Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SKI	6497	broad.mit.edu	37	1	2234822	2234822	+	Silent	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2234822G>A	uc001aja.3	+	3	1266	c.1194G>A	c.(1192-1194)CCG>CCA	p.P398P		NM_003036	NP_003027	P12755	SKI_HUMAN	v-ski sarcoma viral oncogene homolog	398					anterior/posterior axis specification|BMP signaling pathway|bone morphogenesis|cell motility|cell proliferation|embryonic limb morphogenesis|face morphogenesis|lens morphogenesis in camera-type eye|myelination in peripheral nervous system|myotube differentiation|negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of fibroblast proliferation|negative regulation of osteoblast differentiation|negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|neural tube closure|nose morphogenesis|olfactory bulb development|palate development|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|protein homotrimerization|regulation of apoptosis|retina development in camera-type eye|skeletal muscle fiber development|SMAD protein signal transduction|somatic stem cell maintenance|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|PML body|transcription factor complex|transcriptional repressor complex	histone deacetylase inhibitor activity|nucleotide binding|protein domain specific binding|protein kinase binding|repressing transcription factor binding|SMAD binding|transcription corepressor activity|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		CACACCTCCCGGCCCTCATCC	0.642													29	53	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11227530	11227530	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11227530A>G	uc001asd.2	-	29	4419	c.4298T>C	c.(4297-4299)TTA>TCA	p.L1433S		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1433	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GGCATATTCTAACACTCCGGC	0.473													45	134	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918727	16918727	+	5'UTR	SNP	G	C	C			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918727G>C	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CGAGGTGCCTGAACTCAGAGC	0.463													2	16	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16956534	16956534	+	Intron	SNP	C	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16956534C>T	uc009vov.1	-						CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron|CROCCL1_uc001azi.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						GACGGCGCCACGCAGGTGTTC	0.433													6	30	---	---	---	---	PASS
PINK1	65018	broad.mit.edu	37	1	20976948	20976948	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20976948G>A	uc001bdm.2	+	8	1604	c.1510G>A	c.(1510-1512)GCA>ACA	p.A504T	PINK1_uc001bdn.2_Missense_Mutation_p.A197T	NM_032409	NP_115785	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1 precursor	504	Protein kinase.|Cytoplasmic (Potential).				cell death|intracellular protein kinase cascade|mitochondrion degradation|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of release of cytochrome c from mitochondria|regulation of protein complex assembly|regulation of protein ubiquitination|response to stress	cytosol|integral to membrane|mitochondrial outer membrane	ATP binding|C3HC4-type RING finger domain binding|calcium-dependent protein kinase activity|magnesium ion binding|protein serine/threonine kinase activity|ubiquitin protein ligase binding			ovary(2)|central_nervous_system(1)	3		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCGAGTAGCCGCAAATGTGCT	0.502													3	35	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21133885	21133885	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21133885C>T	uc001bec.2	-	32	4941	c.4685G>A	c.(4684-4686)GGC>GAC	p.G1562D	EIF4G3_uc010odi.1_Missense_Mutation_p.G1166D|EIF4G3_uc010odj.1_Missense_Mutation_p.G1561D|EIF4G3_uc009vpz.2_Missense_Mutation_p.G1282D|EIF4G3_uc001bed.2_Missense_Mutation_p.G1562D|EIF4G3_uc001bef.2_Missense_Mutation_p.G1598D|EIF4G3_uc001bee.2_Missense_Mutation_p.G1568D	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4	1562	EIF4A-binding (By similarity).|W2.				interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CAGAGCCACGCCCTTCCCATT	0.473													62	178	---	---	---	---	PASS
C1orf59	113802	broad.mit.edu	37	1	109192997	109192997	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109192997C>T	uc001dvt.3	-	7	830	c.592G>A	c.(592-594)GCA>ACA	p.A198T	C1orf59_uc001dvu.3_Missense_Mutation_p.A198T|C1orf59_uc009wer.2_Missense_Mutation_p.A198T	NM_001102592	NP_001096062	Q5T8I9	HENMT_HUMAN	hypothetical protein LOC113802	198					gene silencing by RNA|piRNA metabolic process	P granule	metal ion binding|O-methyltransferase activity|RNA binding|RNA methyltransferase activity				0		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0152)|Lung(183;0.0895)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.163)		TAGCGATTTGCCACATATAAA	0.428													4	89	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	143403563	143403563	+	5'Flank	SNP	C	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143403563C>A	uc001ejl.1	-						uc002zkn.1_RNA					DQ587539																		TTTCTTTGGCCACTTTGGCTG	0.453													3	10	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157494128	157494128	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157494128C>T	uc001fqu.2	-	10	2338	c.2180G>A	c.(2179-2181)TGT>TAT	p.C727Y	FCRL5_uc009wsm.2_Missense_Mutation_p.C727Y|FCRL5_uc010phv.1_Missense_Mutation_p.C727Y|FCRL5_uc010phw.1_Missense_Mutation_p.C642Y	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	727	Extracellular (Potential).|Ig-like C2-type 7.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GTCTGCCTCACAGGAGTAGAT	0.547													30	53	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158582607	158582607	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158582607C>A	uc001fst.1	-	51	7333	c.7134G>T	c.(7132-7134)CAG>CAT	p.Q2378H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2378	EF-hand 3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGAATCGGACCTGCTTCATGT	0.458													31	74	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243581287	243581287	+	Silent	SNP	T	C	C			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243581287T>C	uc001hzw.2	+	15	1918	c.1762T>C	c.(1762-1764)TTG>CTG	p.L588L	SDCCAG8_uc010pyk.1_Silent_p.L443L|SDCCAG8_uc010pyl.1_Silent_p.L400L|SDCCAG8_uc001hzx.2_Intron	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	588	Mediates interaction with OFD1.|Gln-rich.|Potential.|Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		ACAGTATTTGTTGCTGACCTC	0.373													40	138	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43973091	43973091	+	Silent	SNP	A	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43973091A>T	uc010yny.1	+	24	3725	c.3642A>T	c.(3640-3642)ACA>ACT	p.T1214T		NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	1214	FERM.					cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTCGTCTGACATACAAAAACA	0.378													21	35	---	---	---	---	PASS
IL1RL1	9173	broad.mit.edu	37	2	102956734	102956734	+	Splice_Site	SNP	T	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102956734T>G	uc002tbu.1	+	4	718	c.447_splice	c.e4+2	p.K149_splice	IL1RL1_uc010ywa.1_Splice_Site_p.K32_splice|IL18R1_uc002tbw.3_Intron|IL1RL1_uc002tbv.2_Splice_Site_p.K149_splice	NM_016232	NP_057316	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1 isoform 1						innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity			skin(2)|ovary(1)|central_nervous_system(1)	4						TGGTTTAAGGTAAGAAGAAAT	0.254													15	45	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163279898	163279898	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163279898T>G	uc002uch.1	-	9	2314	c.2102A>C	c.(2101-2103)GAA>GCA	p.E701A	KCNH7_uc002uci.2_Missense_Mutation_p.E694A	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	701	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	GAAATATTCTTCAAGACGTTG	0.453													57	196	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200193631	200193631	+	Silent	SNP	T	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200193631T>A	uc002uuy.1	-	8	1993	c.1176A>T	c.(1174-1176)GGA>GGT	p.G392G	SATB2_uc010fsq.1_Silent_p.G274G|SATB2_uc002uuz.1_Silent_p.G392G|SATB2_uc002uva.1_Silent_p.G392G	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	392	CUT 1.					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						CAGACAACAATCCCTGATTAA	0.463													10	33	---	---	---	---	PASS
ATG16L1	55054	broad.mit.edu	37	2	234178666	234178666	+	Silent	SNP	G	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234178666G>T	uc002vty.2	+	6	917	c.660G>T	c.(658-660)CTG>CTT	p.L220L	ATG16L1_uc002vtx.1_Silent_p.L76L|ATG16L1_uc002vua.2_Silent_p.L220L|ATG16L1_uc002vub.2_Silent_p.L97L|ATG16L1_uc002vtz.2_Silent_p.L76L|ATG16L1_uc002vud.3_Silent_p.L136L	NM_030803	NP_110430	Q676U5	A16L1_HUMAN	APG16 autophagy 16-like isoform 1	220	Potential.				autophagic vacuole assembly|protein homooligomerization|protein transport	autophagic vacuole|pre-autophagosomal structure membrane	protein binding				0		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		AAGCCCGGCTGCAGAAAGAGC	0.443													46	114	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241555893	241555893	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241555893G>A	uc002vzq.1	+	3	539	c.362G>A	c.(361-363)CGA>CAA	p.R121Q	GPR35_uc010fzh.1_5'UTR|GPR35_uc010fzi.1_5'UTR	NM_023089	NP_075577	Q9HC96	CAN10_HUMAN	calpain 10 isoform g	Error:Variant_position_missing_in_Q9HC96_after_alignment					actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		atctcctgtcgactgcgagtc	0.050													76	259	---	---	---	---	PASS
ITIH3	3699	broad.mit.edu	37	3	52842629	52842629	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52842629G>A	uc003dfv.2	+	22	2641	c.2605G>A	c.(2605-2607)GTC>ATC	p.V869I	ITIH3_uc011bek.1_Missense_Mutation_p.V677I	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	869					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTGCTGGTTCGTCCACAACAA	0.537													17	34	---	---	---	---	PASS
FAM86D	692099	broad.mit.edu	37	3	75480060	75480060	+	5'UTR	SNP	C	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75480060C>A	uc003dpp.3	-	3					FAM86D_uc003dpo.3_RNA|FAM86D_uc003dps.3_RNA|FAM86D_uc003dpq.3_5'UTR|FAM86D_uc003dpr.3_RNA	NR_024241				RecName: Full=Protein FAM86B1;												0						CAGGATGCTTCACAGTCTACG	0.527													3	31	---	---	---	---	PASS
MYNN	55892	broad.mit.edu	37	3	169502437	169502437	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169502437G>T	uc003fft.2	+	7	1940	c.1511G>T	c.(1510-1512)TGT>TTT	p.C504F	MYNN_uc011bpm.1_Missense_Mutation_p.C390F|MYNN_uc003ffu.2_Missense_Mutation_p.C504F|MYNN_uc003ffv.2_Missense_Mutation_p.C231F|MYNN_uc010hwo.2_Intron|MYNN_uc003ffw.1_RNA	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin	504	C2H2-type 8.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			TGCGAATTATGTGGAAATTCT	0.234													27	114	---	---	---	---	PASS
SH3BP2	6452	broad.mit.edu	37	4	2833702	2833702	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2833702A>G	uc003gfi.3	+	10	1523	c.1403A>G	c.(1402-1404)GAA>GGA	p.E468G	SH3BP2_uc011bvp.1_Missense_Mutation_p.E496G|SH3BP2_uc003gfj.3_Missense_Mutation_p.E525G|SH3BP2_uc003gfk.3_Missense_Mutation_p.E468G|SH3BP2_uc003gfl.3_Missense_Mutation_p.E401G|SH3BP2_uc003gfm.3_Missense_Mutation_p.E443G	NM_001122681	NP_001116153	P78314	3BP2_HUMAN	SH3-domain binding protein 2 isoform a	468	SH2.				signal transduction		SH3 domain binding|SH3/SH2 adaptor activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		TGCGAAGTGGAAAGGTCAGCA	0.612									Cherubism				9	25	---	---	---	---	PASS
GUCY1B3	2983	broad.mit.edu	37	4	156723600	156723600	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156723600G>A	uc003ipc.2	+	10	1449	c.1282G>A	c.(1282-1284)GTG>ATG	p.V428M	GUCY1B3_uc011cio.1_Missense_Mutation_p.V450M|GUCY1B3_uc011cip.1_Missense_Mutation_p.V408M|GUCY1B3_uc003ipd.2_Missense_Mutation_p.V356M|GUCY1B3_uc010iqf.2_Missense_Mutation_p.V395M|GUCY1B3_uc010iqg.2_Missense_Mutation_p.V399M|GUCY1B3_uc011ciq.1_Missense_Mutation_p.V356M	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	428	Guanylate cyclase.				blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		TAGTGGCATTGTGGGCTTCAA	0.498													15	35	---	---	---	---	PASS
PCDHGA2	56113	broad.mit.edu	37	5	140718869	140718869	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140718869G>T	uc003ljk.1	+	1	516	c.331G>T	c.(331-333)GAG>TAG	p.E111*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Nonsense_Mutation_p.E111*	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	111	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATTCTGCTGGAGGATAAATT	0.473													18	77	---	---	---	---	PASS
BRD2	6046	broad.mit.edu	37	6	32948548	32948548	+	3'UTR	SNP	A	C	C			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32948548A>C	uc003ocn.3	+	13					BRD2_uc003ocq.3_3'UTR|BRD2_uc003ocp.3_3'UTR|BRD2_uc010juh.2_3'UTR	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2						spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5						CCCCTAGACCACCCTGCCCCA	0.637													6	21	---	---	---	---	PASS
CRISP2	7180	broad.mit.edu	37	6	49660289	49660289	+	3'UTR	SNP	T	C	C			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49660289T>C	uc003ozq.2	-	10					CRISP2_uc003ozl.2_3'UTR|CRISP2_uc003ozn.2_3'UTR|CRISP2_uc003ozr.2_3'UTR|CRISP2_uc003ozo.2_3'UTR|CRISP2_uc003ozm.2_3'UTR|CRISP2_uc003ozp.2_3'UTR	NM_001142408	NP_001135880	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2 precursor							extracellular space				skin(1)	1	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			ATGTCAGAGTTCACAGTTGTC	0.358													3	0	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112513053	112513053	+	Splice_Site	SNP	C	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112513053C>G	uc003pvu.2	-	6	813	c.504_splice	c.e6-1	p.R168_splice	LAMA4_uc003pvv.2_Splice_Site_p.R168_splice|LAMA4_uc003pvt.2_Splice_Site_p.R168_splice	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGGAGCACATCTGAAGAGGAA	0.338													13	19	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21639512	21639512	+	Silent	SNP	C	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21639512C>T	uc003svc.2	+	15	2806	c.2775C>T	c.(2773-2775)CAC>CAT	p.H925H		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	925	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CTATAATGCACGACTTAGACT	0.398									Kartagener_syndrome				4	46	---	---	---	---	PASS
NAA38	51691	broad.mit.edu	37	7	117831972	117831972	+	Silent	SNP	C	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117831972C>G	uc003vjg.2	+	4	399	c.207C>G	c.(205-207)GTC>GTG	p.V69V		NM_016200	NP_057284	O95777	NAA38_HUMAN	U6 snRNA-associated Sm-like protein LSm8	69					nuclear mRNA splicing, via spliceosome	nucleus|ribonucleoprotein complex	protein binding|U6 snRNA binding				0						TTAGTGCAGTCATTGGAGAAA	0.333													4	55	---	---	---	---	PASS
SLC7A2	6542	broad.mit.edu	37	8	17401026	17401026	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17401026G>A	uc011kyc.1	+	2	347	c.178G>A	c.(178-180)GCC>ACC	p.A60T	SLC7A2_uc011kyd.1_Missense_Mutation_p.A100T|SLC7A2_uc011kye.1_Missense_Mutation_p.A100T|SLC7A2_uc011kyf.1_Missense_Mutation_p.A60T	NM_001008539	NP_001008539	P52569	CTR2_HUMAN	solute carrier family 7, member 2 isoform 2	60	Extracellular (Potential).				cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	TGGGGAGGTGGCCAAGGCAGA	0.607													3	40	---	---	---	---	PASS
KIAA0196	9897	broad.mit.edu	37	8	126075842	126075842	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126075842T>C	uc003yrt.2	-	11	1659	c.1330A>G	c.(1330-1332)AAA>GAA	p.K444E	KIAA0196_uc011lir.1_Missense_Mutation_p.K296E|KIAA0196_uc003yru.1_Missense_Mutation_p.K18E	NM_014846	NP_055661	Q12768	STRUM_HUMAN	strumpellin	444					cell death	WASH complex				ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GAACCCTCTTTCTTGTAATGC	0.388													25	72	---	---	---	---	PASS
PTCH1	5727	broad.mit.edu	37	9	98209386	98209386	+	Silent	SNP	C	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98209386C>G	uc004avk.3	-	23	4340	c.4152G>C	c.(4150-4152)CCG>CCC	p.P1384P	PTCH1_uc010mrn.2_Silent_p.P176P|PTCH1_uc010mro.2_Silent_p.P1233P|PTCH1_uc010mrp.2_Silent_p.P1233P|PTCH1_uc010mrq.2_Silent_p.P1233P|PTCH1_uc004avl.3_Silent_p.P1233P|PTCH1_uc010mrr.2_Silent_p.P1318P|PTCH1_uc004avm.3_Silent_p.P1383P	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L	1384	Cytoplasmic (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CAGGGACAGGCGGCGGGTGCA	0.692									Basal_Cell_Nevus_syndrome				14	22	---	---	---	---	PASS
DDX50	79009	broad.mit.edu	37	10	70695795	70695795	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70695795A>G	uc001jou.2	+	11	1662	c.1555A>G	c.(1555-1557)ACA>GCA	p.T519A	DDX50_uc010qjc.1_Missense_Mutation_p.T519A	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2	519	Helicase C-terminal.					nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						TGTTCCTTCTACAATGGATTT	0.294													22	56	---	---	---	---	PASS
VWA2	340706	broad.mit.edu	37	10	116045700	116045700	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116045700C>A	uc001lbl.1	+	11	1321	c.1000C>A	c.(1000-1002)CTG>ATG	p.L334M	VWA2_uc001lbk.1_Missense_Mutation_p.L334M|VWA2_uc009xyf.1_Missense_Mutation_p.L30M	NM_198496	NP_940898	Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	334						extracellular region				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5				Epithelial(162;0.036)|all cancers(201;0.0793)		CCCCGCAGCCCTGAAGCTGAG	0.617													3	19	---	---	---	---	PASS
WEE1	7465	broad.mit.edu	37	11	9598847	9598847	+	Intron	SNP	A	C	C			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9598847A>C	uc001mhs.2	+						WEE1_uc001mht.2_Intron|WEE1_uc001mhu.2_3'UTR	NM_003390	NP_003381	P30291	WEE1_HUMAN	WEE1 tyrosine kinase isoform 1						blood coagulation|cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|S phase of mitotic cell cycle	nucleoplasm	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	5				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		AGCTTGAGAAAATGAACATCG	0.308													40	96	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76261122	76261122	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76261122G>A	uc001oxl.2	+	21	4044	c.3901G>A	c.(3901-3903)GAC>AAC	p.D1301N	C11orf30_uc001oxm.2_Missense_Mutation_p.D1203N|C11orf30_uc010rsb.1_Missense_Mutation_p.D1316N|C11orf30_uc010rsc.1_Missense_Mutation_p.D1302N|C11orf30_uc001oxn.2_Missense_Mutation_p.D1302N|C11orf30_uc010rsd.1_Missense_Mutation_p.D1210N|C11orf30_uc010rse.1_Missense_Mutation_p.D548N|C11orf30_uc001oxp.2_Missense_Mutation_p.D234N	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	1301					chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						AATGGAGCAGGACATAGACAG	0.507													17	27	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6701634	6701634	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6701634A>T	uc001qpo.2	-	19	3037	c.2873T>A	c.(2872-2874)CTC>CAC	p.L958H	CHD4_uc001qpn.2_Missense_Mutation_p.L951H|CHD4_uc001qpp.2_Missense_Mutation_p.L955H	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	958					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						ATCGGCTTTGAGCCGCCGCAA	0.502													31	64	---	---	---	---	PASS
SLCO1A2	6579	broad.mit.edu	37	12	21454187	21454187	+	Silent	SNP	T	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21454187T>A	uc001rer.2	-	6	857	c.606A>T	c.(604-606)GGA>GGT	p.G202G	SLCO1A2_uc001res.2_Silent_p.G202G|SLCO1A2_uc010siq.1_Silent_p.G70G|SLCO1A2_uc010sio.1_Silent_p.G70G|SLCO1A2_uc010sip.1_Silent_p.G70G|SLCO1A2_uc001ret.2_Silent_p.G200G|SLCO1A2_uc001reu.2_Silent_p.G182G	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A	202	Cytoplasmic (Potential).				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						CAATAATAGCTCCTGTTTCTA	0.333													12	42	---	---	---	---	PASS
KRT77	374454	broad.mit.edu	37	12	53084872	53084872	+	3'UTR	SNP	C	T	T	rs643027	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53084872C>T	uc001saw.2	-	9					KRT77_uc009zmi.2_3'UTR	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN	keratin 77							keratin filament	structural molecule activity			ovary(1)	1						GAGAGGGGATCAGGAAGGGCG	0.532													3	39	---	---	---	---	PASS
PCBP2	5094	broad.mit.edu	37	12	53853119	53853119	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53853119G>A	uc001sdl.3	+	6	657	c.307G>A	c.(307-309)GTG>ATG	p.V103M	PCBP2_uc001sdc.3_Missense_Mutation_p.V103M|PCBP2_uc001sdb.3_Missense_Mutation_p.V103M|PCBP2_uc001sde.3_Missense_Mutation_p.V103M|PCBP2_uc001sdi.3_Missense_Mutation_p.V103M|PCBP2_uc001sdd.3_Missense_Mutation_p.V103M|PCBP2_uc001sdf.3_Missense_Mutation_p.V103M|PCBP2_uc009zna.2_Missense_Mutation_p.V64M|PCBP2_uc010soh.1_Missense_Mutation_p.V103M|PCBP2_uc009zmz.1_Missense_Mutation_p.V45M|PCBP2_uc001sdg.1_RNA	NM_001128911	NP_001122383	Q15366	PCBP2_HUMAN	poly(rC) binding protein 2 isoform d	103	KH 2.				innate immune response|negative regulation of defense response to virus|negative regulation of type I interferon production|nuclear mRNA splicing, via spliceosome|proteasomal ubiquitin-dependent protein catabolic process|response to virus	cytosol|nucleoplasm|ribonucleoprotein complex	DNA binding|RNA binding|ubiquitin protein ligase binding				0						CCTGAGGCTGGTGGTCCCTGC	0.478													45	85	---	---	---	---	PASS
GAS2L3	283431	broad.mit.edu	37	12	101017385	101017385	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101017385G>A	uc001thu.2	+	10	1028	c.802G>A	c.(802-804)GAT>AAT	p.D268N	GAS2L3_uc009zty.2_Missense_Mutation_p.D268N|GAS2L3_uc001thv.2_Missense_Mutation_p.D164N	NM_174942	NP_777602	Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	268	GAR.				cell cycle arrest					skin(1)	1						TGGAGGCTGGGATACTCTTCA	0.368													50	110	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120622633	120622633	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120622633C>T	uc001txo.2	-	3	192	c.179G>A	c.(178-180)CGA>CAA	p.R60Q		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	60					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCACCTATATCGATGCAGAGT	0.383													29	78	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86088842	86088842	+	Silent	SNP	C	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86088842C>T	uc001xvr.2	+	2	1751	c.984C>T	c.(982-984)ATC>ATT	p.I328I	FLRT2_uc010atd.2_Silent_p.I328I	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	328	Extracellular (Potential).|LRRCT.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TCAAATATATCCCTTCATCTC	0.458													73	196	---	---	---	---	PASS
ARRDC4	91947	broad.mit.edu	37	15	98514489	98514489	+	3'UTR	SNP	A	G	G	rs3803385	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98514489A>G	uc010bom.2	+	8					ARRDC4_uc002bui.3_3'UTR	NM_183376	NP_899232	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4						signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CTTTTTGGGAAAGAGACAGGA	0.393													4	43	---	---	---	---	PASS
TRADD	8717	broad.mit.edu	37	16	67190505	67190505	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67190505T>C	uc002eri.1	-	2	139	c.59A>G	c.(58-60)GAG>GGG	p.E20G	TRADD_uc002erh.1_5'Flank|TRADD_uc010vjb.1_Missense_Mutation_p.E20G	NM_003789	NP_003780	Q15628	TRADD_HUMAN	TNFRSF1A-associated via death domain	20					activation of caspase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|tumor necrosis factor-mediated signaling pathway	cytoskeleton|cytosol|receptor complex	binding, bridging|death domain binding|identical protein binding|kinase binding|signal transducer activity			lung(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		CAGCGAGGACTCCACAAACAG	0.607											OREG0023872	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	32	79	---	---	---	---	PASS
CHAD	1101	broad.mit.edu	37	17	48543170	48543170	+	Missense_Mutation	SNP	C	T	T	rs142146358		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48543170C>T	uc010dbr.2	-	2	889	c.836G>A	c.(835-837)CGC>CAC	p.R279H	ACSF2_uc002iqu.2_Intron|ACSF2_uc010wml.1_Intron|ACSF2_uc010wmm.1_Intron|ACSF2_uc010wmn.1_Intron|ACSF2_uc010wmo.1_Intron|CHAD_uc010dbs.2_Missense_Mutation_p.R279H|ACSF2_uc010dbt.1_5'Flank	NM_001267	NP_001258	O15335	CHAD_HUMAN	chondroadherin precursor	279	LRR 9.				regulation of cell growth	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(2)|central_nervous_system(1)	3	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CTGGTTCAAGCGGTTGTTCTC	0.473													37	104	---	---	---	---	PASS
PTPRS	5802	broad.mit.edu	37	19	5231368	5231368	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5231368C>A	uc002mbv.2	-	14	2342	c.2108G>T	c.(2107-2109)GGA>GTA	p.G703V	PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Missense_Mutation_p.G690V|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	703	Extracellular (Potential).|Fibronectin type-III 4.				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		GGGCCCTGGTCCCACCTCTGT	0.697													3	34	---	---	---	---	PASS
PLEKHG2	64857	broad.mit.edu	37	19	39915872	39915872	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39915872A>G	uc010xuz.1	+	19	4424	c.4099A>G	c.(4099-4101)ACA>GCA	p.T1367A	PLEKHG2_uc010xuy.1_Intron|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Missense_Mutation_p.T1145A	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	1367					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CTTGGCCTCCACACAGGAATC	0.632													7	39	---	---	---	---	PASS
C20orf11	54994	broad.mit.edu	37	20	61574871	61574871	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61574871C>T	uc002ydy.2	+	4	517	c.340C>T	c.(340-342)CGC>TGC	p.R114C		NM_017896	NP_060366	Q9NWU2	CT011_HUMAN	chromosome 20 open reading frame 11	114	CTLH.					nucleus	protein binding				0	Breast(26;5.68e-08)					CGAGCTGATCCGCCAGCGGGA	0.622													11	23	---	---	---	---	PASS
RNF113A	7737	broad.mit.edu	37	X	119004755	119004755	+	Silent	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119004755G>A	uc004esb.2	-	1	1037	c.822C>T	c.(820-822)GTC>GTT	p.V274V	NDUFA1_uc004esc.3_5'Flank	NM_006978	NP_008909	O15541	R113A_HUMAN	ring finger protein 113A	274	RING-type.						nucleic acid binding|zinc ion binding			breast(2)	2						TGCACTTGGTGACAACTGGGT	0.498													29	100	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3834	3834	+	RNA	SNP	G	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3834G>A	uc004cos.3	+	2		c.2127G>A			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		TGATTACTCCTGCCATCATGA	0.468													4	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	20200621	20200623	+	IGR	DEL	CAC	-	-	rs144954291		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20200621_20200623delCAC								RNF186 (58850 upstream) : OTUD3 (8265 downstream)																							ccaccaccatcaccaccaccacc	0.202													4	2	---	---	---	---	
CLSPN	63967	broad.mit.edu	37	1	36203716	36203716	+	Intron	DEL	T	-	-	rs67465242		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36203716delT	uc001bzi.2	-						CLSPN_uc009vux.2_Intron	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin						activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AAAAAAAAAatatatatatat	0.333													15	12	---	---	---	---	
RNF11	26994	broad.mit.edu	37	1	51716222	51716222	+	Intron	DEL	T	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51716222delT	uc001csi.3	+							NM_014372	NP_055187	Q9Y3C5	RNF11_HUMAN	ring finger protein 11						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	DNA binding|protein binding|zinc ion binding				0						tttgtgacaatttTTTTTTTT	0.224													4	2	---	---	---	---	
KIAA1324	57535	broad.mit.edu	37	1	109726258	109726259	+	Intron	INS	-	CTTCCTTT	CTTCCTTT	rs150843023	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109726258_109726259insCTTCCTTT	uc001dwq.2	+						KIAA1324_uc009wex.1_Intron|KIAA1324_uc009wey.2_Intron|KIAA1324_uc010ovg.1_Intron	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor						macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		ttccttccttcctAacagagtc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142803299	142803302	+	Intron	DEL	CAAC	-	-	rs79529551		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803299_142803302delCAAC	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		acaacaacaacaacaaACAGGATG	0.225													7	4	---	---	---	---	
DGKD	8527	broad.mit.edu	37	2	234359866	234359873	+	Intron	DEL	TAAAAACA	-	-	rs13389393	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234359866_234359873delTAAAAACA	uc002vui.1	+						DGKD_uc002vuj.1_Intron|DGKD_uc010fyh.1_Intron|DGKD_uc010fyi.1_Intron	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TTTTTTTTTTTAAAAACAAAAAACAAAA	0.433													4	2	---	---	---	---	
CHRD	8646	broad.mit.edu	37	3	184106176	184106187	+	Intron	DEL	CATCCATCCATC	-	-	rs111934608		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184106176_184106187delCATCCATCCATC	uc003fov.2	+						CHRD_uc003fow.2_Intron|CHRD_uc003fox.2_Intron|CHRD_uc003foy.2_Intron|CHRD_uc010hyc.2_Intron|CHRD_uc011brr.1_Intron	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor						BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			cccattgatgcatccatccatccatccatcca	0.042													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	135393585	135393586	+	IGR	INS	-	AAGG	AAGG	rs144776837	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135393585_135393586insAAGG								PABPC4L (270682 upstream) : None (None downstream)																							agaaggaaggaaaggaaggaag	0.040													7	4	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1093609	1093610	+	Intron	INS	-	GGGCGGGGACT	GGGCGGGGACT	rs138268307	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1093609_1093610insGGGCGGGGACT	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGGGACACACGGGGCGGGGACT	0.668													4	3	---	---	---	---	
PPWD1	23398	broad.mit.edu	37	5	64880705	64880706	+	Intron	INS	-	AAA	AAA	rs10682457		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64880705_64880706insAAA	uc003jtv.3	+						PPWD1_uc011cqv.1_Intron|PPWD1_uc011cqw.1_Intron	NM_015342	NP_056157	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		TAGAGATTATGAAAAAAAAAAA	0.332													5	3	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70888665	70888666	+	Intron	INS	-	T	T			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70888665_70888666insT	uc003kbs.3	+						MCCC2_uc010iyv.1_Intron|MCCC2_uc003kbt.3_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	ACAGACCACTGTTTTTTTTTTT	0.460													5	4	---	---	---	---	
MSH3	4437	broad.mit.edu	37	5	80074815	80074816	+	Intron	DEL	AC	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80074815_80074816delAC	uc003kgz.2	+							NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ttttttttttactttttttttt	0.134								MMR					4	3	---	---	---	---	
FTSJD2	23070	broad.mit.edu	37	6	37420622	37420622	+	Intron	DEL	T	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37420622delT	uc003ons.2	+						FTSJD2_uc010jwu.2_Intron	NM_015050	NP_055865	Q8N1G2	MTR1_HUMAN	FtsJ methyltransferase domain containing 2						mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CCTGTTTACATTTTTTTTTTT	0.244													3	3	---	---	---	---	
RMND1	55005	broad.mit.edu	37	6	151748510	151748511	+	Intron	INS	-	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151748510_151748511insA	uc003qoi.2	-						RMND1_uc011eeq.1_Intron	NM_017909	NP_060379	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog												0		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		gactccgtctcaaaaaaaaaaa	0.134													6	3	---	---	---	---	
SYTL3	94120	broad.mit.edu	37	6	159166782	159166783	+	Intron	INS	-	A	A	rs11481135		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159166782_159166783insA	uc003qrp.2	+						SYTL3_uc011efp.1_Intron|SYTL3_uc003qro.2_Intron|SYTL3_uc003qrq.2_Intron|SYTL3_uc003qrr.2_Intron|SYTL3_uc003qrs.2_Intron|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3						intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		agacaattattaaaaaaaaaaa	0.054													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	44545213	44545214	+	IGR	INS	-	GAAG	GAAG			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44545213_44545214insGAAG								NUDCD3 (14828 upstream) : NPC1L1 (6922 downstream)																							agggaaggaaagaaggaaggaa	0.084													6	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131275575	131275575	+	IGR	DEL	C	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131275575delC								PODXL (34199 upstream) : PLXNA4 (532517 downstream)																							ttccttccttccttccttcct	0.070													9	4	---	---	---	---	
FBXO25	26260	broad.mit.edu	37	8	418672	418673	+	Intron	INS	-	G	G			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:418672_418673insG	uc003wox.2	+						FBXO25_uc003woy.2_Intron|FBXO25_uc003woz.2_Intron|FBXO25_uc003wpa.2_Intron	NM_183421	NP_904357	Q8TCJ0	FBX25_HUMAN	F-box only protein 25 isoform 1							nucleus|SCF ubiquitin ligase complex	actin binding|ubiquitin-protein ligase activity			lung(1)	1		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		AGAGTGTGGCTGGTGGTGGGGC	0.614													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	36165702	36165703	+	IGR	DEL	AC	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36165702_36165703delAC								UNC5D (513522 upstream) : KCNU1 (476139 downstream)																							gtgtgtatgaacacacacacat	0.252													4	2	---	---	---	---	
WDR67	93594	broad.mit.edu	37	8	124154738	124154738	+	Intron	DEL	T	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124154738delT	uc003ypp.1	+						WDR67_uc011lig.1_Intron|WDR67_uc011lih.1_Intron|WDR67_uc003ypq.1_Intron|WDR67_uc003yps.1_Intron|WDR67_uc003ypt.1_Intron|WDR67_uc003ypu.1_Intron	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1							centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			CAAGCATTGATTTtttttttt	0.149													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	11085585	11085586	+	IGR	INS	-	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11085585_11085586insA								PTPRD (472862 upstream) : None (None downstream)																							tttcaaaagagaaaaaaaaaaa	0.000													4	3	---	---	---	---	
TMEM2	23670	broad.mit.edu	37	9	74331268	74331268	+	Intron	DEL	A	-	-	rs35467741		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74331268delA	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		ATTAATCCAGAAAAAAAAAAA	0.289													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	107723323	107723326	+	IGR	DEL	GGAG	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107723323_107723326delGGAG								ABCA1 (32887 upstream) : SLC44A1 (283603 downstream)																							aggaaggaaaggagggagggaggg	0.078													5	6	---	---	---	---	
KIAA1274	27143	broad.mit.edu	37	10	72245966	72245969	+	Intron	DEL	TTTT	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72245966_72245969delTTTT	uc001jrd.3	+							NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						AGTCAATATCTTTTTTTTTTTTTT	0.436													4	2	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112654478	112654478	+	Intron	DEL	T	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112654478delT	uc001kzh.2	+						PDCD4_uc001kzg.2_Intron|PDCD4_uc010qre.1_Intron	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CACTGCAGTGTTTTTTTTTTT	0.279													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132769952	132769955	+	IGR	DEL	TTTT	-	-	rs10829858	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132769952_132769955delTTTT								GLRX3 (787168 upstream) : TCERG1L (120701 downstream)																							tccttccttcttttcttccttcct	0.113													6	6	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ctccctgcactccctgcctctcccgcattccctgcctc	0.193													4	3	---	---	---	---	
RRM1	6240	broad.mit.edu	37	11	4119689	4119689	+	Intron	DEL	A	-	-	rs34474617		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4119689delA	uc001lyw.3	+						RRM1_uc009yeh.1_Intron|RRM1_uc009yei.2_Intron|RRM1_uc010qyc.1_Intron	NM_001033	NP_001024	P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	ACAGCCTGCTAATATTATTTT	0.075													6	4	---	---	---	---	
PRKRIR	5612	broad.mit.edu	37	11	76066593	76066593	+	Intron	DEL	T	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76066593delT	uc001oxh.1	-						PRKRIR_uc010rrz.1_Intron	NM_004705	NP_004696	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double						negative regulation of cell proliferation|response to stress|signal transduction		DNA binding|metal ion binding|protein dimerization activity			ovary(2)|pancreas(1)	3						AACATATTTATTTGTCCTTAC	0.343													9	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90671350	90671351	+	IGR	INS	-	AGAAT	AGAAT	rs5793501	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90671350_90671351insAGAAT								MIR1261 (68980 upstream) : None (None downstream)																							ggaaagaagaaagaaggaagga	0.248													4	7	---	---	---	---	
MRPL42	28977	broad.mit.edu	37	12	93873089	93873090	+	Intron	INS	-	A	A	rs34328828		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93873089_93873090insA	uc001tcr.2	+						MRPL42_uc001tcq.2_Intron|MRPL42_uc001tcs.2_Intron|MRPL42_uc001tct.2_Intron	NM_172177	NP_751917	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42 isoform a						translation	mitochondrial small ribosomal subunit	structural constituent of ribosome			ovary(2)	2						gagtccatctcaaaaaaaaaaa	0.243													9	9	---	---	---	---	
GPR81	27198	broad.mit.edu	37	12	123201446	123201446	+	Intron	DEL	A	-	-	rs35024436		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123201446delA	uc001ucw.1	-						GPR109B_uc001ucy.3_5'Flank	NM_032554		Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81						response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CGAAATCTCTAAAAAAAAAAA	0.403													2	4	---	---	---	---	
TPP2	7174	broad.mit.edu	37	13	103257477	103257478	+	Intron	INS	-	CAGTAGTTCA	CAGTAGTTCA	rs145083043	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103257477_103257478insCAGTAGTTCA	uc001vpi.3	+							NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II						proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					taacggggttccagtcgccctg	0.000													5	3	---	---	---	---	
TMOD3	29766	broad.mit.edu	37	15	52200810	52200810	+	Intron	DEL	T	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52200810delT	uc002abm.2	+						TMOD3_uc010bfc.1_Intron|TMOD3_uc002abn.2_5'Flank	NM_014547	NP_055362	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)							cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		AAGTAGGTTGttttttttttt	0.338													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94521853	94521860	+	IGR	DEL	CTTTCTTT	-	-	rs71458723		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94521853_94521860delCTTTCTTT								RGMA (889420 upstream) : MCTP2 (252941 downstream)																							ttcttccttcctttctttctttctttct	0.000													3	5	---	---	---	---	
NLRC5	84166	broad.mit.edu	37	16	57111993	57111994	+	Intron	INS	-	G	G	rs142860883	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57111993_57111994insG	uc002ekk.1	+						NLRC5_uc010ccr.1_Intron|NLRC5_uc010ccs.1_Intron|NLRC5_uc002eko.1_Intron|NLRC5_uc002ekq.1_Intron|NLRC5_uc002ekr.1_Intron	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				TCGGGAGCAGTGGGGGGGTCCA	0.649													4	3	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36358657	36358658	+	Intron	INS	-	A	A			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36358657_36358658insA	uc010wdn.1	-						TBC1D3_uc010cvk.2_5'Flank			Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TATATTCTCTTAATTATTATTT	0.252													5	6	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3742950	3742965	+	Intron	DEL	CTTCCTTCCTTCCTTC	-	-	rs36220699		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3742950_3742965delCTTCCTTCCTTCCTTC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				ATCAATTTATcttccttccttccttccttccttcct	0.236													6	4	---	---	---	---	
TXNL4A	10907	broad.mit.edu	37	18	77737811	77737815	+	Intron	DEL	TTTTG	-	-	rs71338078		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77737811_77737815delTTTTG	uc002lnp.2	-						TXNL4A_uc002lnr.2_Intron|TXNL4A_uc002lnq.2_Intron|TXNL4A_uc010drf.2_Intron|TXNL4A_uc010drg.2_Intron	NM_006701	NP_006692	P83876	TXN4A_HUMAN	thioredoxin-like 4A						cell division|mitosis|spliceosome assembly	nucleoplasm|spliceosomal complex	protein binding				0		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		TCAGGGCAAtttttgttttgttttt	0.137													6	4	---	---	---	---	
GRIN3B	116444	broad.mit.edu	37	19	1003373	1003374	+	Frame_Shift_Ins	INS	-	G	G	rs34585248	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1003373_1003374insG	uc002lqo.1	+	2	671_672	c.671_672insG	c.(670-672)GCGfs	p.A224fs		NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	224	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	CCGATGGCGGCGCCAGTGGGGG	0.743													4	2	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11517667	11517667	+	Intron	DEL	T	-	-	rs5827125		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11517667delT	uc002mrp.2	-						RGL3_uc002mrn.2_Intron|RGL3_uc002mrm.2_Intron|RGL3_uc002mro.2_Intron	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						CTCTCTTAAAttttttttttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	16092412	16092412	+	IGR	DEL	A	-	-	rs111578902		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16092412delA								OR10H4 (31645 upstream) : LOC126536 (34032 downstream)																							AGAAAACCAGAAAAAAAAAAT	0.303													8	8	---	---	---	---	
MYO9B	4650	broad.mit.edu	37	19	17315973	17315974	+	Intron	INS	-	AAG	AAG	rs77831839		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17315973_17315974insAAG	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron|MYO9B_uc002nfl.1_Intron|MYO9B_uc002nfm.1_5'Flank	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						aaaaaaaaaaaaagaaGGCAAT	0.322													7	5	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17741883	17741886	+	Intron	DEL	TCCT	-	-	rs145348480		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17741883_17741886delTCCT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						cctccctccctccttccttccttc	0.284													5	3	---	---	---	---	
GPCPD1	56261	broad.mit.edu	37	20	5545874	5545874	+	Intron	DEL	T	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5545874delT	uc002wme.3	-						GPCPD1_uc002wmd.3_Intron	NM_019593	NP_062539	Q9NPB8	GPCP1_HUMAN	hypothetical protein LOC56261						glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity				0						CTGAGATCCCttttttttttt	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44621893	44621893	+	IGR	DEL	A	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44621893delA								ZNF335 (21060 upstream) : MMP9 (15654 downstream)																							ctttctatttaaaaaaaaaag	0.020													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57159887	57159888	+	Intron	INS	-	CTTC	CTTC	rs142796198	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57159887_57159888insCTTC	uc002xzg.1	+											Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																		ctcccttctttcttccttcctt	0.000													3	4	---	---	---	---	
COL9A3	1299	broad.mit.edu	37	20	61460913	61460914	+	Intron	INS	-	G	G	rs148586955	by1000genomes	TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61460913_61460914insG	uc002ydm.2	+							NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor						axon guidance	collagen type IX					0	Breast(26;5.68e-08)					GGCAAGGGGCTGGGGGGCCAGC	0.693													13	12	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31298099	31298113	+	Intron	DEL	AAAAAAAAAAAAACG	-	-	rs60499517		TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31298099_31298113delAAAAAAAAAAAAACG	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Intron|OSBP2_uc003ajb.2_Intron|OSBP2_uc011ald.1_Intron|OSBP2_uc010gwd.1_Intron	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						caatataagaaaaaaaaaaAAAACGAAAAAAAAAA	0.237													6	3	---	---	---	---	
TBC1D22A	25771	broad.mit.edu	37	22	47308217	47308217	+	Intron	DEL	G	-	-			TCGA-BP-5001-01A-01D-1462-08	TCGA-BP-5001-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47308217delG	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		GAGAATAATAGTTTTCTCATC	0.264													7	4	---	---	---	---	
