc002snv.3	-											Homo sapiens cytochrome c, somatic pseudogene 6, mRNA (cDNA clone IMAGE:4815768).																		atggagaccatcaaccccatgccacc	0.000													4	2	---	---	---	---	
TCF7L1	83439	broad.mit.edu	37	2	85510394	85510395	+	Intron	INS	-	CCG	CCG	rs147227391	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85510394_85510395insCCG	uc002soy.2	+							NM_031283	NP_112573	Q9HCS4	TF7L1_HUMAN	HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3						CGTGTCCCCCCCCCCAAAATGA	0.460													6	6	---	---	---	---	
MRPL30	51263	broad.mit.edu	37	2	99832211	99832211	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99832211delG	uc002szl.1	+							NM_145213		Q8TCC3	RM30_HUMAN	Homo sapiens HSPC249 mRNA, complete cds.						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1						tttaagtgctgtccggagcca	0.015													4	2	---	---	---	---	
SLC9A2	6549	broad.mit.edu	37	2	103310205	103310205	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103310205delT	uc002tca.2	+							NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN	solute carrier family 9 (sodium/hydrogen							integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			central_nervous_system(3)|skin(3)|breast(2)	8						tttgtaactgttttcggaagt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	110385605	110385605	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110385605delG								ANKRD57 (9042 upstream) : RGPD5 (164730 downstream)																							TGATGGACATGGGGCATTGAC	0.358													4	2	---	---	---	---	
BUB1	699	broad.mit.edu	37	2	111408010	111408010	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111408010delA	uc002tgc.2	-						BUB1_uc010yxh.1_Intron|BUB1_uc010fkb.2_Intron	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1						apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		GAACTCACTGACATCTGTTCT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	119661178	119661179	+	IGR	DEL	AG	-	-	rs149898994		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119661178_119661179delAG								EN1 (55419 upstream) : MARCO (38566 downstream)																							tccaagggtcagagagagagag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121194195	121194195	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121194195delG								INHBB (84812 upstream) : LOC84931 (27716 downstream)																							GGGTCCTGTTGGGGACACTGC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121338223	121338223	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121338223delC								LOC84931 (114298 upstream) : GLI2 (154976 downstream)																							TCCTCACTGTCCCCACAGCTT	0.542													4	2	---	---	---	---	
GYPC	2995	broad.mit.edu	37	2	127437048	127437048	+	Intron	DEL	T	-	-	rs113723695	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127437048delT	uc002tnq.2	+						GYPC_uc002tnr.2_Intron|GYPC_uc010flv.2_Intron	NM_002101	NP_002092	P04921	GLPC_HUMAN	glycophorin C isoform 1							cortical cytoskeleton|integral to plasma membrane	protein binding			central_nervous_system(1)	1	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		GAAAAAAAAATTGAGAGAAGG	0.378													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127940546	127940547	+	IGR	DEL	TA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127940546_127940547delTA								BIN1 (75682 upstream) : CYP27C1 (865 downstream)																							AGTTCCTTTTTACTTTCACCTA	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131601711	131601712	+	Intron	DEL	CC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131601711_131601712delCC	uc002try.1	+											Homo sapiens cDNA FLJ45181 fis, clone BRAWH3047644, highly  similar to Homo sapiens Rho guanine nucleotide exchange factor (GEF) 4 (ARHGEF4).																		GTTTGCTTCTCCCGCTGAGCGC	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131627194	131627194	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131627194delG	uc002try.1	+											Homo sapiens cDNA FLJ45181 fis, clone BRAWH3047644, highly  similar to Homo sapiens Rho guanine nucleotide exchange factor (GEF) 4 (ARHGEF4).																		AGAAGCTGCTGGGGAACAATG	0.532													4	2	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	133531246	133531246	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133531246delA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						TCCAATGTCTAAGGAGATAAT	0.383													4	2	---	---	---	---	
ANKAR	150709	broad.mit.edu	37	2	190599929	190599929	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190599929delT	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqx.1_Intron|ANKAR_uc002uqy.1_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			GTATTCTGCCTTCCTTCCCAG	0.428													3	3	---	---	---	---	
BMPR2	659	broad.mit.edu	37	2	203397632	203397633	+	Intron	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203397632_203397633insT	uc002uzf.3	+						BMPR2_uc010ftr.2_Intron	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II						anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						CAAATTAGGAATTTTTTTTTTT	0.287													4	2	---	---	---	---	
ICA1L	130026	broad.mit.edu	37	2	203693916	203693916	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203693916delA	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron|ICA1L_uc002uzj.2_5'UTR|ICA1L_uc002uzk.1_Intron	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						ctaaaaatacaaaaaaaaatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	207223171	207223172	+	IGR	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207223171_207223172delAA								ZDBF2 (44023 upstream) : ADAM23 (85196 downstream)																							tgttttctgtaatgactctcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	208286490	208286490	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208286490delT								MIR1302-4 (152342 upstream) : CREB1 (108126 downstream)																							TCCGACTACCTTTTTATGACT	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	218653847	218653848	+	IGR	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218653847_218653848insT								DIRC3 (32531 upstream) : TNS1 (10664 downstream)																							TTGAGAAATGATTGAGAAAATC	0.550											OREG0015186	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	5	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218843903	218843904	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218843903_218843904delAC	uc010fvk.1	-						TNS1_uc002vgv.1_5'Flank	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TTCTCCCCTTACACACACACCA	0.639													4	2	---	---	---	---	
KIAA1486	57624	broad.mit.edu	37	2	226277607	226277608	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226277607_226277608delCA	uc002voe.2	+						KIAA1486_uc010fxa.1_Intron	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624											ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		CAAAGACAGTCACAGGTAGAGA	0.515													4	2	---	---	---	---	
PSMD1	5707	broad.mit.edu	37	2	231978226	231978227	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231978226_231978227delGA	uc002vrn.1	+						PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron|HTR2B_uc010fxv.2_Intron|HTR2B_uc002vro.2_Intron	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GGTTCTTTCTGAGGACATGAGT	0.347													4	2	---	---	---	---	
ATG16L1	55054	broad.mit.edu	37	2	234204040	234204040	+	3'UTR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234204040delT	uc002vty.2	+	18					ATG16L1_uc002vua.2_3'UTR|ATG16L1_uc002vub.2_3'UTR|ATG16L1_uc002vtz.2_3'UTR|ATG16L1_uc002vud.3_3'UTR	NM_030803	NP_110430	Q676U5	A16L1_HUMAN	APG16 autophagy 16-like isoform 1						autophagic vacuole assembly|protein homooligomerization|protein transport	autophagic vacuole|pre-autophagosomal structure membrane	protein binding				0		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		TTGCACTTTATTTTTTTTCTT	0.403													4	2	---	---	---	---	
DGKD	8527	broad.mit.edu	37	2	234293860	234293861	+	Intron	DEL	GC	-	-	rs4663580	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234293860_234293861delGC	uc002vui.1	+						DGKD_uc002vuj.1_5'Flank	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CTGGAGACTTGCGCTTCCCCCC	0.564													4	2	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241706166	241706167	+	Intron	INS	-	CA	CA	rs72502157		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241706166_241706167insCA	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		tctctctctctcacacacacac	0.307													4	2	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242410336	242410336	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242410336delA	uc002wbi.1	+							NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CCCTATTCAGAGGGGGACCCT	0.552													4	2	---	---	---	---	
DTYMK	1841	broad.mit.edu	37	2	242624938	242624939	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242624938_242624939delAA	uc002wbz.1	-						DTYMK_uc010zpa.1_Intron|DTYMK_uc010zpb.1_Intron|DTYMK_uc002wca.1_Intron	NM_012145	NP_036277	P23919	KTHY_HUMAN	deoxythymidylate kinase (thymidylate kinase)						cell cycle|cell proliferation|nucleobase, nucleoside and nucleotide interconversion	cytosol	ATP binding|nucleoside phosphate kinase activity|thymidylate kinase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.6e-33)|all cancers(36;3.57e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.23e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		aactccgtctaaaaaaaCCCGA	0.243													4	2	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1393982	1393982	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1393982delC	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AGCCTTACTTCTATTAATGAT	0.294													4	2	---	---	---	---	
TADA3	10474	broad.mit.edu	37	3	9829555	9829556	+	Intron	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9829555_9829556delGG	uc003bsx.1	-						TADA3_uc010hcn.1_Intron|TADA3_uc003bsy.2_Intron|TADA3_uc003bsw.1_5'UTR	NM_006354	NP_006345	O75528	TADA3_HUMAN	transcriptional adaptor 3 isoform a						estrogen receptor signaling pathway|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	ligand-dependent nuclear receptor binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity				0						gggccttgaagggtgagtcaag	0.000													4	2	---	---	---	---	
ATP2B2	491	broad.mit.edu	37	3	10371251	10371252	+	Intron	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10371251_10371252insG	uc003bvt.2	-						ATP2B2_uc003bvv.2_Intron|ATP2B2_uc003bvw.2_Intron|ATP2B2_uc003bvs.2_Intron|ATP2B2_uc010hdo.2_Intron|hsa-mir-378b|MI0014154_5'Flank	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						AATTCATCTTAGGAAAACCACA	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	13823395	13823395	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13823395delC								LOC285375 (35263 upstream) : WNT7A (36687 downstream)																							CCACTTCACACAAACCTGCTT	0.343													4	2	---	---	---	---	
ATRIP	84126	broad.mit.edu	37	3	48488941	48488941	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48488941delA	uc003ctf.1	+						ATRIP_uc011bbj.1_Intron|ATRIP_uc003ctg.1_Intron	NM_130384	NP_569055	Q8WXE1	ATRIP_HUMAN	ATR interacting protein isoform 1						DNA damage checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding|protein serine/threonine kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAGATGAAATAAATTTattct	0.249								Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
UQCRC1	7384	broad.mit.edu	37	3	48639106	48639106	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48639106delC	uc003cub.1	-						UQCRC1_uc003cua.1_Intron|UQCRC1_uc003cuc.1_Intron|UQCRC1_uc003cud.1_Intron	NM_003365	NP_003356	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I						aerobic respiration|proteolysis		metalloendopeptidase activity|ubiquinol-cytochrome-c reductase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	Atovaquone(DB01117)	CCAAATAGCTCCCATGGCCTC	0.522													4	2	---	---	---	---	
RNF123	63891	broad.mit.edu	37	3	49750766	49750766	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49750766delT	uc003cxh.2	+						RNF123_uc003cxi.2_Intron	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123							cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		AGCCTGTGCCTTAGCCCTTGC	0.607													4	2	---	---	---	---	
IP6K1	9807	broad.mit.edu	37	3	49788588	49788589	+	Intron	INS	-	G	G	rs60480891	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49788588_49788589insG	uc003cxm.1	-						IP6K1_uc003cxn.1_Intron|IP6K1_uc011bcv.1_Intron|IP6K1_uc003cxo.2_Intron	NM_153273	NP_695005	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1 isoform 1						phosphatidylinositol phosphorylation	cytoplasm|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity				0						CTCCTTTTTTTTttgttgttgt	0.262													3	3	---	---	---	---	
POC1A	25886	broad.mit.edu	37	3	52176481	52176482	+	Intron	DEL	CC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52176481_52176482delCC	uc003dcu.2	-						POC1A_uc003dcv.2_Intron|POC1A_uc003dcw.2_Intron	NM_015426	NP_056241	Q8NBT0	POC1A_HUMAN	WD repeat domain 51A isoform 1							centriole|microtubule basal body					0						TAGCCCAAAGCCCCAAGTGGGC	0.559													4	2	---	---	---	---	
ITIH3	3699	broad.mit.edu	37	3	52836110	52836110	+	Intron	DEL	T	-	-	rs34126475		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52836110delT	uc003dfv.2	+						ITIH3_uc011bek.1_Intron	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TTCATATTTCTTTTTTTTTTT	0.423													3	3	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57400907	57400907	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57400907delA	uc003dit.2	-							NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						TTTACCAGTTAAGAAATCGTT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72043573	72043573	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72043573delG								PROK2 (209216 upstream) : RYBP (380178 downstream)																							ggagcttggtgtgacagttgg	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	72107503	72107503	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72107503delA	uc003dpb.1	-											Homo sapiens cDNA FLJ39871 fis, clone SPLEN2015730.																		GGGAACACATAAAAAAAAAAA	0.493													4	4	---	---	---	---	
PDZRN3	23024	broad.mit.edu	37	3	73435167	73435167	+	Intron	DEL	T	-	-	rs117149822	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73435167delT	uc003dpl.1	-						PDZRN3_uc011bgh.1_Intron|PDZRN3_uc010hoe.1_Intron|PDZRN3_uc011bgf.1_Intron|PDZRN3_uc011bgg.1_Intron	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3								ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		ATATCCATGATTTTTTTTTTT	0.433													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	96495830	96495832	+	IGR	DEL	AAG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96495830_96495832delAAG								None (None upstream) : EPHA6 (37593 downstream)																							CAATCGGGACAAGAAGAAGAAGG	0.635													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	106198642	106198642	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106198642delT								CBLB (610376 upstream) : LOC100302640 (357018 downstream)																							gatcttcctgtttttttattt	0.000													4	2	---	---	---	---	
MYH15	22989	broad.mit.edu	37	3	108173092	108173092	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108173092delT	uc003dxa.1	-							NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15							myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						GATAACTGTATCAATTCCATT	0.279													4	2	---	---	---	---	
UROC1	131669	broad.mit.edu	37	3	126226359	126226361	+	Intron	DEL	GTG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126226359_126226361delGTG	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		ataataaaatgtggaaaaaGGCA	0.123													4	2	---	---	---	---	
RAB43	339122	broad.mit.edu	37	3	128823431	128823431	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128823431delG	uc003eln.1	-						RAB43_uc003elo.1_Intron|RAB43_uc010hsy.1_Intron	NM_198490	NP_940892	Q86YS6	RAB43_HUMAN	RAB43 protein						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						AGTTTCATATGGGGTGGGGAT	0.552													4	2	---	---	---	---	
C3orf47	339942	broad.mit.edu	37	3	129032892	129032892	+	5'Flank	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129032892delC	uc011bkv.1	+							NR_026991				Homo sapiens cDNA FLJ34151 fis, clone FCBBF3012842.												0						TCCACTGTTTCAGAAGCTTCC	0.458													4	2	---	---	---	---	
PLXND1	23129	broad.mit.edu	37	3	129278871	129278872	+	Intron	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129278871_129278872insT	uc003emx.2	-						PLXND1_uc003emw.2_5'Flank|PLXND1_uc011blb.1_Intron	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						gggtgccggcgctgccactgag	0.203													5	3	---	---	---	---	
PLXND1	23129	broad.mit.edu	37	3	129278877	129278877	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129278877delA	uc003emx.2	-						PLXND1_uc003emw.2_5'Flank|PLXND1_uc011blb.1_Intron	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						cggcgctgccactgagccacg	0.199													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133250968	133250968	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133250968delG								BFSP2 (56912 upstream) : CDV3 (41466 downstream)																							taaacctcttGCTCCTGGGAG	0.284													4	2	---	---	---	---	
GYG1	2992	broad.mit.edu	37	3	148737577	148737578	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148737577_148737578delGA	uc003ewn.2	+						GYG1_uc011bnp.1_Intron|GYG1_uc003ewo.2_Intron|GYG1_uc003ewp.2_Intron	NM_004130	NP_004121	P46976	GLYG_HUMAN	glycogenin 1						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	glycogenin glucosyltransferase activity|metal ion binding|protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TGTTCTTGTTGACATTCAAGAG	0.475													4	2	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	170811929	170811929	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170811929delT	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhg.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			ctcatattAAttttttttttt	0.000													3	3	---	---	---	---	
GHSR	2693	broad.mit.edu	37	3	172165110	172165111	+	Intron	INS	-	A	A	rs9868459	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172165110_172165111insA	uc003fib.1	-							NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a						actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			agagaaaggagagacaggaaga	0.119													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	178823765	178823766	+	Intron	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178823765_178823766insA	uc003fjj.2	-											Homo sapiens cDNA clone IMAGE:4821793.																		gcctcctcccctagactttcag	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185847753	185847754	+	IGR	INS	-	TC	TC			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185847753_185847754insTC								ETV5 (20852 upstream) : DGKG (17237 downstream)																							TTCTGCTGCCTTCTCTCTCTCT	0.421													5	3	---	---	---	---	
ACAP2	23527	broad.mit.edu	37	3	195070608	195070608	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195070608delG	uc003fun.3	-						ACAP2_uc003fuo.2_Intron	NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						CTGGAACAAAGGAACAAGCAA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197235109	197235109	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197235109delT								DLG1 (208966 upstream) : BDH1 (1546 downstream)																							TCCCTCCCTATTTTAGATCCT	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	200127	200128	+	IGR	INS	-	TGAC	TGAC	rs7687238		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:200127_200128insTGAC								ZNF595 (4035 upstream) : ZNF876P (6261 downstream)																							tcatgtgtgagtgagtgactgc	0.035													5	3	---	---	---	---	
ATP5I	521	broad.mit.edu	37	4	666849	666849	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:666849delT	uc003gas.2	-						ATP5I_uc003gar.2_Intron|MYL5_uc003gat.2_5'Flank|MYL5_uc003gau.2_5'Flank	NM_007100	NP_009031	P56385	ATP5I_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP catabolic process|respiratory electron transport chain		hydrogen ion transmembrane transporter activity				0						gcccggctaatttttgtagag	0.000													4	2	---	---	---	---	
ZFYVE28	57732	broad.mit.edu	37	4	2294188	2294188	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2294188delG	uc003gex.1	-						ZFYVE28_uc011bvk.1_Intron|ZFYVE28_uc011bvl.1_Intron|ZFYVE28_uc003gew.1_Intron	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28						negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3						GCATGGACAAGGGAAGCCGAT	0.607													4	2	---	---	---	---	
RGS12	6002	broad.mit.edu	37	4	3306944	3306945	+	Intron	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3306944_3306945delGT	uc003ggu.2	+						RGS12_uc010ics.1_Intron	NM_002926	NP_002917	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 2							condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		catcttggaagtgacatcctat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3604082	3604083	+	IGR	INS	-	A	A	rs150043805		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3604082_3604083insA								LRPAP1 (69858 upstream) : ADRA2C (163992 downstream)																							CATCCTTGATCTGTAGCAAAGT	0.535													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4078785	4078785	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4078785delT								LOC348926 (121637 upstream) : OTOP1 (111745 downstream)																							GATTGTTGTGTTTTTTAGTAA	0.388													4	3	---	---	---	---	
D4S234E	27065	broad.mit.edu	37	4	4371122	4371122	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4371122delT	uc011bvz.1	+							NM_014392	NP_055207	P42857	NSG1_HUMAN	brain neuron cytoplasmic protein 1						dopamine receptor signaling pathway	Golgi membrane|integral to membrane|nucleus	dopamine receptor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		atcagtcccgttttacagatg	0.264													4	2	---	---	---	---	
D4S234E	27065	broad.mit.edu	37	4	4417529	4417529	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4417529delG	uc011bvz.1	+						D4S234E_uc011bwa.1_Intron|D4S234E_uc003ghz.2_Intron|D4S234E_uc003gia.2_Intron|D4S234E_uc003gib.2_Intron	NM_014392	NP_055207	P42857	NSG1_HUMAN	brain neuron cytoplasmic protein 1						dopamine receptor signaling pathway	Golgi membrane|integral to membrane|nucleus	dopamine receptor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		GGGAACCCTTGGTCCGTTTCC	0.657													4	2	---	---	---	---	
STK32B	55351	broad.mit.edu	37	4	5398265	5398265	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5398265delG	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						ACATCTTCTTGGGTCTGTCAC	0.323													4	2	---	---	---	---	
EVC2	132884	broad.mit.edu	37	4	5702603	5702606	+	Intron	DEL	ACTT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5702603_5702606delACTT	uc003gij.2	-						EVC2_uc011bwb.1_Intron|EVC2_uc003gik.2_Intron	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin							integral to membrane				large_intestine(3)|ovary(2)	5						catcgcacacacttaccagcacca	0.044													4	2	---	---	---	---	
HTRA3	94031	broad.mit.edu	37	4	8274131	8274132	+	Intron	DEL	GG	-	-	rs10590860		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8274131_8274132delGG	uc003gla.2	+						HTRA3_uc003gkz.2_Intron	NM_053044	NP_444272	P83110	HTRA3_HUMAN	HtrA serine peptidase 3 precursor						proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity			ovary(1)	1						ccgtgagcgtggggggtcatgg	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	8344923	8344924	+	IGR	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8344923_8344924insG								HTRA3 (36093 upstream) : ACOX3 (23086 downstream)																							CAGAGATGGGTGGGGGGCAGGG	0.495													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	10121656	10121657	+	IGR	INS	-	TGC	TGC	rs149811386	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10121656_10121657insTGC								WDR1 (3083 upstream) : ZNF518B (319848 downstream)																							TATACTTGAGTTGCTTTCAGCT	0.485													1	6	---	---	---	---	
CC2D2A	57545	broad.mit.edu	37	4	15576123	15576123	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15576123delT	uc010idv.2	+						CC2D2A_uc003gnx.2_Intron|CC2D2A_uc003gnz.1_Intron|CC2D2A_uc003goa.1_Intron	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform						cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						GATGTGTGGGTTTGTACTTTC	0.338													4	2	---	---	---	---	
TBC1D1	23216	broad.mit.edu	37	4	38053725	38053725	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38053725delG	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Intron	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1						CTGTTTTCCTGGGGAGTTCAC	0.398													4	2	---	---	---	---	
CFI	3426	broad.mit.edu	37	4	110679138	110679140	+	Intron	DEL	CAC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110679138_110679140delCAC	uc003hzr.3	-						CFI_uc003hzq.2_Intron|CFI_uc011cft.1_Intron|CFI_uc003hzs.3_Intron	NM_000204	NP_000195	P05156	CFAI_HUMAN	complement factor I preproprotein						complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		ACAAAAAACTCACTATAGCAAAG	0.251													2	4	---	---	---	---	
CFI	3426	broad.mit.edu	37	4	110679144	110679145	+	Intron	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110679144_110679145delAG	uc003hzr.3	-						CFI_uc003hzq.2_Intron|CFI_uc011cft.1_Intron|CFI_uc003hzs.3_Intron	NM_000204	NP_000195	P05156	CFAI_HUMAN	complement factor I preproprotein						complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		AACTCACTATAGCAAAGAGATC	0.257													2	4	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140751304	140751305	+	Intron	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140751304_140751305insA	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					actccatatccaaaaaatgaaa	0.000													4	2	---	---	---	---	
SMAD1	4086	broad.mit.edu	37	4	146405751	146405751	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146405751delA	uc003ikc.2	+						SMAD1_uc003ikd.2_Intron|SMAD1_uc010iov.2_Intron	NM_005900	NP_005891	Q15797	SMAD1_HUMAN	Sma- and Mad-related protein 1						BMP signaling pathway|embryonic pattern specification|primary miRNA processing|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|nuclear inner membrane	co-SMAD binding|I-SMAD binding|identical protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity			ovary(1)	1	all_hematologic(180;0.151)					TGAAAGAGGGAAAAGGCTTAC	0.383													4	2	---	---	---	---	
RPS3A	6189	broad.mit.edu	37	4	152020491	152020491	+	5'Flank	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152020491delG	uc003ilz.2	+						RPS3A_uc011cie.1_5'Flank	NM_001006	NP_000997	P61247	RS3A_HUMAN	ribosomal protein S3a						cell differentiation|endocrine pancreas development|induction of apoptosis|translational elongation|translational initiation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_hematologic(180;0.093)					TGGGCGTCTCGTTTTACAGAA	0.443											OREG0016360	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
KIAA0922	23240	broad.mit.edu	37	4	154411077	154411077	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154411077delG	uc003inm.3	+						KIAA0922_uc010ipp.2_Intron	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				GCTGTGGTGTGTCTCTGTATG	0.413													4	2	---	---	---	---	
KIAA0922	23240	broad.mit.edu	37	4	154554135	154554136	+	Intron	DEL	TT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154554135_154554136delTT	uc003inm.3	+						KIAA0922_uc010ipp.2_Intron|KIAA0922_uc010ipq.2_Intron	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				TCCTTCTGCCTTTTAGAGTTGC	0.381													4	2	---	---	---	---	
SORBS2	8470	broad.mit.edu	37	4	186556308	186556308	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186556308delC	uc003iyl.2	-						SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Intron|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cky.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Intron|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Intron|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TGATTCTTCACCCAGAGTCCA	0.343													3	3	---	---	---	---	
SORBS2	8470	broad.mit.edu	37	4	186810599	186810599	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186810599delT	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		ACCTCTGCTATTTTTTTTCAA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189187778	189187778	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189187778delC								TRIML1 (119129 upstream) : None (None downstream)																							ctacctgatgcccatccccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190574486	190574487	+	IGR	INS	-	CTTCCCAT	CTTCCCAT	rs147168512		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190574486_190574487insCTTCCCAT								None (None upstream) : FRG1 (287487 downstream)																							TCCCAGCGCCACCAGCCTTCCT	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190574490	190574490	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190574490delG								None (None upstream) : FRG1 (287484 downstream)																							AGCGCCACCAGCCTTCCTTGG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78951	78953	+	IGR	DEL	GAC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78951_78953delGAC								None (None upstream) : PLEKHG4B (61420 downstream)																							TGCCCTCCTTGACCCTCCTCTGC	0.567											OREG0016466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
TERT	7015	broad.mit.edu	37	5	1278557	1278558	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1278557_1278558delCA	uc003jcb.1	-						TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1						anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			acacacgtgccacacacacaca	0.203									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1315771	1315771	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1315771delT								TERT (20609 upstream) : CLPTM1L (2236 downstream)																							CCCAAACTCATTTTTTTTTAA	0.517													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1859689	1859689	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1859689delC								NDUFS6 (43526 upstream) : IRX4 (17852 downstream)																							GATGTTAGGTCCCCCTGTGCT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2656009	2656010	+	IGR	INS	-	CT	CT	rs145015579	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2656009_2656010insCT								IRX4 (773129 upstream) : IRX2 (90271 downstream)																							TCCCTTGAACACTGCAGTTTGG	0.431													3	4	---	---	---	---	
DAP	1611	broad.mit.edu	37	5	10763214	10763214	+	5'Flank	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10763214delG	uc003jez.3	-						DAP_uc011cmw.1_5'Flank	NM_004394	NP_004385	P51397	DAP1_HUMAN	death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)				AGACGCTTATGGGTGCCACAT	0.323													4	2	---	---	---	---	
IPO11	51194	broad.mit.edu	37	5	61701863	61701864	+	Intron	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61701863_61701864delTG	uc003jtb.1	+						DIMT1L_uc003jta.2_5'Flank|DIMT1L_uc011cqq.1_5'Flank	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		CAAGTTTTTCTGTAGAGAAGGA	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	72602948	72602949	+	IGR	DEL	TC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72602948_72602949delTC								TMEM174 (131980 upstream) : FOXD1 (139138 downstream)																							CCCAACGCTGTCAACTATGACC	0.470													4	2	---	---	---	---	
COL4A3BP	10087	broad.mit.edu	37	5	74675414	74675414	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74675414delT	uc011csu.1	-						COL4A3BP_uc003kds.2_Intron|COL4A3BP_uc003kdt.2_Intron|COL4A3BP_uc003kdu.2_Intron	NM_005713	NP_005704	Q9Y5P4	C43BP_HUMAN	alpha 3 type IV collagen binding protein isoform						ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity			skin(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		AATTAGCATCttttttttttc	0.139													4	3	---	---	---	---	
IQGAP2	10788	broad.mit.edu	37	5	75922855	75922856	+	Intron	INS	-	G	G	rs147069484	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75922855_75922856insG	uc003kek.2	+						IQGAP2_uc010izv.2_Intron|IQGAP2_uc011csv.1_Intron|IQGAP2_uc003kel.2_Intron	NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		ttctaactgccgggggaagcct	0.000													8	6	---	---	---	---	
LHFPL2	10184	broad.mit.edu	37	5	77829521	77829522	+	Intron	INS	-	C	C	rs145294793	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77829521_77829522insC	uc003kfo.2	-							NM_005779	NP_005770	Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2							integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		ATGTGCCAAAACCTCATCTGCA	0.406													2	4	---	---	---	---	
ARSB	411	broad.mit.edu	37	5	78260085	78260085	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78260085delC	uc003kfq.2	-						ARSB_uc003kfr.3_Intron	NM_000046	NP_000037	P15848	ARSB_HUMAN	arylsulfatase B isoform 1 precursor						lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		taacaagcttcccaggctgat	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	79405918	79405918	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79405918delC								THBS4 (26813 upstream) : SERINC5 (1556 downstream)																							CTGCTTCCATCCCACCTGATT	0.637													4	2	---	---	---	---	
EFNA5	1946	broad.mit.edu	37	5	107007624	107007624	+	5'Flank	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107007624delA	uc003kol.2	-						EFNA5_uc010jbr.1_5'Flank	NM_001962	NP_001953	P52803	EFNA5_HUMAN	ephrin-A5 precursor						cell-cell signaling	anchored to plasma membrane|caveola|extracellular space	ephrin receptor binding				0		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		GGAAAAGAGGAAAAAAAAAAA	0.537													2	5	---	---	---	---	
EPB41L4A	64097	broad.mit.edu	37	5	111540423	111540423	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111540423delA	uc003kpv.1	-						EPB41L4A_uc003kpp.1_Intron	NM_022140	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte protein band 4.1-like 4							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CTTCAGTAGTAAAAAATGAAC	0.274													4	2	---	---	---	---	
SRFBP1	153443	broad.mit.edu	37	5	121295950	121295951	+	5'Flank	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121295950_121295951delGT	uc003kst.1	+							NM_152546	NP_689759	Q8NEF9	SRFB1_HUMAN	serum response factor binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	perinuclear region of cytoplasm					0		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		agttttgtaagtgaagtctagt	0.035													4	2	---	---	---	---	
SNX24	28966	broad.mit.edu	37	5	122321778	122321778	+	Intron	DEL	G	-	-	rs34324465		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122321778delG	uc011cwo.1	+						SNX24_uc003ktf.2_Intron|SNX24_uc010jcy.2_Intron	NM_014035	NP_054754	Q9Y343	SNX24_HUMAN	SBBI31 protein						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		AGAGGTGAGAGAAAGGAagca	0.244													2	4	---	---	---	---	
FSTL4	23105	broad.mit.edu	37	5	132864244	132864245	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132864244_132864245delGA	uc003kyn.1	-							NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCTCCTCCCTGAGCTTGTCATG	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133032374	133032374	+	IGR	DEL	C	-	-	rs144411732	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133032374delC								FSTL4 (84151 upstream) : C5orf15 (258825 downstream)																							TAGACAGATTCCCCAGGTGGC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134799066	134799068	+	IGR	DEL	AGG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134799066_134799068delAGG								TIFAB (10977 upstream) : NEUROG1 (70912 downstream)																							TTTTTTCCTTAGGACATGAGCCC	0.360													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135165452	135165452	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135165452delT								LOC340074 (175828 upstream) : LOC153328 (4913 downstream)																							GAGGCAGCACTTTTTttaata	0.279											OREG0016804	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135754936	135754937	+	IGR	INS	-	A	A	rs150290072		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135754936_135754937insA								TRPC7 (61863 upstream) : SPOCK1 (556051 downstream)																							ggtctgtctccaaaaaaaaaaa	0.198													5	5	---	---	---	---	
C5orf32	84418	broad.mit.edu	37	5	139611748	139611748	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139611748delG	uc003lfd.2	+						C5orf32_uc010jfi.2_Intron	NM_032412	NP_115788	Q9H1C7	CE032_HUMAN	hypothetical protein LOC84418												0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tacagaggttgggaacaagag	0.000													4	2	---	---	---	---	
STK32A	202374	broad.mit.edu	37	5	146717515	146717515	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146717515delG	uc010jgn.1	+						STK32A_uc003lol.3_Intron|STK32A_uc003lom.2_Intron|STK32A_uc011dbw.1_Intron	NM_001112724	NP_001106195	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A isoform 1								ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ctattggtgtgggacggatga	0.000													4	2	---	---	---	---	
TCOF1	6949	broad.mit.edu	37	5	149775714	149775736	+	Intron	DEL	GCCTTGCTCTCCCCATCTGTGCC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149775714_149775736delGCCTTGCTCTCCCCATCTGTGCC	uc003lry.2	+						TCOF1_uc011dch.1_Intron|TCOF1_uc003lrz.2_Intron|TCOF1_uc003lrx.2_Intron|TCOF1_uc003lsa.2_Intron	NM_001135243	NP_001128715	Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1						skeletal system development	nucleolus	protein binding|transporter activity			ovary(2)|large_intestine(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGACCGCCAAGCCTTGCTCTCCCCATCTGTGCCATTGTAAGAA	0.507													20	12	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154284431	154284432	+	Intron	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154284431_154284432insA	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CATCAAGTGCTAAAAAAAATTC	0.243													4	2	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155996105	155996106	+	Intron	INS	-	T	T	rs151316395	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155996105_155996106insT	uc003lwd.3	+						SGCD_uc003lwa.1_Intron|SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			atcctcccctcttctaggtacc	0.015													1	8	---	---	---	---	
ADAM19	8728	broad.mit.edu	37	5	156926338	156926338	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156926338delA	uc003lwz.2	-						ADAM19_uc003lww.1_Intron|ADAM19_uc003lwy.2_Intron|ADAM19_uc011ddr.1_Intron	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTTAAAAAAGAAAAAAAAAAG	0.318													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166403053	166403054	+	IGR	DEL	TC	-	-	rs113102619		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166403053_166403054delTC								None (None upstream) : ODZ2 (308789 downstream)																							tgtgtgtgtgtctgtgtgtgtc	0.168													1	6	---	---	---	---	
PANK3	79646	broad.mit.edu	37	5	168005813	168005815	+	Intron	DEL	AAC	-	-	rs141750924		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168005813_168005815delAAC	uc003lzz.1	-							NM_024594	NP_078870	Q9H999	PANK3_HUMAN	pantothenate kinase 3						coenzyme A biosynthetic process	cytoplasm|nucleus	ATP binding|pantothenate kinase activity			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		CTCCAACTGTAACAACAGTGACA	0.453													6	3	---	---	---	---	
KCNIP1	30820	broad.mit.edu	37	5	169847334	169847334	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169847334delG	uc003map.2	+							NM_001034838	NP_001030010	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 3						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ttaataaatagcaaatatatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170170869	170170869	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170170869delA								KCNIP1 (7235 upstream) : GABRP (39854 downstream)																							tctcaccaagaaaaaaaatcc	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	171075818	171075818	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171075818delT								FGF18 (191656 upstream) : FBXW11 (212738 downstream)																							GCTCATGGACTTTAGGGTCCT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173019223	173019223	+	IGR	DEL	C	-	-	rs138713001		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173019223delC								LOC285593 (7149 upstream) : BOD1 (14925 downstream)																							ctgcaatcagccttccattgt	0.020													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175336069	175336070	+	IGR	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175336069_175336070delAC								CPLX2 (25046 upstream) : THOC3 (50466 downstream)																							gcacacgcgaacacacacacac	0.000													8	5	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	177974320	177974320	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177974320delA	uc003mje.2	-							NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		CGGCAGTGAGAAAAAAGGCGG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178396931	178396932	+	IGR	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178396931_178396932insC								ZNF454 (3497 upstream) : GRM6 (8400 downstream)																							CCTGCCGGGTGCCCCTCATCTC	0.530													4	2	---	---	---	---	
TBC1D9B	23061	broad.mit.edu	37	5	179295046	179295046	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179295046delT	uc003mlh.2	-						TBC1D9B_uc003mli.2_Intron|TBC1D9B_uc003mlj.2_Intron|TBC1D9B_uc003mlf.2_5'Flank|TBC1D9B_uc003mlg.2_Intron|TBC1D9B_uc011dgv.1_Intron|TBC1D9B_uc011dgw.1_Intron	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)							integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTTCCTCAGCttttttttttt	0.259													6	3	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180071403	180071403	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180071403delA	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc011dgy.1_Intron|FLT4_uc011dgz.1_Intron|FLT4_uc011dha.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	ACAGCAAAGTAAAAATGGCCA	0.577									Congenital_Hereditary_Lymphedema				4	2	---	---	---	---	
OR2Y1	134083	broad.mit.edu	37	5	180167654	180167654	+	5'Flank	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180167654delA	uc003mmf.1	-							NM_001001657	NP_001001657	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTTGGAGAAGAAAAAAAAATC	0.348													4	2	---	---	---	---	
MGAT1	4245	broad.mit.edu	37	5	180218173	180218173	+	3'UTR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180218173delT	uc003mmg.3	-	2					MGAT1_uc010jlf.2_3'UTR|MGAT1_uc010jlg.2_3'UTR|MGAT1_uc003mmh.3_3'UTR|MGAT1_uc010jlh.2_3'UTR|MGAT1_uc003mmi.3_3'UTR	NM_002406	NP_002397	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(1)	1	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTAGTATCATTTTGGCCACA	0.582													4	2	---	---	---	---	
SERPINB1	1992	broad.mit.edu	37	6	2839924	2839925	+	Intron	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2839924_2839925delAG	uc003mub.2	-						SERPINB1_uc003muc.2_Intron	NM_030666	NP_109591	P30740	ILEU_HUMAN	serine (or cysteine) proteinase inhibitor, clade						regulation of proteolysis	cytoplasm|extracellular space	serine-type endopeptidase inhibitor activity			breast(4)|ovary(1)	5	Ovarian(93;0.0412)			OV - Ovarian serous cystadenocarcinoma(45;0.0717)		TGCTGAGCTTAGAGAGAGAGAG	0.480													4	2	---	---	---	---	
SERPINB9	5272	broad.mit.edu	37	6	2891833	2891833	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2891833delC	uc003mug.2	-						uc003mue.2_Intron|SERPINB9_uc003muf.2_Intron	NM_004155	NP_004146	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B, member 9						anti-apoptosis|cellular response to estrogen stimulus|immune response|mast cell mediated immunity|regulation of proteolysis	cytosol|extracellular space|nucleus	caspase inhibitor activity|protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.108)				TTAACCGCCGCCCACTCCTTC	0.388													4	2	---	---	---	---	
NEDD9	4739	broad.mit.edu	37	6	11233426	11233427	+	5'Flank	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11233426_11233427delTG	uc003mzv.2	-						NEDD9_uc010joz.2_Intron|NEDD9_uc003mzw.3_Intron|NEDD9_uc003mzx.2_5'Flank	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			gcctACTTTTTGTGTGTGTGTG	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	30565140	30565141	+	IGR	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30565140_30565141delCA								ABCF1 (5833 upstream) : PPP1R10 (3041 downstream)																							TATGTCTTCTCAGGTCTTCTCC	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37514326	37514326	+	IGR	DEL	T	-	-	rs71960525		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37514326delT								C6orf129 (46626 upstream) : MDGA1 (85958 downstream)																							gctgctatgattTTTTTAACA	0.184													4	2	---	---	---	---	
FOXP4	116113	broad.mit.edu	37	6	41554207	41554208	+	Intron	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41554207_41554208insA	uc003oql.2	+						FOXP4_uc003oqm.2_Intron|FOXP4_uc003oqn.2_Intron	NM_001012426	NP_001012426	Q8IVH2	FOXP4_HUMAN	forkhead box P4 isoform 1						embryonic foregut morphogenesis|heart development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					CTGGGCAGTGGTGATGTGACTG	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	41737103	41737104	+	IGR	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41737103_41737104insT								PGC (21982 upstream) : FRS3 (810 downstream)																							TAATCCTAGGATTTTAGTAAAG	0.436													2	4	---	---	---	---	
TRERF1	55809	broad.mit.edu	37	6	42330089	42330090	+	Intron	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42330089_42330090insC	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ATCAGATACCACCCCCCTTCCC	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	43824877	43824877	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43824877delA								VEGFA (70656 upstream) : LOC100132354 (33888 downstream)																							CTAACTACTGAAGGGGAAGTG	0.562													4	2	---	---	---	---	
ELOVL5	60481	broad.mit.edu	37	6	53134249	53134249	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53134249delT	uc003pbq.1	-						ELOVL5_uc003pbr.1_Intron|ELOVL5_uc011dwx.1_Intron|ELOVL5_uc003pbs.1_Intron	NM_021814	NP_068586	Q9NYP7	ELOV5_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Lung NSC(77;0.116)					TCATTCTTCCTTTTTTTTTTT	0.348													3	3	---	---	---	---	
FAM83B	222584	broad.mit.edu	37	6	54727858	54727859	+	Intron	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54727858_54727859insT	uc003pck.2	+							NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584											ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					ACACACCTCACTGCTGAGCAAG	0.426													1	5	---	---	---	---	
COL12A1	1303	broad.mit.edu	37	6	75918338	75918338	+	5'Flank	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75918338delA	uc003phs.2	-						COL12A1_uc003pht.2_5'Flank	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						CTAGCTCAACAAAAAGGATCC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	76296054	76296055	+	IGR	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76296054_76296055delGA								FILIP1 (92558 upstream) : SENP6 (15567 downstream)																							CCATCAGCATGAGAACTAGCTC	0.431													4	2	---	---	---	---	
ORC3L	23595	broad.mit.edu	37	6	88311312	88311313	+	Intron	DEL	CC	-	-	rs143775102	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88311312_88311313delCC	uc003pmh.2	+						ORC3L_uc011dzl.1_Intron|ORC3L_uc011dzm.1_Intron|ORC3L_uc011dzn.1_Intron|ORC3L_uc003pmg.2_Intron|ORC3L_uc003pmi.2_Intron|ORC3L_uc011dzo.1_Intron|ORC3L_uc011dzp.1_Intron	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		atcacttgaacctgggaggcgg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	89257859	89257859	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89257859delC								CNR1 (382092 upstream) : RNGTT (62130 downstream)																							ccagcacctaccacccttgaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	89283775	89283776	+	IGR	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89283775_89283776insC								CNR1 (408008 upstream) : RNGTT (36213 downstream)																							GGCAGCCTGCACCCCGCCCATT	0.594													4	2	---	---	---	---	
ARMC2	84071	broad.mit.edu	37	6	109276784	109276785	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109276784_109276785delCA	uc003pss.3	+						ARMC2_uc011eao.1_Intron	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2								binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		catcacgtgTCACCTGTCTTGA	0.208													4	2	---	---	---	---	
SESN1	27244	broad.mit.edu	37	6	109323220	109323222	+	Intron	DEL	TGT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109323220_109323222delTGT	uc003pst.3	-						SESN1_uc003psu.2_Intron	NM_014454	NP_055269	Q9Y6P5	SESN1_HUMAN	sestrin 1						cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		TATAAGCAGATGTTGTATCACTG	0.350													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112365630	112365630	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112365630delT								FYN (171003 upstream) : WISP3 (9648 downstream)																							TGCAAACTGCTTATCAGATAA	0.537													4	2	---	---	---	---	
THEMIS	387357	broad.mit.edu	37	6	128200863	128200863	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128200863delA	uc003qbi.2	-						THEMIS_uc011ebt.1_Intron|THEMIS_uc010kfb.2_Intron	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform						negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						AAAAAGAAAGAAAAAAAACGA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134858465	134858465	+	RNA	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134858465delC	uc003qev.1	-	5		c.1220delG								AJ606331																		AATTCAGCAGCCCCAGAGTTT	0.502													4	2	---	---	---	---	
SNX9	51429	broad.mit.edu	37	6	158324797	158324797	+	Intron	DEL	A	-	-	rs67472222		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158324797delA	uc003qqv.1	+							NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9						cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		ttataaccttaaggcaagttt	0.015													4	7	---	---	---	---	
SYNJ2	8871	broad.mit.edu	37	6	158430118	158430118	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158430118delG	uc003qqx.1	+						SYNJ2_uc011efm.1_Intron|SYNJ2_uc003qqw.1_Intron	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		ccatctccctggcttccttca	0.000													4	2	---	---	---	---	
SERAC1	84947	broad.mit.edu	37	6	158579538	158579538	+	Intron	DEL	A	-	-	rs111829898		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158579538delA	uc003qrc.2	-						SERAC1_uc003qrb.2_Intron	NM_032861	NP_116250	Q96JX3	SRAC1_HUMAN	serine active site containing 1						GPI anchor metabolic process|intracellular protein transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	binding|hydrolase activity, acting on ester bonds				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		CTTTCCAATTAAAAAAAAAAT	0.294													3	5	---	---	---	---	
TMEM181	57583	broad.mit.edu	37	6	158993911	158993918	+	Intron	DEL	GTGGGCTT	-	-	rs142788574		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158993911_158993918delGTGGGCTT	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron|TMEM181_uc003qri.1_Intron|TMEM181_uc003qrj.1_Intron|TMEM181_uc003qrk.1_Intron	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		AGAGGGAGGAgtgggcttgtgggcttgt	0.457													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159911199	159911200	+	IGR	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159911199_159911200delGT								FNDC1 (218060 upstream) : SOD2 (188951 downstream)																							CAGTTATTGAGTGAAGAGCAAG	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164170775	164170775	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164170775delC	uc003quk.1	+											Homo sapiens cDNA FLJ35795 fis, clone TESTI2005827.																		CACGGTTGGTCCATAGAGCAG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166504932	166504932	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166504932delA								LOC441177 (101829 upstream) : T (66154 downstream)																							agcatttctgaaaaaaaactc	0.000													4	2	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	685688	685688	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:685688delT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		CTGCACGCTAttttttttttt	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1640200	1640201	+	IGR	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1640200_1640201delCA								KIAA1908 (10941 upstream) : TFAMP1 (13905 downstream)																							GCCTGAAGGCCAAACACTCAcc	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	2425790	2425790	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2425790delA								EIF3B (5415 upstream) : CHST12 (17433 downstream)																							GCTCTGCAGGAAAGGACATGG	0.547													4	2	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4267853	4267854	+	Intron	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4267853_4267854insT	uc003smx.2	+						SDK1_uc010kso.2_Intron|SDK1_uc003smy.2_Intron|SDK1_uc003smz.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TTCTCAGTGGCTTCCCACTTTC	0.480													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	21132643	21132645	+	IGR	DEL	CCA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21132643_21132645delCCA								RPL23P8 (265204 upstream) : SP4 (335044 downstream)																							CATCAGGTTGCCACCACAAGATG	0.498													4	2	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	27929957	27929958	+	Intron	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27929957_27929958delGG	uc003szn.2	-						JAZF1_uc003szm.2_Intron	NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						GAGAAACCCTGGCTGAATGAAA	0.243			T	SUZ12	endometrial stromal tumours								4	2	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28731860	28731860	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28731860delT	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron|CREB5_uc003szs.2_Intron|CREB5_uc011jzr.1_Intron	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						TTCTGCTCCCTTTTTGTTTGG	0.264													4	2	---	---	---	---	
WIPF3	644150	broad.mit.edu	37	7	29890469	29890469	+	Intron	DEL	C	-	-	rs11326639		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29890469delC	uc003taj.1	+							NM_001080529	NP_001073998	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3											ovary(1)	1						gtggacctggctcccgagttt	0.179													2	4	---	---	---	---	
EEPD1	80820	broad.mit.edu	37	7	36279212	36279212	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36279212delC	uc003tfa.2	+							NM_030636	NP_085139	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family						DNA repair		DNA binding				0						TGCCTCTCTGCCCCCAAACCA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	42725149	42725149	+	IGR	DEL	A	-	-	rs34886054		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42725149delA								GLI3 (448531 upstream) : C7orf25 (223725 downstream)																							ACTGAGTTCCAAAAAAAAGTA	0.413													3	3	---	---	---	---	
HECW1	23072	broad.mit.edu	37	7	43496232	43496236	+	Intron	DEL	AAGTT	-	-	rs3214630		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43496232_43496236delAAGTT	uc003tid.1	+						HECW1_uc011kbi.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GGCGAGAGACAAGTTAAGCTTGAGT	0.390													4	4	---	---	---	---	
SPDYE1	285955	broad.mit.edu	37	7	44041932	44041933	+	Intron	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44041932_44041933insG	uc003tjf.2	+						POLR2J4_uc003tjc.2_Intron|POLR2J4_uc003tjd.2_Intron|POLR2J4_uc010kxw.2_Intron|POLR2J4_uc003tje.3_Intron	NM_175064	NP_778234	Q8NFV5	SPDE1_HUMAN	Williams Beuren syndrome chromosome region 19											ovary(1)	1						aaaaaaaaaaaaaaaAAAGGGA	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47232673	47232673	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47232673delA								None (None upstream) : TNS3 (82080 downstream)																							TTGTGATCACAGATATTGACT	0.502													4	2	---	---	---	---	
TNS3	64759	broad.mit.edu	37	7	47368593	47368593	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47368593delC	uc003tnv.2	-						TNS3_uc003tnw.2_Intron	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						AAGCCAACTGCTGAAAAACTC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	50213107	50213108	+	IGR	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50213107_50213108delTG								C7orf72 (13749 upstream) : IKZF1 (131270 downstream)																							GTGGGGGTGTTGTGAAACCCCT	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61822440	61822441	+	IGR	DEL	AT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61822440_61822441delAT								None (None upstream) : LOC643955 (929231 downstream)																							tgagggagaaatgacttgccAG	0.361													8	4	---	---	---	---	
TPST1	8460	broad.mit.edu	37	7	65675252	65675252	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65675252delG	uc003tuw.2	+						TPST1_uc010kzy.2_Intron|TPST1_uc010kzz.2_Intron|TPST1_uc010laa.2_Intron	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1						inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						aggaaatacaggaaaataaac	0.174													4	2	---	---	---	---	
LOC729156	729156	broad.mit.edu	37	7	66282053	66282053	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66282053delT	uc003tvj.1	-							NR_003934				Homo sapiens cDNA FLJ36054 fis, clone TESTI2018290.												0						TGAATCAACCTTCTTTATCAT	0.483													2	8	---	---	---	---	
TYW1B	441250	broad.mit.edu	37	7	72085782	72085782	+	Intron	DEL	C	-	-	rs35569946		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72085782delC	uc011kej.1	-						TYW1B_uc011keh.1_Intron|TYW1B_uc011kei.1_Intron	NM_001145440	NP_001138912	Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B isoform						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity				0						AAGTTCTTCACCCAAAACTCT	0.368													4	3	---	---	---	---	
NSUN5	55695	broad.mit.edu	37	7	72719874	72719874	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72719874delC	uc003txw.2	-						FKBP6_uc003twz.2_Intron|NSUN5_uc003txv.2_Intron|NSUN5_uc003txx.2_Intron|NSUN5_uc011kev.1_Intron	NM_018044	NP_060514	Q96P11	NSUN5_HUMAN	NOL1/NOP2/Sun domain family, member 5 isoform 2								methyltransferase activity				0		Lung NSC(55;0.163)				ATGGTAGAGGCAGAAGGAAGA	0.323													4	2	---	---	---	---	
CLIP2	7461	broad.mit.edu	37	7	73785109	73785109	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73785109delT	uc003uam.2	+						CLIP2_uc003uan.2_Intron	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2							microtubule associated complex				skin(3)	3						gcctgccttgtacaaggagtc	0.104													4	2	---	---	---	---	
CCL26	10344	broad.mit.edu	37	7	75401043	75401043	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75401043delA	uc003udt.1	-							NM_006072	NP_006063	Q9Y258	CCL26_HUMAN	chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0						tcaaaaagagaaaaaaaaaGT	0.254													4	2	---	---	---	---	
PTPN12	5782	broad.mit.edu	37	7	77265372	77265373	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77265372_77265373delAC	uc003ugh.2	+						PTPN12_uc011kgp.1_Intron|PTPN12_uc011kgq.1_Intron|PTPN12_uc010lds.2_Intron	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type							soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3						AACCTGATCTACATACAACTAT	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	86860004	86860005	+	IGR	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86860004_86860005delGT								C7orf23 (10973 upstream) : TP53TG1 (94661 downstream)																							acaccttggggtgacctgccag	0.000													4	2	---	---	---	---	
MGC72080	389538	broad.mit.edu	37	7	97603736	97603736	+	5'Flank	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97603736delA	uc010lfp.1	-						MGC72080_uc003upb.1_5'Flank|MGC72080_uc003upa.1_5'Flank					Homo sapiens cDNA, FLJ99734.												0						AGCATAATCTACAGAGTCCTT	0.328													4	2	---	---	---	---	
BAIAP2L1	55971	broad.mit.edu	37	7	97936025	97936025	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97936025delT	uc003upj.2	-						uc003upk.1_5'Flank	NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			TTGTTAACAAtttttttttaa	0.179													4	2	---	---	---	---	
PILRA	29992	broad.mit.edu	37	7	99995214	99995214	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99995214delG	uc003uuo.1	+						PILRA_uc011kjo.1_Intron|PILRA_uc003uup.1_Intron|PILRA_uc003uuq.1_Intron	NM_013439	NP_038467	Q9UKJ1	PILRA_HUMAN	paired immunoglobulin-like type 2 receptor alpha						interspecies interaction between organisms	extracellular region|integral to membrane|plasma membrane	protein binding|receptor activity			skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCTCAGCGGTGGAGGGAGCCA	0.632													4	2	---	---	---	---	
ARMC10	83787	broad.mit.edu	37	7	102729089	102729089	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102729089delA	uc003vaw.1	+						ARMC10_uc003vay.1_Intron|ARMC10_uc003vax.1_Intron|ARMC10_uc003vbb.1_Intron|ARMC10_uc011kli.1_Intron|ARMC10_uc010lis.1_Intron|ARMC10_uc003vba.1_Intron|ARMC10_uc003vaz.1_Intron	NM_031905	NP_114111	Q8N2F6	ARM10_HUMAN	SVH protein isoform a						regulation of growth	endoplasmic reticulum membrane|integral to membrane	binding			ovary(1)	1						ACAACCTCTGAAATCCATGAA	0.353													4	2	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111449112	111449113	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111449112_111449113delAA	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron|uc003vfz.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				ACCTTTTAGTAAAAGAGATCTG	0.302													4	2	---	---	---	---	
PAX4	5078	broad.mit.edu	37	7	127255859	127255859	+	5'Flank	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127255859delC	uc010lld.1	-						PAX4_uc003vmf.2_5'Flank|PAX4_uc003vmg.1_Intron|PAX4_uc003vmh.2_5'Flank	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4						cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GAAAAAGCTTCCCCAGAACAT	0.547													4	2	---	---	---	---	
IMPDH1	3614	broad.mit.edu	37	7	128033537	128033538	+	Intron	DEL	TC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128033537_128033538delTC	uc011kol.1	-						IMPDH1_uc011kom.1_Intron|IMPDH1_uc003vmt.2_Intron|IMPDH1_uc003vmu.2_Intron|IMPDH1_uc003vmw.2_Intron|IMPDH1_uc011kon.1_Intron|IMPDH1_uc003vmv.2_Intron|IMPDH1_uc003vmx.2_Intron|IMPDH1_uc003vmy.2_Intron	NM_001142573	NP_001136045	P20839	IMDH1_HUMAN	inosine monophosphate dehydrogenase 1 isoform e						GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	DNA binding|IMP dehydrogenase activity|metal ion binding			skin(2)|lung(1)|central_nervous_system(1)	4					Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)	GTCACGGGCATCTCTCTGCAGC	0.609													8	4	---	---	---	---	
NUP205	23165	broad.mit.edu	37	7	135253525	135253525	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135253525delT	uc003vsw.2	+						NUP205_uc011kqa.1_Intron	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						CTGAATTCTCTTTCATGCTTT	0.308													4	2	---	---	---	---	
SVOPL	136306	broad.mit.edu	37	7	138291770	138291771	+	Intron	INS	-	T	T	rs141988826	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138291770_138291771insT	uc011kqh.1	-						SVOPL_uc003vue.2_Intron	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						actgttttttgttttttttttc	0.104													4	2	---	---	---	---	
ZC3HAV1	56829	broad.mit.edu	37	7	138763121	138763121	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138763121delA	uc003vun.2	-						ZC3HAV1_uc003vuo.2_Intron|ZC3HAV1_uc003vup.2_Intron	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1						response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						atagttcctcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
TBXAS1	6916	broad.mit.edu	37	7	139516114	139516115	+	Intron	DEL	TC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139516114_139516115delTC	uc003vvh.2	+						TBXAS1_uc010lne.2_Intron	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					GAAGTCAGGGTCTCTCCTGGGG	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141105637	141105638	+	IGR	DEL	TC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141105637_141105638delTC								MRPS33 (390856 upstream) : AGK (145440 downstream)																							CGATGGGGCTTCCTGGTGTCAC	0.490													4	2	---	---	---	---	
KIAA1147	57189	broad.mit.edu	37	7	141368983	141368983	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141368983delT	uc003vwk.2	-							NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)					TTCCAGTTTATTTTTTTCCCT	0.358													4	2	---	---	---	---	
CUL1	8454	broad.mit.edu	37	7	148496097	148496097	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148496097delT	uc010lpg.2	+						CUL1_uc003wey.2_Intron|CUL1_uc003wez.2_Intron|CUL1_uc003wfa.2_Intron	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TTTTGTCTCCTTTTTTTTAAT	0.403													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148990306	148990306	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148990306delG	uc003wfr.3	+						uc011kup.1_Intron|uc003wft.3_Intron|uc003wfu.2_5'Flank					Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																		CCCCTGGCTTGACTCACTGCC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	154894400	154894400	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154894400delG								HTR5A (16941 upstream) : INSIG1 (195086 downstream)																							CCCTAAGCCTGGAATGCCGAG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155232513	155232514	+	IGR	INS	-	C	C	rs6960335		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155232513_155232514insC								INSIG1 (130571 upstream) : EN2 (18310 downstream)																							CATGGGCTTTTCTCCGGCCCTT	0.579													6	10	---	---	---	---	
ERICH1	157697	broad.mit.edu	37	8	672229	672229	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:672229delA	uc003wph.2	-						ERICH1_uc011kwh.1_Intron|ERICH1_uc003wpe.1_Intron	NM_207332	NP_997215	Q86X53	ERIC1_HUMAN	glutamate-rich 1											large_intestine(2)	2		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		ATGCCAATCGAAAAAAAAAAC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2107786	2107787	+	IGR	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2107786_2107787insG								MYOM2 (14407 upstream) : CSMD1 (685089 downstream)																							CGAGAAGGAATGGGGGGGCTGT	0.535													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	2931808	2931809	+	Intron	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2931808_2931809delAG	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ctctgcccctagaagagcccgt	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	5594367	5594368	+	IGR	INS	-	G	G	rs2669268		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5594367_5594368insG								CSMD1 (742039 upstream) : MCPH1 (669753 downstream)																							TGtttttgtttttttttttttt	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6886744	6886744	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6886744delT								DEFA1B (49130 upstream) : DEFA5 (26085 downstream)																							ggagaggtgaTCACCTAAGAG	0.259													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7727519	7727519	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7727519delT								SPAG11A (6201 upstream) : DEFB4A (24680 downstream)																							GGGGTGGATCTTTAGCTGTTA	0.423													4	2	---	---	---	---	
SGK223	157285	broad.mit.edu	37	8	8183908	8183908	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8183908delA	uc003wsh.3	-							NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin								ATP binding|non-membrane spanning protein tyrosine kinase activity				0						TTCTAACTGGAAAAAAAAGCG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	8349717	8349717	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8349717delG								SGK223 (110460 upstream) : CLDN23 (209949 downstream)																							tcactgctctggatgtgttga	0.025													4	2	---	---	---	---	
PEBP4	157310	broad.mit.edu	37	8	22618085	22618085	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22618085delG	uc003xcn.1	-							NM_144962	NP_659399	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4							lysosome				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)		GAGGATGGCAGGGGGGGCAGT	0.572													4	2	---	---	---	---	
EBF2	64641	broad.mit.edu	37	8	25897959	25897959	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25897959delA	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc003xet.1_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GACAGGGAAGAAAAAAAAAAA	0.522													3	3	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	25940291	25940291	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25940291delT	uc003xek.2	+							NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		AGCCCTTTACTTCCCGCCAGA	0.517													4	2	---	---	---	---	
PNOC	5368	broad.mit.edu	37	8	28174674	28174675	+	5'UTR	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28174674_28174675insT	uc010lva.2	+	1					PNOC_uc003xgp.2_5'UTR	NM_006228	NP_006219	Q13519	PNOC_HUMAN	prepronociceptin precursor						neuropeptide signaling pathway|sensory perception|synaptic transmission	extracellular region	neuropeptide hormone activity|opioid peptide activity			central_nervous_system(1)	1		Ovarian(32;0.000953)		KIRC - Kidney renal clear cell carcinoma(542;0.104)|Kidney(114;0.125)|Colorectal(74;0.145)|BRCA - Breast invasive adenocarcinoma(99;0.245)		AGGTTCTGCTGTTTGGTTGCTG	0.579													4	2	---	---	---	---	
PLEKHA2	59339	broad.mit.edu	37	8	38810454	38810455	+	Intron	INS	-	T	T	rs146846522	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38810454_38810455insT	uc003xmi.3	+						PLEKHA2_uc011lce.1_Intron	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A						positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			TTCTTCTTATATTTTTTTGtct	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	39883698	39883698	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39883698delC								IDO2 (9788 upstream) : C8orf4 (127291 downstream)																							TGTGTGCTCTCCCACCCTGTG	0.413													4	2	---	---	---	---	
ANK1	286	broad.mit.edu	37	8	41561344	41561344	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41561344delA	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AGAGGAGGGTAAATGGTGCTT	0.299													4	2	---	---	---	---	
SLC20A2	6575	broad.mit.edu	37	8	42292442	42292443	+	Intron	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42292442_42292443delGT	uc010lxl.2	-						SLC20A2_uc010lxm.2_Intron|SLC20A2_uc003xpe.2_Intron|SLC20A2_uc011lcu.1_Intron	NM_006749	NP_006740	Q08357	S20A2_HUMAN	solute carrier family 20, member 2						interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			gtgtgtgtgcgtgtgtgtgtgc	0.198													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	43102548	43102548	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43102548delA								HGSNAT (44579 upstream) : POTEA (45037 downstream)																							CCGCGACAGGAAAGACAGGCA	0.562													4	2	---	---	---	---	
TOX	9760	broad.mit.edu	37	8	60031724	60031724	+	5'UTR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60031724delG	uc003xtw.1	-	1					uc003xtx.1_5'Flank|uc003xty.1_5'Flank	NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				aaaaaaaagaggggggaaaag	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	94868947	94868947	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94868947delT								TMEM67 (38601 upstream) : PDP1 (60136 downstream)																							aatgttctccttctaccttct	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	98263478	98263478	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98263478delC								PGCP (107757 upstream) : TSPYL5 (22237 downstream)																							CTGAGGGGGACCAAACCTTAA	0.517													4	2	---	---	---	---	
LAPTM4B	55353	broad.mit.edu	37	8	98817953	98817953	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98817953delT	uc003yia.2	+						LAPTM4B_uc010mbg.2_Intron	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4						transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			CCTTTTGGCCTTTTTTGAGAG	0.353													4	2	---	---	---	---	
NACAP1	83955	broad.mit.edu	37	8	102373535	102373535	+	5'Flank	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102373535delG	uc010mbs.1	+											Homo sapiens FKSG17 (FKSG17) mRNA, complete cds.												0						GTTTCATTTTGAAAGAGGTTT	0.428													4	2	---	---	---	---	
ZHX2	22882	broad.mit.edu	37	8	123967490	123967490	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123967490delG	uc003ypk.1	+							NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GGGGAGGGCTGGTGGGAGGGA	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126591448	126591448	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126591448delA								TRIB1 (140806 upstream) : FAM84B (973239 downstream)																							TGGAGAAGATAAAACAGGAAG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135475379	135475379	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135475379delA								ST3GAL1 (891196 upstream) : ZFAT (14654 downstream)																							aatggtctccaaagatggcta	0.000													4	2	---	---	---	---	
JRK	8629	broad.mit.edu	37	8	143753693	143753694	+	5'Flank	INS	-	CCC	CCC	rs137867800	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143753693_143753694insCCC	uc003ywo.2	-						JRK_uc003ywp.2_5'Flank	NM_001077527	NP_001070995			jerky isoform b												0	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				ccaactgccctccccaatccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143882287	143882287	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143882287delG								LY6D (14279 upstream) : GML (33930 downstream)																							GGGGAGCTGCGGGGCTTCCTC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144256021	144256021	+	IGR	DEL	G	-	-	rs10448085	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144256021delG								LY6H (13968 upstream) : GPIHBP1 (39047 downstream)																							TTTTTTTTTTGACTGTCCCTG	0.358													7	4	---	---	---	---	
ZNF16	7564	broad.mit.edu	37	8	146158412	146158412	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146158412delT	uc003zet.2	-						ZNF16_uc003zeu.2_Intron	NM_001029976	NP_001025147	P17020	ZNF16_HUMAN	zinc finger protein 16						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		ACACCACTCCTTACACTGTTA	0.308													4	2	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14910481	14910482	+	5'Flank	INS	-	CA	CA			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14910481_14910482insCA	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		CAGcacacaggcacacacacac	0.262													4	2	---	---	---	---	
ADAMTSL1	92949	broad.mit.edu	37	9	18625271	18625271	+	Intron	DEL	T	-	-	rs113787073		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18625271delT	uc003zne.3	+						ADAMTSL1_uc003znb.2_Intron|ADAMTSL1_uc003znc.3_Intron	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		TATATCCAAGTTTTTTTTTTT	0.408													4	2	---	---	---	---	
DDX58	23586	broad.mit.edu	37	9	32472759	32472760	+	Intron	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32472759_32472760insT	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ACACATATACAACacacacctc	0.069													4	2	---	---	---	---	
DDX58	23586	broad.mit.edu	37	9	32472767	32472767	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32472767delC	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ACAACacacacctctcatata	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	33802685	33802686	+	Intron	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33802685_33802686insA	uc003ztk.1	-											full-length cDNA clone CS0DF037YH05 of Fetal brain of Homo sapiens (human).																		GGTAAAGTGGTATGATCTTCCA	0.455													4	2	---	---	---	---	
UBE2R2	54926	broad.mit.edu	37	9	33916000	33916000	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33916000delA	uc003ztm.2	+							NM_017811	NP_060281	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme UBC3B						protein K48-linked ubiquitination|protein monoubiquitination		ATP binding|ubiquitin-protein ligase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		ccgagatgccaaaaaaagacc	0.000													4	2	---	---	---	---	
VCP	7415	broad.mit.edu	37	9	35061323	35061323	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35061323delT	uc003zvy.2	-						VCP_uc003zvz.2_Intron|VCP_uc010mkh.1_Intron|VCP_uc010mki.1_Intron	NM_007126	NP_009057	P55072	TERA_HUMAN	valosin-containing protein						activation of caspase activity|double-strand break repair|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|retrograde protein transport, ER to cytosol	cytosol|endoplasmic reticulum|microsome|nucleus|proteasome complex	ATP binding|ATPase activity|lipid binding|polyubiquitin binding|protein domain specific binding|protein phosphatase binding			upper_aerodigestive_tract(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ATGGGCTGGGTTTTAAGTACT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	88046071	88046071	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88046071delT								NTRK2 (407566 upstream) : AGTPBP1 (115384 downstream)																							GCACTTCAGCTGCTTGAAGGG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	91586701	91586702	+	IGR	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91586701_91586702insC								LOC286238 (319626 upstream) : C9orf47 (19076 downstream)																							ACCAACCTGTGCCTGCCATTCC	0.599													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92821362	92821362	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92821362delT								LOC100129066 (486688 upstream) : DIRAS2 (550752 downstream)																							AGCAGATGGCTTTACATAGCA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	94716239	94716239	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94716239delG								ROR2 (3795 upstream) : SPTLC1 (77181 downstream)																							ACAAGCAGCTGGGTGTGGTCA	0.279													4	2	---	---	---	---	
FBP1	2203	broad.mit.edu	37	9	97390991	97390992	+	Intron	DEL	TC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97390991_97390992delTC	uc004auw.3	-						FBP1_uc010mrl.2_Intron	NM_000507	NP_000498	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1						gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	CATGTGTGAATCAATAGGTGGC	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	97851475	97851476	+	IGR	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97851475_97851476delAG								C9orf3 (2035 upstream) : FANCC (9862 downstream)																							AGAGGCCTCTAGATTCCAGCCT	0.525													4	2	---	---	---	---	
SNX30	401548	broad.mit.edu	37	9	115540439	115540439	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115540439delC	uc004bgj.3	+							NM_001012994	NP_001013012	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30						cell communication|protein transport	cytoplasm	phosphatidylinositol binding				0						tggatgggtacctggagggca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	116058836	116058837	+	IGR	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116058836_116058837delGG								PRPF4 (3782 upstream) : RNF183 (538 downstream)																							GGTTAAAACTGGGGAAACAGAA	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	122725921	122725922	+	IGR	DEL	TC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122725921_122725922delTC								DBC1 (594182 upstream) : MIR147 (281335 downstream)																							tcatgtggggtctcagtttctc	0.168													4	2	---	---	---	---	
LHX6	26468	broad.mit.edu	37	9	124969261	124969261	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124969261delA	uc010mvw.2	-						LHX6_uc004blx.3_Intron|LHX6_uc004bly.3_Intron	NM_014368	NP_055183	Q9UPM6	LHX6_HUMAN	LIM homeobox protein 6 isoform 1						cell maturation|cerebral cortex GABAergic interneuron migration|cerebral cortex radially oriented cell migration|cerebral cortex tangential migration	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						tgggtcctctaaggtcaagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	128163309	128163310	+	IGR	DEL	CT	-	-	rs79376828		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128163309_128163310delCT								GAPVD1 (36020 upstream) : MAPKAP1 (36364 downstream)																							tctgagccccctctctctcctc	0.129													1	5	---	---	---	---	
CERCAM	51148	broad.mit.edu	37	9	131172599	131172599	+	5'Flank	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131172599delT	uc004buy.1	+									Q5T4B2	GT253_HUMAN	RecName: Full=Glycosyltransferase 25 family member 3;          EC=2.-.-.-; AltName: Full=Cerebral endothelial cell adhesion molecule; Flags: Precursor;						cellular component movement|leukocyte cell-cell adhesion|lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen|plasma membrane				pancreas(1)	1						ACTTAAACAGTAACACCAACA	0.254													4	2	---	---	---	---	
USP20	10868	broad.mit.edu	37	9	132601472	132601473	+	Intron	DEL	TA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132601472_132601473delTA	uc004bys.2	+						USP20_uc004byr.2_Intron|USP20_uc004byt.1_Intron	NM_001110303	NP_001103773	Q9Y2K6	UBP20_HUMAN	ubiquitin specific protease 20						endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|ubiquitin thiolesterase activity|zinc ion binding			lung(1)|breast(1)	2		Ovarian(14;0.00556)				cttagccagttattccacttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133441397	133441397	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133441397delC								ASS1 (64737 upstream) : LOC100272217 (11342 downstream)																							TCACAAGCTTCCCCAGCATCA	0.393													4	2	---	---	---	---	
SARDH	1757	broad.mit.edu	37	9	136546007	136546007	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136546007delG	uc004cep.3	-						SARDH_uc004ceo.2_Intron|SARDH_uc011mdn.1_Intron|SARDH_uc011mdo.1_Intron|SARDH_uc004cen.2_Intron	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor						glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GCTCAGTGCTGGGCATCAGGG	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138311284	138311284	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138311284delC								OLFM1 (298253 upstream) : KIAA0649 (60364 downstream)																							TCCCTCCCTTCCCCAGCAGGC	0.562													4	2	---	---	---	---	
UBAC1	10422	broad.mit.edu	37	9	138828034	138828034	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138828034delA	uc004cgt.2	-						UBAC1_uc004cgs.1_Intron|UBAC1_uc004cgu.2_Intron	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1							Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		ttctattaggaaaaaaaaaag	0.194													4	4	---	---	---	---	
NACC2	138151	broad.mit.edu	37	9	138972434	138972434	+	Intron	DEL	T	-	-	rs7044661	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138972434delT	uc004cgw.2	-						NACC2_uc010nbh.2_Intron	NM_144653	NP_653254	Q96BF6	NACC2_HUMAN	BTB (POZ) domain containing 14A						negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization	nuclear body					0						CCTGCTCCAATAAAAAAACTC	0.328													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	139598062	139598062	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139598062delG								AGPAT2 (16151 upstream) : FAM69B (8962 downstream)																							GCTGCTCTAAGGGGGGCTCTG	0.557													4	2	---	---	---	---	
C9orf139	401563	broad.mit.edu	37	9	139924507	139924507	+	Intron	DEL	C	-	-	rs75467572		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139924507delC	uc004ckp.1	+						ABCA2_uc011mel.1_5'Flank|ABCA2_uc011mem.1_5'Flank|ABCA2_uc004ckl.1_5'Flank|ABCA2_uc004ckm.1_5'Flank	NM_207511	NP_997394	Q6ZV77	CI139_HUMAN	hypothetical protein LOC401563												0	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)		GGCGACAGGACCCCCCGTGGG	0.677											OREG0019625	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140290396	140290396	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140290396delT	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_5'Flank|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron|EXD3_uc004cmt.3_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CCTCAGAGTGTTTTTTTTTCT	0.323													6	3	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140572151	140572152	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140572151_140572152delAA	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		TATAATTGACAAAAAGAGTTGG	0.243													4	2	---	---	---	---	
CACNA1B	774	broad.mit.edu	37	9	140847119	140847119	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140847119delA	uc004cog.2	+							NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TGTGGTCTGTAATGGGAGGTT	0.587													4	2	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1620871	1620872	+	Intron	INS	-	AG	AG	rs138276650	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1620871_1620872insAG	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		cacacacacacagagagaagtg	0.243													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	5558633	5558634	+	IGR	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5558633_5558634delGG								CALML5 (17100 upstream) : CALML3 (8290 downstream)																							AAAGTAGGCTGGAACATAGTCT	0.480													4	2	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29916614	29916615	+	Intron	DEL	CT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29916614_29916615delCT	uc001iut.1	-						SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TCTCTGATGCCTCTGGAGTGAA	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30806865	30806866	+	IGR	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30806865_30806866insC								MAP3K8 (56104 upstream) : LYZL2 (93843 downstream)																							caccaaaaccaccccctccacc	0.203													4	2	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32309104	32309104	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32309104delT	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				CTCCTCTGTCTTTCATCTTCC	0.383													4	2	---	---	---	---	
ALOX5	240	broad.mit.edu	37	10	45915705	45915705	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45915705delA	uc001jce.2	+						ALOX5_uc009xmt.2_Intron|ALOX5_uc010qfg.1_Intron	NM_000698	NP_000689	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding			ovary(1)|pancreas(1)	2		Lung SC(717;0.0257)			Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)	ATTGTAAAATAAATTTGTTTG	0.284													4	2	---	---	---	---	
FAM21A	387680	broad.mit.edu	37	10	51866413	51866414	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51866413_51866414delCA	uc001jjb.2	+						FAM21A_uc001jja.1_Intron|FAM21A_uc010qhi.1_Intron|FAM21A_uc010qhj.1_Intron|FAM21B_uc009xoq.2_Intron	NM_001005751	NP_001005751	Q641Q2	FA21A_HUMAN	hypothetical protein LOC387680						retrograde transport, endosome to Golgi	early endosome membrane|WASH complex				ovary(1)	1						TGAATCTCTTCAAAATGGTTAG	0.307													4	2	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	52752337	52752337	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52752337delG	uc001jjm.2	+						PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GGACGCCTCTGGGCTCCTTCC	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	61488496	61488496	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61488496delA								SLC16A9 (18847 upstream) : CCDC6 (60026 downstream)																							atctcattttaaaaactgtgg	0.000													4	2	---	---	---	---	
HKDC1	80201	broad.mit.edu	37	10	70991979	70991979	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70991979delA	uc001jpf.3	+						HKDC1_uc010qje.1_5'Flank	NM_025130	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1						glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity			ovary(4)|skin(1)	5						GCTCTGGCCTAAAAAAATCAG	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71488663	71488664	+	IGR	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71488663_71488664delTG								C10orf35 (95316 upstream) : COL13A1 (72980 downstream)																							AGCAAAGGGATGTGTGTGTGTA	0.564													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78899659	78899659	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78899659delA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	GTAGCCCCTGAAAAAAAAATT	0.398													9	4	---	---	---	---	
LOC283050	283050	broad.mit.edu	37	10	80780537	80780537	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80780537delC	uc001jzz.2	-						LOC283050_uc001jzx.2_Intron|LOC283050_uc001jzy.2_Intron|LOC283050_uc001kab.1_Intron	NR_024431				Homo sapiens cDNA FLJ40604 fis, clone THYMU2011806.												0						tgatctatagcactgcacagg	0.114													4	2	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	80873951	80873951	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80873951delC	uc001kaf.2	+							NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CCAGAAAACACCCCAGTGGAA	0.502													4	2	---	---	---	---	
ANKRD1	27063	broad.mit.edu	37	10	92676188	92676189	+	Intron	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92676188_92676189delTG	uc001khe.1	-							NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein						cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				CTAAATTACAtgtgtgtgtgtg	0.248													6	3	---	---	---	---	
MYOF	26509	broad.mit.edu	37	10	95066953	95066953	+	Intron	DEL	G	-	-	rs60442844		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95066953delG	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc009xue.2_Intron	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						gcacccccccgccaagttgtt	0.005													6	4	---	---	---	---	
PIPSL	266971	broad.mit.edu	37	10	95718422	95718422	+	3'UTR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95718422delT	uc009xuj.2	-	1						NR_002319				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0						tctttctttcttttttttttG	0.164													5	3	---	---	---	---	
TLL2	7093	broad.mit.edu	37	10	98147789	98147789	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98147789delG	uc001kml.1	-							NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor						cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GTTGAACCTAGGAAGAAGAAA	0.428													4	2	---	---	---	---	
SLIT1	6585	broad.mit.edu	37	10	98823081	98823081	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98823081delT	uc001kmw.2	-						SLIT1_uc009xvh.1_Intron	NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor						axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		AGGTGATGGGTGGGGCCAGGT	0.642													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	99599291	99599291	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99599291delG								SFRP5 (67535 upstream) : GOLGA7B (10705 downstream)																							cagagctggtgggggactctt	0.000													4	2	---	---	---	---	
ENTPD7	57089	broad.mit.edu	37	10	101456090	101456090	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101456090delA	uc001kqa.3	+						ENTPD7_uc009xwl.2_Intron	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase							cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		TAGGACTCATAAAGTACAGTA	0.408													4	2	---	---	---	---	
CPN1	1369	broad.mit.edu	37	10	101810166	101810166	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101810166delA	uc001kql.2	-							NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor						proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		acagagctacaaaaaaaggaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	103021841	103021841	+	Intron	DEL	T	-	-	rs66507937		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103021841delT	uc001ksy.1	-											Homo sapiens cDNA FLJ34886 fis, clone NT2NE2016766, weakly similar to Mus musculus nuclear localization signal binding protein (spot-1) mRNA.																		GGGTCTTTACTTTTTTTTTTT	0.328													4	4	---	---	---	---	
DPCD	25911	broad.mit.edu	37	10	103328352	103328353	+	5'Flank	DEL	GC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103328352_103328353delGC	uc010qpz.1	+									Q9BVM2	DPCD_HUMAN	SubName: Full=cDNA FLJ57512;								protein binding			skin(1)	1						TGTCTCCTTTGCAGGCAGAGTT	0.574													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112163203	112163203	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112163203delT								SMNDC1 (98496 upstream) : DUSP5 (94422 downstream)																							tctttctttctttttttttga	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	118635948	118635949	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118635948_118635949delCA	uc001lcw.2	+											SubName: Full=Putative uncharacterized protein C10orf134;																		TGACTCCCTTCACTACGTTCCA	0.480													4	2	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121183331	121183332	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121183331_121183332delAC	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		acacacacatacacacacacaG	0.376													4	2	---	---	---	---	
C10orf119	79892	broad.mit.edu	37	10	121596270	121596292	+	Intron	DEL	TTTTTTTTTTTTTTTTTTTTTTT	-	-	rs66623828		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121596270_121596292delTTTTTTTTTTTTTTTTTTTTTTT	uc001ler.2	-						C10orf119_uc001leq.1_Intron|C10orf119_uc001les.1_Intron	NM_024834	NP_079110	Q9BTE3	MCMBP_HUMAN	chromosome 10 open reading frame 119						cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)		GCAGTCACAGttttttttttttttttttttttttttttttttt	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	123217263	123217263	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123217263delA								WDR11 (548228 upstream) : FGFR2 (20582 downstream)																							AAAGCACTGTAAACATGCCCA	0.458													4	2	---	---	---	---	
FGFR2	2263	broad.mit.edu	37	10	123328146	123328146	+	Intron	DEL	A	-	-	rs72004065		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123328146delA	uc010qtk.1	-						FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Intron|FGFR2_uc010qti.1_Intron|FGFR2_uc010qtj.1_Intron|FGFR2_uc010qtl.1_Intron|FGFR2_uc010qtm.1_Intron|FGFR2_uc001lfl.3_Intron|FGFR2_uc001lfm.2_Intron|FGFR2_uc001lfn.3_Intron|FGFR2_uc010qtn.1_Intron|FGFR2_uc010qto.1_Intron|FGFR2_uc001lfo.1_Intron|FGFR2_uc010qtp.1_Intron|FGFR2_uc010qtq.1_Intron	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1						angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	GGAAAAAAAGAAAAAAAAAAG	0.413		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				4	3	---	---	---	---	
TACC2	10579	broad.mit.edu	37	10	123911190	123911191	+	Intron	INS	-	T	T	rs146685929	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123911190_123911191insT	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron|TACC2_uc001lfx.2_Intron|TACC2_uc001lfy.2_Intron	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				gaggaggagggtgggtggagga	0.069													3	6	---	---	---	---	
BTBD16	118663	broad.mit.edu	37	10	124053681	124053681	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124053681delG	uc001lgc.1	+						BTBD16_uc001lgd.1_Intron	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16											skin(1)	1		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				TAGTTGGGCTGGGTCTTGCCT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	124901146	124901146	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124901146delG								HMX3 (3900 upstream) : HMX2 (6492 downstream)																							TCTCAATTTTGTCTTTTCACC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132014435	132014436	+	IGR	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132014435_132014436delGA								GLRX3 (31651 upstream) : TCERG1L (876220 downstream)																							GAAATAGCCTGAGTGTTCTCCA	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134866802	134866803	+	IGR	INS	-	A	A	rs151023585	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134866802_134866803insA								C10orf93 (110738 upstream) : GPR123 (17630 downstream)																							GATGAAAAGATAGAGTCACGGA	0.495													6	3	---	---	---	---	
RRM1	6240	broad.mit.edu	37	11	4122545	4122546	+	Intron	INS	-	T	T	rs111807668		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4122545_4122546insT	uc001lyw.3	+						RRM1_uc009yeh.1_Intron|RRM1_uc009yei.2_Intron|RRM1_uc010qyc.1_Intron	NM_001033	NP_001024	P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	gattctgtggattttttttttt	0.000													4	2	---	---	---	---	
C11orf16	56673	broad.mit.edu	37	11	8954463	8954463	+	5'UTR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8954463delC	uc001mhb.3	-	1					C11orf16_uc001mhc.3_5'UTR	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN	hypothetical protein LOC56673											upper_aerodigestive_tract(1)|pancreas(1)	2				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		GCCCCAAACTCCCAGCCTCCA	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13095248	13095249	+	IGR	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13095248_13095249delGT								RASSF10 (62601 upstream) : ARNTL (204076 downstream)																							AGTGCCGAGAGTGACCCATGAT	0.589													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13185200	13185200	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13185200delC								RASSF10 (152553 upstream) : ARNTL (114125 downstream)																							cctcctttgacctggaaaact	0.179													4	2	---	---	---	---	
USH1C	10083	broad.mit.edu	37	11	17553419	17553420	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17553419_17553420delCA	uc001mnf.2	-						USH1C_uc001mne.2_Intron|USH1C_uc009yhb.2_Intron|USH1C_uc001mng.2_Intron|USH1C_uc001mnd.2_Intron	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a						equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						GACAATTCCTCACACACTCATC	0.500													4	2	---	---	---	---	
MADD	8567	broad.mit.edu	37	11	47346789	47346791	+	Intron	DEL	TTC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47346789_47346791delTTC	uc001ner.1	+						MADD_uc001neq.2_Intron|MADD_uc001nev.1_Intron|MADD_uc001nes.1_Intron|MADD_uc001net.1_Intron|MADD_uc009yln.1_Intron|MADD_uc001neu.1_Intron|MADD_uc001nex.2_Intron|MADD_uc001nez.2_Intron|MADD_uc001new.2_Intron	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing						activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		ACTTTTTTTTTTCTCTCTTGGTC	0.453													4	2	---	---	---	---	
NDUFS3	4722	broad.mit.edu	37	11	47602712	47602712	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602712delT	uc001nga.2	+						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_3'UTR	NM_004551	NP_004542	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3						induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	ttttgtttaattttttttttt	0.015													4	3	---	---	---	---	
STX3	6809	broad.mit.edu	37	11	59540468	59540469	+	Intron	INS	-	CG	CG			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59540468_59540469insCG	uc001nog.2	+						STX3_uc010rkx.1_Intron|STX3_uc010rky.1_Intron	NM_004177	NP_004168	Q13277	STX3_HUMAN	syntaxin 3						cellular response to oxidative stress|intracellular protein transport|neuron projection development|neurotransmitter transport	apical plasma membrane|azurophil granule|cell-cell junction|growth cone|integral to membrane|plasma membrane enriched fraction|SNARE complex|specific granule	arachidonic acid binding|SNAP receptor activity			ovary(2)	2						acacacacacacacacacacac	0.213													4	2	---	---	---	---	
CD5	921	broad.mit.edu	37	11	60890708	60890710	+	Intron	DEL	TGC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60890708_60890710delTGC	uc009ynk.2	+							NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor						cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		AAATTGCAATTGCTGATTTGTCC	0.527													5	7	---	---	---	---	
TMEM138	51524	broad.mit.edu	37	11	61131644	61131645	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61131644_61131645delAC	uc001nrl.1	+						CYBASC3_uc010rlh.1_5'Flank|CYBASC3_uc001nrg.2_5'Flank|CYBASC3_uc009ynn.2_5'Flank|CYBASC3_uc001nrh.2_5'Flank|CYBASC3_uc001nri.2_5'Flank|CYBASC3_uc001nrk.2_5'Flank|TMEM138_uc010rli.1_Intron|TMEM138_uc001nrm.2_Intron	NM_016464	NP_057548	Q9NPI0	TM138_HUMAN	transmembrane protein 138							integral to membrane					0						ctggagtggtacctggcacaca	0.188													4	2	---	---	---	---	
FTH1	2495	broad.mit.edu	37	11	61737381	61737381	+	5'Flank	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61737381delC	uc001nsu.2	-							NM_002032	NP_002023	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1						cell proliferation|cellular membrane organization|immune response|intracellular sequestering of iron ion|iron ion transport|negative regulation of cell proliferation|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|ferroxidase activity|protein binding			ovary(1)	1					Iron Dextran(DB00893)	attcaaaaagcctagcataaa	0.000													4	2	---	---	---	---	
AHNAK	79026	broad.mit.edu	37	11	62310996	62310997	+	Intron	DEL	CT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62310996_62310997delCT	uc001ntl.2	-						AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1						nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AGTGACCTACCTAAGACTGCCA	0.559											OREG0021025	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	63389798	63389802	+	IGR	DEL	TTTGT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63389798_63389802delTTTGT								PLA2G16 (7857 upstream) : ATL3 (6635 downstream)																							TAATGGATTATTTGTTTTGGTCTGC	0.429													2	4	---	---	---	---	
FERMT3	83706	broad.mit.edu	37	11	63975815	63975815	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63975815delG	uc001nyl.2	+						FERMT3_uc001nym.2_Intron	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form						integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1						AACAGAGAGAGGGTGGTGAAG	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	64267808	64267808	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64267808delC								RPS6KA4 (128122 upstream) : SLC22A11 (55290 downstream)																							TCTAGCCCCACCAGGAGGAGT	0.488													4	2	---	---	---	---	
SUV420H1	51111	broad.mit.edu	37	11	67978508	67978508	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67978508delT	uc001onm.1	-						SUV420H1_uc001onn.1_Intron|SUV420H1_uc009ysf.2_Intron|SUV420H1_uc001ono.1_Intron|SUV420H1_uc001onp.2_Intron|SUV420H1_uc010rqa.1_Intron|SUV420H1_uc001onq.2_Intron	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						AATCTCTTTATCACACAACCT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68635745	68635746	+	IGR	DEL	CT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68635745_68635746delCT								CPT1A (26346 upstream) : MRPL21 (23001 downstream)																							gttttgggggctcaaggcagga	0.000													4	2	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68898575	68898575	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68898575delG	uc001oot.2	+							NM_139075		Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GTTGGCTTGTGGTCCCTGCCG	0.562											OREG0021159	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68935489	68935490	+	IGR	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68935489_68935490delTG								TPCN2 (5582 upstream) : MYEOV (126132 downstream)																							GATCCAGCGATGTGTGTGTGTG	0.579													3	3	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69971957	69971959	+	Intron	DEL	AAC	-	-	rs10792912		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69971957_69971959delAAC	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						ctcaaaaaaaaacaaaaaaagag	0.261													4	2	---	---	---	---	
RELT	84957	broad.mit.edu	37	11	73099635	73099635	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73099635delA	uc001otv.2	+						RELT_uc001otw.2_Intron|RELT_uc009yto.1_5'Flank	NM_152222	NP_689408	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor precursor							cytoplasm|integral to membrane|plasma membrane	binding|receptor activity			upper_aerodigestive_tract(1)	1						TTGAGCTTTGAAGGGTAAAGG	0.587													4	2	---	---	---	---	
MRPL48	51642	broad.mit.edu	37	11	73516339	73516339	+	Intron	DEL	T	-	-	rs11335180		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73516339delT	uc001ouh.3	+						MRPL48_uc009ytt.2_Intron|MRPL48_uc010rri.1_Intron|MRPL48_uc009ytu.2_Intron	NM_016055	NP_057139	Q96GC5	RM48_HUMAN	mitochondrial ribosomal protein L48 precursor						translation	mitochondrial ribosome	protein binding|structural constituent of ribosome				0						gatgctgttcttttttttttt	0.000													6	3	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76881756	76881756	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76881756delC	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						ACTCCCCAGTCCCAGGGgagg	0.328													4	2	---	---	---	---	
INTS4	92105	broad.mit.edu	37	11	77657361	77657361	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77657361delA	uc001oys.2	-						INTS4_uc001oyt.2_Intron|INTS4_uc001oyu.1_Intron	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ctaataccctaaaaccatcta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	93630282	93630282	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93630282delG								C11orf90 (46614 upstream) : HEPHL1 (124096 downstream)																							TGGCCTGTGTGGGGGGATCAG	0.587													4	2	---	---	---	---	
DDX10	1662	broad.mit.edu	37	11	108691560	108691561	+	Intron	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108691560_108691561delTG	uc001pkm.2	+						DDX10_uc001pkl.1_Intron	NM_004398	NP_004389	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10								ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		GCCTAGGGCCTGTGAATCAGTT	0.411			T	NUP98	AML*								4	2	---	---	---	---	
NLRX1	79671	broad.mit.edu	37	11	119049240	119049240	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119049240delG	uc001pvu.2	+						NLRX1_uc010rzc.1_Intron|NLRX1_uc001pvv.2_Intron|NLRX1_uc001pvw.2_Intron|NLRX1_uc001pvx.2_Intron	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1						innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		gcaaatgcctgggaagaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119659389	119659389	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119659389delG								PVRL1 (59954 upstream) : TRIM29 (322606 downstream)																							CTGGCTGCCTGGGCAGAGTGG	0.647													4	2	---	---	---	---	
TRIM29	23650	broad.mit.edu	37	11	119996754	119996755	+	Intron	DEL	TC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119996754_119996755delTC	uc001pwz.2	-						TRIM29_uc001pwy.2_5'Flank|TRIM29_uc010rzi.1_Intron|TRIM29_uc010rzj.1_Intron|TRIM29_uc001pxa.2_Intron	NM_012101	NP_036233	Q14134	TRI29_HUMAN	tripartite motif protein TRIM29						transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		atgaaaaggttcaactaaaagc	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	125026518	125026518	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125026518delA								TMEM218 (45043 upstream) : PKNOX2 (8041 downstream)																							CAAAGCCAAGAAAAAAAAAAT	0.463													6	3	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126324057	126324059	+	Intron	DEL	CTT	-	-	rs72019155		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126324057_126324059delCTT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CTCCTCCCACCTTCTTCTCTTTC	0.335													3	3	---	---	---	---	
SLC6A12	6539	broad.mit.edu	37	12	299436	299436	+	3'UTR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:299436delT	uc001qhz.2	-	17					SLC6A12_uc001qhx.2_3'UTR|SLC6A12_uc001qhy.2_3'UTR|SLC6A12_uc001qia.2_3'UTR|SLC6A12_uc001qib.2_3'UTR|SLC6A12_uc009zdh.1_3'UTR	NM_003044	NP_003035	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter						cellular nitrogen compound metabolic process|neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			ggggtttgcgttagaAGCAGG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	1608700	1608700	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1608700delA								ERC1 (3601 upstream) : FBXL14 (66460 downstream)																							ATGGGACAGGAATGAGGTTTG	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6292425	6292426	+	IGR	DEL	CT	-	-	rs10568270		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6292425_6292426delCT								VWF (58589 upstream) : CD9 (16447 downstream)																							tcccatgtggcttcagagggca	0.094													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	7960616	7960616	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7960616delA								NANOG (11961 upstream) : SLC2A14 (5782 downstream)																							TTAGCTGAGGAAAATTCAGAG	0.478													4	2	---	---	---	---	
LOH12CR1	118426	broad.mit.edu	37	12	12548004	12548005	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12548004_12548005delAA	uc001ral.2	+						LOH12CR1_uc009zhu.2_Intron	NM_058169	NP_477517	Q969J3	L12R1_HUMAN	LOH1CR12											ovary(1)	1		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.0205)		AGCTGAACCTAAAAGGACAGGT	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	42325671	42325672	+	IGR	INS	-	AGTGAATGCGAG	AGTGAATGCGAG	rs149895360	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42325671_42325672insAGTGAATGCGAG								PDZRN4 (357287 upstream) : GXYLT1 (149978 downstream)																							agagaggttgcattgcgccaca	0.059													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	49382355	49382355	+	IGR	DEL	A	-	-	rs147029743		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49382355delA								WNT1 (5960 upstream) : DDN (6578 downstream)																							AAGCCGCAGGAAAAAAAATTA	0.294											OREG0021777	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
RHEBL1	121268	broad.mit.edu	37	12	49463362	49463374	+	Intron	DEL	CCTCCACTCTTCC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49463362_49463374delCCTCCACTCTTCC	uc001rtc.1	-						RHEBL1_uc001rtd.1_Intron|RHEBL1_uc009zlc.1_Intron	NM_144593	NP_653194	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1 precursor						positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding			lung(1)|breast(1)	2						CTCTTCCAATCCTCCACTCTTCCATTCCTCCAC	0.573													5	4	---	---	---	---	
ACVRL1	94	broad.mit.edu	37	12	52305435	52305435	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52305435delG	uc001rzj.2	+						ACVRL1_uc001rzk.2_5'Flank|ACVRL1_uc010snm.1_5'Flank	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	ctggaaacctgggatgtacgc	0.139									Hereditary_Hemorrhagic_Telangiectasia				6	3	---	---	---	---	
NR4A1	3164	broad.mit.edu	37	12	52446408	52446408	+	5'UTR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52446408delC	uc001rzs.2	+	2					NR4A1_uc010sno.1_Intron|NR4A1_uc001rzr.2_Intron|NR4A1_uc009zmb.1_Intron|NR4A1_uc001rzt.2_Intron	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		TGGGACTGCTCCCCCCTCCTG	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	52501562	52501562	+	RNA	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52501562delT	uc009zme.1	+	3		c.961delT								Homo sapiens olfactory receptor, family 7, subfamily E, member 47 pseudogene, mRNA (cDNA clone IMAGE:5590288).																		TTTTGCTGTCTTTTTTTTTTC	0.433													3	4	---	---	---	---	
KRT8	3856	broad.mit.edu	37	12	53291008	53291008	+	3'UTR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53291008delA	uc001sbd.2	-	8					KRT8_uc009zmj.2_3'UTR|KRT8_uc009zmk.1_3'UTR|KRT8_uc009zml.1_3'UTR|KRT8_uc009zmm.1_3'UTR	NM_002273	NP_002264	P05787	K2C8_HUMAN	keratin 8						cytoskeleton organization|interspecies interaction between organisms	cytoplasm|keratin filament|nuclear matrix|nucleoplasm	protein binding|structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.108)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATTTTGGACCAAAAAAAAAAA	0.532													3	4	---	---	---	---	
ZNF385A	25946	broad.mit.edu	37	12	54773962	54773962	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54773962delC	uc001sfw.1	-						ZNF385A_uc001sfv.1_5'Flank|ZNF385A_uc009zno.1_Intron|ZNF385A_uc010sov.1_Intron|ZNF385A_uc001sfx.1_Intron|ZNF385A_uc001sfy.3_Intron|ZNF385A_uc001sfz.3_Intron	NM_015481	NP_056296	Q96PM9	Z385A_HUMAN	zinc finger protein 385A isoform c						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1						AGGTGCCAGTCCACTGGGAAA	0.368													4	2	---	---	---	---	
ERBB3	2065	broad.mit.edu	37	12	56493246	56493246	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56493246delT	uc001sjh.2	+						ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Intron|ERBB3_uc009zok.2_Intron|ERBB3_uc001sjk.2_Intron|ERBB3_uc001sjl.2_Intron	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor						cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			gcccagctaatttttttttgt	0.000													4	2	---	---	---	---	
SMARCC2	6601	broad.mit.edu	37	12	56564203	56564203	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56564203delT	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			ATAACACCTGtttttttttgt	0.035													4	2	---	---	---	---	
C12orf61	283416	broad.mit.edu	37	12	62996480	62996480	+	3'UTR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62996480delC	uc001sri.1	-	1					MIRLET7I_hsa-let-7i|MI0000434_5'Flank|uc001srj.1_5'Flank	NM_175895	NP_787091	Q8N7H1	CL061_HUMAN	hypothetical protein LOC283416												0			BRCA - Breast invasive adenocarcinoma(9;0.0399)	GBM - Glioblastoma multiforme(28;0.134)		TTTCTGGTAGCACGCTGACGC	0.547													4	2	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79288630	79288630	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79288630delA	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						attgtacatcatgatgactgt	0.000													11	5	---	---	---	---	
NDUFA12	55967	broad.mit.edu	37	12	95377544	95377546	+	Intron	DEL	CTT	-	-	rs151241895		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95377544_95377546delCTT	uc001tdl.2	-							NM_018838	NP_061326	Q9UI09	NDUAC_HUMAN	13kDa differentiation-associated protein						respiratory electron transport chain|respiratory gaseous exchange|response to oxidative stress|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0					NADH(DB00157)	cttacaacagcttcttaagtgag	0.039													3	3	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104026455	104026455	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104026455delG	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						gagcatccctgaacagaccct	0.000											OREG0022065	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	107695502	107695503	+	IGR	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107695502_107695503insA								CRY1 (207904 upstream) : BTBD11 (16694 downstream)																							cagccctttataaaaaaatctt	0.084													4	2	---	---	---	---	
KCTD10	83892	broad.mit.edu	37	12	109888159	109888161	+	3'UTR	DEL	GCC	-	-	rs142955162		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109888159_109888161delGCC	uc001toi.1	-	7					KCTD10_uc001toh.1_RNA|KCTD10_uc009zvi.1_3'UTR|KCTD10_uc001toj.1_3'UTR|KCTD10_uc001tok.1_3'UTR	NM_031954	NP_114160	Q9H3F6	BACD3_HUMAN	potassium channel tetramerisation domain						proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|nucleus|voltage-gated potassium channel complex	voltage-gated potassium channel activity				0						TCCAGCAGGGGCCGCCACCTGTG	0.571													6	3	---	---	---	---	
ALDH2	217	broad.mit.edu	37	12	112246509	112246509	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112246509delA	uc001tst.2	+						ALDH2_uc010syi.1_Intron|ALDH2_uc009zvy.2_Intron	NM_000690	NP_000681	P05091	ALDH2_HUMAN	mitochondrial aldehyde dehydrogenase 2						carbohydrate metabolic process|ethanol oxidation|neurotransmitter biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase|electron carrier activity			skin(2)|ovary(1)|central_nervous_system(1)	4					Disulfiram(DB00822)|Guanidine(DB00536)|NADH(DB00157)|Nitroglycerin(DB00727)	actccgtctcaaaaaaaaaaa	0.000			T	HMGA2	leiomyoma								4	2	---	---	---	---	
C12orf49	79794	broad.mit.edu	37	12	117175431	117175432	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117175431_117175432delAA	uc001tvz.1	-						RNFT2_uc009zwn.2_5'Flank|RNFT2_uc001twb.3_5'Flank|RNFT2_uc001twa.3_5'Flank|C12orf49_uc009zwm.1_Intron	NM_024738	NP_079014	Q9H741	CL049_HUMAN	hypothetical protein LOC79794 precursor							extracellular region				ovary(1)	1	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0281)		gaagggaaggaaggaggaagga	0.000													4	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	118274293	118274293	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118274293delG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCCAGACAGAGGCAAAAGCAC	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121405195	121405195	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121405195delT								SPPL3 (63044 upstream) : C12orf27 (2446 downstream)																							tggaatctgattttttttaac	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121528694	121528695	+	5'Flank	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121528694_121528695delGG	uc001tzl.2	+											DQ570466																		CTGAGTGCATGGAAGATCCTTC	0.495													4	2	---	---	---	---	
ANAPC5	51433	broad.mit.edu	37	12	121758413	121758413	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121758413delT	uc001uag.2	-						ANAPC5_uc010szu.1_Intron|ANAPC5_uc001uae.2_Intron|ANAPC5_uc010szv.1_Intron|ANAPC5_uc001uaf.2_Intron|ANAPC5_uc001uah.2_Intron|ANAPC5_uc001uai.1_Intron	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					cttttctttcttttttttttt	0.214													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	122503434	122503434	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122503434delT								BCL7A (3486 upstream) : MLXIP (13326 downstream)																							cgaagggtggtttagagcagg	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128803899	128803900	+	IGR	INS	-	GA	GA	rs142814007	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128803899_128803900insGA								None (None upstream) : TMEM132C (95391 downstream)																							TTTGCAGTCCCgagagagagag	0.411													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130622415	130622415	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130622415delA								LOC100190940 (95528 upstream) : FZD10 (24617 downstream)																							ATGGGGAGGTAAAAAAGGAGG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130625145	130625145	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130625145delT								LOC100190940 (98258 upstream) : FZD10 (21887 downstream)																							GCTAGATGGCTTTTCTAACAT	0.308													4	2	---	---	---	---	
LOC116437	116437	broad.mit.edu	37	12	131649998	131649998	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131649998delC	uc001uiw.2	+							NR_026670				Homo sapiens mRNA; cDNA DKFZp434L2430 (from clone DKFZp434L2430).												0						actttctccacccccaacctg	0.040													4	2	---	---	---	---	
GALNT9	50614	broad.mit.edu	37	12	132852497	132852497	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132852497delC	uc001ukc.3	-						GALNT9_uc001ukb.2_Intron|GALNT9_uc009zys.2_Intron|uc001ukd.1_5'Flank|LOC100130238_uc010tbp.1_Intron	NM_001122636	NP_001116108	Q9HCQ5	GALT9_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide						protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		GGAGCTGGATCCCAGGCCACC	0.433													4	2	---	---	---	---	
FBRSL1	57666	broad.mit.edu	37	12	133108076	133108076	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133108076delG	uc001ukf.2	+							NM_001142641	NP_001136113	Q9HCM7	FBSL_HUMAN	fibrosin-like 1											central_nervous_system(2)	2						TGGGCTGCATGGGGCTGTGCG	0.368													4	2	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	25025986	25025986	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25025986delG	uc001upl.2	-							NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ATGTAGGGGTGTTAGCCTCTC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	25327008	25327008	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25327008delC								ATP12A (41091 upstream) : RNF17 (11293 downstream)																							ttagccatttcccattaccag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27396268	27396268	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27396268delG								GPR12 (61346 upstream) : USP12 (246170 downstream)																							gtgcttcagtgggtcctgcaa	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	28323136	28323136	+	IGR	DEL	C	-	-	rs78592942	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28323136delC								POLR1D (81589 upstream) : GSX1 (43644 downstream)																							gtctaactgaccccagagccc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	35122297	35122297	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35122297delC								RFC3 (581603 upstream) : NBEA (394159 downstream)																							CCAAAGATTTCCATGAGCCTT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	49137972	49137972	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49137972delC								RCBTB2 (27854 upstream) : CYSLTR2 (89893 downstream)																							caccctgactcccagcttcct	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	68477286	68477286	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68477286delC								PCDH9 (672818 upstream) : None (None downstream)																							ATTCAAAGCGCCCTCTGGAGG	0.517													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	82712920	82712920	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82712920delA								None (None upstream) : None (None downstream)																							aggaaccttgaactccccagc	0.000													4	2	---	---	---	---	
CLDN10	9071	broad.mit.edu	37	13	96128822	96128822	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96128822delG	uc001vmg.2	+						CLDN10_uc010tii.1_Intron	NM_182848	NP_878268	P78369	CLD10_HUMAN	claudin 10 isoform a						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			gaattttggagggacacagat	0.204													4	2	---	---	---	---	
FARP1	10160	broad.mit.edu	37	13	98993408	98993409	+	Intron	INS	-	G	G	rs66470261		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98993408_98993409insG	uc001vnj.2	+						FARP1_uc001vnh.2_Intron	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TAAAAAAAAAAAAGTACTTAAT	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101704094	101704094	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101704094delA								TMTC4 (376991 upstream) : NALCN (2036 downstream)																							GATGAATAAGAAATAGAGGAA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	111604151	111604152	+	IGR	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111604151_111604152delGG								ANKRD10 (36735 upstream) : ARHGEF7 (163472 downstream)																							TTAAGAACATGGAAAAAATGGG	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112220395	112220396	+	IGR	DEL	AT	-	-	rs67112505		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112220395_112220396delAT								C13orf16 (223802 upstream) : SOX1 (501517 downstream)																							GTATCTTTCAATACACACTGGA	0.520													3	8	---	---	---	---	
ATP11A	23250	broad.mit.edu	37	13	113342723	113342724	+	5'Flank	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113342723_113342724delCA	uc001vsi.3	+						ATP11A_uc001vsj.3_5'Flank	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				ATCCCACAGTCACGGTTTACAA	0.332													4	2	---	---	---	---	
GRTP1	79774	broad.mit.edu	37	13	114000255	114000255	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114000255delG	uc001vtn.2	-						GRTP1_uc010tkb.1_Intron|GRTP1_uc010tkc.1_Intron	NM_024719	NP_078995	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1							intracellular	Rab GTPase activator activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			CGGAAATGCTGGGAAGACCTC	0.532													4	2	---	---	---	---	
TFDP1	7027	broad.mit.edu	37	13	114280250	114280250	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114280250delT	uc001vtw.2	+						TFDP1_uc010tkd.1_Intron|TFDP1_uc010tke.1_Intron|TFDP1_uc001vty.3_Intron|TFDP1_uc010agx.2_Intron	NM_007111	NP_009042	Q14186	TFDP1_HUMAN	transcription factor Dp-1						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			lung(4)|ovary(2)|skin(1)	7	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			TCCTCAGGTGTTTCTCAGGCG	0.587										TSP Lung(29;0.18)			4	2	---	---	---	---	
GAS6	2621	broad.mit.edu	37	13	114526947	114526947	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114526947delC	uc001vud.2	-						GAS6_uc001vug.2_Intron|GAS6_uc001vuf.2_Intron	NM_000820	NP_000811	Q14393	GAS6_HUMAN	growth arrest-specific 6 isoform 1 precursor						cell proliferation|leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|post-translational protein modification|proteolysis|regulation of growth	endoplasmic reticulum lumen|extracellular space|Golgi lumen|platelet alpha granule lumen	calcium ion binding|receptor agonist activity			central_nervous_system(4)	4	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				GGTAGCAGCACAGGGCCCAGT	0.612													4	2	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114810960	114810961	+	Intron	DEL	GC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114810960_114810961delGC	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron|RASA3_uc010tkl.1_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ACACAACTGAGCAAGAGCTGCC	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20253702	20253702	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20253702delG								OR4M1 (4280 upstream) : OR4N2 (41906 downstream)																							GACTGGTGGTGGGGCTGCAGA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23571083	23571083	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23571083delC	uc010aki.1	-	8	1104	c.1056delG	c.(1054-1056)GGGfs	p.G352fs						Homo sapiens cDNA clone IMAGE:40134016.																		AGGAGCCAGTCCCACATGTGG	0.512													4	2	---	---	---	---	
FAM71D	161142	broad.mit.edu	37	14	67692213	67692214	+	Intron	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67692213_67692214insA	uc001xja.1	+						FAM71D_uc010aqn.1_Intron	NM_173526	NP_775797	Q8N9W8	FA71D_HUMAN	hypothetical protein LOC161142											ovary(1)	1		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		AGGTGAGGCACTGGAAGAGAAT	0.441													4	2	---	---	---	---	
ZFYVE26	23503	broad.mit.edu	37	14	68216140	68216140	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68216140delC	uc001xka.2	-						ZFYVE26_uc010tsz.1_Intron	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26						cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCTCATGAATCCCCAGCTTGG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	77525100	77525100	+	Intron	DEL	A	-	-	rs113373883		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77525100delA	uc001xsz.2	-											Homo sapiens cDNA clone IMAGE:5271982.																		GGCAAATTAGAAAAAAAAAAA	0.299													7	4	---	---	---	---	
CCDC88C	440193	broad.mit.edu	37	14	91882829	91882830	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91882829_91882830delAC	uc010aty.2	-						CCDC88C_uc010twk.1_Intron|CCDC88C_uc001xzl.3_Intron	NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE						microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				TGCACTATCTACACCACGTAAA	0.426													4	2	---	---	---	---	
RIN3	79890	broad.mit.edu	37	14	92986355	92986355	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92986355delG	uc001yap.2	+						RIN3_uc010auk.2_Intron	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3						endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				GGTAGGGGTTGGAGGGACTGC	0.562													4	2	---	---	---	---	
ITPK1	3705	broad.mit.edu	37	14	93567080	93567081	+	Intron	DEL	CT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93567080_93567081delCT	uc001ybg.2	-						ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Intron|ITPK1_uc001ybh.2_Intron	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		ACCCCTGTGGCTCTAGGAATCA	0.500													4	2	---	---	---	---	
IFI27L1	122509	broad.mit.edu	37	14	94564963	94564963	+	Intron	DEL	A	-	-	rs34261085		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94564963delA	uc001ycl.2	+						IFI27L1_uc001yck.2_Intron	NM_206949	NP_996832	Q96BM0	I27L1_HUMAN	interferon, alpha-inducible protein 27-like 1							integral to membrane					0						cacccctgtcaagacactgct	0.000													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98630798	98630800	+	IGR	DEL	ACA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98630798_98630800delACA								C14orf64 (186337 upstream) : C14orf177 (547150 downstream)																							CAGACTCCCCacaacaacaacaa	0.340													4	2	---	---	---	---	
BCL11B	64919	broad.mit.edu	37	14	99727851	99727851	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99727851delG	uc001yga.2	-						BCL11B_uc001ygb.2_Intron	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1							nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		ACCCAGAGACGAAAAAGCACC	0.552			T	TLX3	T-ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101930375	101930376	+	IGR	DEL	CA	-	-	rs34175788		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101930375_101930376delCA								MIR656 (397237 upstream) : DIO3OS (88184 downstream)																							GCCCTGATGTcacacacacaca	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	104813247	104813247	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104813247delT								KIF26A (166013 upstream) : C14orf180 (232809 downstream)																							ggccACACtctttttttttag	0.055													4	2	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105710852	105710853	+	Intron	INS	-	GG	GG	rs111274758	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105710852_105710853insGG	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axj.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		GTGGAGGAGGAAGTGGTGGGCA	0.416													3	3	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105710853	105710854	+	Intron	INS	-	G	G	rs75139030	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105710853_105710854insG	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axj.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		TGGAGGAGGAAGTGGTGGGCAG	0.416													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106993545	106993545	+	Intron	DEL	A	-	-	rs34821324		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106993545delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TCCTGTTTTTAAAAAAAAAAA	0.393													2	4	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107173684	107173685	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107173684_107173685delAA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ttcacattctaaagggaattaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20965571	20965571	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20965571delC								BCL8 (4091 upstream) : POTEB (75130 downstream)																							TTAAACAAGGCCCACTGTTGC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	29911805	29911805	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29911805delA								FAM189A1 (48878 upstream) : TJP1 (80554 downstream)																							CACAGTACTGAAAAGTGCCTG	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	30769766	30769766	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30769766delT	uc001zeh.1	+											Homo sapiens cDNA clone IMAGE:4804281.																		TGAAAGTAGGTTTTTTTTTCC	0.363													4	2	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	31815593	31815593	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31815593delT	uc001zfq.2	-						OTUD7A_uc001zfr.2_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GAGGAAGTGCTTTTTTTGGGT	0.597													4	2	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	34046969	34046970	+	Intron	INS	-	G	G	rs138029527	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34046969_34046970insG	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATTTTGTTTTTTCTGTTTACAG	0.272													2	4	---	---	---	---	
PAK6	56924	broad.mit.edu	37	15	40537659	40537659	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40537659delC	uc010bbl.2	+						PAK6_uc010bbm.2_Intron|PAK6_uc001zky.3_Intron|PAK6_uc010bbn.2_Intron	NM_001128628	NP_001122100	Q9NQU5	PAK6_HUMAN	p21-activated kinase 6								ATP binding|protein binding|protein serine/threonine kinase activity			lung(5)|large_intestine(1)|ovary(1)|skin(1)	8		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		GCTCTAGCCTCCATTTTCTTT	0.537													4	2	---	---	---	---	
LOC729082	729082	broad.mit.edu	37	15	41576683	41576683	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41576683delT	uc001znm.3	+						LOC729082_uc001znn.1_Intron	NR_026757				Homo sapiens cDNA FLJ26241 fis, clone DMC00738.												0						TCGTTCCCCCTCTTTGCCCGT	0.478													4	2	---	---	---	---	
NDUFAF1	51103	broad.mit.edu	37	15	41695430	41695430	+	5'Flank	DEL	C	-	-	rs56283962		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41695430delC	uc001znx.2	-						NDUFAF1_uc010bcf.2_5'Flank	NM_016013	NP_057097	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|protein complex assembly	mitochondrial respiratory chain complex I	unfolded protein binding			ovary(1)	1		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		TCGCCCCACACGGTCGCCAGT	0.458													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	42886254	42886258	+	Intron	DEL	GCCCT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42886254_42886258delGCCCT	uc001zqg.2	+											Homo sapiens cDNA FLJ16106 fis, clone THYMU1000496, moderately similar to KINESIN-LIKE PROTEIN KIF1C.																		ATGTCAAGGAGCCCTgagagagagt	0.244													4	2	---	---	---	---	
TGM5	9333	broad.mit.edu	37	15	43541395	43541395	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43541395delC	uc001zrd.1	-						TGM5_uc001zre.1_Intron	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1						epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	CCACTTCCAACCCCAGGCAGT	0.413													4	2	---	---	---	---	
MYO5C	55930	broad.mit.edu	37	15	52530461	52530461	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52530461delG	uc010bff.2	-						MYO5C_uc010uga.1_Intron|MYO5C_uc010ugb.1_Intron	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		gtgatactttgctatgacagt	0.219													4	2	---	---	---	---	
PRTG	283659	broad.mit.edu	37	15	55916371	55916371	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55916371delC	uc002adg.2	-							NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor						multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		TCACCTTTTTCCCCCTAAATA	0.269													4	2	---	---	---	---	
TEX9	374618	broad.mit.edu	37	15	56683760	56683760	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56683760delG	uc002adp.2	+						TEX9_uc002ado.1_Intron|TEX9_uc010ugl.1_Intron|TEX9_uc002adq.1_Intron	NM_198524	NP_940926	Q8N6V9	TEX9_HUMAN	testis expressed 9												0				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		atgtggtggagggaggaatga	0.075													4	2	---	---	---	---	
GCOM1	145781	broad.mit.edu	37	15	57975156	57975156	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57975156delC	uc002aei.2	+						GCOM1_uc002aej.2_Intron|GCOM1_uc002aek.2_Intron|GCOM1_uc002ael.2_Intron|GCOM1_uc002aem.2_Intron|GCOM1_uc002aeq.2_Intron|GCOM1_uc002aen.2_Intron|GCOM1_uc010bfy.2_Intron|GCOM1_uc002aeo.2_Intron|GCOM1_uc002aep.2_Intron|GCOM1_uc010bfx.2_Intron|GCOM1_uc002aer.1_Intron|GRINL1A_uc002aes.2_Intron	NM_001018100	NP_001018110	P0CAP1	GCOM1_HUMAN	GRINL1A upstream protein isoform 7						intracellular signal transduction	extrinsic to internal side of plasma membrane|I band				ovary(1)	1						CCTCAATTTTCCCATCATGTG	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62544601	62544604	+	5'Flank	DEL	CCTT	-	-	rs2611795	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62544601_62544604delCCTT	uc002akj.2	+						uc010uhs.1_5'Flank|uc002akl.1_5'Flank|uc002akm.2_5'Flank|uc002ako.1_5'Flank|uc002akp.2_5'Flank|uc010uht.1_5'Flank|uc002akq.2_5'Flank|uc010uhu.1_5'Flank|uc002akr.2_5'Flank|uc010uhv.1_5'Flank					DQ588475																		CCCCACCATCCCTTCCTCCCAAGC	0.466													5	6	---	---	---	---	
ZNF609	23060	broad.mit.edu	37	15	64950070	64950070	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64950070delT	uc002ann.2	+							NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						TATTTACTTCTTTTTTTTTTA	0.333													4	2	---	---	---	---	
SMAD3	4088	broad.mit.edu	37	15	67360695	67360695	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67360695delT	uc002aqj.2	+							NM_005902	NP_005893	P84022	SMAD3_HUMAN	mothers against decapentaplegic homolog 3						activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		CCTGTGGATCTTTGTATGTGC	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	68853865	68853865	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68853865delC								ITGA11 (129373 upstream) : CORO2B (17708 downstream)																							GGAAACCAGGCCTGCCCCTCC	0.602													4	2	---	---	---	---	
HCN4	10021	broad.mit.edu	37	15	73638023	73638024	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73638023_73638024delCA	uc002avp.2	-							NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic						blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		TATCCCCATTCACACACACAGT	0.465													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78155847	78155847	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78155847delG								LINGO1 (167372 upstream) : LOC645752 (50712 downstream)																							gcctggtgctgggcatacagc	0.269													4	2	---	---	---	---	
RASGRF1	5923	broad.mit.edu	37	15	79317324	79317324	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79317324delA	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						acatacacacaaacacacaca	0.204													4	2	---	---	---	---	
FANCI	55215	broad.mit.edu	37	15	89789333	89789333	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89789333delT	uc010bnp.1	+						FANCI_uc002bnm.1_Intron|FANCI_uc002bnn.1_Intron|FANCI_uc002bno.2_Intron	NM_001113378	NP_001106849	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I isoform						cell cycle|DNA repair	nucleoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)					gatggtaccatttatggagac	0.114								Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
LOC254559	254559	broad.mit.edu	37	15	89932350	89932351	+	Intron	DEL	GT	-	-	rs10533346		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89932350_89932351delGT	uc002bnt.2	+						LOC254559_uc002bnv.2_Intron|LOC254559_uc002bnw.2_Intron					Homo sapiens cDNA FLJ30148 fis, clone BRACE2000267.												0						CAGGAGAtgcgtgtgtgtgtgt	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90825347	90825347	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90825347delT								TTLL13 (9904 upstream) : GABARAPL3 (64418 downstream)																							AAAGGTTTTGTTTTTTTTTTG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93961250	93961250	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93961250delC	uc002bsu.1	+						uc002bsx.1_5'Flank|uc002bsy.2_5'Flank|uc002bta.1_RNA					Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																		GTAAAGCTCTCCCTCCCAGGG	0.512													4	2	---	---	---	---	
ADAMTS17	170691	broad.mit.edu	37	15	100630597	100630597	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100630597delG	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CCTTGGCATTGGGATCACCGA	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102312241	102312241	+	RNA	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102312241delA	uc010utk.1	+	1		c.34delA			uc010utl.1_5'Flank|uc010utm.1_5'Flank|uc002ccq.3_5'Flank|uc010utn.1_5'Flank|uc002ccs.1_5'Flank|uc010uto.1_5'Flank|uc002cct.1_5'Flank|uc002ccu.2_5'Flank|uc002ccv.1_5'Flank|uc002ccw.2_5'Flank					DQ593367																		AGTGGCCGGGAAATTTGCTGT	0.592													8	5	---	---	---	---	
CASKIN1	57524	broad.mit.edu	37	16	2227425	2227425	+	3'UTR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2227425delT	uc010bsg.1	-	20					TRAF7_uc002cow.2_3'UTR	NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1						signal transduction	cytoplasm				skin(2)	2						attttttaaatttttttttta	0.547													4	4	---	---	---	---	
LOC342346	342346	broad.mit.edu	37	16	4621857	4621857	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4621857delT	uc010uxn.1	+							NM_001145011	NP_001138483	C9JH24	C9JH24_HUMAN	hypothetical protein LOC342346												0						ttttcttttcttttttttttt	0.254													5	4	---	---	---	---	
LOC342346	342346	broad.mit.edu	37	16	4629239	4629239	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4629239delC	uc010uxn.1	+							NM_001145011	NP_001138483	C9JH24	C9JH24_HUMAN	hypothetical protein LOC342346												0						CTACACGGTTCTGTGTCTCAG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8629623	8629624	+	IGR	DEL	CT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8629623_8629624delCT								TMEM114 (7397 upstream) : C16orf68 (85903 downstream)																							cacatcatcgctcaaaagcctc	0.035													4	2	---	---	---	---	
USP7	7874	broad.mit.edu	37	16	9018168	9018168	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9018168delA	uc002czl.2	-						USP7_uc010uyk.1_Intron|USP7_uc010uyj.1_Intron|USP7_uc002czk.2_Intron|USP7_uc010uyl.1_Intron	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7						interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						CAATACTTTTATAAAGCATCA	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	11588704	11588704	+	IGR	DEL	A	-	-	rs113986793		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11588704delA								C16orf75 (143087 upstream) : LITAF (52878 downstream)																							tcacctgggcaacttcataat	0.219													4	2	---	---	---	---	
CPPED1	55313	broad.mit.edu	37	16	12765296	12765296	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12765296delA	uc002dca.3	-						CPPED1_uc002dcb.3_Intron|CPPED1_uc002dbz.3_Intron	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain								hydrolase activity|metal ion binding				0						AAGGGGAGAGAAAAAAAAAGG	0.478													4	2	---	---	---	---	
C16orf45	89927	broad.mit.edu	37	16	15551442	15551444	+	Intron	DEL	ACG	-	-	rs114061254	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15551442_15551444delACG	uc002ddo.2	+							NM_033201	NP_149978	Q96MC5	CP045_HUMAN	hypothetical protein LOC89927 isoform 1											ovary(1)	1						ctctccctccacgtgcccagcca	0.197													4	2	---	---	---	---	
MYH11	4629	broad.mit.edu	37	16	15939579	15939579	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15939579delG	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron|MYH11_uc002deb.3_Intron	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						gagagagagagaaaaagaagg	0.279			T	CBFB	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16480918	16480919	+	5'Flank	DEL	TG	-	-	rs143034672		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16480918_16480919delTG	uc010vag.1	+							NM_178541	NP_848636			hypothetical protein LOC339047																		TGTCATTCTTtgtgtgtgtgtg	0.035													1	5	---	---	---	---	
NOMO2	283820	broad.mit.edu	37	16	18562508	18562508	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18562508delA	uc002dfe.2	-						NOMO2_uc002dff.2_Intron|NOMO2_uc010bvx.2_Intron	NM_001004060	NP_001004060	Q5JPE7	NOMO2_HUMAN	nodal modulator 2 isoform 1							endoplasmic reticulum membrane|integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			skin(1)	1						aataaaaaataaaaaaataaa	0.234													4	2	---	---	---	---	
GPR139	124274	broad.mit.edu	37	16	20084575	20084578	+	Intron	DEL	CACA	-	-	rs72044205		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20084575_20084578delCACA	uc002dgu.1	-						GPR139_uc010vaw.1_Intron	NM_001002911	NP_001002911	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139							integral to membrane|plasma membrane				ovary(2)	2						TCACAGTCATcacacacacacaca	0.461													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22928789	22928789	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22928789delG								HS3ST2 (1132 upstream) : USP31 (143940 downstream)																							CTGCATTTCTGGGGGATGCTT	0.433													4	2	---	---	---	---	
SCNN1B	6338	broad.mit.edu	37	16	23390421	23390421	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23390421delC	uc002dln.2	+							NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta						excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	acccattcatccctccatcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26523780	26523781	+	IGR	DEL	TG	-	-	rs10539097		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26523780_26523781delTG								HS3ST4 (374772 upstream) : C16orf82 (554438 downstream)																							GGGATTTTGATGTGTGTGTGTG	0.342													4	2	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27988219	27988219	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27988219delT	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						GCAACATTTCTCCACTCTAAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28099435	28099435	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28099435delA								GSG1L (24605 upstream) : XPO6 (9881 downstream)																							acagctacacaggttgttcac	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29166379	29166380	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29166379_29166380delCA	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		cacgcgcgcgcacacacacaca	0.104													6	3	---	---	---	---	
GDPD3	79153	broad.mit.edu	37	16	30119362	30119363	+	Intron	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30119362_30119363delGT	uc002dwp.2	-						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|GDPD3_uc002dwq.2_Intron	NM_024307	NP_077283	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0						gtgtgtgttcgtgtgtgtgtgt	0.020													3	3	---	---	---	---	
BCL7C	9274	broad.mit.edu	37	16	30877499	30877499	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30877499delG	uc002dzt.1	-							NM_004765	NP_004756	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C						apoptosis						0			Colorectal(24;0.198)			GAGTGATGGAGGAGTTGGCAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32191048	32191049	+	Intron	INS	-	ACTG	ACTG			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32191048_32191049insACTG	uc010vfv.1	-											Homo sapiens cDNA FLJ60890 complete cds, moderately similar to HECT domain and RCC1-like domain-containing protein 2.																		GTAGCATACAAACTGTATAAAT	0.327													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32480842	32480842	+	IGR	DEL	T	-	-	rs112323562		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32480842delT								HERC2P4 (316968 upstream) : TP53TG3B (203999 downstream)																							ttcccaccacttttttccaag	0.040													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	50541663	50541664	+	IGR	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50541663_50541664delAG								BRD7 (138834 upstream) : NKD1 (40577 downstream)																							GCCTGGAGCTAGGACTCTCTCC	0.450													4	2	---	---	---	---	
NOD2	64127	broad.mit.edu	37	16	50743839	50743839	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50743839delG	uc002egm.1	+						NOD2_uc010cbk.1_Intron|NOD2_uc002egl.1_Intron|NOD2_uc010cbl.1_5'Flank|NOD2_uc010cbm.1_5'Flank|NOD2_uc010cbn.1_5'Flank|NOD2_uc010cbo.1_5'Flank|NOD2_uc010cbp.1_5'Flank|NOD2_uc010cbq.1_5'Flank|NOD2_uc010cbr.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain						activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				ggtgtatattgtccccatttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54355292	54355292	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54355292delT								IRX3 (34914 upstream) : IRX5 (609819 downstream)																							CAGAGCAGCCTTTTTGCTTAG	0.423													4	2	---	---	---	---	
CCL22	6367	broad.mit.edu	37	16	57392508	57392508	+	5'Flank	DEL	G	-	-	rs41411344	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57392508delG	uc002elh.2	+							NM_002990	NP_002981	O00626	CCL22_HUMAN	small inducible cytokine A22 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|response to virus|signal transduction	extracellular space	chemokine activity				0						ACAGAGTTGAGGGGGGGTCCC	0.473													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	58679808	58679809	+	IGR	DEL	CT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58679808_58679809delCT								CNOT1 (16058 upstream) : SLC38A7 (20489 downstream)																							CAGAGCCATACTCAGAACCTCA	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	65952767	65952767	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65952767delG								LOC283867 (342564 upstream) : CDH5 (447758 downstream)																							TCCTTTCCATGGGCTCTGGCT	0.443													4	2	---	---	---	---	
COG8	84342	broad.mit.edu	37	16	69369375	69369376	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69369375_69369376delAA	uc002ewy.2	-						COG8_uc002ewz.3_Intron	NM_032382	NP_115758	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8						protein transport	Golgi membrane|Golgi transport complex				ovary(1)	1						GTAATTTCCTAAAGCTGATGCC	0.371													4	2	---	---	---	---	
DDX19A	55308	broad.mit.edu	37	16	70399235	70399236	+	Intron	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70399235_70399236insA	uc002eyv.2	+						DDX19B_uc010vly.1_Intron|DDX19A_uc002eys.2_Intron|DDX19A_uc010cfq.1_Intron|DDX19A_uc010cfr.2_Intron|DDX19A_uc010cfs.2_Intron|DDX19A_uc010vlz.1_Intron|DDX19A_uc010vma.1_Intron	NM_018332	NP_060802	Q9NUU7	DD19A_HUMAN	DDX19-like protein						mRNA transport|protein transport|transmembrane transport	cytoplasm|nuclear membrane|nuclear pore	ATP binding|ATP-dependent helicase activity|RNA binding				0		Ovarian(137;0.221)				TTCGGTTGATTAAAAAAAAAAA	0.371													8	4	---	---	---	---	
VAC14	55697	broad.mit.edu	37	16	70796004	70796004	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70796004delT	uc002ezm.2	-						VAC14_uc010cfw.2_Intron|VAC14_uc002ezn.2_Intron|uc002ezp.1_Intron	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog						interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				CTAAAGTGAGttttttttttt	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75824893	75824893	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75824893delG								TERF2IP (133565 upstream) : CNTNAP4 (486283 downstream)																							caagtggggtggggactcctg	0.194													4	2	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81215098	81215098	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81215098delA	uc002fgh.1	-						PKD1L2_uc002fgg.1_5'Flank|PKD1L2_uc002fgi.2_5'Flank|PKD1L2_uc002fgj.2_Intron|PKD1L2_uc002fgl.1_5'Flank	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gctggttgctaaaaagatggc	0.000													4	2	---	---	---	---	
PLCG2	5336	broad.mit.edu	37	16	81941531	81941553	+	Intron	DEL	CTGGCTGGCTTGTCTCTGATTGG	-	-	rs58979839		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81941531_81941553delCTGGCTGGCTTGTCTCTGATTGG	uc002fgt.2	+						PLCG2_uc010chg.1_Intron	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2						intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						GTACCATGTCCTGGCTGGCTTGTCTCTGATTGGCTGGCTGCCC	0.578													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83171170	83171170	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83171170delT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CAGACAACGCTTTTTTTTGTT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	83968696	83968697	+	IGR	INS	-	GACA	GACA	rs150971160	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83968696_83968697insGACA								MLYCD (18911 upstream) : OSGIN1 (13975 downstream)																							agagagcagaggacaccctgcc	0.064													2	5	---	---	---	---	
BANP	54971	broad.mit.edu	37	16	88012971	88012971	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88012971delG	uc002fkr.2	+						BANP_uc002fkp.2_Intron|BANP_uc002fkq.2_Intron|BANP_uc010vow.1_Intron|BANP_uc002fks.3_Intron|BANP_uc002fko.1_Intron|BANP_uc010vov.1_Intron	NM_079837	NP_524576	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein isoform b						cell cycle|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GTAAGGTGCTGGGAGGGTGGT	0.577													4	2	---	---	---	---	
CHMP1A	5119	broad.mit.edu	37	16	89718313	89718313	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89718313delT	uc002fnu.2	-						CHMP1A_uc002fnv.2_Intron	NM_002768	NP_002759	Q9HD42	CHM1A_HUMAN	chromatin modifying protein 1A isoform 2						cell division|gene silencing|mitotic chromosome condensation|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription by glucose|protein transport|transcription, DNA-dependent|vesicle-mediated transport	condensed nuclear chromosome|early endosome|endomembrane system|endosome membrane|microtubule organizing center|nuclear matrix	metallopeptidase activity|protein domain specific binding|zinc ion binding				0		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		CCAGTGTCTGTCTTCTCTGTG	0.587													4	2	---	---	---	---	
SPIRE2	84501	broad.mit.edu	37	16	89909834	89909835	+	Intron	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89909834_89909835insG	uc002foz.1	+						SPIRE2_uc010civ.1_Intron|SPIRE2_uc010ciw.1_Intron	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2						transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		ACTCGGACTGTGGTTCTCTAAG	0.545													6	3	---	---	---	---	
DOC2B	8447	broad.mit.edu	37	17	25469	25470	+	Intron	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25469_25470delGT	uc010vpx.1	-							NM_003585	NP_003576	Q14184	DOC2B_HUMAN	double C2-like domains, beta						calcium ion-dependent exocytosis of neurotransmitter|positive regulation of calcium ion-dependent exocytosis|positive regulation of insulin secretion|positive regulation of vesicle fusion|protein localization	plasma membrane|synaptic vesicle	calcium-dependent phospholipid binding|transporter activity				0						CTGGGATCTGGTGTGACACCCA	0.441													4	2	---	---	---	---	
SERPINF1	5176	broad.mit.edu	37	17	1662794	1662794	+	5'Flank	DEL	A	-	-	rs76161952		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1662794delA	uc002ftl.2	+						SERPINF1_uc010cjw.2_5'Flank	NM_002615	NP_002606	P36955	PEDF_HUMAN	serine (or cysteine) proteinase inhibitor, clade						cell proliferation|negative regulation of angiogenesis|positive regulation of neurogenesis|regulation of proteolysis	extracellular space|melanosome	serine-type endopeptidase inhibitor activity			ovary(1)	1						actccgtctcaaaaaaaaaag	0.244													5	3	---	---	---	---	
SPNS3	201305	broad.mit.edu	37	17	4341955	4341955	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4341955delT	uc002fxt.2	+						SPNS3_uc002fxu.2_Intron	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3						lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1						CACGTTCGTCTTTTTATGTAC	0.517													4	2	---	---	---	---	
ZMYND15	84225	broad.mit.edu	37	17	4644575	4644575	+	Intron	DEL	T	-	-	rs112302834		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4644575delT	uc002fyt.2	+						CXCL16_uc002fyr.3_5'Flank|CXCL16_uc002fys.3_5'Flank|ZMYND15_uc002fyv.2_Intron|ZMYND15_uc002fyu.2_Intron	NM_032265	NP_115641	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15 isoform 2								zinc ion binding				0						cacagtggggttttttttttt	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	5109688	5109688	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5109688delT	uc002gbf.1	+						uc002gbg.1_Intron					Homo sapiens cDNA FLJ11816 fis, clone HEMBA1006416.																		TCCTTAtttcttttttttttt	0.159													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	5505385	5505385	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5505385delT								NLRP1 (17553 upstream) : WSCD1 (467052 downstream)																							tccccacctcttttttttttt	0.060													2	4	---	---	---	---	
ASGR1	432	broad.mit.edu	37	17	7077932	7077933	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7077932_7077933delAC	uc002ges.3	-						ASGR1_uc010clx.1_Intron	NM_001671	NP_001662	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1						receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding			breast(1)|central_nervous_system(1)	2						AGACCCCCATacacacacacac	0.302													4	2	---	---	---	---	
NTN1	9423	broad.mit.edu	37	17	8957953	8957954	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8957953_8957954delGA	uc002glw.3	+							NM_004822	NP_004813	O95631	NET1_HUMAN	netrin 1 precursor						apoptosis|axon guidance		protein binding				0						GTGGGAGAATGAGAAGACATGC	0.480													4	2	---	---	---	---	
USP43	124739	broad.mit.edu	37	17	9628226	9628226	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9628226delG	uc010cod.2	+						USP43_uc002gma.3_Intron|USP43_uc010vva.1_Intron|USP43_uc010coe.2_Intron|USP43_uc002gmc.3_Intron	NM_153210	NP_694942	Q70EL4	UBP43_HUMAN	ubiquitin specific protease 43						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						TGCTCAACTAGGAAAAGTCTT	0.423													4	2	---	---	---	---	
PIRT	644139	broad.mit.edu	37	17	10735516	10735516	+	Intron	DEL	T	-	-	rs67459916		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10735516delT	uc010col.2	-							NM_001101387	NP_001094857	P0C851	PIRT_HUMAN	phosphoinositide-interacting regulator of							integral to membrane				ovary(1)	1						gttctgattcttttttttttt	0.000													3	3	---	---	---	---	
PIRT	644139	broad.mit.edu	37	17	10742104	10742104	+	5'Flank	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10742104delA	uc010col.2	-							NM_001101387	NP_001094857	P0C851	PIRT_HUMAN	phosphoinositide-interacting regulator of							integral to membrane				ovary(1)	1						aaggaggatgaaaaggttttc	0.000													4	2	---	---	---	---	
FAM18B2	201158	broad.mit.edu	37	17	15408294	15408294	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15408294delA	uc002goq.2	-						CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron	NM_145301	NP_660344	Q96ET8	F18B2_HUMAN	hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)		AGGGTCCAATAAAACCGCTGT	0.468													4	2	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	15961519	15961519	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15961519delA	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpl.2_5'UTR|NCOR1_uc002gpm.2_Intron|NCOR1_uc010vwb.1_Intron|NCOR1_uc010coy.2_Intron|NCOR1_uc010vwc.1_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AATTTTGGAGAAAAAAAAAAT	0.284													3	3	---	---	---	---	
C17orf76	388341	broad.mit.edu	37	17	16392428	16392428	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16392428delT	uc010cph.1	-						C17orf76_uc002gqh.2_Intron	NM_001113567	NP_001107039	Q8NAA5	CQ076_HUMAN	hypothetical protein LOC388341 isoform 1												0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)		tgtgtgtagctttttcagagc	0.149													4	3	---	---	---	---	
SLC5A10	125206	broad.mit.edu	37	17	18914153	18914153	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18914153delC	uc002guu.1	+						SLC5A10_uc002gur.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron	NM_001042450	NP_001035915	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/glucose						sodium ion transport|transmembrane transport	integral to membrane	transporter activity			ovary(1)	1						CCGACTGTGTCCCCCAGGCAA	0.567													4	2	---	---	---	---	
CYTSB	92521	broad.mit.edu	37	17	20052567	20052568	+	Intron	DEL	GC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20052567_20052568delGC	uc002gwq.2	+						CYTSB_uc010cqx.2_Intron|CYTSB_uc002gwr.2_Intron|CYTSB_uc002gws.2_Intron	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						tggtttcTCtgcagaaaagggt	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20957964	20957965	+	IGR	DEL	AT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20957964_20957965delAT								USP22 (10891 upstream) : DHRS7B (72293 downstream)																							CCCCTTCACCATACAGTGCAAC	0.525													4	2	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21315322	21315323	+	Intron	DEL	TT	-	-	rs35614271		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21315322_21315323delTT	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CTGGGGAGGGTTTCTCTCTCTC	0.515										Prostate(3;0.18)			5	3	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	32480318	32480318	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32480318delG	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	CGCACTTAAAGAAAGAAGTCA	0.423													4	2	---	---	---	---	
AP2B1	163	broad.mit.edu	37	17	33925548	33925549	+	Intron	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33925548_33925549delGT	uc002hjr.2	+						AP2B1_uc002hjq.2_Intron|AP2B1_uc010wci.1_Intron|AP2B1_uc002hjs.2_Intron|AP2B1_uc002hjt.2_Intron|AP2B1_uc010ctv.2_Intron	NM_001282	NP_001273	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TTGTTATGGGGTGTGTGTGTGT	0.376													6	3	---	---	---	---	
CCL18	6362	broad.mit.edu	37	17	34397174	34397174	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34397174delC	uc002hku.2	+							NM_002988	NP_002979	P55774	CCL18_HUMAN	small inducible cytokine A18 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|response to biotic stimulus|signal transduction	extracellular space	chemokine activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AGGCCCTCTGCCCCCAGGCCC	0.587													4	2	---	---	---	---	
GGNBP2	79893	broad.mit.edu	37	17	34942797	34942798	+	Intron	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34942797_34942798delAG	uc002hnb.2	+							NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GGTTGGGGGCAGAGAGAGATGT	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35255775	35255776	+	IGR	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35255775_35255776delAA								MRM1 (290369 upstream) : LHX1 (38723 downstream)																							TCAGCTCTGTAATAACTTTTAG	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35419877	35419878	+	IGR	INS	-	CC	CC	rs145445935	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35419877_35419878insCC								AATF (5707 upstream) : ACACA (22050 downstream)																							GGGAAAGCCAGCCCCCCCGCTC	0.515													4	3	---	---	---	---	
SRCIN1	80725	broad.mit.edu	37	17	36726601	36726602	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36726601_36726602delCA	uc002hqd.2	-						SRCIN1_uc002hqe.2_Intron|SRCIN1_uc002hqh.1_Intron	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein						exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						TGATGGCATTCACACTCACCCT	0.540													4	2	---	---	---	---	
RARA	5914	broad.mit.edu	37	17	38494149	38494149	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38494149delC	uc002huk.1	+						RARA_uc002hul.3_Intron|RARA_uc010wfe.1_Intron	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1						apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	GGAGGGACAGCCCAGGCGGAG	0.572			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								4	2	---	---	---	---	
KRT13	3860	broad.mit.edu	37	17	39662027	39662028	+	5'Flank	INS	-	T	T	rs72133811		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39662027_39662028insT	uc002hwu.1	-						KRT13_uc002hwv.1_5'Flank|KRT13_uc002hww.2_5'Flank|KRT13_uc010wfr.1_5'Flank|KRT13_uc010cxo.2_5'Flank|KRT13_uc002hwx.1_5'Flank	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a						epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				TTGGGGGTGGCTTTTTTTTTAA	0.465													4	3	---	---	---	---	
DBF4B	80174	broad.mit.edu	37	17	42818501	42818501	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42818501delA	uc002ihf.2	+						DBF4B_uc010wjb.1_Intron|DBF4B_uc002ihe.2_Intron|DBF4B_uc010wjc.1_Intron	NM_145663	NP_663696	Q8NFT6	DBF4B_HUMAN	DBF4 homolog B isoform 1						cell cycle	nucleus	nucleic acid binding|zinc ion binding				0		Prostate(33;0.0322)				actctgtctcaaaaaaaaaaa	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47456071	47456071	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47456071delG								ZNF652 (16236 upstream) : PHB (25349 downstream)																							AAATGCAAGTGAAGGTCTCAA	0.428													4	2	---	---	---	---	
SCN4A	6329	broad.mit.edu	37	17	62044289	62044289	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62044289delA	uc002jds.1	-							NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha						muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	cctaatttgcaagaaggcgct	0.378													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64113534	64113534	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64113534delA	uc002jfl.2	-						CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			GCACAAGACCAAAAAAAAAAT	0.294													1	5	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67170656	67170657	+	Intron	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67170656_67170657insC	uc010dfa.1	-						ABCA10_uc010wqs.1_Intron|ABCA10_uc010wqt.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TGCATATTACATGCCTTTTGCT	0.337													4	2	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67235346	67235347	+	Intron	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67235346_67235347delGT	uc010dfa.1	-							NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					gggttggtcagtgtgaatgtga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72196603	72196603	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72196603delC								C17orf54 (371927 upstream) : RPL38 (3192 downstream)																							CCAAGCCCAGCCCGATGTTCA	0.478													3	3	---	---	---	---	
ST6GALNAC2	10610	broad.mit.edu	37	17	74566389	74566390	+	Intron	DEL	CC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74566389_74566390delCC	uc002jsg.3	-							NM_006456	NP_006447	Q9UJ37	SIA7B_HUMAN	sialyltransferase 7B						protein glycosylation	integral to Golgi membrane	sialyltransferase activity				0						AGCTGCCTCTCCCACCCCCAGC	0.629													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79445272	79445273	+	IGR	INS	-	G	G	rs141462773	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79445272_79445273insG								BAHCC1 (11914 upstream) : ACTG1 (31726 downstream)																							gcagtgagcacgggcagcattg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79456744	79456745	+	IGR	DEL	CT	-	-	rs147834287		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79456744_79456745delCT								BAHCC1 (23386 upstream) : ACTG1 (20254 downstream)																							CCCAGGAGGCCTCTCTCAGCAT	0.545													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79468626	79468627	+	IGR	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79468626_79468627insA								BAHCC1 (35268 upstream) : ACTG1 (8372 downstream)																							agaccctgtccaaaaaaagaaa	0.040													4	2	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80519348	80519349	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80519348_80519349delAA	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			atcgggcggtaaagagaggagg	0.094													4	2	---	---	---	---	
B3GNTL1	146712	broad.mit.edu	37	17	81008681	81008683	+	Intron	DEL	GGA	-	-	rs10609454		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81008681_81008683delGGA	uc002kgg.1	-						B3GNTL1_uc002kgf.1_5'Flank	NM_001009905	NP_001009905	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			gtgtgggcacggaggaggtgtgc	0.217													5	5	---	---	---	---	
FAM38B	63895	broad.mit.edu	37	18	10854067	10854067	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10854067delT	uc002kow.1	-									Q9H5I5	PIEZ2_HUMAN	RecName: Full=Uncharacterized protein C18orf58;							integral to membrane	ion channel activity			ovary(1)	1						tccatgctgatttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11569344	11569344	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11569344delG								FAM38B (867365 upstream) : GNAL (119792 downstream)																							CTGGTACACAGGGGCAGTGAA	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	12033402	12033403	+	IGR	INS	-	CCACA	CCACA	rs139760767	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12033402_12033403insCCACA								IMPA2 (2526 upstream) : CIDEA (220915 downstream)																							GGATTGATGTTCAGGTAGCTGT	0.515													6	3	---	---	---	---	
NPC1	4864	broad.mit.edu	37	18	21117034	21117034	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21117034delC	uc002kum.3	-						NPC1_uc010xaz.1_Intron	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor						autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGACTGGCttctttttttttt	0.254													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33334684	33334684	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33334684delA								GALNT1 (42887 upstream) : MIR187 (150097 downstream)																							CTAGGCCCTCATCACATGTGC	0.562													4	2	---	---	---	---	
LIPG	9388	broad.mit.edu	37	18	47090005	47090005	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47090005delG	uc002ldv.2	+						LIPG_uc002ldu.1_Intron|LIPG_uc010xdh.1_Intron	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor						cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						gcatgttggtgggggaaggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	47249620	47249620	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47249620delT								LIPG (130344 upstream) : ACAA2 (60255 downstream)																							TGGTGTGGGATGAGCTGTCAT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	62595368	62595369	+	IGR	INS	-	AGAC	AGAC	rs145630449	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62595368_62595369insAGAC								C18orf20 (779108 upstream) : CDH7 (822119 downstream)																							tggagtcacttagcataactgt	0.000													5	3	---	---	---	---	
TSHZ1	10194	broad.mit.edu	37	18	72991673	72991673	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72991673delC	uc002lly.2	+							NM_005786	NP_005777	Q6ZSZ6	TSH1_HUMAN	teashirt family zinc finger 1							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GGTTCCAAATCCCCTTTCATT	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	74478085	74478086	+	IGR	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74478085_74478086delAC								LOC284276 (206302 upstream) : ZNF236 (58030 downstream)																							agacacacagacacacacacac	0.238													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75617945	75617946	+	IGR	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75617945_75617946delGG								GALR1 (635851 upstream) : None (None downstream)																							GGCAAAACTTGGGATGTGAGCA	0.639													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	1324743	1324743	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1324743delT								EFNA2 (24799 upstream) : MUM1 (30233 downstream)																							ACAGTGAAGCTTTGGAGGAAA	0.557													4	2	---	---	---	---	
GNG7	2788	broad.mit.edu	37	19	2629020	2629021	+	Intron	DEL	TG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2629020_2629021delTG	uc002lwd.2	-							NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		tgcctaGGACTGTAGCTGTAAA	0.203													4	2	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3034685	3034686	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3034685_3034686delAC	uc010dti.2	-							NM_001144761	NP_001138233	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATACGCGCGTacacacacacac	0.198													4	3	---	---	---	---	
PIP5K1C	23396	broad.mit.edu	37	19	3688826	3688826	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3688826delG	uc002lyj.1	-						PIP5K1C_uc010xhq.1_Intron|PIP5K1C_uc010xhr.1_Intron	NM_012398	NP_036530	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						axon guidance	cytosol|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			stomach(2)|skin(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		ACGTCGCCATGGCCCCCCACC	0.522													4	2	---	---	---	---	
SAFB2	9667	broad.mit.edu	37	19	5599608	5599608	+	Intron	DEL	T	-	-	rs3080631		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5599608delT	uc002mcd.2	-							NM_014649	NP_055464	Q14151	SAFB2_HUMAN	scaffold attachment factor B2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding				0				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		AGTTGGCTTATTTTTTTTTGC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8257784	8257785	+	IGR	INS	-	A	A			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8257784_8257785insA								FBN3 (45403 upstream) : LASS4 (16432 downstream)																							TCTTTTTAAAGAAAAAAACTGA	0.089													4	2	---	---	---	---	
ZNF699	374879	broad.mit.edu	37	19	9408812	9408812	+	Intron	DEL	T	-	-	rs144670815		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9408812delT	uc002mlc.1	-							NM_198535	NP_940937	Q32M78	ZN699_HUMAN	zinc finger protein 699						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						aatttatttattttttttttt	0.184													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9506373	9506373	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9506373delG								ZNF177 (13509 upstream) : ZNF266 (16899 downstream)																							GAAGGTCCGTGGGATTGCTCA	0.502													4	2	---	---	---	---	
DOCK6	57572	broad.mit.edu	37	19	11340398	11340398	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11340398delG	uc002mqs.3	-						DOCK6_uc010xlq.1_Intron	NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						GTGTGGGTATGGGAGAAGAAC	0.323													4	2	---	---	---	---	
CNN1	1264	broad.mit.edu	37	19	11654730	11654730	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11654730delA	uc002msc.1	+						CNN1_uc010xmb.1_Intron|CNN1_uc010xmc.1_Intron	NM_001299	NP_001290	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle						actomyosin structure organization|regulation of smooth muscle contraction	cytoskeleton	actin binding|calmodulin binding				0						aaagtataagaaaaaaaaaaa	0.095													5	3	---	---	---	---	
ZNF20	7568	broad.mit.edu	37	19	12258787	12258787	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12258787delT	uc002mtg.1	-						ZNF625_uc010dyn.1_Intron|ZNF625_uc002mth.2_Intron|ZNF625_uc010dyo.1_5'Flank	NM_021143	NP_066966	P17024	ZNF20_HUMAN	zinc finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAAGAAAttctttttttttaa	0.179													4	2	---	---	---	---	
ZNF44	51710	broad.mit.edu	37	19	12406873	12406873	+	5'Flank	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12406873delT	uc010xmj.1	-						ZNF44_uc002mtl.2_5'Flank|ZNF44_uc010dyr.1_5'Flank|ZNF44_uc010xmi.1_5'Flank|ZNF44_uc002mtn.3_5'Flank|ZNF44_uc010dys.2_5'Flank|ZNF44_uc002mto.2_5'Flank	NM_001164276	NP_001157748	P15621	ZNF44_HUMAN	zinc finger protein 44 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		gggagctcggtttttggagac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14353019	14353019	+	IGR	DEL	A	-	-	rs76601520		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14353019delA								LPHN1 (36022 upstream) : CD97 (139194 downstream)																							actccgtctcaaaaaaaaaaa	0.194													2	4	---	---	---	---	
CD97	976	broad.mit.edu	37	19	14509141	14509142	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14509141_14509142delCA	uc002myl.2	+						CD97_uc002mym.2_Intron|CD97_uc002myn.2_Intron	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor						cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						cacacgcatgcacacacacaca	0.079													4	2	---	---	---	---	
BRD4	23476	broad.mit.edu	37	19	15354400	15354401	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15354400_15354401delAC	uc002nar.2	-							NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long						interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GTGCTCTCCTACTGGCCTCCCT	0.594			T	NUT|C15orf55	lethal midline carcinoma of young people								4	2	---	---	---	---	
ZNF708	7562	broad.mit.edu	37	19	21491776	21491776	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21491776delA	uc002npq.1	-						ZNF708_uc002npr.1_Intron|ZNF708_uc010ecs.1_Intron	NM_021269	NP_067092	P17019	ZN708_HUMAN	zinc finger protein 708						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6						AAAACAATGGAAAAAAAAAGT	0.169													4	2	---	---	---	---	
ZNF43	7594	broad.mit.edu	37	19	22009807	22009807	+	Intron	DEL	A	-	-	rs78773989	byFrequency	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22009807delA	uc002nqj.2	-						ZNF43_uc010ecv.2_Intron|ZNF43_uc002nql.2_Intron|ZNF43_uc002nqm.2_Intron|ZNF43_uc002nqk.2_Intron	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		CTGTATTGAGAAAAAAAAAAA	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30549423	30549423	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30549423delG								C19orf2 (42812 upstream) : ZNF536 (313905 downstream)																							GTTGAGAGCTGGGCTGAAGGA	0.493													4	2	---	---	---	---	
WDR62	284403	broad.mit.edu	37	19	36587621	36587621	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36587621delA	uc002odc.2	+						WDR62_uc002odd.2_Intron	NM_173636	NP_775907	O43379	WDR62_HUMAN	WD repeat domain 62 isoform 2						cerebral cortex development	nucleus					0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			tcaaaaaaagaaaaaaaaaga	0.000													6	3	---	---	---	---	
TBCB	1155	broad.mit.edu	37	19	36612003	36612003	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36612003delG	uc002odg.1	+						TBCB_uc002odh.1_Intron	NM_001281	NP_001272	Q99426	TBCB_HUMAN	cytoskeleton associated protein 1						'de novo' posttranslational protein folding|cell differentiation|nervous system development	cytoplasm|microtubule	protein binding				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AGGGTCAGATGGGGGCATGGG	0.388													4	2	---	---	---	---	
ZFP30	22835	broad.mit.edu	37	19	38135818	38135818	+	Intron	DEL	A	-	-	rs34274239		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38135818delA	uc002ogv.1	-						ZFP30_uc002ogw.1_Intron|ZFP30_uc002ogx.1_Intron|ZFP30_uc010xtt.1_Intron	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			aacttgtctcaaaaaaaaagg	0.000													5	5	---	---	---	---	
AKT2	208	broad.mit.edu	37	19	40779599	40779600	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40779599_40779600delCA	uc002onf.2	-						AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			CCTGCCACCCCACACACACACC	0.569			A		ovarian|pancreatic 								4	2	---	---	---	---	
NUMBL	9253	broad.mit.edu	37	19	41194875	41194876	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41194875_41194876delCA	uc002oon.2	-						NUMBL_uc010xvq.1_Intron|NUMBL_uc002ooo.2_Intron|NUMBL_uc010xvr.1_Intron	NM_004756	NP_004747	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like						cytokine-mediated signaling pathway|lateral ventricle development|neuroblast division in subventricular zone|protein metabolic process	cytoplasm	protein binding			lung(3)|ovary(1)|breast(1)	5			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			CAACCCCAGTCACACAGATACA	0.431													4	2	---	---	---	---	
CEACAM7	1087	broad.mit.edu	37	19	42190102	42190102	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42190102delC	uc002ori.1	-						CEACAM7_uc010ehx.2_Intron|CEACAM7_uc010ehy.1_Intron	NM_006890	NP_008821	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion							anchored to membrane|integral to membrane|plasma membrane				ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		CAGAAACTTTCTTCTTCTTTT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42664014	42664014	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42664014delC								POU2F2 (27384 upstream) : DEDD2 (38738 downstream)																							ctgagccatgcccagGATCAC	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42779436	42779437	+	IGR	DEL	CC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42779436_42779437delCC								ERF (20127 upstream) : CIC (9380 downstream)																							accactgtgtccagtAAACATC	0.307													4	2	---	---	---	---	
PSG6	5675	broad.mit.edu	37	19	43545124	43545124	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43545124delT	uc002ovi.2	-						PSG10_uc002ouv.1_Intron|PSG6_uc010xwk.1_Intron			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				GTTATGTGGATTTGGGCTGGC	0.532													4	2	---	---	---	---	
ZNF225	7768	broad.mit.edu	37	19	44622974	44622974	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44622974delT	uc002oyj.1	+						ZNF225_uc010eje.1_Intron|ZNF225_uc010ejf.1_Intron	NM_013362	NP_037494	Q9UK10	ZN225_HUMAN	zinc finger protein 225						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)|all_neural(266;0.202)				ttctggcttcttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45074272	45074272	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45074272delA								CEACAM22P (14122 upstream) : PVR (72826 downstream)																							gcattgagacaaccagagaac	0.065											OREG0025539	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CEACAM19	56971	broad.mit.edu	37	19	45184003	45184003	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45184003delC	uc002ozo.3	+						CEACAM19_uc002ozp.3_Intron	NM_020219	NP_064604	Q7Z692	CEA19_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane					0	Lung NSC(12;0.00308)|all_lung(12;0.00806)	Prostate(69;0.0376)				ctccatggctcccctgtgccc	0.095													4	2	---	---	---	---	
GLTSCR1	29998	broad.mit.edu	37	19	48197640	48197640	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48197640delC	uc002phh.3	+	8	2746	c.2552delC	c.(2551-2553)GCCfs	p.A851fs	GLTSCR1_uc002phi.3_Frame_Shift_Del_p.A609fs	NM_015711	NP_056526	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	851							protein binding			pancreas(3)	3		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		AGCAACCCGGCCCCTACTGCC	0.726													22	10	---	---	---	---	
SPHK2	56848	broad.mit.edu	37	19	49124033	49124034	+	Intron	INS	-	GG	GG			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49124033_49124034insGG	uc002pjr.2	+						RPL18_uc002pjp.1_5'Flank|RPL18_uc002pjq.1_5'Flank|RPL18_uc010xzs.1_5'Flank|SPHK2_uc010xzt.1_Intron|SPHK2_uc002pjs.2_Intron|SPHK2_uc002pjt.2_Intron	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		atacaaaaattagccaggcatg	0.000													4	3	---	---	---	---	
SPHK2	56848	broad.mit.edu	37	19	49124034	49124035	+	Intron	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49124034_49124035insG	uc002pjr.2	+						RPL18_uc002pjp.1_5'Flank|RPL18_uc002pjq.1_5'Flank|RPL18_uc010xzs.1_5'Flank|SPHK2_uc010xzt.1_Intron|SPHK2_uc002pjs.2_Intron|SPHK2_uc002pjt.2_Intron	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		tacaaaaattagccaggcatgg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51713435	51713435	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51713435delA								SIGLECP3 (36661 upstream) : CD33 (14900 downstream)																							TAAGCCCCATAAAAAAATTGC	0.348													4	2	---	---	---	---	
ZNF808	388558	broad.mit.edu	37	19	53035995	53035996	+	Intron	INS	-	GCC	GCC	rs77897069		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53035995_53035996insGCC	uc010epq.1	+						ZNF808_uc002pzq.2_Intron	NM_001039886	NP_001034975	Q8N4W9	ZN808_HUMAN	zinc finger protein 808						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		GTAAAGTATTTATTAAGTATTT	0.307													2	4	---	---	---	---	
ZNF808	388558	broad.mit.edu	37	19	53035999	53036001	+	Intron	DEL	AAG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53035999_53036001delAAG	uc010epq.1	+						ZNF808_uc002pzq.2_Intron	NM_001039886	NP_001034975	Q8N4W9	ZN808_HUMAN	zinc finger protein 808						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		AGTATTTATTAAGTATTTATTAA	0.305													2	4	---	---	---	---	
CACNG7	59284	broad.mit.edu	37	19	54429054	54429055	+	Intron	DEL	AT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54429054_54429055delAT	uc002qcr.1	+						CACNG7_uc010era.1_Intron	NM_031896	NP_114102	P62955	CCG7_HUMAN	voltage-dependent calcium channel gamma-7						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(1)	1	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		gccgtagcagataaggtctgtg	0.000													4	2	---	---	---	---	
RDH13	112724	broad.mit.edu	37	19	55573586	55573587	+	Intron	INS	-	GGT	GGT	rs146463466	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55573586_55573587insGGT	uc002qio.3	-						RDH13_uc002qip.2_Intron|RDH13_uc010yfq.1_Intron	NM_001145971	NP_001139443	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 isoform 1								binding|oxidoreductase activity			large_intestine(1)|ovary(1)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	gacccctctacggagtcacgac	0.213													9	4	---	---	---	---	
ZNF264	9422	broad.mit.edu	37	19	57722572	57722572	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57722572delA	uc002qob.2	+							NM_003417	NP_003408	O43296	ZN264_HUMAN	zinc finger protein 264						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		ACCAGGATAGAAAGAAATTGC	0.423													4	2	---	---	---	---	
ZSCAN22	342945	broad.mit.edu	37	19	58851380	58851381	+	3'UTR	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58851380_58851381delCA	uc002qsc.2	+	3					ZSCAN22_uc010yhz.1_3'UTR	NM_181846	NP_862829	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		atctgtaattcacctccttttc	0.000													4	2	---	---	---	---	
FKBP1A	2280	broad.mit.edu	37	20	1364944	1364944	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1364944delG	uc002wey.2	-						FKBP1A_uc010gac.2_Intron|FKBP1A_uc002wez.2_Intron|FKBP1A_uc010gad.2_Intron|FKBP1A_uc002wfa.2_Intron|FKBP1A_uc002wfb.2_Intron|FKBP1A_uc010gae.2_Intron|FKBP1A_uc010gaf.2_Intron	NM_000801	NP_000792	P62942	FKB1A_HUMAN	FK506 binding protein 1A, 12kDa						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	tcctgggaaagactcaataaa	0.000													3	4	---	---	---	---	
SIGLEC1	6614	broad.mit.edu	37	20	3688448	3688448	+	5'Flank	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3688448delG	uc002wja.2	-						SIGLEC1_uc002wiz.3_5'Flank|SIGLEC1_uc002wjc.2_5'Flank	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor						cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						GACCCACTCTGGGGGCAGTTC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	3806411	3806411	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3806411delA								C20orf29 (457 upstream) : MAVS (21038 downstream)																							tactgcctttagtcagtggtt	0.000													4	2	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8815863	8815864	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8815863_8815864delGA	uc002wnb.2	+						PLCB1_uc002wna.2_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						ctggcttgttgaacaatgaggc	0.094													4	2	---	---	---	---	
JAG1	182	broad.mit.edu	37	20	10641593	10641593	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10641593delG	uc002wnw.2	-							NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor						angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						AGCATAACCTGGGACCACACC	0.537									Alagille_Syndrome				4	2	---	---	---	---	
PCSK2	5126	broad.mit.edu	37	20	17437280	17437281	+	Intron	DEL	AC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17437280_17437281delAC	uc002wpm.2	+						PCSK2_uc002wpl.2_Intron|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2						enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GCGTGTGCATACACACACACAC	0.510													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19059321	19059322	+	IGR	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19059321_19059322delGT								C20orf79 (264288 upstream) : SLC24A3 (133968 downstream)																							accagctgaggtcatcttggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24321310	24321310	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24321310delC								GGTLC1 (351894 upstream) : TMEM90B (128525 downstream)																							attgatgcatcccaggcatct	0.090													4	2	---	---	---	---	
TMEM90B	79953	broad.mit.edu	37	20	24474269	24474270	+	Intron	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24474269_24474270delCA	uc002wtw.1	+							NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						ctggttttgtcactgctctgtc	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31142274	31142275	+	Intron	DEL	GA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31142274_31142275delGA	uc002wxx.2	-											SubName: Full=LOC284804 protein; Flags: Fragment;																		CCAAGAGAAGGAGGCCCCTGTC	0.520													4	2	---	---	---	---	
MMP24	10893	broad.mit.edu	37	20	33824328	33824328	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33824328delG	uc002xbu.2	+						EDEM2_uc010zuv.1_Intron	NM_006690	NP_006681	Q9Y5R2	MMP24_HUMAN	matrix metalloproteinase 24 preproprotein						proteolysis	integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00252)			TCAGTTATATGGGTAGAGGAG	0.458													4	2	---	---	---	---	
EPB41L1	2036	broad.mit.edu	37	20	34791437	34791438	+	Intron	DEL	AG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34791437_34791438delAG	uc002xfb.2	+						EPB41L1_uc002xeu.2_Intron|EPB41L1_uc010zvo.1_Intron|EPB41L1_uc002xev.2_Intron|EPB41L1_uc002xew.2_Intron|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Intron|EPB41L1_uc010gfq.2_Intron	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1						cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)					GTTGCTAGTTAGAATTGGGGCA	0.470											OREG0025901	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
C20orf111	51526	broad.mit.edu	37	20	42838252	42838253	+	Intron	INS	-	CTTT	CTTT	rs141342158	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42838252_42838253insCTTT	uc002xlk.2	-						uc002xll.2_5'Flank|uc002xlm.2_5'Flank|uc002xln.2_5'Flank	NM_016470	NP_057554	Q9NX31	CT111_HUMAN	oxidative stress responsive 1												0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			ATTCGAAGTTAAAGTCAAATCA	0.371													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46614299	46614302	+	IGR	DEL	TCTC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46614299_46614302delTCTC								SULF2 (198939 upstream) : LOC284749 (374352 downstream)																							TCCTCCTCGGTCTCTCTCTCTCAC	0.534													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47720641	47720641	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47720641delC								CSE1L (7157 upstream) : STAU1 (9237 downstream)																							TTTTCAGCCACCCACCAGGTG	0.453													4	2	---	---	---	---	
TMEM189-UBE2V1	387522	broad.mit.edu	37	20	48769099	48769099	+	Intron	DEL	G	-	-	rs112222312		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48769099delG	uc002xvf.2	-						TMEM189_uc010zyq.1_Intron|TMEM189_uc002xvg.2_Intron|TMEM189_uc010gif.2_Intron	NM_199203	NP_954673	Q13404	UB2V1_HUMAN	TMEM189-UBE2V1 readthrough transcript						cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein K63-linked ubiquitination|regulation of DNA repair|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-UEV1A complex|ubiquitin ligase complex	acid-amino acid ligase activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			AGTGGGTGTAGGGGGGGTGCT	0.532													3	6	---	---	---	---	
CYP24A1	1591	broad.mit.edu	37	20	52773545	52773545	+	Intron	DEL	A	-	-	rs113497239		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52773545delA	uc002xwv.2	-						CYP24A1_uc002xwu.1_Intron|CYP24A1_uc002xww.2_Intron	NM_000782	NP_000773	Q07973	CP24A_HUMAN	cytochrome P450 family 24 subfamily A						hormone biosynthetic process|osteoblast differentiation|vitamin D catabolic process|vitamin D receptor signaling pathway|xenobiotic metabolic process	mitochondrial inner membrane	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity|electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	tttacaaatgaaaaaaaaaaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	53086351	53086352	+	IGR	DEL	TG	-	-	rs138708751		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53086351_53086352delTG								PFDN4 (249860 upstream) : DOK5 (5905 downstream)																							tttatccgtttgtgtgtgtgtg	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55182009	55182009	+	IGR	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55182009delT								C20orf107 (70435 upstream) : TFAP2C (22349 downstream)																							AGGAAAAACATTTTTTTGGCG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55687283	55687283	+	IGR	DEL	C	-	-	rs11475868		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55687283delC								TFAP2C (472947 upstream) : BMP7 (56526 downstream)																							acgattgggaccagaaccagg	0.095													3	3	---	---	---	---	
BMP7	655	broad.mit.edu	37	20	55770192	55770192	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55770192delG	uc010gip.1	-						BMP7_uc010giq.1_Intron|BMP7_uc002xyc.2_Intron	NM_001719	NP_001710	P18075	BMP7_HUMAN	bone morphogenetic protein 7 precursor						BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity			skin(1)	1	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GCCAGCCCGAGGAACCCAGCG	0.637													4	2	---	---	---	---	
BMP7	655	broad.mit.edu	37	20	55787316	55787316	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55787316delA	uc010gip.1	-						BMP7_uc010giq.1_Intron|BMP7_uc002xyc.2_Intron	NM_001719	NP_001710	P18075	BMP7_HUMAN	bone morphogenetic protein 7 precursor						BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity			skin(1)	1	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			taacacagctaaaagggcagg	0.313													4	2	---	---	---	---	
SS18L1	26039	broad.mit.edu	37	20	60739354	60739362	+	Intron	DEL	GGGCAAGGA	-	-	rs3830872		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60739354_60739362delGGGCAAGGA	uc002ycb.2	+						SS18L1_uc011aaa.1_Intron|SS18L1_uc002ybz.1_Intron|SS18L1_uc002yca.1_Intron|SS18L1_uc002ycc.1_Intron	NM_198935	NP_945173	O75177	CREST_HUMAN	SS18-like protein 1						chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome kinetochore				ovary(2)	2	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			GCAGCTGCAGgggcaaggagggcaaggag	0.589			T	SSX1	synovial sarcoma								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61024112	61024112	+	IGR	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61024112delG								C20orf151 (21523 upstream) : GATA5 (14441 downstream)																							GCTCCTGGCTGGGGCCTCTCT	0.637													4	2	---	---	---	---	
DIDO1	11083	broad.mit.edu	37	20	61568589	61568589	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61568589delT	uc002yds.1	-						DIDO1_uc002ydu.1_Intron|DIDO1_uc002ydx.1_Intron|C20orf11_uc002ydy.2_5'Flank	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c						apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					CTATCAAATATTTTAAGGTAC	0.483													4	2	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10995810	10995811	+	Intron	DEL	TA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10995810_10995811delTA	uc002yis.1	-									P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ACCATTTCCTTATAAAACCTGA	0.257													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11071942	11071942	+	Intron	DEL	G	-	-	rs150796084		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11071942delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		acatacacctgggagtagtaa	0.000													4	2	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32782400	32782401	+	Intron	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32782400_32782401delGT	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						GGGCGTAGCAgtgtgtgtgtgt	0.347													3	3	---	---	---	---	
TIAM1	7074	broad.mit.edu	37	21	32857424	32857425	+	Intron	INS	-	T	T	rs139996716	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32857424_32857425insT	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						tgaataatttcattctttcaga	0.158													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33616605	33616606	+	IGR	DEL	TT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33616605_33616606delTT								NCRNA00159 (87789 upstream) : C21orf45 (23926 downstream)																							cacacgggaatttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33994380	33994381	+	IGR	DEL	GC	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33994380_33994381delGC								C21orf59 (9714 upstream) : SYNJ1 (6688 downstream)																							CATTCCTTTTGCAGGATGGGTT	0.317													4	2	---	---	---	---	
ATP5O	539	broad.mit.edu	37	21	35282897	35282897	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35282897delA	uc002ytl.2	-						DONSON_uc002ysn.1_Intron	NM_001697	NP_001688	P48047	ATPO_HUMAN	mitochondrial ATP synthase, O subunit precursor						ATP catabolic process|mitochondrial ATP synthesis coupled proton transport|respiratory electron transport chain	mitochondrial proton-transporting ATP synthase complex|plasma membrane|proton-transporting ATP synthase complex, catalytic core F(1)	drug binding|hydrogen ion transporting ATP synthase activity, rotational mechanism			ovary(1)	1						TCTCCATTGTAAACATGATTG	0.408													4	2	---	---	---	---	
HLCS	3141	broad.mit.edu	37	21	38132376	38132376	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38132376delC	uc010gnb.2	-						HLCS_uc002yvs.2_Intron	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase						cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	TCTTCCCCATCCCCCAGCACT	0.468													4	2	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	39870559	39870560	+	Intron	INS	-	T	T	rs148522133		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39870559_39870560insT	uc010gnw.2	-						ERG_uc002yxa.2_5'Flank|ERG_uc011aek.1_5'Flank|ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc011aem.1_5'Flank|ERG_uc002yxc.3_Intron|ERG_uc010gnz.2_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				CAGCCAGGAGattttttttttt	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40319906	40319907	+	IGR	INS	-	G	G			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40319906_40319907insG								ETS2 (123030 upstream) : PSMG1 (227483 downstream)																							aaatgtcccctggggggtaaaa	0.233													4	2	---	---	---	---	
SH3BGR	6450	broad.mit.edu	37	21	40846816	40846817	+	Intron	INS	-	GT	GT	rs143845691	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40846816_40846817insGT	uc002yya.2	+						SH3BGR_uc002yxz.2_Intron	NM_007341	NP_031367	P55822	SH3BG_HUMAN	SH3-binding domain and glutamic acid-rich						protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		CATGGGTAGGGGTGTGTGTGTG	0.401													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	41350528	41350529	+	IGR	DEL	TT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41350528_41350529delTT								PCP4 (49208 upstream) : DSCAM (33814 downstream)																							ATGAGAAGGATTTGTGACCATG	0.490													4	2	---	---	---	---	
C2CD2	25966	broad.mit.edu	37	21	43328521	43328522	+	Intron	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43328521_43328522insT	uc002yzw.2	-						C2CD2_uc002yzt.2_5'Flank|C2CD2_uc002yzu.2_Intron|C2CD2_uc002yzv.2_Intron|C2CD2_uc002yzx.1_Intron	NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform							cytosol|extracellular region|nucleus				ovary(1)	1						AATTTCATGGATTCCATCAGGC	0.297													4	2	---	---	---	---	
PDE9A	5152	broad.mit.edu	37	21	44170966	44170966	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44170966delA	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron|PDE9A_uc002zch.2_Intron|PDE9A_uc010gpf.1_Intron	NM_002606	NP_002597	O76083	PDE9A_HUMAN	phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2						aagtgctgggattgcaggcat	0.169													4	2	---	---	---	---	
PDE9A	5152	broad.mit.edu	37	21	44189934	44189935	+	Intron	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44189934_44189935insC	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron|PDE9A_uc002zch.2_Intron	NM_002606	NP_002597	O76083	PDE9A_HUMAN	phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2						AGCAGCCTCTTCCCCGGCTGTC	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	45125175	45125175	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45125175delA								RRP1B (9217 upstream) : PDXK (13803 downstream)																							gggagcggggaagggctgaga	0.000													4	2	---	---	---	---	
LSS	4047	broad.mit.edu	37	21	47648123	47648123	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47648123delA	uc002zij.2	-						LSS_uc011afv.1_Intron|LSS_uc002zil.2_Intron|LSS_uc002zik.2_Intron|MCM3APAS_uc002zim.2_5'Flank|MCM3APAS_uc002zin.2_5'Flank	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1						cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)					aaattatctcaaaataaggtg	0.333													4	2	---	---	---	---	
MCM3AP	8888	broad.mit.edu	37	21	47675339	47675340	+	Intron	DEL	CT	-	-	rs17176667		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47675339_47675340delCT	uc002zir.1	-						MCM3AP_uc002zip.1_Intron|MCM3AP_uc002ziq.1_Intron	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3						DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					tggaggatccctctgttgtggt	0.079													5	4	---	---	---	---	
MICAL3	57553	broad.mit.edu	37	22	18307092	18307092	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18307092delC	uc002zng.3	-						MICAL3_uc011agl.1_Intron	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		CGGATCAAAGCCCCAGGCTGG	0.512													4	2	---	---	---	---	
COMT	1312	broad.mit.edu	37	22	19954917	19954917	+	Intron	DEL	T	-	-	rs68091468		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19954917delT	uc002zqu.2	+						COMT_uc002zqv.2_Intron|COMT_uc002zqw.2_Intron|COMT_uc011ahd.1_Intron|COMT_uc002zqx.2_Intron	NM_000754	NP_000745	P21964	COMT_HUMAN	catechol-O-methyltransferase isoform MB-COMT						neurotransmitter biosynthetic process|neurotransmitter catabolic process|xenobiotic metabolic process	cytosol|integral to membrane|intracellular membrane-bounded organelle|microsome|plasma membrane|soluble fraction	catechol O-methyltransferase activity|magnesium ion binding|protein binding			ovary(1)	1	Colorectal(54;0.0993)				Carbidopa(DB00190)|Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Folic Acid(DB00158)|L-Valine(DB00161)|Levodopa(DB01235)|Methyldopa(DB00968)|Modafinil(DB00745)|Morphine(DB00295)|S-Adenosylmethionine(DB00118)|Tolcapone(DB00323)	TGCTAGGACATTTTTTTTTTT	0.517													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20277562	20277563	+	IGR	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20277562_20277563insT								RTN4R (21746 upstream) : DGCR6L (24239 downstream)																							GCCCATCATCACCTATGGTGGA	0.589													4	2	---	---	---	---	
AIFM3	150209	broad.mit.edu	37	22	21321662	21321662	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21321662delG	uc002ztj.2	+						AIFM3_uc002ztk.2_Intron|AIFM3_uc002ztl.2_Intron|AIFM3_uc011ahx.1_Intron	NM_144704	NP_653305	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor,						activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CATTGTAGGAGGGAGAAGACC	0.627													4	2	---	---	---	---	
C22orf43	51233	broad.mit.edu	37	22	23974618	23974619	+	5'Flank	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23974618_23974619insC	uc002zxf.2	-							NM_016449	NP_057533	Q6PGQ1	CV043_HUMAN	hypothetical protein LOC51233											skin(1)	1						CAGCCCCACAGCCCCCCCCAAT	0.574													4	2	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26196439	26196440	+	Intron	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26196439_26196440delGG	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						acagagatgtgggaacatgttg	0.178													4	2	---	---	---	---	
HSCB	150274	broad.mit.edu	37	22	29138730	29138730	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29138730delA	uc003aea.2	+						CHEK2_uc003adt.1_5'Flank|CHEK2_uc003adu.1_5'Flank|CHEK2_uc003adv.1_5'Flank|CHEK2_uc003adw.1_5'Flank|CHEK2_uc003adx.1_5'Flank|CHEK2_uc003ady.1_5'Flank|CHEK2_uc003adz.1_5'Flank	NM_172002	NP_741999	Q8IWL3	HSC20_HUMAN	J-type co-chaperone HSC20 precursor						iron-sulfur cluster assembly|protein folding	mitochondrion	chaperone binding|heat shock protein binding|metal ion binding			kidney(1)	1						AGTAAGGTTTAAAGTTGGGTT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32327915	32327916	+	IGR	INS	-	GAAAG	GAAAG	rs146857596	by1000genomes	TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32327915_32327916insGAAAG								DEPDC5 (24915 upstream) : C22orf24 (1592 downstream)																							ACACAGGTCTTGAAGTGATGAT	0.510													3	3	---	---	---	---	
RFPL2	10739	broad.mit.edu	37	22	32593376	32593376	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32593376delT	uc003amg.3	-						RFPL2_uc003amf.3_Intron|RFPL2_uc003amh.3_Intron	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2								zinc ion binding			skin(1)	1						AGCCAAGTTCTTTTTTTTTTC	0.294													4	2	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33013453	33013453	+	Intron	DEL	T	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33013453delT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						ATGACACATCtttttttttct	0.154													4	2	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33198658	33198658	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33198658delG	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron|TIMP3_uc003anb.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						CCGAGCTTCTGGGACTGCCAA	0.527													4	2	---	---	---	---	
ELFN2	114794	broad.mit.edu	37	22	37787691	37787692	+	Intron	DEL	GG	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37787691_37787692delGG	uc003asq.3	-							NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62							cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)					GACCATCAAAGGGACGGTGTCT	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39077528	39077528	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39077528delA	uc003awd.2	-						TOMM22_uc003awe.2_5'Flank					Homo sapiens PKD2 interactor, golgi and endoplasmic reticulum associated 1, mRNA (cDNA clone IMAGE:4120338).																		AACTTTTGTTAAAAAAAAAAA	0.383													13	7	---	---	---	---	
SULT4A1	25830	broad.mit.edu	37	22	44244113	44244113	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44244113delG	uc003bee.1	-						SULT4A1_uc003bef.1_Intron|SULT4A1_uc011aqb.1_Intron	NM_014351	NP_055166	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process|steroid metabolic process|xenobiotic metabolic process	cytosol	sulfotransferase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		cagagctgctggggtcaaagg	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	47688401	47688401	+	IGR	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47688401delA								TBC1D22A (118679 upstream) : None (None downstream)																							ACTTAGAGGGAAAGAACATTC	0.458													4	2	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	48915301	48915301	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48915301delC	uc003bim.3	+							NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		TCTCTGCCATCCCAGGCAGCA	0.612													4	2	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49033706	49033707	+	Intron	DEL	AA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49033706_49033707delAA	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		TCTCCTGTGTAAAGCCTTGAAA	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49334507	49334510	+	IGR	DEL	TTTC	-	-	rs3076045		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49334507_49334510delTTTC								FAM19A5 (186765 upstream) : C22orf34 (473666 downstream)																							CTTTTCTGTTTTTCTTTATTTGCA	0.466													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49509534	49509535	+	IGR	DEL	CA	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49509534_49509535delCA								FAM19A5 (361792 upstream) : C22orf34 (298641 downstream)																							cacaccagtgcacacacacaca	0.243													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50121386	50121386	+	IGR	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50121386delC								C22orf34 (70196 upstream) : BRD1 (45552 downstream)																							CCGGTCCTTTCCTTTCAATTT	0.632													4	2	---	---	---	---	
TUBGCP6	85378	broad.mit.edu	37	22	50675559	50675559	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50675559delC	uc003bkb.1	-						TUBGCP6_uc010har.1_Intron|TUBGCP6_uc010has.1_Intron	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6						G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGGCCTCCCTCCGCCTTAACC	0.597											OREG0026677	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PPP2R3B	28227	broad.mit.edu	37	X	298156	298156	+	Intron	DEL	A	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:298156delA	uc004cpg.2	-						PPP2R3B_uc004cpf.2_Intron	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AAAGGCAAAGAAACCAGAATA	0.368													4	2	---	---	---	---	
GAGE8	100101629	broad.mit.edu	37	X	49346415	49346416	+	Intron	DEL	GT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49346415_49346416delGT	uc011mng.1	+						GAGE12F_uc011mnt.1_Intron|GAGE1_uc011mnu.1_Intron|GAGE12D_uc004doh.3_Intron	NM_001098412	NP_001091882	Q9UEU5	GGE2D_HUMAN	G antigen 13						cellular defense response		protein binding				0	Ovarian(276;0.236)					TGgtgtgtgcgtgtgtgtgtgt	0.366													4	2	---	---	---	---	
FAM156A	29057	broad.mit.edu	37	X	52964633	52964633	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52964633delG	uc004drm.2	-							NM_014138		Q8NDB6	FA156_HUMAN	family with sequence similarity 156, member A							integral to membrane|nuclear envelope					0						CTTCCCACGTGGCACACCCCG	0.672											OREG0019791	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
OGT	8473	broad.mit.edu	37	X	70767480	70767480	+	Intron	DEL	C	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70767480delC	uc004eaa.1	+						BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Intron|OGT_uc004eac.2_5'UTR|OGT_uc004ead.2_5'UTR	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1						cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)					CCAGTTAAGTCCCAGTGTAAG	0.527													4	2	---	---	---	---	
ZCCHC16	340595	broad.mit.edu	37	X	111560774	111560774	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111560774delG	uc004epo.1	+							NM_001004308	NP_001004308	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16								nucleic acid binding|zinc ion binding			ovary(1)	1						GCTGCTCCCTGGAACTCTGCC	0.473													4	2	---	---	---	---	
KIAA1210	57481	broad.mit.edu	37	X	118242877	118242880	+	Intron	DEL	TATT	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118242877_118242880delTATT	uc004era.3	-							NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481											ovary(4)|skin(1)	5						gcacattatatatttatacattct	0.157													4	2	---	---	---	---	
GRIA3	2892	broad.mit.edu	37	X	122574852	122574852	+	Intron	DEL	G	-	-			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122574852delG	uc004etq.3	+						GRIA3_uc004etr.3_Intron|GRIA3_uc004ets.3_Intron	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform						glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	AGTCTGTCCTGGACACTCTGG	0.328													4	2	---	---	---	---	
MAP7D3	79649	broad.mit.edu	37	X	135322789	135322790	+	Intron	INS	-	T	T			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135322789_135322790insT	uc004ezt.2	-						MAP7D3_uc004ezs.2_Intron|MAP7D3_uc011mwc.1_Intron|MAP7D3_uc010nsa.1_Intron	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3							cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					CCCGTCAATCCTTTTtttttag	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	151993587	151993588	+	IGR	INS	-	C	C			TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151993587_151993588insC								MAGEA3 (55347 upstream) : CETN2 (2285 downstream)																							ATCCACATCCTCCCCCGCCTTC	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59029846	59029847	+	IGR	INS	-	CAG	CAG	rs141550993		TCGA-B2-4102-01A-02D-1386-10	TCGA-B2-4102-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59029846_59029847insCAG								None (None upstream) : None (None downstream)																							agtggaataaacagatctgctg	0.000													3	3	---	---	---	---	
