Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AHDC1	27245	broad.mit.edu	37	1	27874262	27874262	+	Silent	SNP	G	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27874262G>A	uc009vsy.2	-	6	5334	c.4365C>T	c.(4363-4365)CAC>CAT	p.H1455H	AHDC1_uc009vsz.1_Silent_p.H1455H	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1455							DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GGGAATCGTAGTGGGGCTGGC	0.697													7	6	---	---	---	---	PASS
TXLNA	200081	broad.mit.edu	37	1	32646917	32646917	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32646917A>C	uc001bui.2	+	3	309	c.244A>C	c.(244-246)ATA>CTA	p.I82L	TXLNA_uc001buj.2_Missense_Mutation_p.I82L	NM_175852	NP_787048	P40222	TXLNA_HUMAN	taxilin	82					cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				ACTGGAAGACATACTGAGCAC	0.612													15	26	---	---	---	---	PASS
EIF2C3	192669	broad.mit.edu	37	1	36499790	36499790	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36499790T>G	uc001bzp.2	+	13	1863	c.1607T>G	c.(1606-1608)GTA>GGA	p.V536G	EIF2C3_uc001bzq.2_Missense_Mutation_p.V302G	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN	eukaryotic translation initiation factor 2C, 3	536	Piwi.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GTGAAACGTGTAGGAGACACA	0.348													19	30	---	---	---	---	PASS
RIMKLA	284716	broad.mit.edu	37	1	42880262	42880262	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42880262G>C	uc001chi.2	+	5	931	c.793G>C	c.(793-795)GAC>CAC	p.D265H		NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family	265	ATP-grasp.				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						CCTTATCATGGACGATGGCTC	0.502													145	315	---	---	---	---	PASS
RPL5	6125	broad.mit.edu	37	1	93299160	93299160	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93299160C>A	uc001doz.2	+	3	210	c.132C>A	c.(130-132)TAC>TAA	p.Y44*	FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_RNA|RPL5_uc001dpb.2_5'UTR|RPL5_uc001dpd.2_5'Flank	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5	44					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		AAAATAAATACAACACACCCA	0.343													22	58	---	---	---	---	PASS
ITGA10	8515	broad.mit.edu	37	1	145534208	145534208	+	Silent	SNP	G	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145534208G>A	uc001eoa.2	+	14	1789	c.1713G>A	c.(1711-1713)GCG>GCA	p.A571A	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Silent_p.A440A|ITGA10_uc009wiw.2_Silent_p.A428A|ITGA10_uc010oyw.1_Silent_p.A516A	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	571	Extracellular (Potential).|FG-GAP 6.				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTGTGGGGGCGCCTCTGGAAG	0.577													67	100	---	---	---	---	PASS
IGSF8	93185	broad.mit.edu	37	1	160063938	160063938	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160063938A>G	uc001fva.2	-	3	511	c.466T>C	c.(466-468)TCT>CCT	p.S156P	IGSF8_uc001fuz.2_Missense_Mutation_p.S156P|IGSF8_uc009wtf.2_Missense_Mutation_p.S156P	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	156	Extracellular (Potential).				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding				0	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GGGGCAGCAGACACCTGGAGG	0.592													5	17	---	---	---	---	PASS
RXRG	6258	broad.mit.edu	37	1	165386398	165386398	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165386398T>C	uc001gda.2	-	4	802	c.502A>G	c.(502-504)AGG>GGG	p.R168G		NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a	168	Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	AGGTCCTTCCTTATCGTCCTC	0.468													60	82	---	---	---	---	PASS
RABGAP1L	9910	broad.mit.edu	37	1	174245014	174245014	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174245014C>T	uc001gjx.2	+	9	1292	c.1097C>T	c.(1096-1098)ACT>ATT	p.T366I	RABGAP1L_uc009wwq.1_Missense_Mutation_p.T378I|RABGAP1L_uc001gjw.2_Missense_Mutation_p.T329I|RABGAP1L_uc001gjy.2_Missense_Mutation_p.T34I|RABGAP1L_uc001gjz.2_Missense_Mutation_p.T13I	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A	366					regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						TATGTCATCACTGGCATGTGG	0.363													71	95	---	---	---	---	PASS
CHIT1	1118	broad.mit.edu	37	1	203188874	203188874	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203188874T>A	uc001gzn.2	-	8	929	c.833A>T	c.(832-834)GAC>GTC	p.D278V	FMOD_uc010pqi.1_Intron|CHIT1_uc001gzm.1_RNA|CHIT1_uc009xal.1_Missense_Mutation_p.D69V|CHIT1_uc009xam.1_RNA|CHIT1_uc009xan.1_RNA|CHIT1_uc001gzo.2_Missense_Mutation_p.D269V	NM_003465	NP_003456	Q13231	CHIT1_HUMAN	chitotriosidase precursor	278					chitin catabolic process|immune response|response to bacterium	extracellular space|lysosome	cation binding|chitin binding|endochitinase activity				0						CACTCTGGTGTCTGATGAGGA	0.602													35	47	---	---	---	---	PASS
KCNK2	3776	broad.mit.edu	37	1	215408257	215408257	+	Silent	SNP	G	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215408257G>A	uc001hkq.2	+	7	1219	c.1050G>A	c.(1048-1050)GAG>GAA	p.E350E	KCNK2_uc001hko.2_Silent_p.E346E|KCNK2_uc009xdm.2_RNA|KCNK2_uc001hkp.2_RNA|KCNK2_uc001hkr.3_Silent_p.E335E	NM_001017425	NP_001017425	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2 isoform	350	Cytoplasmic (Potential).						outward rectifier potassium channel activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)	TGAGTGTGGAGATTTATGACA	0.547													31	70	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39222302	39222302	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39222302C>T	uc002rrk.3	-	20	3349	c.3308G>A	c.(3307-3309)AGT>AAT	p.S1103N	SOS1_uc002rrj.3_Missense_Mutation_p.S717N	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	1103					apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				ATCAAATACACTGCAAACATC	0.413									Noonan_syndrome				90	34	---	---	---	---	PASS
TMEM150A	129303	broad.mit.edu	37	2	85828149	85828149	+	Silent	SNP	G	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85828149G>T	uc002spw.1	-	3	916	c.195C>A	c.(193-195)CTC>CTA	p.L65L	USP39_uc002sqb.2_5'Flank|TMEM150A_uc002spx.1_Nonsense_Mutation_p.S4*|TMEM150A_uc002spz.1_Nonsense_Mutation_p.S35*|TMEM150A_uc002sqa.1_5'UTR|TMEM150A_uc002spy.1_Silent_p.L65L	NM_001031738	NP_001026908	Q86TG1	T150A_HUMAN	transmembrane protein 150A isoform 1	65	Extracellular (Potential).					integral to membrane|plasma membrane					0						CTTACCTGATGAGGGGGACAT	0.607													39	19	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188263	10188263	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188263T>G	uc003bvc.2	+	2	619	c.406T>G	c.(406-408)TTT>GTT	p.F136V	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	136	Involved in binding to CCT complex.		F -> S (in VHLD).|F -> Y (in VHLD).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.F136fs*23(5)|p.V137fs*7(4)|p.F136V(3)|p.F136fs*8(2)|p.F136C(1)|p.F136I(1)|p.F136del(1)|p.?fs(1)|p.F136L(1)|p.F136S(1)|p.L135fs*7(1)|p.F136Y(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AACTGAATTATTTGTGCCATC	0.428		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				198	66	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102153916	102153916	+	Intron	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102153916A>G	uc003dvs.1	+						ZPLD1_uc003dvt.1_5'UTR|ZPLD1_uc011bhg.1_5'UTR	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						AAAAGTATTTAGGGACTGTGC	0.428													3	65	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170244556	170244556	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170244556T>C	uc003fgz.2	-	2	486	c.170A>G	c.(169-171)GAC>GGC	p.D57G	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	57						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			AGAGATGAGGTCCACTGTGGT	0.572													29	11	---	---	---	---	PASS
LOC220729	220729	broad.mit.edu	37	3	197348668	197348668	+	RNA	SNP	C	G	G	rs79940815	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197348668C>G	uc011bug.1	-	4		c.423G>C			LOC220729_uc003fxw.2_RNA|LOC220729_uc003fxy.2_RNA|LOC220729_uc010iao.1_Intron					Homo sapiens cDNA FLJ60865 complete cds, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC 1.3.5.1).												0						ACTTGAGGCTCTGTCCACCAA	0.488													4	136	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21751720	21751720	+	3'UTR	SNP	T	A	A	rs55879862		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21751720T>A	uc010iuc.2	-	12					CDH12_uc011cno.1_3'UTR|CDH12_uc003jgk.2_3'UTR|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						TGTCCCAGAgtgtgtgtgtgt	0.249										HNSCC(59;0.17)			3	24	---	---	---	---	PASS
PAIP1	10605	broad.mit.edu	37	5	43543190	43543190	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43543190A>T	uc003job.2	-	4	897	c.650T>A	c.(649-651)ATG>AAG	p.M217K	PAIP1_uc003joa.2_Missense_Mutation_p.M138K|PAIP1_uc010ivp.2_Missense_Mutation_p.M138K|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Missense_Mutation_p.M105K	NM_006451	NP_006442	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	217	MIF4G.				mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)					GCGAGCTCCCATATAAGAGAA	0.373													58	51	---	---	---	---	PASS
ITGA1	3672	broad.mit.edu	37	5	52221264	52221264	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52221264A>T	uc003jou.2	+	19	2612	c.2560A>T	c.(2560-2562)AAC>TAC	p.N854Y	ITGA1_uc003jov.2_RNA|ITGA1_uc003jow.2_Missense_Mutation_p.N385Y	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor	854	Extracellular (Potential).				axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				CAGTGCCTATAACACCAGGAC	0.388													40	108	---	---	---	---	PASS
NLN	57486	broad.mit.edu	37	5	65088386	65088386	+	Silent	SNP	A	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65088386A>C	uc003juf.2	+	9	1547	c.1431A>C	c.(1429-1431)TCA>TCC	p.S477S	NLN_uc003jue.2_Silent_p.S477S|NLN_uc003jug.2_Silent_p.S306S|NLN_uc010iww.2_Silent_p.S172S	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor	477					proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		TGAACTTCTCACAGCCAGTGG	0.552													13	47	---	---	---	---	PASS
SEC24A	10802	broad.mit.edu	37	5	133996855	133996855	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133996855A>C	uc003kzs.2	+	2	432	c.144A>C	c.(142-144)CAA>CAC	p.Q48H	SEC24A_uc011cxu.1_5'UTR	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	48					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAGTGAGCCAAGGATACAATT	0.418													302	332	---	---	---	---	PASS
LARS	51520	broad.mit.edu	37	5	145562154	145562154	+	5'UTR	SNP	C	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145562154C>G	uc003lnx.1	-	1					LARS_uc011dbq.1_5'UTR|LARS_uc011dbr.1_5'UTR|LARS_uc011dbs.1_5'UTR	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase						leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	GATGCCAGGCCTCCCACGAAA	0.577													9	33	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156810297	156810297	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156810297T>G	uc003lwq.2	+	30	3275	c.3137T>G	c.(3136-3138)ATG>AGG	p.M1046R	CYFIP2_uc011ddn.1_Missense_Mutation_p.M1020R|CYFIP2_uc011ddo.1_Missense_Mutation_p.M850R|CYFIP2_uc003lwr.2_Missense_Mutation_p.M1046R|CYFIP2_uc003lws.2_Missense_Mutation_p.M1046R|CYFIP2_uc003lwt.2_Missense_Mutation_p.M949R|CYFIP2_uc011ddp.1_Missense_Mutation_p.M780R|CYFIP2_uc003lwv.2_Missense_Mutation_p.M1R	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2	1071					apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGGTCCGGATGAAACGTCTG	0.557													9	55	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17850652	17850652	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17850652G>C	uc003ncg.3	-	8	724	c.619C>G	c.(619-621)CGA>GGA	p.R207G	KIF13A_uc003ncf.2_Missense_Mutation_p.R207G|KIF13A_uc003nch.3_Missense_Mutation_p.R207G|KIF13A_uc003nci.3_Missense_Mutation_p.R207G	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	207	Kinesin-motor.				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GCTACCGTTCGAGACTTATTT	0.453													10	13	---	---	---	---	PASS
DOM3Z	1797	broad.mit.edu	37	6	31939426	31939426	+	Silent	SNP	T	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31939426T>C	uc003nyo.1	-	1	561	c.27A>G	c.(25-27)GGA>GGG	p.G9G	DOM3Z_uc003nyp.1_Silent_p.G9G|DOM3Z_uc003nyq.1_Intron|DOM3Z_uc003nyr.1_Silent_p.G9G|DOM3Z_uc003nys.1_Silent_p.G9G|DOM3Z_uc010jtl.1_Silent_p.G9G|STK19_uc003nyt.2_Intron|DOM3Z_uc003nyu.1_Silent_p.G9G|STK19_uc011dow.1_5'Flank|STK19_uc011dox.1_5'Flank|STK19_uc003nyv.2_5'Flank|STK19_uc003nyw.2_5'Flank|STK19_uc010jtn.1_5'Flank	NM_005510	NP_005501	O77932	DOM3Z_HUMAN	DOM-3 homolog Z	9							identical protein binding|metal ion binding|nucleotide binding				0						TCTTCTCAGCTCCTCTCTTGG	0.552													13	48	---	---	---	---	PASS
SPDEF	25803	broad.mit.edu	37	6	34506194	34506194	+	Missense_Mutation	SNP	G	A	A	rs148079586		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34506194G>A	uc003ojq.1	-	6	1280	c.865C>T	c.(865-867)CGG>TGG	p.R289W	SPDEF_uc011dsq.1_Missense_Mutation_p.R273W	NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription	289	ETS.				negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(3)|ovary(1)|central_nervous_system(1)	5						CCCCACAGCCGGGCCACCTGG	0.582													50	101	---	---	---	---	PASS
C6orf89	221477	broad.mit.edu	37	6	36882108	36882108	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36882108C>A	uc003omx.2	+	5	736	c.452C>A	c.(451-453)CCC>CAC	p.P151H	C6orf89_uc003omv.2_Missense_Mutation_p.P45H|C6orf89_uc003omw.2_Missense_Mutation_p.P158H|C6orf89_uc011dtr.1_Missense_Mutation_p.P45H|C6orf89_uc003omy.2_5'UTR	NM_152734	NP_689947	Q6UWU4	CF089_HUMAN	hypothetical protein LOC221477	151						integral to membrane				ovary(1)	1						GAGTCAGAGCCCATTCCTGCC	0.517													29	63	---	---	---	---	PASS
KIF6	221458	broad.mit.edu	37	6	39304293	39304293	+	3'UTR	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39304293A>G	uc003oot.2	-	23					KIF6_uc003oos.2_3'UTR|KIF6_uc010jwz.1_3'UTR|KIF6_uc010jxa.1_3'UTR|KIF6_uc011dua.1_3'UTR|KIF6_uc010jxb.1_3'UTR	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						TCATGGATGGATATTTCCTGG	0.478													29	63	---	---	---	---	PASS
FAM135A	57579	broad.mit.edu	37	6	71185175	71185175	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71185175A>G	uc003pfj.2	+	4	353	c.220A>G	c.(220-222)ATT>GTT	p.I74V	FAM135A_uc003pfi.2_Missense_Mutation_p.I74V|FAM135A_uc003pfh.2_Missense_Mutation_p.I31V|FAM135A_uc003pfk.2_Missense_Mutation_p.I74V|FAM135A_uc003pfl.2_5'UTR	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c	74										central_nervous_system(1)	1						AACATTTCAAATTTTGTACAA	0.279													11	43	---	---	---	---	PASS
FSCN1	6624	broad.mit.edu	37	7	5632985	5632985	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5632985C>T	uc003sou.2	+	1	532	c.418C>T	c.(418-420)CCT>TCT	p.P140S		NM_003088	NP_003079	Q16658	FSCN1_HUMAN	fascin 1	140					actin filament bundle assembly|cell migration|cell proliferation	cell junction|cytoplasm|filopodium|invadopodium|stress fiber	actin filament binding|drug binding|protein binding, bridging			ovary(1)	1		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		CGCCATGCACCCTCAGGTCAA	0.706													39	51	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41740067	41740067	+	5'UTR	SNP	A	T	T	rs111584790		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41740067A>T	uc003thq.2	-	1					LOC285954_uc003tht.3_Intron|INHBA_uc003thr.2_5'UTR|LOC285954_uc003ths.2_Intron	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor						cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						GGAtttttttatttttttttt	0.353										TSP Lung(11;0.080)			4	30	---	---	---	---	PASS
CFTR	1080	broad.mit.edu	37	7	117232369	117232369	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117232369G>T	uc003vjd.2	+	14	2280	c.2148G>T	c.(2146-2148)AAG>AAT	p.K716N	CFTR_uc011knq.1_Missense_Mutation_p.K122N	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	716	Cytoplasmic (Potential).				respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	TTGTGCAAAAGACTCCCTTAC	0.398									Cystic_Fibrosis				47	76	---	---	---	---	PASS
CYP7A1	1581	broad.mit.edu	37	8	59404310	59404310	+	Silent	SNP	A	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59404310A>C	uc003xtm.3	-	6	1302	c.1239T>G	c.(1237-1239)CTT>CTG	p.L413L		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	413					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				CGTTTTCATCAAGATACCTAT	0.348									Neonatal_Giant_Cell_Hepatitis				59	49	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106813474	106813474	+	Silent	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106813474C>T	uc003ymd.2	+	8	1187	c.1164C>T	c.(1162-1164)AGC>AGT	p.S388S	ZFPM2_uc011lhs.1_Silent_p.S119S|uc003yme.1_5'Flank	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	388					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ATGTCCCTAGCGGCAAACTTC	0.517													55	37	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113277723	113277723	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113277723C>T	uc003ynu.2	-	60	9764	c.9605G>A	c.(9604-9606)GGC>GAC	p.G3202D	CSMD3_uc003yns.2_Missense_Mutation_p.G2404D|CSMD3_uc003ynt.2_Missense_Mutation_p.G3162D|CSMD3_uc011lhx.1_Missense_Mutation_p.G3033D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3202	Extracellular (Potential).|Sushi 24.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CATCGTGTAGCCTGGCTGGCA	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			72	42	---	---	---	---	PASS
DERL1	79139	broad.mit.edu	37	8	124031368	124031368	+	Intron	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124031368C>T	uc003ypl.2	-						DERL1_uc003ypm.2_Intron|DERL1_uc011lif.1_Intron|DERL1_uc003ypn.2_3'UTR	NM_024295	NP_077271	Q9BUN8	DERL1_HUMAN	Der1-like domain family, member 1 isoform a						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|intracellular transport of viral proteins in host cell|retrograde protein transport, ER to cytosol	integral to endoplasmic reticulum membrane	MHC class I protein binding|receptor activity				0	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			CCTCATGGAGCTCTCATTAGG	0.433													5	2	---	---	---	---	PASS
FLJ43859	389761	broad.mit.edu	37	9	84547720	84547720	+	Missense_Mutation	SNP	G	C	C	rs138456481	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84547720G>C	uc004amh.2	+	4	2730	c.2644G>C	c.(2644-2646)GGC>CGC	p.G882R	uc004ami.1_Intron|uc004amj.1_5'Flank	NM_001145197	NP_001138669	Q6ZUB0	YI020_HUMAN	hypothetical protein LOC389761	882						integral to membrane					0						TGAGGACCACGGCGTTGATAC	0.418													2	2	---	---	---	---	PASS
PTRH1	138428	broad.mit.edu	37	9	130478287	130478287	+	5'Flank	SNP	G	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130478287G>A	uc004bro.2	-						PTRH1_uc004brm.2_5'Flank|PTRH1_uc010mxm.2_5'UTR|PTRH1_uc011mah.1_5'UTR|TTC16_uc004brq.1_5'Flank|TTC16_uc011mai.1_5'Flank|TTC16_uc004brr.1_5'Flank	NM_001002913	NP_001002913	Q86Y79	PTH_HUMAN	peptidyl-tRNA hydrolase 1 homolog						translation		aminoacyl-tRNA hydrolase activity|protein binding				0						CCTCCCTCCGGCTCAAAAAGC	0.393													3	37	---	---	---	---	PASS
HK1	3098	broad.mit.edu	37	10	71103744	71103744	+	Silent	SNP	T	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71103744T>C	uc001jpl.3	+	2	326	c.225T>C	c.(223-225)TCT>TCC	p.S75S	HK1_uc009xqc.1_3'UTR|HK1_uc001jpg.3_Silent_p.S63S|HK1_uc001jph.3_Silent_p.S79S|HK1_uc001jpi.3_Silent_p.S79S|HK1_uc001jpj.3_Silent_p.S110S|HK1_uc001jpk.3_Silent_p.S74S|HK1_uc009xqd.2_Missense_Mutation_p.L3P	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI	75	Regulatory.				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1						CTGATGGCTCTGGTAAGTCTG	0.388													35	56	---	---	---	---	PASS
MGEA5	10724	broad.mit.edu	37	10	103557823	103557823	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103557823T>C	uc001ktv.2	-	10	2341	c.1898A>G	c.(1897-1899)AAC>AGC	p.N633S	MGEA5_uc001ktu.2_RNA|MGEA5_uc010qqe.1_Missense_Mutation_p.N580S|MGEA5_uc009xws.2_Missense_Mutation_p.N580S|MGEA5_uc001ktw.2_Missense_Mutation_p.N633S	NM_012215	NP_036347	O60502	NCOAT_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	633	Histone acetyltransferase activity (By similarity).				glycoprotein catabolic process	cytoplasm|nucleus	histone acetyltransferase activity|hyalurononglucosaminidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		AATTGTCCTGTTGGCACAATT	0.433													54	77	---	---	---	---	PASS
ST5	6764	broad.mit.edu	37	11	8752274	8752274	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8752274C>A	uc001mgt.2	-	3	749	c.563G>T	c.(562-564)CGG>CTG	p.R188L	ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Missense_Mutation_p.R188L|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Missense_Mutation_p.R188L	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1	188					positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		AGAGCCCTCCCGCTTCTCTCC	0.662													3	29	---	---	---	---	PASS
OR5L1	219437	broad.mit.edu	37	11	55579566	55579566	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579566T>G	uc001nhw.1	+	1	624	c.624T>G	c.(622-624)AGT>AGG	p.S208R		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	208	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				TGAATGAGAGTGTTACCATCA	0.488													5	239	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14613557	14613557	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14613557G>C	uc001rbw.2	+	9	2445	c.2287G>C	c.(2287-2289)GCT>CCT	p.A763P	ATF7IP_uc010shs.1_3'UTR|ATF7IP_uc001rbu.2_Missense_Mutation_p.A763P|ATF7IP_uc001rbv.1_Missense_Mutation_p.A762P|ATF7IP_uc001rbx.2_Missense_Mutation_p.A762P|ATF7IP_uc010sht.1_3'UTR|ATF7IP_uc001rby.3_Missense_Mutation_p.A763P|ATF7IP_uc001rca.2_Missense_Mutation_p.A763P	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	763	Interaction with SETDB1.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						TACTGTAGTTGCTACTACTCA	0.488													49	93	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	44917251	44917251	+	Silent	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44917251C>T	uc001rog.2	-	17	2416	c.1821G>A	c.(1819-1821)GGG>GGA	p.G607G	NELL2_uc001rof.3_Silent_p.G606G|NELL2_uc001roh.2_Silent_p.G607G|NELL2_uc009zkd.2_Silent_p.G559G|NELL2_uc010skz.1_Silent_p.G657G|NELL2_uc010sla.1_Silent_p.G630G|NELL2_uc001roi.1_Silent_p.G607G	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	607	EGF-like 6; calcium-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GCCTCCCGGTCCCACACTCAT	0.453													41	38	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49425039	49425039	+	Silent	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49425039C>T	uc001rta.3	-	39	13449	c.13449G>A	c.(13447-13449)CTG>CTA	p.L4483L		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4483					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TCTCAGCTCGCAGCCCCTCGG	0.597			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			46	77	---	---	---	---	PASS
KRT4	3851	broad.mit.edu	37	12	53207945	53207945	+	Silent	SNP	G	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53207945G>T	uc001saz.2	-	1	391	c.120C>A	c.(118-120)CCC>CCA	p.P40P		NM_002272	NP_002263	B4DRS2	B4DRS2_HUMAN	keratin 4	Error:Variant_position_missing_in_B4DRS2_after_alignment						keratin filament	structural molecule activity			ovary(4)|skin(2)	6						TGGAGCAGCAGGGCTTGGTTG	0.572													24	34	---	---	---	---	PASS
AVPR1A	552	broad.mit.edu	37	12	63544403	63544403	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63544403C>A	uc001sro.1	-	1	2188	c.214G>T	c.(214-216)GTA>TTA	p.V72L		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	72	Helical; Name=1; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	GCCAGCAGTACGCTGCTGTTG	0.667													3	39	---	---	---	---	PASS
DACH1	1602	broad.mit.edu	37	13	72204836	72204836	+	Silent	SNP	G	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72204836G>A	uc010thn.1	-	4	1401	c.978C>T	c.(976-978)GCC>GCT	p.A326A	DACH1_uc010tho.1_Silent_p.A326A|DACH1_uc010thp.1_Intron	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	326	Interaction with SIX6 and HDAC3 (By similarity).|Poly-Ala.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		ctgctgcagcggctgcTGTCA	0.224													29	50	---	---	---	---	PASS
ZIC5	85416	broad.mit.edu	37	13	100622569	100622569	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100622569T>C	uc001vom.1	-	1	1610	c.1361A>G	c.(1360-1362)GAG>GGG	p.E454G		NM_033132	NP_149123	Q96T25	ZIC5_HUMAN	zinc finger protein of the cerebellum 5	454					cell differentiation	nucleus	DNA binding|zinc ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCTGCTCTGCTCGGGGCCTCC	0.602													21	38	---	---	---	---	PASS
RNASE8	122665	broad.mit.edu	37	14	21526326	21526326	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21526326G>T	uc010tlm.1	+	1	275	c.275G>T	c.(274-276)AGC>ATC	p.S92I	NDRG2_uc010tll.1_Intron	NM_138331	NP_612204	Q8TDE3	RNAS8_HUMAN	ribonuclease, RNase A family, 8 precursor	92						extracellular region	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;3.42e-11)|Epithelial(56;5.57e-09)|all cancers(55;2.36e-08)	GBM - Glioblastoma multiforme(265;0.0188)		TGCAAGAATAGCTGTAAAAAC	0.552													76	37	---	---	---	---	PASS
MTHFD1	4522	broad.mit.edu	37	14	64855180	64855180	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64855180T>A	uc001xhb.2	+	1	422	c.35T>A	c.(34-36)ATC>AAC	p.I12N	MTHFD1_uc010aqe.2_Missense_Mutation_p.I68N|MTHFD1_uc010aqf.2_Missense_Mutation_p.I68N	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1	12	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GGGAAGGAGATCTCCGCGTAA	0.592													43	19	---	---	---	---	PASS
ABCD4	5826	broad.mit.edu	37	14	74753229	74753229	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74753229G>A	uc001xpr.2	-	19	1908	c.1756C>T	c.(1756-1758)CAT>TAT	p.H586Y	ABCD4_uc001xps.2_Missense_Mutation_p.H427Y|ABCD4_uc001xpt.2_3'UTR|ABCD4_uc010tur.1_3'UTR	NM_005050	NP_005041	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D, member 4	586	ABC transporter.					ATP-binding cassette (ABC) transporter complex|integral to membrane|peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			upper_aerodigestive_tract(2)|large_intestine(1)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00153)		ACCAAGGAATGAAACTACAAG	0.537													7	112	---	---	---	---	PASS
ZDHHC22	283576	broad.mit.edu	37	14	77600035	77600035	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77600035C>G	uc010asp.2	-	3	986	c.783G>C	c.(781-783)CAG>CAC	p.Q261H		NM_174976	NP_777636	Q8N966	ZDH22_HUMAN	zinc finger, DHHC domain containing 22	261						integral to membrane	acyltransferase activity|zinc ion binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)		ACTACTTATCCTGCTGCTTGG	0.527													33	11	---	---	---	---	PASS
SERPINA10	51156	broad.mit.edu	37	14	94752497	94752497	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94752497A>G	uc001yct.2	-	4	1557	c.1091T>C	c.(1090-1092)TTT>TCT	p.F364S	SERPINA10_uc001ycu.3_Missense_Mutation_p.F364S	NM_016186	NP_057270	Q9UK55	ZPI_HUMAN	serine (or cysteine) proteinase inhibitor, clade	364					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		AAGGTCAGCAAAGGGTGAGAA	0.438													8	96	---	---	---	---	PASS
CYP46A1	10858	broad.mit.edu	37	14	100166423	100166423	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100166423T>C	uc001ygo.2	+	5	428	c.428T>C	c.(427-429)CTG>CCG	p.L143P	CYP46A1_uc001ygn.1_Missense_Mutation_p.L105P	NM_006668	NP_006659	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46	143					bile acid biosynthetic process|cholesterol catabolic process|nervous system development|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol 24-hydroxylase activity|electron carrier activity|heme binding|steroid hydroxylase activity				0		Melanoma(154;0.0866)|all_epithelial(191;0.179)				GTCATAGACCTGGCCTTCAGC	0.622													20	17	---	---	---	---	PASS
USP8	9101	broad.mit.edu	37	15	50763851	50763851	+	Silent	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50763851A>G	uc001zym.3	+	9	1208	c.708A>G	c.(706-708)GAA>GAG	p.E236E	USP8_uc001zyk.1_5'UTR|USP8_uc001zyl.3_Silent_p.E236E|USP8_uc001zyn.3_Silent_p.E236E|USP8_uc010ufh.1_Silent_p.E159E|USP8_uc010bev.1_Intron	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	236	Rhodanese.				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GTTGGATTGAAGCACACCTGC	0.388													48	90	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59470597	59470597	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59470597C>G	uc002aga.2	-	19	2416	c.2044G>C	c.(2044-2046)GAG>CAG	p.E682Q		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	682					actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		CTCACAGACTCGGGGGCTTTG	0.493													22	31	---	---	---	---	PASS
LOC645752	645752	broad.mit.edu	37	15	78207569	78207569	+	Missense_Mutation	SNP	G	A	A	rs56314252	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78207569G>A	uc010bky.2	-	18	2107	c.1343C>T	c.(1342-1344)GCA>GTA	p.A448V	LOC645752_uc010umq.1_Missense_Mutation_p.A95V|uc002bcw.1_5'Flank|uc002bcx.1_5'Flank	NR_027024				SubName: Full=GOLGA6 protein; Flags: Fragment;												0						GATCTGCTGTGCAGTGGGGTT	0.572													4	29	---	---	---	---	PASS
SPSB3	90864	broad.mit.edu	37	16	1828480	1828480	+	Missense_Mutation	SNP	G	A	A	rs150535227		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1828480G>A	uc002cmr.2	-	2	293	c.260C>T	c.(259-261)TCG>TTG	p.S87L	SPSB3_uc002cms.2_5'UTR|SPSB3_uc002cmt.2_5'UTR|SPSB3_uc002cmu.2_Missense_Mutation_p.S87L|SPSB3_uc002cmv.2_5'UTR|SPSB3_uc010uvm.1_Missense_Mutation_p.S142L	NM_080861	NP_543137	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box	87	B30.2/SPRY.				intracellular signal transduction						0						CCGGTGGGCCGAGTGCAGGCT	0.711													21	14	---	---	---	---	PASS
NOD2	64127	broad.mit.edu	37	16	50745117	50745117	+	Missense_Mutation	SNP	C	T	T	rs2076754	byFrequency	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50745117C>T	uc002egm.1	+	4	1400	c.1295C>T	c.(1294-1296)GCG>GTG	p.A432V	NOD2_uc010cbk.1_Missense_Mutation_p.A405V|NOD2_uc002egl.1_Missense_Mutation_p.A210V|NOD2_uc010cbl.1_Missense_Mutation_p.A210V|NOD2_uc010cbm.1_Missense_Mutation_p.A210V|NOD2_uc010cbn.1_RNA|NOD2_uc010cbo.1_RNA|NOD2_uc010cbp.1_5'Flank|NOD2_uc010cbq.1_5'Flank|NOD2_uc010cbr.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	432	NACHT.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				GCTGTGTCGGCGTTCCTCAGG	0.612													25	83	---	---	---	---	PASS
IRX3	79191	broad.mit.edu	37	16	54319294	54319294	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54319294T>C	uc002eht.1	-	2	915	c.499A>G	c.(499-501)ACC>GCC	p.T167A		NM_024336	NP_077312	P78415	IRX3_HUMAN	iroquois homeobox 3	167	Homeobox; TALE-type.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GTCATCTTGGTGATGATGGCC	0.627													42	136	---	---	---	---	PASS
SLC12A4	6560	broad.mit.edu	37	16	67979424	67979424	+	Silent	SNP	C	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67979424C>A	uc002euz.2	-	22	3021	c.2880G>T	c.(2878-2880)CTG>CTT	p.L960L	LCAT_uc002euy.1_5'Flank|SLC12A4_uc010ceu.2_Silent_p.L954L|SLC12A4_uc010vkh.1_Silent_p.L929L|SLC12A4_uc010vki.1_Silent_p.L954L|SLC12A4_uc010vkj.1_Silent_p.L962L|SLC12A4_uc002eva.2_Silent_p.L960L	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a	960	Cytoplasmic (Potential).				cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCTCCAGCCGCAGGGCCGAGT	0.587													18	60	---	---	---	---	PASS
C17orf97	400566	broad.mit.edu	37	17	263315	263315	+	Silent	SNP	C	T	T	rs71356792		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263315C>T	uc002frh.2	+	3	727	c.711C>T	c.(709-711)CCC>CCT	p.P237P	C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	237	4.|20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									ovary(1)	1						GCTTCCACCCCGACCCCGAGG	0.711													3	12	---	---	---	---	PASS
PER1	5187	broad.mit.edu	37	17	8048306	8048306	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8048306T>A	uc002gkd.2	-	18	2462	c.2224A>T	c.(2224-2226)ATC>TTC	p.I742F	PER1_uc010cns.2_5'Flank|PER1_uc010vuq.1_RNA|PER1_uc010vur.1_Missense_Mutation_p.I726F	NM_002616	NP_002607	O15534	PER1_HUMAN	period 1	742	CSNK1E binding domain (By similarity).				circadian rhythm|entrainment of circadian clock|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			lung(2)|breast(2)|skin(2)|large_intestine(1)|ovary(1)|kidney(1)	9						TCCATCATGATGATGTCTGAG	0.373			T	ETV6	AML|CMML			Other_conserved_DNA_damage_response_genes					10	17	---	---	---	---	PASS
CYTSB	92521	broad.mit.edu	37	17	20130773	20130773	+	Silent	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20130773C>T	uc002gwq.2	+	5	2056	c.1911C>T	c.(1909-1911)GCC>GCT	p.A637A	CYTSB_uc010cqx.2_Silent_p.A637A|CYTSB_uc002gwr.2_Silent_p.A637A|CYTSB_uc002gws.2_Silent_p.A637A|CYTSB_uc002gwv.2_Silent_p.A556A|CYTSB_uc010vzf.1_5'UTR|CYTSB_uc002gww.2_Silent_p.A413A|CYTSB_uc002gwt.2_Silent_p.A556A|CYTSB_uc002gwu.2_Silent_p.A556A	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b	637	Potential.					nucleus					0						ATCACCAAGCCGAACAGCTGA	0.393													9	28	---	---	---	---	PASS
SEZ6	124925	broad.mit.edu	37	17	27308944	27308944	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27308944A>C	uc002hdp.2	-	2	363	c.169T>G	c.(169-171)TTT>GTT	p.F57V	SEZ6_uc002hdm.2_RNA|SEZ6_uc010cry.1_Missense_Mutation_p.F57V|SEZ6_uc002hdq.1_5'UTR|SEZ6_uc010crz.1_Missense_Mutation_p.F57V	NM_178860	NP_849191	Q53EL9	SEZ6_HUMAN	seizure related 6 homolog isoform 1	57	Extracellular (Potential).					integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			GTTGTGACAAAGTGGACGCCT	0.612													11	22	---	---	---	---	PASS
STAT5B	6777	broad.mit.edu	37	17	40359718	40359718	+	Silent	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40359718A>G	uc002hzh.2	-	16	2104	c.1935T>C	c.(1933-1935)CCT>CCC	p.P645P		NM_012448	NP_036580	P51692	STA5B_HUMAN	signal transducer and activator of transcription	645	SH2.				2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity			ovary(3)|lung(2)|skin(1)	6		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	TGGTGGTAAAAGGCATCAGAT	0.393													25	53	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13114196	13114196	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13114196A>C	uc010xac.1	+	42	7315	c.7235A>C	c.(7234-7236)CAT>CCT	p.H2412P	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.H1937P|CEP192_uc002kru.2_Intron|CEP192_uc002krv.2_Missense_Mutation_p.H834P|CEP192_uc002krw.2_Missense_Mutation_p.H561P|CEP192_uc002krx.2_Missense_Mutation_p.H416P|CEP192_uc002kry.2_Intron	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	2412										ovary(4)|pancreas(1)	5						AAAATAGATCATTTAGTTAAG	0.408													94	166	---	---	---	---	PASS
CHST9	83539	broad.mit.edu	37	18	24496340	24496340	+	Silent	SNP	G	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24496340G>T	uc002kwd.2	-	5	1413	c.1215C>A	c.(1213-1215)ACC>ACA	p.T405T	C18orf16_uc002kwb.2_Intron|C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_Silent_p.T320T|CHST9_uc002kwe.2_Silent_p.T405T	NM_031422	NP_113610	Q7L1S5	CHST9_HUMAN	GalNAc-4-sulfotransferase 2	405	Lumenal (Potential).				carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)					CTTGAGCATTGGTTCTTTCAT	0.353													63	165	---	---	---	---	PASS
CD226	10666	broad.mit.edu	37	18	67531478	67531478	+	3'UTR	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67531478A>G	uc010dqo.2	-	6					CD226_uc002lkm.3_3'UTR	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor						cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				TGGGTAGTGGAAAAAAATTGC	0.333													16	29	---	---	---	---	PASS
BTBD2	55643	broad.mit.edu	37	19	1993133	1993133	+	Silent	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1993133C>T	uc002lup.1	-	3	570	c.570G>A	c.(568-570)GTG>GTA	p.V190V	BTBD2_uc002luo.1_5'Flank	NM_017797	NP_060267	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	190						cytoplasmic mRNA processing body	protein binding			ovary(1)|skin(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGTGGTCATCACCGTCTCCG	0.637													23	25	---	---	---	---	PASS
RINL	126432	broad.mit.edu	37	19	39361507	39361507	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39361507C>T	uc002ojq.2	-	8	773	c.385G>A	c.(385-387)GAG>AAG	p.E129K	RINL_uc002ojr.1_5'Flank|RINL_uc010xuo.1_Missense_Mutation_p.E243K	NM_198445	NP_940847	Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	129							GTPase activator activity			pancreas(1)	1						CTTCCTTCCTCCTTTCCTTCA	0.632													50	135	---	---	---	---	PASS
PSG1	5669	broad.mit.edu	37	19	43358110	43358110	+	Intron	SNP	T	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43358110T>G	uc010eio.1	-						PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG8_uc002oul.3_Intron|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Intron|PSG10_uc010eip.2_RNA|PSG1_uc002our.1_Intron|PSG1_uc002oux.1_Intron|PSG1_uc002ouy.1_Intron	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1						female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				CGGTATAAGGTGAAGGTGAAA	0.512													131	370	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53926630	53926630	+	RNA	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53926630C>T	uc002qbn.2	+	4		c.581C>T						Q7L2R6	ZN765_HUMAN	Homo sapiens cDNA FLJ50389 complete cds, moderately similar to Zinc finger protein 611.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		GGGGCTCATGCTCTGGGGCAG	0.602													3	3	---	---	---	---	PASS
ZIM3	114026	broad.mit.edu	37	19	57646763	57646763	+	Silent	SNP	C	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57646763C>T	uc002qnz.1	-	5	1328	c.942G>A	c.(940-942)AAG>AAA	p.K314K		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	314	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAATGAAAGCCTTTCCACAGT	0.398													81	274	---	---	---	---	PASS
MAP1LC3A	84557	broad.mit.edu	37	20	33137723	33137723	+	5'UTR	SNP	C	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33137723C>A	uc002xap.1	+	2						NM_181509	NP_852610	Q9H492	MLP3A_HUMAN	microtubule-associated protein 1 light chain 3						autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|cytosol|endomembrane system|microtubule	phosphatidylethanolamine binding|protein binding				0						CCATGGCTTCCGAGTTGCTGA	0.418													24	23	---	---	---	---	PASS
SFRS6	6431	broad.mit.edu	37	20	42087921	42087921	+	Intron	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42087921A>G	uc010zwg.1	+						SFRS6_uc002xki.2_5'UTR|SFRS6_uc002xkk.2_Intron	NM_006275	NP_006266	Q13247	SRSF6_HUMAN	arginine/serine-rich splicing factor 6						mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GGAAGCCATGACGACAGCAGC	0.493													77	74	---	---	---	---	PASS
SLC13A3	64849	broad.mit.edu	37	20	45192249	45192249	+	Intron	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45192249A>G	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron|SLC13A3_uc002xse.1_5'UTR|SLC13A3_uc010ghm.1_Intron|SLC13A3_uc010zxv.1_Intron	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	CGACCACAGCAagagggagag	0.308													2	12	---	---	---	---	PASS
C21orf45	54069	broad.mit.edu	37	21	33641251	33641251	+	3'UTR	SNP	C	T	T	rs11557587		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33641251C>T	uc002ypi.2	-	5						NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45						cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0						ttttttttttctttttttttt	0.154													3	19	---	---	---	---	PASS
XBP1	7494	broad.mit.edu	37	22	29196020	29196020	+	Intron	SNP	C	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29196020C>G	uc011akl.1	-						XBP1_uc003aec.2_5'Flank|XBP1_uc003aed.2_Missense_Mutation_p.R2P|XBP1_uc003aef.2_Intron	NM_001079539	NP_001073007	P17861	XBP1_HUMAN	X-box binding protein 1 isoform XBP1(S)						immune response	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						GACAGGTGCCCGCATCCCCAG	0.557													45	19	---	---	---	---	PASS
GPM6B	2824	broad.mit.edu	37	X	13797994	13797994	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13797994G>T	uc004cvz.2	-	4	811	c.520C>A	c.(520-522)CCG>ACG	p.P174T	GPM6B_uc004cvx.2_Missense_Mutation_p.P155T|GPM6B_uc011min.1_Missense_Mutation_p.P88T|GPM6B_uc004cwa.2_Missense_Mutation_p.P155T|GPM6B_uc004cvw.2_Missense_Mutation_p.P214T|GPM6B_uc011mim.1_Missense_Mutation_p.P188T|GPM6B_uc004cvy.2_Missense_Mutation_p.P214T	NM_005278	NP_005269	Q13491	GPM6B_HUMAN	glycoprotein M6B isoform 3	174					cell differentiation|nervous system development	integral to membrane					0						TTGGTCTGCGGTGACTTGATG	0.498													7	216	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21667030	21667030	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21667030G>T	uc004czx.1	+	21	2810	c.2774G>T	c.(2773-2775)GGA>GTA	p.G925V	CNKSR2_uc011mjo.1_Missense_Mutation_p.G895V	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	925					regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						TCACCACTAGGAGAACATCGT	0.388													127	33	---	---	---	---	PASS
PRICKLE3	4007	broad.mit.edu	37	X	49040319	49040319	+	Silent	SNP	C	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49040319C>A	uc004dmy.1	-	3	206	c.180G>T	c.(178-180)GCG>GCT	p.A60A	PRICKLE3_uc011mmv.1_5'UTR|PRICKLE3_uc011mmw.1_5'UTR|PRICKLE3_uc011mmx.1_Silent_p.A60A|PRICKLE3_uc011mmy.1_Silent_p.A60A	NM_006150	NP_006141	O43900	PRIC3_HUMAN	LIM domain only 6	60							protein binding|zinc ion binding			breast(1)	1						CCACAGGCACCGCGTGCACTG	0.597													3	76	---	---	---	---	PASS
GAGE12J	729396	broad.mit.edu	37	X	49179737	49179737	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49179737A>T	uc010nit.2	+	2	181	c.65A>T	c.(64-66)GAA>GTA	p.E22V	GAGE12J_uc004dnl.3_Missense_Mutation_p.E22V|GAGE10_uc010nis.2_Intron|GAGE12J_uc004dnk.3_Missense_Mutation_p.E22V	NM_001098406	NP_001091876	A6NER3	GG12J_HUMAN	G antigen 12J	22											0	Ovarian(276;0.236)					CAGCCTCCTGAAATGATTGGG	0.413													187	271	---	---	---	---	PASS
MAGEE1	57692	broad.mit.edu	37	X	75649863	75649863	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75649863G>T	uc004ecm.1	+	1	1747	c.1540G>T	c.(1540-1542)GAG>TAG	p.E514*		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	514	MAGE 1.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						CCCTATCCGGGAGTCTGAAAT	0.488													47	14	---	---	---	---	PASS
ITM2A	9452	broad.mit.edu	37	X	78618083	78618083	+	Silent	SNP	G	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78618083G>A	uc004edh.2	-	4	882	c.547C>T	c.(547-549)CTG>TTG	p.L183L	ITM2A_uc011mqr.1_Silent_p.L139L	NM_004867	NP_004858	O43736	ITM2A_HUMAN	integral membrane protein 2A	183	BRICHOS.					integral to membrane	protein binding			lung(2)	2						CATACCGCCAGTTTGCCAAAG	0.348													68	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13844	13844	+	RNA	SNP	A	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13844A>G	uc004cox.3	+	1		c.1508A>G			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		AACAGCCCTAGACCTCAACTA	0.453													7	1	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169551549	169551550	+	Intron	INS	-	A	A	rs139372356	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169551549_169551550insA	uc001ggg.1	-						F5_uc010plr.1_Intron	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	cagtactTCTTAAAAAAAAAAC	0.119													3	3	---	---	---	---	
BAT2L2	23215	broad.mit.edu	37	1	171483663	171483663	+	Intron	DEL	T	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171483663delT	uc010pmg.1	+						BAT2L2_uc001ghq.1_Intron|BAT2L2_uc001ghr.1_Intron	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2								protein C-terminus binding				0						TGGATTCATATTTTTTTTTAA	0.358													5	5	---	---	---	---	
PTPRC	5788	broad.mit.edu	37	1	198687421	198687421	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198687421delA	uc001gur.1	+	14	1823	c.1643delA	c.(1642-1644)TACfs	p.Y548fs	PTPRC_uc001gus.1_Frame_Shift_Del_p.Y500fs|PTPRC_uc001gut.1_Frame_Shift_Del_p.Y387fs|PTPRC_uc009wzf.1_Frame_Shift_Del_p.Y436fs|PTPRC_uc010ppg.1_Frame_Shift_Del_p.Y484fs	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	548	Extracellular (Potential).|Fibronectin type-III 2.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						TCAACAGACTACACTTTTAAG	0.333													23	15	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215916729	215916730	+	Intron	DEL	TG	-	-	rs6540907		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215916729_215916730delTG	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		tatatatatatgtgtgtgtgtg	0.178										HNSCC(13;0.011)			4	2	---	---	---	---	
MOSC2	54996	broad.mit.edu	37	1	220926579	220926580	+	Intron	INS	-	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220926579_220926580insA	uc001hmq.2	+						MOSC2_uc001hmr.2_Intron|MOSC2_uc009xdx.2_Intron	NM_017898	NP_060368	Q969Z3	MOSC2_HUMAN	MOCO sulphurase C-terminal domain containing 2							mitochondrial outer membrane|peroxisome	molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.00499)|all cancers(67;0.204)		cagaaaaaaagaaaaaaaaaag	0.218													3	3	---	---	---	---	
NLRP3	114548	broad.mit.edu	37	1	247604430	247604441	+	Intron	DEL	TCTCTTTCTTTC	-	-	rs71675612		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247604430_247604441delTCTCTTTCTTTC	uc001icr.2	+						NLRP3_uc001ics.2_Intron|NLRP3_uc001icu.2_Intron|NLRP3_uc001icw.2_Intron|NLRP3_uc001icv.2_Intron|NLRP3_uc010pyw.1_Intron	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a						detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			tttttctttttctctttctttctttctttctc	0.014													4	2	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17890091	17890092	+	Intron	INS	-	TATA	TATA	rs147636514	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17890091_17890092insTATA	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron|SMC6_uc002rcp.1_Intron|SMC6_uc002rcq.2_Intron	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					tgaaaattgtgtatatatatat	0.198													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	35766717	35766744	+	IGR	DEL	TTCCTTCCTTCCTTCCTTCCTTCCTTCG	-	-	rs147961695	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35766717_35766744delTTCCTTCCTTCCTTCCTTCCTTCCTTCG								None (None upstream) : CRIM1 (816653 downstream)																							ccttccttccttccttccttccttccttccttccttcgttccttcctt	0.197													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90249300	90249300	+	RNA	DEL	G	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90249300delG	uc010fhm.2	+	28		c.3843delG								Parts of antibodies, mostly variable regions.																		AAGGTTCAGCGGCAGTGGATC	0.468													72	228	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152362014	152362014	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152362014delT	uc010fnx.2	-	137	18808	c.18617delA	c.(18616-18618)GAGfs	p.E6206fs	NEB_uc002txr.2_Frame_Shift_Del_p.E2629fs|RIF1_uc002txp.2_Intron|NEB_uc002txq.2_5'Flank|NEB_uc010zca.1_Frame_Shift_Del_p.E37fs|NEB_uc010zcb.1_Frame_Shift_Del_p.E37fs|NEB_uc002txt.3_Frame_Shift_Del_p.E711fs	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	6206	Nebulin 170.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTTCTGCGTCTCCTTCACACG	0.463													78	171	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	155769809	155769811	+	IGR	DEL	AAC	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155769809_155769811delAAC								KCNJ3 (56795 upstream) : None (None downstream)																							GAAGAAAAGAaacaacaacaaca	0.246													4	2	---	---	---	---	
SCN1A	6323	broad.mit.edu	37	2	166894166	166894166	+	Intron	DEL	T	-	-	rs67819222		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166894166delT	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AATTATACTCtttttttttat	0.149													0	14	---	---	---	---	
KBTBD10	10324	broad.mit.edu	37	2	170354215	170354215	+	Intron	DEL	T	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170354215delT	uc010zdh.1	+						BBS5_uc002uet.2_Intron|BBS5_uc010fpw.2_Intron	NM_152384	NP_689597	O60662	KBTBA_HUMAN	Bardet-Biedl syndrome 5						striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0						ATCTTGTATATTTTTATTAAT	0.259													81	131	---	---	---	---	
HOXD10	3236	broad.mit.edu	37	2	176983587	176983592	+	Intron	DEL	AAAACC	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176983587_176983592delAAAACC	uc002ukj.2	+							NM_002148	NP_002139	P28358	HXD10_HUMAN	homeobox D10							nucleus	sequence-specific DNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		aacaaaaacgaaaaccaaaaccaaaa	0.277													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32647935	32647937	+	IGR	DEL	AGG	-	-	rs34405029		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32647935_32647937delAGG								DYNC1LI1 (35585 upstream) : CNOT10 (78761 downstream)																							gaaggaaggaaggaggaaggaag	0.000													4	3	---	---	---	---	
CDCP1	64866	broad.mit.edu	37	3	45167743	45167744	+	Intron	INS	-	TCTC	TCTC	rs140448669	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45167743_45167744insTCTC	uc003com.2	-						CDCP1_uc003con.2_Intron	NM_022842	NP_073753	Q9H5V8	CDCP1_HUMAN	CUB domain-containing protein 1 isoform 1							extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		tccttccttcttctctctctct	0.158													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	58216894	58216897	+	IGR	DEL	AGGA	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58216894_58216897delAGGA								DNASE1L3 (16041 upstream) : ABHD6 (6362 downstream)																							AGagaaagagaggaaggaaggaag	0.083													4	3	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195490839	195490845	+	Intron	DEL	TCCAGAT	-	-	rs63306962		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195490839_195490845delTCCAGAT	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTACTCCTTATCCAGATGCCACCTCCC	0.628													3	5	---	---	---	---	
MAP9	79884	broad.mit.edu	37	4	156281456	156281457	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156281456_156281457insT	uc003ios.2	-	7	1177_1178	c.913_914insA	c.(913-915)AGTfs	p.S305fs	MAP9_uc011cin.1_Frame_Shift_Ins_p.S280fs|MAP9_uc010iqa.1_RNA|MAP9_uc003iot.1_Frame_Shift_Ins_p.S304fs	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein	305	Potential.				cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		AGTCACTTGACTTTCCTTGGAT	0.371													44	104	---	---	---	---	
WWC2	80014	broad.mit.edu	37	4	184175071	184175071	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184175071delA	uc010irx.2	+	9	1297	c.1115delA	c.(1114-1116)GAAfs	p.E372fs	WWC2_uc003ivk.3_Frame_Shift_Del_p.E167fs|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_Frame_Shift_Del_p.E54fs	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	372	Potential.									ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		GATGAATTAGAACGCCTAGAA	0.453													13	31	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16902321	16902322	+	Intron	INS	-	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16902321_16902322insT	uc003jft.3	-						MYO10_uc003jfu.2_Intron|MYO10_uc003jfv.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						ggcccggctaattttttttttt	0.163													8	5	---	---	---	---	
ZFYVE16	9765	broad.mit.edu	37	5	79768393	79768393	+	Intron	DEL	A	-	-	rs33928816		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79768393delA	uc003kgr.3	+						ZFYVE16_uc003kgq.3_Intron|ZFYVE16_uc003kgs.3_Intron|ZFYVE16_uc003kgt.3_Intron|ZFYVE16_uc003kgu.3_Intron	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16						BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		ttttaaCCTTAAAAAAAAAAT	0.134													4	5	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	90069949	90069949	+	Intron	DEL	A	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90069949delA	uc003kju.2	+						GPR98_uc003kjt.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GACAACATTCAAACTTTGGCT	0.378													9	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102588878	102588879	+	IGR	DEL	GT	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102588878_102588879delGT								PPIP5K2 (49971 upstream) : C5orf30 (5563 downstream)																							gtataggatggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	109481445	109481448	+	IGR	DEL	TTCT	-	-	rs5012007	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109481445_109481448delTTCT								MAN2A1 (278016 upstream) : TMEM232 (143486 downstream)																							ccttccttccttctttctttcttt	0.015													4	2	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140031160	140031161	+	Intron	INS	-	A	A	rs75532104		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140031160_140031161insA	uc003lgq.2	+						IK_uc011czk.1_Intron	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gactccgtctcaaaaaaaaaaa	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170261083	170261085	+	IGR	DEL	CAC	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170261083_170261085delCAC								GABRP (20035 upstream) : RANBP17 (27937 downstream)																							ccatcaccatcaccaccaccacc	0.118													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	171005598	171005601	+	IGR	DEL	AGGA	-	-	rs111722197		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171005598_171005601delAGGA								FGF18 (121436 upstream) : FBXW11 (282955 downstream)																							AGAGAGATAGaggaaggaaggaag	0.230													7	7	---	---	---	---	
RUFY1	80230	broad.mit.edu	37	5	179036199	179036200	+	Intron	DEL	CT	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179036199_179036200delCT	uc003mka.1	+						RUFY1_uc003mkb.1_Intron|RUFY1_uc003mkc.1_Intron|RUFY1_uc003mkd.1_Intron	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a						endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ctgagcaagactctatctcaaa	0.193										HNSCC(44;0.11)			5	3	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44149154	44149155	+	Intron	DEL	CA	-	-	rs150779569		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149154_44149155delCA	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AAGCCCTAACCACACACACACA	0.351													5	3	---	---	---	---	
DST	667	broad.mit.edu	37	6	56346819	56346819	+	Intron	DEL	G	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56346819delG	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCTAATTTAGCTTTACATAG	0.373													23	14	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90399594	90399595	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90399594_90399595insG	uc003pnn.1	-	65	11133_11134	c.11017_11018insC	c.(11017-11019)CTGfs	p.L3673fs		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	3673					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CATACCCATCAGGGGGTAGAAG	0.450													27	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134707148	134707155	+	IGR	DEL	GAAGGAAG	-	-	rs66858982		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134707148_134707155delGAAGGAAG								SGK1 (67952 upstream) : ALDH8A1 (531374 downstream)																							aagaaagaaagaaggaaggaaggaagga	0.000													4	2	---	---	---	---	
PHACTR2	9749	broad.mit.edu	37	6	144128096	144128096	+	Intron	DEL	A	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144128096delA	uc003qjq.3	+						PHACTR2_uc010khh.2_Intron|PHACTR2_uc010khi.2_Intron|PHACTR2_uc003qjr.3_Intron	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3								actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		tctatctcttaaaaaaaaaaa	0.149													6	3	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28859060	28859061	+	3'UTR	INS	-	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28859060_28859061insT	uc003szq.2	+	11					CREB5_uc003szo.2_3'UTR|CREB5_uc003szr.2_3'UTR|CREB5_uc003szs.2_3'UTR	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						TTTATACTTAGTTATATAAGAA	0.327													4	6	---	---	---	---	
PION	54103	broad.mit.edu	37	7	76985105	76985105	+	Intron	DEL	T	-	-	rs148300900		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76985105delT	uc003ugf.2	-						PION_uc003ugg.1_Intron	NM_017439	NP_059135	A4D1B5	GSAP_HUMAN	pigeon homolog						beta-amyloid formation|regulation of proteolysis	trans-Golgi network	beta-amyloid binding			central_nervous_system(1)	1						TGACAGCCCGttttttttttt	0.199													5	3	---	---	---	---	
AKAP9	10142	broad.mit.edu	37	7	91706411	91706411	+	Intron	DEL	T	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91706411delT	uc003ulg.2	+						AKAP9_uc003ulf.2_Intron|AKAP9_uc003uli.2_Intron|AKAP9_uc003ulj.2_Intron	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			tattTCtttcttttttttttt	0.085			T	BRAF	papillary thyroid								5	3	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100229246	100229247	+	Intron	INS	-	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100229246_100229247insA	uc003uvv.1	-						TFR2_uc010lhc.1_Intron|TFR2_uc003uvu.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					gactccatctcaaaaaaaaaaa	0.035													10	5	---	---	---	---	
MLL5	55904	broad.mit.edu	37	7	104719584	104719584	+	Intron	DEL	T	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104719584delT	uc003vcm.2	+						MLL5_uc010lja.1_Intron|MLL5_uc010ljb.1_Intron|MLL5_uc003vcl.2_Intron|MLL5_uc010ljc.2_Intron|MLL5_uc003vco.1_Intron|MLL5_uc010ljd.1_Intron	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						CTATGAAGTCttttttttttt	0.204													4	2	---	---	---	---	
CHMP7	91782	broad.mit.edu	37	8	23114302	23114302	+	Intron	DEL	C	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23114302delC	uc003xdc.2	+						CHMP7_uc011kzs.1_Intron|CHMP7_uc003xdd.2_Intron|CHMP7_uc003xde.2_Intron	NM_152272	NP_689485	Q8WUX9	CHMP7_HUMAN	CHMP family, member 7						cellular membrane organization|late endosome to vacuole transport	cytosol|ESCRT III complex	protein transporter activity				0		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		AATGAGGCCTCtttttttttt	0.159													3	3	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131175377	131175378	+	Intron	INS	-	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131175377_131175378insG	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CACATGTGGCAGGaaaacaaaa	0.381													3	3	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139705856	139705856	+	Intron	DEL	C	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139705856delC	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTCCGGGGCTCCCCCACGAGG	0.632										HNSCC(7;0.00092)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45362789	45362791	+	IGR	DEL	TTC	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45362789_45362791delTTC								FAM27C (371298 upstream) : FAM27A (364238 downstream)																							CTTCAGCCTGTTCTTCTTCAGTC	0.468													4	2	---	---	---	---	
CBWD6	644019	broad.mit.edu	37	9	69207122	69207122	+	Intron	DEL	G	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69207122delG	uc004afj.3	-						CBWD6_uc004afk.3_Intron|CBWD6_uc011lrf.1_Intron	NM_001085457	NP_001078926	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding				0						CATATGTGCTGTTTTTTTGGA	0.294													3	3	---	---	---	---	
PTPDC1	138639	broad.mit.edu	37	9	96870182	96870183	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96870182_96870183insA	uc004auf.1	+	10	2561_2562	c.2221_2222insA	c.(2221-2223)GAAfs	p.E741fs	PTPDC1_uc004aug.1_Frame_Shift_Ins_p.E736fs|PTPDC1_uc004auh.1_Frame_Shift_Ins_p.E793fs|PTPDC1_uc010mrj.1_Frame_Shift_Ins_p.E795fs	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	741							protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						CACGCTGGAAGAAAAAAGAAAA	0.366													29	29	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8555337	8555338	+	IGR	INS	-	C	C	rs138737388	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8555337_8555338insC								GATA3 (438175 upstream) : None (None downstream)																							TTttctttttttccttccttcc	0.173													4	4	---	---	---	---	
OR5M11	219487	broad.mit.edu	37	11	56310877	56310878	+	5'Flank	INS	-	TT	TT	rs137998724	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56310877_56310878insTT	uc010rjl.1	-							NM_001005245	NP_001005245	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTACCATAAACTGGTTTTGGTA	0.287													2	4	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69995756	69995756	+	Intron	DEL	A	-	-	rs72410022		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69995756delA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						aactctgtctaaaaaaaaaaa	0.234													7	4	---	---	---	---	
PDZRN4	29951	broad.mit.edu	37	12	41961407	41961407	+	Intron	DEL	T	-	-	rs34848026		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41961407delT	uc010skn.1	+						PDZRN4_uc001rmq.3_Intron|PDZRN4_uc009zjz.2_Intron|PDZRN4_uc001rmr.2_Intron	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2								ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				ATAAGAGTCCTTTTTTTTTTT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59213391	59213392	+	IGR	INS	-	GGCCT	GGCCT	rs140022030	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59213391_59213392insGGCCT								XRCC6BP1 (862340 upstream) : LRIG3 (52546 downstream)																							ggctgccgcagggcctgcacgg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	74711567	74711568	+	IGR	INS	-	TCCT	TCCT			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74711567_74711568insTCCT								None (None upstream) : ATXN7L3B (219983 downstream)																							cttttccttcctccttccttcc	0.134													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	62159090	62159091	+	IGR	INS	-	GAAG	GAAG			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62159090_62159091insGAAG								PCDH20 (157011 upstream) : None (None downstream)																							aaggaatgaaagaaggaaggaa	0.000													6	3	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95848985	95848991	+	Intron	DEL	AGAAGGG	-	-	rs113892410		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95848985_95848991delAGAAGGG	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron|ABCC4_uc001vmf.2_Intron|ABCC4_uc010afl.1_Intron|ABCC4_uc010afm.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	gaaggaaggaagaagggagggagggaa	0.135													3	3	---	---	---	---	
SLC15A1	6564	broad.mit.edu	37	13	99336799	99336800	+	3'UTR	INS	-	A	A			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99336799_99336800insA	uc001vno.2	-	23						NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide						digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	aactctgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
TRIP11	9321	broad.mit.edu	37	14	92487733	92487733	+	Intron	DEL	A	-	-	rs35038594		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92487733delA	uc001xzy.2	-							NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11						transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		attctgtctcaaaaaaaaaaa	0.030			T	PDGFRB	AML								3	3	---	---	---	---	
GABPB1	2553	broad.mit.edu	37	15	50581976	50581977	+	Intron	INS	-	TTTTTT	TTTTTT	rs140176493	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50581976_50581977insTTTTTT	uc001zyb.2	-						GABPB1_uc001zya.2_Intron|GABPB1_uc010ufg.1_Intron|GABPB1_uc001zyc.2_Intron|GABPB1_uc001zyd.2_Intron|GABPB1_uc001zye.2_Intron|GABPB1_uc001zyf.2_Intron	NM_005254	NP_005245	Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta						positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)	1						tttcttttttcttttttaaata	0.129													3	4	---	---	---	---	
NECAB2	54550	broad.mit.edu	37	16	84034564	84034565	+	Intron	INS	-	GGTGGAG	GGTGGAG	rs144191894	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84034564_84034565insGGTGGAG	uc002fhd.2	+						NECAB2_uc002fhe.2_Intron	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2						CAGTAAACCCTGGTGGAGGCAG	0.609													4	2	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11597919	11597922	+	Intron	DEL	CTTT	-	-	rs12946299		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11597919_11597922delCTTT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TACCTCGGAGctttcttgctttct	0.270													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51991222	51991222	+	IGR	DEL	T	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51991222delT								KIF2B (88649 upstream) : TOM1L1 (986830 downstream)																							tttttctttcttttttttttt	0.114													3	3	---	---	---	---	
TUBD1	51174	broad.mit.edu	37	17	57963684	57963684	+	Intron	DEL	A	-	-	rs113094238		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57963684delA	uc002ixw.1	-						TUBD1_uc010ddf.1_Intron|TUBD1_uc010ddg.1_Intron|TUBD1_uc010ddh.1_Intron|TUBD1_uc010wok.1_Intron|TUBD1_uc002ixx.1_Intron|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin						cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			GTCCAAATCCAAAAAAAAAAA	0.373													4	2	---	---	---	---	
CARD14	79092	broad.mit.edu	37	17	78164412	78164412	+	Intron	DEL	A	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78164412delA	uc002jxw.1	+						CARD14_uc002jxt.1_Intron|CARD14_uc002jxv.2_Intron|CARD14_uc010wud.1_Intron|CARD14_uc002jxx.2_Intron|CARD14_uc010dhu.1_Intron	NM_024110	NP_077015	Q9BXL6	CAR14_HUMAN	caspase recruitment domain protein 14 isoform 1						activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding			ovary(4)|skin(1)	5	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			tctctgtctcaaaaaaaaaaa	0.204													6	4	---	---	---	---	
PPP4R1	9989	broad.mit.edu	37	18	9594800	9594801	+	Intron	INS	-	T	T	rs77692629		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9594800_9594801insT	uc002koe.1	-						PPP4R1_uc010wzo.1_Intron|PPP4R1_uc002kod.1_Intron|PPP4R1_uc010wzp.1_Intron	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1						protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						ATTAATGGTAATTTTTTTTTTT	0.272													4	2	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59894429	59894429	+	Intron	DEL	A	-	-	rs35190394		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59894429delA	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				aaccgatcttaaaaaaaaaaa	0.085													4	2	---	---	---	---	
POLRMT	5442	broad.mit.edu	37	19	632854	632854	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:632854delC	uc002lpf.1	-	2	229	c.173delG	c.(172-174)GGCfs	p.G58fs		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	58					transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCACGTGGCCCCAGTCCTT	0.697													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5401984	5401999	+	IGR	DEL	GAAGGAAGGAAGGAAA	-	-	rs28828993	by1000genomes	TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5401984_5401999delGAAGGAAGGAAGGAAA								PTPRS (61170 upstream) : ZNRF4 (53427 downstream)																							gggaaggagggaaggaaggaaggaaagaaggaagga	0.000													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	10055883	10055895	+	IGR	DEL	GGGAGGGAGGGAG	-	-	rs111802762		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10055883_10055895delGGGAGGGAGGGAG								OLFM2 (8813 upstream) : COL5A3 (14342 downstream)																							aaggaaggaagggagggagggagggaaggaagg	0.146													4	3	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14746810	14746823	+	Intron	DEL	TCTTTCTCTTTCTT	-	-	rs77234249		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14746810_14746823delTCTTTCTCTTTCTT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						cctttctctctctttctctttctttcttccttcc	0.000													6	4	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14746874	14746874	+	Intron	DEL	T	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14746874delT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						ccttccttcctttcctttcct	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23079429	23079432	+	IGR	DEL	TTCC	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23079429_23079432delTTCC								ZNF99 (126645 upstream) : ZNF91 (441987 downstream)																							ccctccttctttccttccttcctt	0.074													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32668615	32668615	+	IGR	DEL	A	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32668615delA								TSHZ3 (828425 upstream) : ZNF507 (167899 downstream)																							ggaaggaaggaaAATGATCTA	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47075975	47075978	+	Intron	DEL	AGAA	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47075975_47075978delAGAA	uc002pev.1	-											SubName: Full=cDNA FLJ37185 fis, clone BRALZ2001743, moderately similar to Serine/threonine-protein phosphatase 5;          EC=3.1.3.16;																		ggaaagaaggagaaagaaagaaag	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47265475	47265476	+	IGR	INS	-	GT	GT	rs112622467		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47265475_47265476insGT								FKRP (3643 upstream) : SLC1A5 (12666 downstream)																							actaaaaatacgtgtgtgtgtg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49715837	49715838	+	IGR	INS	-	CTTC	CTTC	rs76677262		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49715837_49715838insCTTC								TRPM4 (746 upstream) : SLC6A16 (77056 downstream)																							AATGTAACCTActtccttcctt	0.035													10	5	---	---	---	---	
MED25	81857	broad.mit.edu	37	19	50331486	50331486	+	Intron	DEL	A	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50331486delA	uc002ppw.1	+						MED25_uc010ybe.1_Intron	NM_030973	NP_112235	Q71SY5	MED25_HUMAN	mediator complex subunit 25						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm				ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		actccatctcaaaaaaaaaaa	0.259													6	3	---	---	---	---	
PTPRH	5794	broad.mit.edu	37	19	55714695	55714696	+	Intron	DEL	AA	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55714695_55714696delAA	uc002qjq.2	-						PTPRH_uc010esv.2_Intron|PTPRH_uc002qjs.2_Intron	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		actctgtctcaaaaaaaaaaaa	0.069													4	2	---	---	---	---	
C20orf46	55321	broad.mit.edu	37	20	1162182	1162183	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1162182_1162183insG	uc010gaa.1	-	3	299_300	c.80_81insC	c.(79-81)TCTfs	p.S27fs	C20orf46_uc002weq.1_Frame_Shift_Ins_p.S27fs	NM_018354	NP_060824	Q9NUR3	CT046_HUMAN	hypothetical protein LOC55321	27						integral to membrane	protein binding			ovary(1)	1						GACCAGGGGGAGATGCCATTGG	0.584													64	43	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4825430	4825433	+	IGR	DEL	GAAG	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4825430_4825433delGAAG								RASSF2 (21139 upstream) : SLC23A2 (7569 downstream)																							aggagggaacgaaggaaggaagga	0.005													4	3	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33230143	33230144	+	Intron	INS	-	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33230143_33230144insT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron|TIMP3_uc003anb.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						CTGAGCCCAGCttttttttttt	0.233													4	2	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33411227	33411228	+	Intron	INS	-	T	T	rs74280322		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33411227_33411228insT	uc003amz.2	-							NM_001135774	NP_001129246	O14994	SYN3_HUMAN	synapsin III isoform IIIg						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						aaaaaaaaaaaCTACTGTATCT	0.188													4	3	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36691448	36691449	+	Intron	DEL	GT	-	-	rs111330544		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36691448_36691449delGT	uc003apg.2	-							NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GAGGGCCACGgtgtgtgtgtgt	0.550			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	53043948	53043948	+	IGR	DEL	A	-	-			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53043948delA								FAM156A (106365 upstream) : GPR173 (34558 downstream)																							agaccttgccaaaaaaaaaaa	0.000													12	6	---	---	---	---	
GPRASP1	9737	broad.mit.edu	37	X	101912814	101912815	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101912814_101912815insT	uc004ejj.3	+	5	4774_4775	c.3973_3974insT	c.(3973-3975)CTCfs	p.L1325fs	GPRASP1_uc004eji.3_Frame_Shift_Ins_p.L1325fs|GPRASP1_uc010nod.2_Frame_Shift_Ins_p.L1325fs	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	1325	OPRD1-binding.					cytoplasm	protein binding			ovary(1)|lung(1)	2						ATTTATAGGCCTCTTTAACAGG	0.322													29	108	---	---	---	---	
SRPK3	26576	broad.mit.edu	37	X	153048657	153048657	+	Intron	DEL	A	-	-	rs112360480		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153048657delA	uc004fil.2	+						SRPK3_uc004fik.2_Intron|SRPK3_uc010nul.2_Intron|SRPK3_uc004fin.2_Intron|SRPK3_uc004fim.2_Intron	NM_014370	NP_055185	Q9UPE1	SRPK3_HUMAN	serine arginine rich protein-specific kinase 3						cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity			pancreas(2)|lung(1)	3	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GTCCCCCCCCACCGCTCCCCA	0.677													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	3720516	3720517	+	IGR	INS	-	T	T	rs35895769		TCGA-BP-4967-01A-01D-1462-08	TCGA-BP-4967-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:3720516_3720517insT								TGIF2LY (272436 upstream) : None (None downstream)																							TTTTTTTCCCATTTTTTCTCTT	0.347													2	6	---	---	---	---	
