Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA2013	90231	broad.mit.edu	37	1	11980277	11980277	+	3'UTR	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11980277G>A	uc001atk.2	-	3						NM_138346	NP_612355	Q8IYS2	K2013_HUMAN	hypothetical protein LOC90231 precursor							integral to membrane				ovary(1)	1	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CACAAAGGGCGGGTGCTTCCA	0.547													6	104	---	---	---	---	PASS
ESPNP	284729	broad.mit.edu	37	1	17023403	17023403	+	Silent	SNP	G	A	A	rs10907267	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17023403G>A	uc001azn.1	-	9	1545	c.1431C>T	c.(1429-1431)AAC>AAT	p.N477N		NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						GGAACATCACGTTGAAAGACT	0.622													10	34	---	---	---	---	PASS
FAM76A	199870	broad.mit.edu	37	1	28060630	28060630	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28060630C>T	uc001boq.2	+	4	392	c.290C>T	c.(289-291)CCA>CTA	p.P97L	FAM76A_uc009vtb.2_Missense_Mutation_p.P97L|FAM76A_uc001bor.2_Missense_Mutation_p.P131L|FAM76A_uc001bos.2_Missense_Mutation_p.P131L|FAM76A_uc001bot.2_Missense_Mutation_p.P97L|FAM76A_uc010ofm.1_Intron	NM_152660	NP_689873	Q8TAV0	FA76A_HUMAN	hypothetical protein LOC199870 isoform 3	97											0		Colorectal(325;0.000147)|all_lung(284;0.00181)|Lung NSC(340;0.00278)|Renal(390;0.00357)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00253)|KIRC - Kidney renal clear cell carcinoma(1967;0.00292)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)		AAGTATGGACCACCCTATTCT	0.383													27	122	---	---	---	---	PASS
KTI12	112970	broad.mit.edu	37	1	52498351	52498351	+	3'UTR	SNP	C	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52498351C>T	uc001ctj.1	-	1					TXNDC12_uc001cti.2_Intron	NM_138417	NP_612426	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated								ATP binding			central_nervous_system(2)	2						GCCATGGCTTCCCCCCTACCT	0.483													5	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142819309	142819309	+	Intron	SNP	C	T	T	rs4118822		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142819309C>T	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron|uc001ejc.2_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		AAGAAAGGTGCAAAAGAAGTG	0.299													4	21	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171753287	171753287	+	Silent	SNP	C	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171753287C>T	uc001ghz.2	+	2	908	c.561C>T	c.(559-561)GCC>GCT	p.A187A	METTL13_uc001gia.2_Silent_p.A101A|METTL13_uc001gib.2_Intron|METTL13_uc010pml.1_Silent_p.A186A	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	187							methyltransferase activity|protein binding			kidney(1)	1						ACCAAGTGGCCAACAGCCAGG	0.587													19	89	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171756896	171756896	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171756896G>A	uc001ghz.2	+	4	1482	c.1135G>A	c.(1135-1137)GGG>AGG	p.G379R	METTL13_uc001gia.2_Missense_Mutation_p.G293R|METTL13_uc001gib.2_Missense_Mutation_p.G223R|METTL13_uc010pml.1_Missense_Mutation_p.G378R	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	379							methyltransferase activity|protein binding			kidney(1)	1						GTCTGTGGGTGGGGACATTGG	0.498													7	59	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	210970969	210970969	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210970969G>A	uc001hib.2	-	9	1966	c.1796C>T	c.(1795-1797)ACG>ATG	p.T599M	KCNH1_uc001hic.2_Missense_Mutation_p.T572M	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	599	Cytoplasmic (Potential).|cNMP.				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		ACAGTGCACCGTCTGGAACTC	0.607													7	95	---	---	---	---	PASS
MARK1	4139	broad.mit.edu	37	1	220835248	220835248	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220835248A>G	uc001hmn.3	+	18	2725	c.2128A>G	c.(2128-2130)AGT>GGT	p.S710G	MARK1_uc009xdw.2_Missense_Mutation_p.S711G|MARK1_uc010pun.1_Missense_Mutation_p.S695G|MARK1_uc001hmm.3_Missense_Mutation_p.S673G	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1	710					intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		GAAGACCACTAGTTCAATGGA	0.398													15	97	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236766491	236766491	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236766491C>T	uc001hyd.1	-	3	453	c.328G>A	c.(328-330)GCA>ACA	p.A110T	HEATR1_uc001hye.1_Missense_Mutation_p.A110T	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	110					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CACTTCTGTGCTGGCTTAAGC	0.373													21	146	---	---	---	---	PASS
REG3G	130120	broad.mit.edu	37	2	79255044	79255044	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79255044C>A	uc002snw.2	+	5	530	c.445C>A	c.(445-447)CTG>ATG	p.L149M	REG3G_uc002snx.2_Missense_Mutation_p.L149M|REG3G_uc010ffu.2_Missense_Mutation_p.L103M	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor	149	C-type lectin.				acute-phase response	extracellular region	sugar binding				0						CTGTGGGAGCCTGTCAAGAAG	0.483													24	99	---	---	---	---	PASS
SLC11A1	6556	broad.mit.edu	37	2	219254723	219254723	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219254723C>A	uc002vhv.2	+	9	1266	c.926C>A	c.(925-927)GCC>GAC	p.A309D	SLC11A1_uc010fvp.1_Missense_Mutation_p.A309D|SLC11A1_uc010fvq.1_Missense_Mutation_p.A242D|SLC11A1_uc010zkc.1_Missense_Mutation_p.A242D|SLC11A1_uc002vhu.1_Missense_Mutation_p.A104D|SLC11A1_uc002vhw.2_Missense_Mutation_p.A191D|SLC11A1_uc010fvr.2_Missense_Mutation_p.A104D	NM_000578	NP_000569	P49279	NRAM1_HUMAN	natural resistance-associated macrophage protein	309	Extracellular (Potential).				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity			ovary(3)|central_nervous_system(1)	4		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTTGGGCAGGCCTTCTACCAG	0.542													8	42	---	---	---	---	PASS
SCG2	7857	broad.mit.edu	37	2	224463620	224463620	+	Silent	SNP	A	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224463620A>T	uc002vnm.2	-	2	514	c.381T>A	c.(379-381)TCT>TCA	p.S127S		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	127					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		CTTTTGGTGCAGACTGAGGCT	0.443													22	344	---	---	---	---	PASS
CRELD1	78987	broad.mit.edu	37	3	9982650	9982650	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9982650G>A	uc003bug.2	+	6	695	c.577G>A	c.(577-579)GGC>AGC	p.G193S	CIDEC_uc003bto.2_Intron|CRELD1_uc003buf.2_Missense_Mutation_p.G193S|CRELD1_uc003buh.2_Missense_Mutation_p.G193S|CRELD1_uc003bui.2_Missense_Mutation_p.G193S|CRELD1_uc003buj.2_RNA	NM_001077415	NP_001070883	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1 isoform 3	193	Extracellular (Potential).|EGF-like 1.				cardiac septum development|endocardial cushion development	integral to membrane	calcium ion binding			ovary(1)	1						TGAGGCCTGTGGCCAGTGTGG	0.637													4	33	---	---	---	---	PASS
KLHL8	57563	broad.mit.edu	37	4	88106697	88106697	+	Silent	SNP	A	G	G			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88106697A>G	uc011cdb.1	-	3	856	c.471T>C	c.(469-471)TGT>TGC	p.C157C	KLHL8_uc003hql.1_Silent_p.C157C|KLHL8_uc003hqm.1_Silent_p.C81C|KLHL8_uc003hqn.1_Intron|KLHL8_uc010ikj.1_Intron	NM_020803	NP_065854	Q9P2G9	KLHL8_HUMAN	kelch-like 8	157											0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		TCATGTATTCACAACAAGCTC	0.438													15	113	---	---	---	---	PASS
UCP1	7350	broad.mit.edu	37	4	141484270	141484270	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141484270A>T	uc011chj.1	-	4	698	c.622T>A	c.(622-624)TTA>ATA	p.L208I	UCP1_uc011chk.1_Missense_Mutation_p.L207I	NM_021833	NP_068605	P25874	UCP1_HUMAN	uncoupling protein 1	208					brown fat cell differentiation|cellular lipid metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1	all_hematologic(180;0.162)					TTACCTGCTAATATGTTGTTT	0.403													10	76	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	233767	233767	+	Intron	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:233767G>A	uc003jao.3	+						SDHA_uc003jan.2_Intron|SDHA_uc011clv.1_Intron|SDHA_uc011clw.1_Intron|SDHA_uc003jap.3_Intron|SDHA_uc003jaq.3_Intron|SDHA_uc003jar.3_Translation_Start_Site	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GAAGGTGCGTGTGATTTACCA	0.592									Familial_Paragangliomas				19	97	---	---	---	---	PASS
C5orf40	408263	broad.mit.edu	37	5	156769839	156769839	+	3'UTR	SNP	C	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156769839C>T	uc003lwu.2	-	2					CYFIP2_uc003lwq.2_Intron|CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001001343	NP_001001343	Q8TBE3	FNDC9_HUMAN	hypothetical protein LOC408263							integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGCTTTAGGCTACATGATGC	0.532											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	26	---	---	---	---	PASS
LMAN2	10960	broad.mit.edu	37	5	176778599	176778599	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176778599A>G	uc003mge.2	-	1	287	c.50T>C	c.(49-51)CTG>CCG	p.L17P	LMAN2_uc003mgd.2_Missense_Mutation_p.L17P	NM_006816	NP_006807	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2 precursor	17					protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	metal ion binding|sugar binding				0	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGCCTTCCCAGGCACCGCCG	0.637													4	25	---	---	---	---	PASS
GABRR1	2569	broad.mit.edu	37	6	89891701	89891701	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89891701G>T	uc003pna.2	-	8	1327	c.872C>A	c.(871-873)CCC>CAC	p.P291H	GABRR1_uc011dzv.1_Missense_Mutation_p.P268H	NM_002042	NP_002033	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 1	291	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)	CAGGGTAGCGGGGAAATAAGT	0.512													21	110	---	---	---	---	PASS
C6orf182	285753	broad.mit.edu	37	6	109484145	109484145	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109484145G>T	uc010kdk.2	+	13	1932	c.1355G>T	c.(1354-1356)AGA>ATA	p.R452I	C6orf182_uc003psx.3_3'UTR|C6orf182_uc010kdl.2_Missense_Mutation_p.R452I|C6orf182_uc003psy.3_Missense_Mutation_p.R452I	NM_001083535	NP_001077004	Q8IYX8	CE57L_HUMAN	hypothetical protein LOC285753	452						microtubule|microtubule organizing center					0		all_cancers(87;4.45e-07)|Acute lymphoblastic leukemia(125;2.15e-10)|all_hematologic(75;3.25e-08)|all_epithelial(87;0.000254)|Colorectal(196;0.0293)|all_lung(197;0.11)		BRCA - Breast invasive adenocarcinoma(108;0.00123)|Epithelial(106;0.0022)|all cancers(137;0.00405)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)		ATGAAATTGAGAAGAGATGAT	0.333													6	57	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136972151	136972151	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136972151A>C	uc003qhc.2	-	11	2120	c.1759T>G	c.(1759-1761)TCT>GCT	p.S587A	MAP3K5_uc011edj.1_5'UTR|MAP3K5_uc011edk.1_Missense_Mutation_p.S432A	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	587					activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TGCCAAATAGAGATTGTCTTT	0.348													11	43	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48767813	48767813	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48767813C>T	uc003xqi.2	-	51	6788	c.6731G>A	c.(6730-6732)TGC>TAC	p.C2244Y	PRKDC_uc003xqj.2_Missense_Mutation_p.C2244Y|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	2244					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				ATCCTTCCAGCACTCGACAAG	0.333								NHEJ					7	16	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110412378	110412378	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110412378T>A	uc003yne.2	+	13	1190	c.1086T>A	c.(1084-1086)AAT>AAA	p.N362K		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	362	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGGAATACAATGAAAAAACGC	0.418										HNSCC(38;0.096)			53	303	---	---	---	---	PASS
IKZF5	64376	broad.mit.edu	37	10	124753235	124753235	+	3'UTR	SNP	A	G	G			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124753235A>G	uc001lha.2	-	5					IKZF5_uc001lgz.2_3'UTR	NM_022466	NP_071911	Q9H5V7	IKZF5_HUMAN	zinc finger protein, subfamily 1A, 5						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_neural(114;0.169)|Colorectal(57;0.178)|Glioma(114;0.222)		Colorectal(40;0.0701)|COAD - Colon adenocarcinoma(40;0.0754)		GACCAAAACAAAAAACAAAAA	0.289													8	42	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47862007	47862007	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47862007G>C	uc001ngm.2	-	3	533	c.448C>G	c.(448-450)CGT>GGT	p.R150G	NUP160_uc009ylw.2_RNA|NUP160_uc001ngn.1_Missense_Mutation_p.R150G	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	150					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						ATTATCACACGATTCTGAGTC	0.413													11	143	---	---	---	---	PASS
C3AR1	719	broad.mit.edu	37	12	8211158	8211158	+	3'UTR	SNP	T	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8211158T>A	uc001qtv.1	-	2						NM_004054	NP_004045	Q16581	C3AR_HUMAN	complement component 3a receptor 1						blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)	1				Kidney(36;0.0893)		gaatttgcatttctaacaagt	0.085													5	12	---	---	---	---	PASS
YEATS4	8089	broad.mit.edu	37	12	69756582	69756582	+	Silent	SNP	T	G	G			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69756582T>G	uc001sux.2	+	2	287	c.66T>G	c.(64-66)GTT>GTG	p.V22V		NM_006530	NP_006521	O95619	YETS4_HUMAN	glioma-amplified sequence-41	22	YEATS.				histone H2A acetylation|histone H4 acetylation|mitosis|positive regulation of transcription, DNA-dependent|regulation of growth	NuA4 histone acetyltransferase complex|nuclear matrix	DNA binding|protein C-terminus binding|sequence-specific DNA binding transcription factor activity|structural constituent of cytoskeleton				0	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)			TTACTATCGTTAAACCAATAG	0.313													19	76	---	---	---	---	PASS
LUM	4060	broad.mit.edu	37	12	91497883	91497883	+	3'UTR	SNP	C	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91497883C>A	uc001tbm.2	-	3					LUM_uc001tbn.2_RNA	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor						collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						AATATGGATACTATGAAAACT	0.274													6	23	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99194855	99194855	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99194855C>T	uc001tge.1	-	20	3532	c.3115G>A	c.(3115-3117)GCC>ACC	p.A1039T	ANKS1B_uc001tgf.1_Missense_Mutation_p.A555T|ANKS1B_uc001tgk.2_Missense_Mutation_p.A336T|ANKS1B_uc010svd.1_Missense_Mutation_p.A45T|ANKS1B_uc001tgd.1_Missense_Mutation_p.A205T|ANKS1B_uc009ztq.2_5'UTR|ANKS1B_uc010sve.1_Missense_Mutation_p.A69T|ANKS1B_uc001tgh.3_Missense_Mutation_p.A45T|ANKS1B_uc001tgi.2_Missense_Mutation_p.A289T|ANKS1B_uc009ztr.2_Missense_Mutation_p.A229T|ANKS1B_uc001tgj.2_Missense_Mutation_p.A205T|ANKS1B_uc009ztp.2_Missense_Mutation_p.A70T|ANKS1B_uc010svf.1_Missense_Mutation_p.A69T|ANKS1B_uc001tgg.3_Missense_Mutation_p.A137T|ANKS1B_uc010svg.1_Missense_Mutation_p.A174T|ANKS1B_uc009zts.1_Missense_Mutation_p.A265T	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	1039						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GAGGCTGTGGCTTCATTCGGA	0.453													6	21	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42356908	42356908	+	Silent	SNP	C	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42356908C>A	uc001wvm.2	+	3	2278	c.1080C>A	c.(1078-1080)TCC>TCA	p.S360S	LRFN5_uc010ana.2_Silent_p.S360S	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	360	Extracellular (Potential).|Ig-like.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GCATTGCTTCCAATCCTGCTG	0.388										HNSCC(30;0.082)			10	147	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107062359	107062359	+	RNA	SNP	G	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107062359G>T	uc010tyt.1	-	131		c.6236C>A								Parts of antibodies, mostly variable regions.												0						AGACAGCGCAGATGAGGGACA	0.607													4	60	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33873752	33873752	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33873752T>C	uc001zhi.2	+	14	1551	c.1481T>C	c.(1480-1482)GTC>GCC	p.V494A	RYR3_uc010bar.2_Missense_Mutation_p.V494A	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	494	Cytoplasmic (By similarity).		V -> I.		cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGCTTAAATGTCTACAATAGC	0.443													26	120	---	---	---	---	PASS
CDAN1	146059	broad.mit.edu	37	15	43020179	43020179	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43020179C>G	uc001zql.2	-	22	3038	c.2921G>C	c.(2920-2922)TGT>TCT	p.C974S	CDAN1_uc001zqj.2_RNA|CDAN1_uc001zqk.2_Missense_Mutation_p.C300S	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	974						integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CAGCCAAGCACAGGCTTTCTC	0.537													26	425	---	---	---	---	PASS
DHX33	56919	broad.mit.edu	37	17	5372140	5372140	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5372140G>A	uc002gca.2	-	1	42	c.40C>T	c.(40-42)CGG>TGG	p.R14W	DHX33_uc002gcb.2_5'UTR|DHX33_uc010clf.2_Missense_Mutation_p.R14W	NM_020162	NP_064547	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	14						nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|pancreas(1)	2						GAGCCTGGCCGGAATCTCTTG	0.731													2	6	---	---	---	---	PASS
RHOT1	55288	broad.mit.edu	37	17	30477531	30477531	+	Intron	SNP	T	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30477531T>A	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron|RHOT1_uc002hgv.2_Intron|ARGFXP2_uc002hhc.2_RNA	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				AAGCCTTGCCTTATCATACTG	0.453													6	30	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37565879	37565879	+	Silent	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37565879G>A	uc002hrv.3	-	17	2807	c.2595C>T	c.(2593-2595)TTC>TTT	p.F865F	MED1_uc010wee.1_Silent_p.F693F|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	865	Interaction with ESR1.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		AATCAGGATTGAAATCTACTC	0.393										HNSCC(31;0.082)			36	151	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56083160	56083160	+	Splice_Site	SNP	A	G	G			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56083160A>G	uc002ivi.2	-	3	761	c.552_splice	c.e3+1	p.E184_splice	SFRS1_uc002ivj.2_Missense_Mutation_p.V185A	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		TGTATAACCTACCTCATGAGA	0.398													6	113	---	---	---	---	PASS
ENPP7	339221	broad.mit.edu	37	17	77710932	77710932	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77710932C>A	uc002jxa.2	+	4	1139	c.1119C>A	c.(1117-1119)TTC>TTA	p.F373L		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	373					negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GCCCTAGCTTCAGGGCGGGCC	0.607													4	60	---	---	---	---	PASS
TAF4B	6875	broad.mit.edu	37	18	23969879	23969879	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23969879G>A	uc002kvu.3	+	15	2981	c.2492G>A	c.(2491-2493)AGA>AAA	p.R831K	TAF4B_uc002kvs.3_RNA|TAF4B_uc002kvt.3_Missense_Mutation_p.R836K	NM_005640	NP_005631	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding	831	Required for interaction with TAF12.				transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleolus|transcription factor TFIID complex	DNA binding|NF-kappaB binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)|skin(1)	3	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			CATCGTCCAAGAATCACGAGA	0.438													6	183	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50450208	50450208	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50450208G>A	uc002lfe.1	+	4	1416	c.829G>A	c.(829-831)GAG>AAG	p.E277K	DCC_uc010xdr.1_Missense_Mutation_p.E125K	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	277	Extracellular (Potential).|Ig-like C2-type 3.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GTTACGAGGCGAGGAAGTCAT	0.373													8	115	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53385021	53385021	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53385021T>C	uc002qag.2	-	4	549	c.358A>G	c.(358-360)ACT>GCT	p.T120A	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.T66A|ZNF320_uc002qai.2_Missense_Mutation_p.T120A	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	120					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		GTACTACTAGTCAACTTTTTT	0.388													37	233	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53385022	53385022	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53385022C>A	uc002qag.2	-	4	548	c.357G>T	c.(355-357)TTG>TTT	p.L119F	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.L65F|ZNF320_uc002qai.2_Missense_Mutation_p.L119F	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	119					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		TACTACTAGTCAACTTTTTTA	0.388													38	230	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32379127	32379127	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32379127G>A	uc002wzy.2	+	15	2389	c.2369G>A	c.(2368-2370)GGC>GAC	p.G790D	ZNF341_uc002wzx.2_Missense_Mutation_p.G783D|ZNF341_uc010geq.2_Missense_Mutation_p.G700D|ZNF341_uc010ger.2_RNA|ZNF341_uc002wzz.2_Missense_Mutation_p.G217D	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	790					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GCTGTCCCCGGCAAGCCGCCC	0.701													3	36	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22663086	22663086	+	RNA	SNP	T	G	G	rs1054157	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22663086T>G	uc011aim.1	+	29		c.1859T>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						AGCTGCCACATAAGTTGTCCT	0.299													3	41	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22663087	22663087	+	RNA	SNP	A	G	G	rs1054158		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22663087A>G	uc011aim.1	+	29		c.1860A>G			LOC96610_uc011aiq.1_RNA|LOC96610_uc011aip.1_RNA|LOC96610_uc010gto.2_RNA					Parts of antibodies, mostly variable regions.												0						GCTGCCACATAAGTTGTCCTT	0.303													3	41	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24735484	24735484	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24735484G>A	uc004dbl.2	+	9	789	c.766G>A	c.(766-768)GAG>AAG	p.E256K	POLA1_uc004dbm.2_Missense_Mutation_p.E262K|POLA1_uc004dbn.2_Missense_Mutation_p.E120K	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	256					cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	TGACTTTGATGAGCCCATGGA	0.512													15	63	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38353317	38353320	+	Intron	DEL	CAAA	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38353317_38353320delCAAA	uc001ccg.1	-						INPP5B_uc009vvk.1_Intron|INPP5B_uc001ccf.1_Intron|INPP5B_uc010oij.1_Intron	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ggtgctgttgcaaacaaaaaccca	0.103													3	3	---	---	---	---	
YBX1	4904	broad.mit.edu	37	1	43162182	43162183	+	Intron	INS	-	CC	CC	rs113762321		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43162182_43162183insCC	uc001chs.2	+							NM_004559	NP_004550	P67809	YBOX1_HUMAN	nuclease sensitive element binding protein 1						CRD-mediated mRNA stabilization|negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|positive regulation of cell division|transcription from RNA polymerase II promoter	CRD-mediated mRNA stability complex|extracellular region|histone pre-mRNA 3'end processing complex|nucleoplasm|stress granule|U12-type spliceosomal complex	double-stranded DNA binding|protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(4)|upper_aerodigestive_tract(1)	5	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACGCAGTTGCGCCCCCCCCCCC	0.416													8	5	---	---	---	---	
APOA1BP	128240	broad.mit.edu	37	1	156562641	156562642	+	Intron	INS	-	CA	CA	rs148811958	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156562641_156562642insCA	uc001fph.2	+						APOA1BP_uc001fpg.2_Intron|APOA1BP_uc001fpi.2_Intron|APOA1BP_uc001fpj.2_Intron|APOA1BP_uc001fpk.2_Intron|APOA1BP_uc010php.1_Intron	NM_144772	NP_658985	Q8NCW5	AIBP_HUMAN	apolipoprotein A-I binding protein precursor							extracellular region	protein binding			central_nervous_system(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCATGAGTCCCACACACCACC	0.495													2	6	---	---	---	---	
DARS2	55157	broad.mit.edu	37	1	173819743	173819744	+	Intron	INS	-	T	T	rs66665709		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173819743_173819744insT	uc001gjh.1	+							NM_018122	NP_060592	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)	CTGCATAAATCttttttttttt	0.183													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207273438	207273439	+	IGR	DEL	TA	-	-	rs72516622		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273438_207273439delTA								C4BPB (103 upstream) : C4BPA (4072 downstream)																							tgtgtgtgtgtatgtgtgtgtg	0.257													4	2	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17959465	17959466	+	Intron	DEL	AT	-	-	rs10535307		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17959465_17959466delAT	uc010exo.2	-						GEN1_uc002rct.2_Intron|GEN1_uc010yjs.1_Intron|GEN1_uc002rcu.2_Intron	NM_024624	NP_078900	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					acacacacacatatatgtgtat	0.050													12	8	---	---	---	---	
IMMT	10989	broad.mit.edu	37	2	86400703	86400704	+	Intron	INS	-	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86400703_86400704insA	uc002sqz.3	-						IMMT_uc002sqy.3_5'Flank|IMMT_uc002srb.3_Intron|IMMT_uc002sra.3_Intron|IMMT_uc010ytd.1_Intron|IMMT_uc010yte.1_Intron|IMMT_uc002src.1_5'Flank|IMMT_uc002srd.2_Intron|IMMT_uc002sre.3_Intron|IMMT_uc010ytf.1_Intron|IMMT_uc010fgs.1_Intron	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1							integral to mitochondrial inner membrane	protein binding			skin(1)	1						aactccatctcaaaaaaaaaaa	0.139													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106105748	106105749	+	IGR	INS	-	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106105748_106105749insA								FHL2 (50518 upstream) : NCK2 (255605 downstream)																							aggaaggaaggaaggaaggaag	0.000													2	5	---	---	---	---	
UXS1	80146	broad.mit.edu	37	2	106739753	106739753	+	Intron	DEL	G	-	-	rs11325302		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106739753delG	uc002tdm.2	-						UXS1_uc002tdl.2_Intron|UXS1_uc002tdn.2_Intron|UXS1_uc002tdo.2_Intron|UXS1_uc010ywh.1_Intron	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1						cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						TTTACTTACAGGGGAAAAAAA	0.348													4	2	---	---	---	---	
MYO7B	4648	broad.mit.edu	37	2	128394875	128394876	+	Intron	INS	-	A	A	rs139192837	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128394875_128394876insA	uc002top.2	+						MYO7B_uc002tos.1_Frame_Shift_Ins_p.P322fs|MYO7B_uc002tot.2_Intron	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CTCTGACCCCCCCGTCCCCTGT	0.624													5	4	---	---	---	---	
GALNT13	114805	broad.mit.edu	37	2	154772641	154772642	+	Intron	INS	-	TTCC	TTCC	rs150452834	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154772641_154772642insTTCC	uc002tyr.3	+							NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						tccttccttcgttccttccttc	0.099													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176088017	176088018	+	IGR	DEL	TT	-	-	rs71407191		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176088017_176088018delTT								ATP5G3 (41527 upstream) : KIAA1715 (702392 downstream)																							tttctttctctttctttctttc	0.035													5	3	---	---	---	---	
PLCL1	5334	broad.mit.edu	37	2	198684609	198684612	+	Intron	DEL	TGTG	-	-	rs66908716		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198684609_198684612delTGTG	uc010fsp.2	+						PLCL1_uc002uuv.3_Intron	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	CTATTATGCAtgtgtgtgtgtgtg	0.147													4	2	---	---	---	---	
ATG7	10533	broad.mit.edu	37	3	11483144	11483146	+	Intron	DEL	ATT	-	-	rs12163595		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11483144_11483146delATT	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						tttttttttaatttttttttttt	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32677110	32677111	+	IGR	INS	-	G	G	rs148064913	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32677110_32677111insG								DYNC1LI1 (64760 upstream) : CNOT10 (49587 downstream)																							CCAGGACGCGAGAAAAAAAAAA	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	12947399	12947400	+	IGR	INS	-	GAAGGAAGGAAA	GAAGGAAGGAAA	rs148935395	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12947399_12947400insGAAGGAAGGAAA								None (None upstream) : HSP90AB2P (387637 downstream)																							aaggaaggaaggaaggaaggaa	0.005													3	3	---	---	---	---	
STIM2	57620	broad.mit.edu	37	4	27009063	27009063	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27009063delT	uc003gsh.3	+						STIM2_uc003gsg.3_Intron|STIM2_uc010iex.2_Intron|STIM2_uc010iey.2_Intron	NM_020860	NP_065911	Q9P246	STIM2_HUMAN	stromal interaction molecule 2						activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding			central_nervous_system(1)|skin(1)	2		Breast(46;0.0503)				TTAAAATAGCTTTTTTTTTTT	0.169													5	3	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	99996377	99996377	+	Intron	DEL	T	-	-	rs112636325		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99996377delT	uc003hui.2	-						ADH5_uc003huk.1_3'UTR|ADH5_uc003huj.2_Intron	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	ttttttgttgttttttttttt	0.119													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4119834	4119835	+	IGR	INS	-	TTCT	TTCT	rs143387872	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4119834_4119835insTTCT								IRX1 (518318 upstream) : LOC340094 (914637 downstream)																							tttctctttccttctttctttc	0.183													4	4	---	---	---	---	
MTMR12	54545	broad.mit.edu	37	5	32263538	32263539	+	Intron	INS	-	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32263538_32263539insT	uc003jhq.2	-						MTMR12_uc010iuk.2_Intron|MTMR12_uc010iul.2_Intron	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12							cytoplasm	phosphatase activity			ovary(1)	1						GACTGAGTCTCttttttttttt	0.173													6	3	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37305493	37305493	+	Intron	DEL	A	-	-	rs11317040		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37305493delA	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			caaaaaatacaaaaaaattgg	0.000													4	3	---	---	---	---	
SPINK6	404203	broad.mit.edu	37	5	147585796	147585803	+	Intron	DEL	ACCTAACC	-	-	rs62388546		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147585796_147585803delACCTAACC	uc003lpa.2	+							NM_205841	NP_995313	Q6UWN8	ISK6_HUMAN	serine protease inhibitor, Kazal type 6							extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTAAAAGAACCTAACCACACATTCTC	0.216													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157575627	157575628	+	IGR	INS	-	C	C			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157575627_157575628insC								CLINT1 (289459 upstream) : EBF1 (547296 downstream)																							cttccttccttcttccctccct	0.054													4	2	---	---	---	---	
CCNG1	900	broad.mit.edu	37	5	162866030	162866031	+	Intron	INS	-	A	A	rs72299838		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162866030_162866031insA	uc003lzb.2	+						CCNG1_uc011dek.1_Intron|CCNG1_uc011del.1_Intron|CCNG1_uc003lzc.2_Intron	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1						cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		gactccttctcaaaaaaaaaaa	0.168													4	4	---	---	---	---	
RUFY1	80230	broad.mit.edu	37	5	179021762	179021762	+	Intron	DEL	A	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179021762delA	uc003mka.1	+						RUFY1_uc003mkb.1_Intron|RUFY1_uc003mkc.1_Intron|RUFY1_uc003mkd.1_Intron	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a						endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			actctgtctcaaaaaaaaaaa	0.174										HNSCC(44;0.11)			4	2	---	---	---	---	
MRS2	57380	broad.mit.edu	37	6	24416484	24416484	+	Intron	DEL	T	-	-	rs35657958		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24416484delT	uc003neb.2	+						MRS2_uc003nea.2_Intron|MRS2_uc011djl.1_Intron|MRS2_uc011djm.1_Intron|MRS2_uc011djn.1_Intron|MRS2_uc003nec.2_Intron	NM_020662	NP_065713	Q9HD23	MRS2_HUMAN	MRS2-like, magnesium homeostasis factor						ion transport	integral to membrane|mitochondrial inner membrane					0						AATACTCAACttttttttttt	0.139													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29049194	29049197	+	IGR	DEL	TTCC	-	-	rs111521915		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29049194_29049197delTTCC								OR2W1 (36242 upstream) : OR2B3 (4789 downstream)																							ccttctctttttccttccttcctt	0.000													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32557230	32557230	+	Intron	DEL	A	-	-	rs28357085		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32557230delA	uc003obk.3	-						HLA-DRB1_uc003obp.3_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						CCCCTTACACAAGTCTCATGA	0.393													5	3	---	---	---	---	
SNX14	57231	broad.mit.edu	37	6	86251852	86251852	+	Intron	DEL	A	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86251852delA	uc003pkr.2	-						SNX14_uc003pkp.2_Intron|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		CAGTTTTGGGAAAAAAAAAAA	0.274													4	2	---	---	---	---	
C6orf165	154313	broad.mit.edu	37	6	88125702	88125702	+	Intron	DEL	A	-	-	rs34892535		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88125702delA	uc003plv.2	+						C6orf165_uc003plw.2_Intron|C6orf165_uc010kbv.1_Intron|C6orf165_uc003plu.1_Intron	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN	hypothetical protein LOC154313 isoform 1											central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TTTTTATCTGAAAAAAAAAAA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	31404676	31404676	+	IGR	DEL	A	-	-	rs35317967		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31404676delA								NEUROD6 (24138 upstream) : CCDC129 (149009 downstream)																							actctgtctcaaaaaaaaaaa	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67206114	67206117	+	IGR	DEL	TTCT	-	-	rs56895053		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67206114_67206117delTTCT								STAG3L4 (419602 upstream) : None (None downstream)																							ccttccttccttctttccttcctt	0.113													5	4	---	---	---	---	
NRCAM	4897	broad.mit.edu	37	7	107872523	107872523	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107872523delT	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						GAAGAAACACTTTTTTTTTTT	0.348													4	3	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	146741293	146741294	+	Intron	INS	-	AT	AT	rs148378854	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146741293_146741294insAT	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			tgcatagatacatatatatata	0.198										HNSCC(39;0.1)			9	4	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6390140	6390141	+	Intron	INS	-	C	C	rs141106218	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6390140_6390141insC	uc003wqi.2	+						ANGPT2_uc003wqj.3_Intron|ANGPT2_uc003wqk.3_Intron|ANGPT2_uc010lri.2_Intron|ANGPT2_uc003wql.3_Intron	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TACCTTGCCTTCCTTTTGGAAT	0.312													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	87103592	87103592	+	IGR	DEL	C	-	-	rs145573710	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87103592delC								PSKH2 (21741 upstream) : ATP6V0D2 (7547 downstream)																							gaaagaaagacaggaaggaag	0.000													4	2	---	---	---	---	
KCNV1	27012	broad.mit.edu	37	8	110985209	110985209	+	Intron	DEL	T	-	-	rs113449582		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110985209delT	uc003ynr.3	-						KCNV1_uc010mcw.2_Intron	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1							voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			TTAtttttccttttttttttt	0.134													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	136184772	136184774	+	IGR	DEL	CTG	-	-	rs72449624		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136184772_136184774delCTG								ABO (34142 upstream) : SURF6 (12779 downstream)																							GAGGCTGAGACTGCTGGATGAAG	0.621													4	2	---	---	---	---	
KCNT1	57582	broad.mit.edu	37	9	138606581	138606582	+	Intron	INS	-	GG	GG	rs141291153	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138606581_138606582insGG	uc011mdq.1	+						KCNT1_uc011mdr.1_Intron|KCNT1_uc010nbf.2_Intron	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1							membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GGACCGGGCGCGGGGTGGGGGC	0.614													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4734491	4734492	+	IGR	DEL	GT	-	-	rs71391963		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4734491_4734492delGT								LOC100216001 (14229 upstream) : AKR1E2 (133910 downstream)																							aggaaggaaggtgaaggaagga	0.149													6	3	---	---	---	---	
WAC	51322	broad.mit.edu	37	10	28824816	28824817	+	Intron	INS	-	T	T	rs144095892	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28824816_28824817insT	uc001iuf.2	+						WAC_uc001iud.2_Intron|WAC_uc001iue.2_Intron|WAC_uc009xlb.2_Intron|WAC_uc001iug.2_Intron|WAC_uc001iuh.2_Intron	NM_016628	NP_057712	Q9BTA9	WAC_HUMAN	WW domain-containing adapter with a coiled-coil						cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2						TAATCCTATCATTTTTTTTTTA	0.257													4	2	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29751492	29751495	+	Intron	DEL	TGTT	-	-	rs144445879		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29751492_29751495delTGTT	uc001iut.1	-						LOC387647_uc001iuo.1_Intron|LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Intron|SVIL_uc001iuu.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TTATATAAGATGTTTGTTAGTTTC	0.368													4	2	---	---	---	---	
C10orf68	79741	broad.mit.edu	37	10	32856935	32856935	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32856935delT	uc001iwn.3	+						CCDC7_uc001iwj.2_Intron|CCDC7_uc001iwk.2_Intron|CCDC7_uc009xlv.2_Intron|C10orf68_uc001iwl.1_Intron|C10orf68_uc001iwm.1_Intron	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68											skin(2)|ovary(1)	3						TGTTTTTGGGttttttttttt	0.124													4	2	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34964520	34964520	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34964520delT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				ATACCCCAACTTTTTTTTTTT	0.333													4	2	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51623014	51623015	+	Intron	INS	-	A	A			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51623014_51623015insA	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|uc010qhh.1_5'Flank|uc001jiu.2_Intron|uc010qhg.1_Intron|uc009xop.2_5'Flank	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		TGCCAGCAAGGAAAAAAAAAAC	0.455													4	3	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	68784892	68784893	+	Intron	DEL	AC	-	-	rs144688394	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68784892_68784893delAC	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmz.1_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						tctgtcaaaaacaaaaaaaaaa	0.094													6	3	---	---	---	---	
LIPN	643418	broad.mit.edu	37	10	90521476	90521479	+	Intron	DEL	CTAT	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90521476_90521479delCTAT	uc010qmw.1	+							NM_001102469	NP_001095939	Q5VXI9	LIPN_HUMAN	lipase-like, ab-hydrolase domain containing 4						lipid catabolic process	extracellular region	hydrolase activity				0		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		TGCTATTGTGctatctatctatct	0.211													4	3	---	---	---	---	
PI4K2A	55361	broad.mit.edu	37	10	99402621	99402622	+	Intron	DEL	TT	-	-	rs72182783		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99402621_99402622delTT	uc001kog.1	+						PI4K2A_uc010qoy.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		tctttctttctttttctttctt	0.089													2	5	---	---	---	---	
PPRC1	23082	broad.mit.edu	37	10	103909487	103909487	+	Intron	DEL	A	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103909487delA	uc001kum.2	+						PPRC1_uc001kun.2_Intron|PPRC1_uc010qqj.1_Intron|PPRC1_uc009xxa.2_Intron|NOLC1_uc001kuo.2_5'Flank|NOLC1_uc001kup.2_5'Flank|NOLC1_uc001kuq.2_5'Flank|NOLC1_uc009xxb.1_5'Flank|NOLC1_uc001kur.2_5'Flank	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		agactgtctcaaaaaaaaaaa	0.204													5	4	---	---	---	---	
CSDA	8531	broad.mit.edu	37	12	10854208	10854208	+	Intron	DEL	A	-	-	rs3214857		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10854208delA	uc001qyt.2	-						CSDA_uc001qyu.2_Intron	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a						negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					AACAGCTTACAAAACGGCAAC	0.294													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	27288144	27288144	+	IGR	DEL	A	-	-	rs11301501		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27288144delA								C12orf71 (52689 upstream) : STK38L (108934 downstream)																							CAGCACATTTAAAAAAAAAAA	0.348													4	3	---	---	---	---	
KRT77	374454	broad.mit.edu	37	12	53096333	53096338	+	Intron	DEL	TGTGTT	-	-	rs68056717		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53096333_53096338delTGTGTT	uc001saw.2	-						KRT77_uc009zmi.2_Intron	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN	keratin 77							keratin filament	structural molecule activity			ovary(1)	1						tgtgtgtgtgtgtgtttgtgtgtgtg	0.049													1	5	---	---	---	---	
YEATS4	8089	broad.mit.edu	37	12	69759837	69759837	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69759837delT	uc001sux.2	+							NM_006530	NP_006521	O95619	YETS4_HUMAN	glioma-amplified sequence-41						histone H2A acetylation|histone H4 acetylation|mitosis|positive regulation of transcription, DNA-dependent|regulation of growth	NuA4 histone acetyltransferase complex|nuclear matrix	DNA binding|protein C-terminus binding|sequence-specific DNA binding transcription factor activity|structural constituent of cytoskeleton				0	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)			TTCAAAATCCTTTTTTTTTTC	0.284													4	3	---	---	---	---	
IKBIP	121457	broad.mit.edu	37	12	99028313	99028313	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99028313delT	uc001tfv.2	-						IKBIP_uc001tfw.2_Intron|IKBIP_uc001tfx.2_Intron	NM_201612	NP_963906	Q70UQ0	IKIP_HUMAN	IKK interacting protein isoform 2						induction of apoptosis|response to X-ray	endoplasmic reticulum membrane|integral to membrane	protein binding				0						TAGCTGTAGGttttttttttt	0.169													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110073415	110073420	+	IGR	DEL	TCACTG	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110073415_110073420delTCACTG								MVK (38345 upstream) : C12orf34 (78770 downstream)																							accaccatcatcactgccaccaccat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97980620	97980627	+	IGR	DEL	CCTTCCTC	-	-	rs113634866		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97980620_97980627delCCTTCCTC								VRK1 (632670 upstream) : C14orf64 (411320 downstream)																							ttccttttttccttcctcccttcctccc	0.062													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22566684	22566684	+	IGR	DEL	A	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22566684delA								MIR1268 (53404 upstream) : GOLGA8DP (135601 downstream)																							GTAAAGCGTGAACAAGTAAGA	0.299													10	8	---	---	---	---	
FAM82A2	55177	broad.mit.edu	37	15	41037611	41037611	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41037611delT	uc001zmo.1	-						FAM82A2_uc001zmp.1_Intron|FAM82A2_uc001zmq.1_Intron	NM_018145	NP_060615	Q96TC7	RMD3_HUMAN	family with sequence similarity 82, member A2						apoptosis|cell differentiation	integral to membrane|microtubule|mitochondrial membrane|nucleus|spindle pole	protein binding				0						ACTTTTTTtcttttttttttt	0.219													9	4	---	---	---	---	
DAPK2	23604	broad.mit.edu	37	15	64217874	64217875	+	Intron	INS	-	GC	GC	rs147933961	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64217874_64217875insGC	uc002amr.2	-						DAPK2_uc010uim.1_Intron	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		GCTGACTTGTAGCGcacacaca	0.327													6	4	---	---	---	---	
ST8SIA2	8128	broad.mit.edu	37	15	93007302	93007303	+	Intron	INS	-	T	T	rs34156050		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93007302_93007303insT	uc002bra.2	+						ST8SIA2_uc002brb.2_Intron	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TGtttcttttcttttttttttt	0.441													3	3	---	---	---	---	
MGRN1	23295	broad.mit.edu	37	16	4718126	4718126	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4718126delT	uc002cwz.2	+						MGRN1_uc002cxa.2_Intron|MGRN1_uc010btx.2_Intron|MGRN1_uc010btw.2_Intron|MGRN1_uc002cxb.2_Intron|MGRN1_uc010uxo.1_Intron|MGRN1_uc010uxp.1_Intron|MGRN1_uc010uxq.1_Intron	NM_001142290	NP_001135762	O60291	MGRN1_HUMAN	mahogunin, ring finger 1 isoform 3						endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2						GGCCCCACCCttttttttttt	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85421898	85421899	+	IGR	INS	-	TGGA	TGGA			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85421898_85421899insTGGA								FAM92B (275784 upstream) : KIAA0182 (223130 downstream)																							ggatgggtgggtggatggatgg	0.000													4	3	---	---	---	---	
SRR	63826	broad.mit.edu	37	17	2221914	2221917	+	Intron	DEL	TTTT	-	-	rs140473085		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2221914_2221917delTTTT	uc002fue.1	+						SRR_uc002fui.1_Intron	NM_021947	NP_068766	Q9GZT4	SRR_HUMAN	serine racemase						D-serine biosynthetic process|L-serine metabolic process|protein homotetramerization|pyruvate biosynthetic process|response to lipopolysaccharide	cytoplasm|neuronal cell body|soluble fraction	ATP binding|calcium ion binding|D-serine ammonia-lyase activity|glycine binding|L-serine ammonia-lyase activity|magnesium ion binding|PDZ domain binding|protein homodimerization activity|pyridoxal phosphate binding|serine racemase activity|threonine racemase activity				0		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	tgcctggctatttttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	5620680	5620691	+	IGR	DEL	CTTCCTTCCTTC	-	-	rs61057456		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5620680_5620691delCTTCCTTCCTTC								NLRP1 (132848 upstream) : WSCD1 (351746 downstream)																							ctttctctttcttccttccttccttccttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	9669678	9669681	+	IGR	DEL	CTCT	-	-	rs72084350		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9669678_9669681delCTCT								USP43 (36677 upstream) : DHRS7C (5075 downstream)																							tccttccttcctctctctctctct	0.108													7	6	---	---	---	---	
CCDC144A	9720	broad.mit.edu	37	17	16649585	16649586	+	Intron	INS	-	T	T			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16649585_16649586insT	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A												0						ctctctctctcttttttttttt	0.109													9	4	---	---	---	---	
KRT26	353288	broad.mit.edu	37	17	38925002	38925003	+	Intron	INS	-	G	G			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38925002_38925003insG	uc002hvf.2	-							NM_181539	NP_853517	Q7Z3Y9	K1C26_HUMAN	keratin 26							intermediate filament	structural molecule activity				0		Breast(137;0.00526)				GCAATAATATACATTCCTGAGG	0.292													4	2	---	---	---	---	
TEX14	56155	broad.mit.edu	37	17	56680063	56680064	+	Intron	INS	-	T	T	rs11451118		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56680063_56680064insT	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					taacttctttatttttttttct	0.223													7	4	---	---	---	---	
RNF157	114804	broad.mit.edu	37	17	74160693	74160693	+	Intron	DEL	A	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74160693delA	uc002jqz.2	-						RNF157_uc002jra.2_Intron	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157								zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			TTCTTTGATTaaaaaaaaaaa	0.224													8	4	---	---	---	---	
DENND1C	79958	broad.mit.edu	37	19	6469043	6469043	+	Intron	DEL	T	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6469043delT	uc002mfe.2	-						DENND1C_uc002mfb.2_Intron|DENND1C_uc002mfc.2_Intron|DENND1C_uc002mfd.2_Intron|DENND1C_uc010xje.1_Intron	NM_024898	NP_079174	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1						TTAGTTAGtcttttttttttt	0.264													4	2	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9006225	9006226	+	Intron	INS	-	CT	CT	rs142182629	by1000genomes	TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9006225_9006226insCT	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCCTGGAGCCAGTTTCCTGGAT	0.480													5	3	---	---	---	---	
HKR1	284459	broad.mit.edu	37	19	37852826	37852827	+	Intron	DEL	AC	-	-	rs11344990		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37852826_37852827delAC	uc002ogb.2	+						HKR1_uc002ofx.2_Intron|HKR1_uc002ofy.2_Intron|HKR1_uc002oga.2_Intron|HKR1_uc010xto.1_Intron|HKR1_uc002ogc.2_Intron|HKR1_uc010xtp.1_Intron|HKR1_uc002ogd.2_Intron	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			aaaaaaaaaaacaaaaaaacaa	0.144													3	5	---	---	---	---	
ZFP28	140612	broad.mit.edu	37	19	57062145	57062145	+	Intron	DEL	C	-	-			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57062145delC	uc002qnj.2	+						ZFP28_uc002qni.2_3'UTR|uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		TCCTCCTTTGCCCCCTTCTCT	0.438													2	5	---	---	---	---	
C21orf81	391267	broad.mit.edu	37	21	15347257	15347258	+	Intron	INS	-	A	A	rs80199214		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15347257_15347258insA	uc002yji.2	-							NR_027270				Homo sapiens C21orf81 protein (C21orf81) mRNA, complete cds.												0						ACCCTGCACAGAAAAAAAGTTG	0.307													7	4	---	---	---	---	
EGFL6	25975	broad.mit.edu	37	X	13618385	13618386	+	Intron	INS	-	TTCT	TTCT	rs71913558		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13618385_13618386insTTCT	uc004cvi.2	+						EGFL6_uc004cvj.2_Intron|EGFL6_uc011mik.1_Intron	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN	epidermal growth factor-like protein 6						cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2						cctttctttccttctttctttc	0.119													4	3	---	---	---	---	
CTPS2	56474	broad.mit.edu	37	X	16716680	16716682	+	Intron	DEL	TTT	-	-	rs72307111		TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16716680_16716682delTTT	uc004cxk.2	-						CTPS2_uc004cxl.2_Intron|CTPS2_uc004cxm.2_Intron	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN	cytidine triphosphate synthase II						glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)					ctttgttttgtttttttttttta	0.138													4	3	---	---	---	---	
GPKOW	27238	broad.mit.edu	37	X	48978625	48978626	+	Intron	INS	-	AGG	AGG			TCGA-BP-4974-01A-01D-1462-08	TCGA-BP-4974-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48978625_48978626insAGG	uc004dmr.2	-							NM_015698	NP_056513	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs							nucleus	nucleic acid binding			ovary(2)	2						AAAATGATGACAGAAGGGGCAG	0.490													3	3	---	---	---	---	
