Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11217299	11217299	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11217299A>G	uc001asd.2	-	30	4500	c.4379T>C	c.(4378-4380)CTT>CCT	p.L1460P		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1460	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						ATAGGCCACAAGGGCATCCTC	0.547													57	133	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19455528	19455528	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19455528G>A	uc001bbi.2	-	61	8951	c.8947C>T	c.(8947-8949)CAG>TAG	p.Q2983*	UBR4_uc001bbk.1_Nonsense_Mutation_p.Q630*	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2983					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGCAGGGTCTGCAGTAATCTC	0.493													44	116	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86453338	86453338	+	Splice_Site	SNP	C	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86453338C>A	uc001dlj.2	-	20	2353	c.2311_splice	c.e20-1	p.G771_splice	COL24A1_uc010osd.1_Splice_Site_p.G71_splice|COL24A1_uc001dlk.2_Splice_Site|COL24A1_uc010ose.1_Splice_Site|COL24A1_uc010osf.1_Splice_Site	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTGGAAAACCCTAGGGAATAT	0.358													28	120	---	---	---	---	PASS
GPATCH4	54865	broad.mit.edu	37	1	156564922	156564922	+	3'UTR	SNP	C	T	T	rs3795733	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156564922C>T	uc001fpm.2	-	8					APOA1BP_uc010php.1_Intron|GPATCH4_uc001fpl.2_3'UTR	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1							intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTAGCCCCGCCATCCTTCTCA	0.527													5	117	---	---	---	---	PASS
GPATCH4	54865	broad.mit.edu	37	1	156565621	156565621	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156565621G>T	uc001fpm.2	-	8	551	c.512C>A	c.(511-513)ACA>AAA	p.T171K	APOA1BP_uc010php.1_Intron|GPATCH4_uc001fpl.2_Missense_Mutation_p.T166K	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1	166	Potential.					intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCCTTCATTGTGATCCCAAG	0.597													11	50	---	---	---	---	PASS
DEDD	9191	broad.mit.edu	37	1	161093979	161093979	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161093979T>A	uc001fxz.2	-	3	447	c.274A>T	c.(274-276)ATC>TTC	p.I92F	NIT1_uc001fxw.2_3'UTR|DEDD_uc009wty.2_Missense_Mutation_p.I92F|DEDD_uc001fya.2_Missense_Mutation_p.I92F|DEDD_uc001fyb.2_Missense_Mutation_p.I92F|DEDD_uc010pkb.1_Missense_Mutation_p.I49F|DEDD_uc001fyc.2_5'UTR	NM_001039712	NP_001034801	O75618	DEDD_HUMAN	death effector domain-containing protein	92	DED.				apoptosis|induction of apoptosis via death domain receptors|negative regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding				0	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TGGCGAGTGATGATGCGCAGC	0.577													7	80	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8953448	8953448	+	Silent	SNP	A	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8953448A>C	uc002qzc.2	-	5	506	c.324T>G	c.(322-324)CTT>CTG	p.L108L	KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Silent_p.L66L|KIDINS220_uc010yiw.1_Silent_p.L108L	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	108	Cytoplasmic (Potential).|ANK 4.				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGCCCACATAAGAGCTGTCC	0.378													51	148	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96521777	96521777	+	Missense_Mutation	SNP	T	C	C	rs77768218		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96521777T>C	uc002suz.1	-	31	2790	c.1313A>G	c.(1312-1314)CAT>CGT	p.H438R						SubName: Full=Putative uncharacterized protein ENSP00000312008; Flags: Fragment;																		AAGGTCTTCATGCTTTCTTTT	0.383													4	45	---	---	---	---	PASS
C2orf49	79074	broad.mit.edu	37	2	105959481	105959481	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105959481G>A	uc002tcs.1	+	3	475	c.443G>A	c.(442-444)AGT>AAT	p.S148N	C2orf49_uc010fjd.1_Intron	NM_024093	NP_076998	Q9BVC5	ASHWN_HUMAN	ashwin	148						tRNA-splicing ligase complex					0						TCCTCTTCGAGTGTTTCACCC	0.393													35	87	---	---	---	---	PASS
GPR17	2840	broad.mit.edu	37	2	128407597	128407597	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128407597G>A	uc010yzn.1	+	3	622	c.11G>A	c.(10-12)CGG>CAG	p.R4Q	LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Missense_Mutation_p.R4Q|GPR17_uc010yzo.1_Intron|GPR17_uc002tpd.2_Intron	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a	4	Extracellular (Potential).					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		ATGTCCAAACGGAGTTGGTGG	0.547											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	25	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185802977	185802977	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185802977T>C	uc002uph.2	+	4	3448	c.2854T>C	c.(2854-2856)TTT>CTT	p.F952L		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	952						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GCAAATTCCTTTTCAGGTGCC	0.388													14	121	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183752	10183752	+	Missense_Mutation	SNP	T	A	A	rs5030803		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183752T>A	uc003bvc.2	+	1	434	c.221T>A	c.(220-222)GTC>GAC	p.V74D	VHL_uc003bvd.2_Missense_Mutation_p.V74D	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	74					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V74D(4)|p.V74fs*85(2)|p.V74A(1)|p.S72_V87>L(1)|p.P71fs*84(1)|p.R60fs*35(1)|p.N67_V74del(1)|p.V74fs*58(1)|p.V74fs*77(1)|p.V74fs*82(1)|p.V74fs*51(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCTCCCAGGTCATCTTCTGC	0.721		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				5	7	---	---	---	---	PASS
OXSR1	9943	broad.mit.edu	37	3	38287677	38287677	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38287677C>G	uc003chy.2	+	13	1564	c.1222C>G	c.(1222-1224)CTC>GTC	p.L408V	OXSR1_uc010hhb.2_Missense_Mutation_p.L342V	NM_005109	NP_005100	O95747	OXSR1_HUMAN	oxidative-stress responsive 1	408					intracellular protein kinase cascade|response to oxidative stress		ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TCAAGTCTCTCTCCCACCCAC	0.493													7	65	---	---	---	---	PASS
FBXO40	51725	broad.mit.edu	37	3	121340772	121340772	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121340772G>T	uc003eeg.2	+	3	706	c.496G>T	c.(496-498)GTG>TTG	p.V166L		NM_016298	NP_057382	Q9UH90	FBX40_HUMAN	F-box protein 40	166					muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(114;0.189)		TGAAACCAGTGTGGAGGAAAT	0.483													27	48	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124438413	124438413	+	3'UTR	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124438413C>T	uc003ehg.2	+	60					KALRN_uc003ehk.2_3'UTR	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						CATTTCACTCCGTGCAGTTCT	0.448													5	15	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8584302	8584302	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8584302G>A	uc003glk.2	+	2	1132	c.713G>A	c.(712-714)CGC>CAC	p.R238H	CPZ_uc003gll.2_RNA	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	238	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						CGCCGCCACCGCGCCACCAGG	0.627													15	135	---	---	---	---	PASS
UBA6	55236	broad.mit.edu	37	4	68514833	68514833	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68514833C>T	uc003hdg.3	-	14	1253	c.1201G>A	c.(1201-1203)GAA>AAA	p.E401K	UBA6_uc003hdh.1_5'UTR	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2	401					protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						TTCAATACTTCTTGGCTGGCA	0.418													58	101	---	---	---	---	PASS
NUP54	53371	broad.mit.edu	37	4	77036406	77036406	+	3'UTR	SNP	T	G	G	rs17001433	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77036406T>G	uc003hjs.2	-	12					NUP54_uc010ije.2_3'UTR|NUP54_uc011cbs.1_3'UTR|NUP54_uc011cbt.1_3'UTR|NUP54_uc003hjt.2_3'UTR	NM_017426	NP_059122	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa						carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm				ovary(1)|lung(1)	2						AAAAAACCAATCCAAGAAAGA	0.338													2	17	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115858556	115858556	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115858556C>T	uc003ibu.2	-	5	2004	c.1325G>A	c.(1324-1326)GGT>GAT	p.G442D	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	442	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GACTTGAATACCCCAGACCTT	0.498													20	117	---	---	---	---	PASS
BRD9	65980	broad.mit.edu	37	5	864640	864640	+	Silent	SNP	G	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:864640G>T	uc003jbq.2	-	16	1904	c.1737C>A	c.(1735-1737)ACC>ACA	p.T579T	BRD9_uc003jbl.2_Silent_p.T463T|BRD9_uc003jbm.2_RNA|BRD9_uc003jbn.2_RNA|BRD9_uc011cmb.1_Silent_p.T526T|BRD9_uc003jbo.2_Silent_p.T483T	NM_023924	NP_076413	Q9H8M2	BRD9_HUMAN	bromodomain containing 9 isoform 1	579							nucleic acid binding				0			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			AGGGGTCGTGGGTGACGTCTG	0.507													34	121	---	---	---	---	PASS
SDHAP3	728609	broad.mit.edu	37	5	1572205	1572205	+	Intron	SNP	T	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1572205T>C	uc011cmd.1	-						SDHAP3_uc011cme.1_RNA					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0						GGTGCCAATCTCCCTTCAATG	0.483													3	4	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21783501	21783501	+	Silent	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21783501C>T	uc010iuc.2	-	8	1817	c.1359G>A	c.(1357-1359)GCG>GCA	p.A453A	CDH12_uc011cno.1_Silent_p.A413A|CDH12_uc003jgk.2_Silent_p.A453A	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	453	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						AATTATACTGCGCAGTGCTTT	0.373										HNSCC(59;0.17)			99	276	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32088233	32088233	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32088233C>T	uc003jhl.2	+	20	5067	c.4679C>T	c.(4678-4680)TCT>TTT	p.S1560F	PDZD2_uc003jhm.2_Missense_Mutation_p.S1560F	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1560					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GATTCTTCTTCTGACCCTGAG	0.557													12	177	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32088238	32088238	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32088238C>T	uc003jhl.2	+	20	5072	c.4684C>T	c.(4684-4686)CCT>TCT	p.P1562S	PDZD2_uc003jhm.2_Missense_Mutation_p.P1562S	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1562					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TTCTTCTGACCCTGAGTCACT	0.562													14	177	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32090571	32090571	+	Silent	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32090571C>T	uc003jhl.2	+	20	7405	c.7017C>T	c.(7015-7017)ATC>ATT	p.I2339I	PDZD2_uc003jhm.2_Silent_p.I2339I	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	2339					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						AGCAGCGGATCAAGTCTTTTG	0.527													12	152	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41159278	41159278	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41159278C>G	uc003jmk.2	-	12	1972	c.1762G>C	c.(1762-1764)GAA>CAA	p.E588Q	C6_uc003jml.1_Missense_Mutation_p.E588Q	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	588	TSP type-1 3.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TTATTGCATTCTCGGGTTCTC	0.493													7	168	---	---	---	---	PASS
TMEM171	134285	broad.mit.edu	37	5	72419335	72419335	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72419335G>C	uc003kcm.2	+	2	339	c.135G>C	c.(133-135)CAG>CAC	p.Q45H	TMEM171_uc003kcn.3_Missense_Mutation_p.Q45H	NM_173490	NP_775761	Q8WVE6	TM171_HUMAN	transmembrane protein 171 isoform 1	45						integral to membrane					0		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		TTGGGTTCCAGGCATGCCAAT	0.587													17	220	---	---	---	---	PASS
PDE6A	5145	broad.mit.edu	37	5	149240511	149240511	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149240511C>A	uc003lrg.3	-	22	2650	c.2530G>T	c.(2530-2532)GGA>TGA	p.G844*		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	844					cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CTGGGGTTTCCCCCCGGCTGA	0.572													26	52	---	---	---	---	PASS
GNB2L1	10399	broad.mit.edu	37	5	180670812	180670812	+	5'UTR	SNP	G	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180670812G>C	uc003mni.1	-	1					GNB2L1_uc003mnh.1_5'UTR|GNB2L1_uc003mnk.1_5'UTR|GNB2L1_uc003mnj.1_5'UTR|GNB2L1_uc003mnl.1_5'Flank|GNB2L1_uc011dhk.1_5'UTR|GNB2L1_uc010jls.2_5'UTR|GNB2L1_uc011dhl.1_5'UTR|SNORD96A_uc010jlt.1_5'Flank|SNORD95_uc003mnn.1_5'Flank	NM_006098	NP_006089	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein),						apoptosis|cell cycle|gastrulation|interspecies interaction between organisms|negative regulation of cell growth|negative regulation of phagocytosis|negative regulation of translation|negative regulation of Wnt receptor signaling pathway|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of gastrulation|positive regulation of GTPase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein homooligomerization|positive regulation of protein phosphorylation|regulation of cell cycle|regulation of cell division|regulation of establishment of cell polarity|regulation of protein localization|rhythmic process	cytoskeleton|dendrite|midbody|nucleus|perikaryon|perinuclear region of cytoplasm|phagocytic cup|small ribosomal subunit	ion channel inhibitor activity|protein kinase C binding|protein phosphatase binding|protein tyrosine kinase inhibitor activity|receptor tyrosine kinase binding|SH2 domain binding				0	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		GCGGCGGCGAGAGCGTGTGTC	0.602													5	9	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32065169	32065169	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32065169C>T	uc003nzl.2	-	3	663	c.461G>A	c.(460-462)TGC>TAC	p.C154Y		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	154					actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						GGAACAGGTGCAGCGGCTCAG	0.627													6	47	---	---	---	---	PASS
MRPS18A	55168	broad.mit.edu	37	6	43642986	43642986	+	Silent	SNP	A	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43642986A>T	uc003ovy.1	-	5	411	c.399T>A	c.(397-399)CCT>CCA	p.P133P	MRPS18A_uc003ovz.1_Intron|MRPS18A_uc003owa.1_Silent_p.P207P	NM_018135	NP_060605	Q9NVS2	RT18A_HUMAN	mitochondrial ribosomal protein S18A precursor	133					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0	all_cancers(18;6.56e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000479)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0102)|OV - Ovarian serous cystadenocarcinoma(102;0.137)			CAGGAAGCCGAGGCCTGTGAT	0.562													17	98	---	---	---	---	PASS
TIAM2	26230	broad.mit.edu	37	6	155578323	155578323	+	3'UTR	SNP	G	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155578323G>T	uc003qqb.2	+	29					TIAM2_uc003qqe.2_3'UTR|TIAM2_uc010kjj.2_3'UTR|TIAM2_uc003qqf.2_3'UTR|TIAM2_uc011efl.1_3'UTR|TIAM2_uc003qqg.2_3'UTR|TIAM2_uc003qqh.2_3'UTR|uc003qqi.1_5'Flank	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		AGTGGAAATTGCaaaaaaaaa	0.284													3	22	---	---	---	---	PASS
RUNX1T1	862	broad.mit.edu	37	8	92982925	92982925	+	Silent	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92982925G>A	uc003yfd.2	-	10	1584	c.1500C>T	c.(1498-1500)GAC>GAT	p.D500D	RUNX1T1_uc003yfc.1_Silent_p.D473D|RUNX1T1_uc003yfe.1_Silent_p.D463D|RUNX1T1_uc010mao.2_Silent_p.D473D|RUNX1T1_uc011lgi.1_Silent_p.D511D|RUNX1T1_uc010man.1_Silent_p.D125D|RUNX1T1_uc003yfb.1_Silent_p.D463D	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	500					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CTGCCAGTGCGTCCTCCGCCG	0.547													11	48	---	---	---	---	PASS
SYT15	83849	broad.mit.edu	37	10	46968694	46968694	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46968694G>A	uc001jea.2	-	3	395	c.242C>T	c.(241-243)CCA>CTA	p.P81L	SYT15_uc001jdz.2_Missense_Mutation_p.P81L|SYT15_uc001jeb.2_5'UTR|SYT15_uc010qfp.1_5'Flank	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a	81	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0						TTGAAGGGTTGGGGGCACCAC	0.632													19	108	---	---	---	---	PASS
KNDC1	85442	broad.mit.edu	37	10	135012532	135012532	+	Silent	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135012532G>A	uc001llz.1	+	14	2521	c.2520G>A	c.(2518-2520)CCG>CCA	p.P840P	KNDC1_uc001lma.1_Silent_p.P775P|KNDC1_uc001lmb.1_Silent_p.P252P	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	840	Pro-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCGAGCGCCCGGGCCAGGAGC	0.657													4	9	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1078457	1078457	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1078457G>A	uc001lsx.1	+	6	692	c.665G>A	c.(664-666)CGC>CAC	p.R222H		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	222	VWFD 1.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGTCCCCAGCGCGCCGAGTGT	0.697													7	12	---	---	---	---	PASS
WT1	7490	broad.mit.edu	37	11	32417899	32417899	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32417899T>A	uc001mtn.1	-	7	1349	c.1153A>T	c.(1153-1155)ACC>TCC	p.T385S	WT1_uc001mtl.1_Missense_Mutation_p.T173S|WT1_uc001mtm.1_Missense_Mutation_p.T156S|WT1_uc001mto.1_Missense_Mutation_p.T385S|WT1_uc001mtp.1_Missense_Mutation_p.T368S|WT1_uc001mtq.1_Missense_Mutation_p.T368S|WT1_uc009yjs.1_RNA	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D	317					adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	p.C385Y(1)|p.L310fs*63(1)|p.C385fs*6(1)|p.P308fs*67(1)|p.V380_S410del(1)	EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TTCTCACTGGTCTCAGATGCC	0.522			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				34	75	---	---	---	---	PASS
MAPK8IP1	9479	broad.mit.edu	37	11	45925587	45925587	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45925587C>A	uc001nbr.2	+	7	1711	c.1541C>A	c.(1540-1542)CCT>CAT	p.P514H		NM_005456	NP_005447	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting	514	SH3.				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity			ovary(2)|breast(1)|skin(1)	4				GBM - Glioblastoma multiforme(35;0.231)		GTGGATGACCCTCTGCTAGTG	0.577													34	165	---	---	---	---	PASS
SSRP1	6749	broad.mit.edu	37	11	57099909	57099909	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57099909T>G	uc001njt.2	-	7	1087	c.820A>C	c.(820-822)ATC>CTC	p.I274L		NM_003146	NP_003137	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	274					DNA repair|DNA replication|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|cytoplasm|nucleoplasm	DNA binding|protein binding			ovary(2)	2						AAGAGGAGGATCAGGAAGTGG	0.488													74	155	---	---	---	---	PASS
MS4A10	341116	broad.mit.edu	37	11	60561455	60561455	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60561455G>A	uc001npz.1	+	5	467	c.371G>A	c.(370-372)TGC>TAC	p.C124Y		NM_206893	NP_996776	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member	124	Helical; (Potential).					integral to membrane	receptor activity			ovary(1)|skin(1)	2						AAGATGTTGTGCCTGATGACA	0.512													91	162	---	---	---	---	PASS
PCNXL3	399909	broad.mit.edu	37	11	65402821	65402821	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65402821C>T	uc001oey.2	+	31	5086	c.5086C>T	c.(5086-5088)CCC>TCC	p.P1696S	PCNXL3_uc001oez.2_Missense_Mutation_p.P583S	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	1696						integral to membrane					0						CAGCAACACGCCCTCCCTGCT	0.617													7	14	---	---	---	---	PASS
ZNF705A	440077	broad.mit.edu	37	12	8325234	8325234	+	Splice_Site	SNP	G	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8325234G>T	uc001qud.1	+	1	84	c.12_splice	c.e1+1	p.L4_splice		NM_001004328	NP_001004328	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				Kidney(36;0.0877)		GCATTCACTAGTGAGTAGGGG	0.408													14	298	---	---	---	---	PASS
OR6C3	254786	broad.mit.edu	37	12	55725604	55725604	+	Silent	SNP	G	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55725604G>T	uc010spj.1	+	1	120	c.120G>T	c.(118-120)CTG>CTT	p.L40L		NM_054104	NP_473445	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C,	40	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTGGAAACCTGACTATCATCA	0.393													37	316	---	---	---	---	PASS
OR5AU1	390445	broad.mit.edu	37	14	21623848	21623848	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21623848G>A	uc010tlp.1	-	1	337	c.337C>T	c.(337-339)CTC>TTC	p.L113F		NM_001004731	NP_001004731	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU,	113	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		CTCTTCAGGAGGGAGTACATG	0.542													20	64	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23894068	23894068	+	Silent	SNP	T	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23894068T>C	uc001wjx.2	-	22	2695	c.2589A>G	c.(2587-2589)CTA>CTG	p.L863L		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	863	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CGGACTTCTCTAGCGCCTCTT	0.567													13	114	---	---	---	---	PASS
PTGER2	5732	broad.mit.edu	37	14	52782081	52782081	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52782081C>T	uc001wzr.2	+	1	1066	c.815C>T	c.(814-816)ACC>ATC	p.T272I		NM_000956	NP_000947	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	272	Helical; Name=6; (Potential).					integral to plasma membrane	prostaglandin E receptor activity			lung(1)|breast(1)	2	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Iloprost(DB01088)	ATGACCATCACCTTCGCCGTC	0.527													15	58	---	---	---	---	PASS
CCNB2	9133	broad.mit.edu	37	15	59417125	59417125	+	3'UTR	SNP	T	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59417125T>C	uc002afz.2	+	9					CCNB2_uc010bge.2_3'UTR	NM_004701	NP_004692	O95067	CCNB2_HUMAN	cyclin B2						cell cycle checkpoint|cell division|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	centrosome|cytosol|nucleus	protein kinase binding				0						CTTTTTCTTATTGGTTTAGAA	0.443													5	16	---	---	---	---	PASS
PSMA4	5685	broad.mit.edu	37	15	78834689	78834689	+	Intron	SNP	A	G	G	rs2292117	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78834689A>G	uc002bdu.3	+						PSMA4_uc010blf.2_Intron|PSMA4_uc002bdv.3_Intron|PSMA4_uc002bdw.3_5'UTR|PSMA4_uc002bdx.3_Intron	NM_002789	NP_002780	P25789	PSA4_HUMAN	proteasome alpha 4 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	identical protein binding|threonine-type endopeptidase activity				0						AGCAATTATCATCACCAGGTT	0.333													4	61	---	---	---	---	PASS
CLEC16A	23274	broad.mit.edu	37	16	11217730	11217730	+	Silent	SNP	C	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11217730C>G	uc002dao.2	+	21	2630	c.2400C>G	c.(2398-2400)CGC>CGG	p.R800R	CLEC16A_uc002dan.3_Silent_p.R782R|CLEC16A_uc002dap.2_5'Flank	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A	800										ovary(1)|central_nervous_system(1)	2						ACCACATCCGCTGCATCATCG	0.612													9	46	---	---	---	---	PASS
NKD1	85407	broad.mit.edu	37	16	50583388	50583388	+	Silent	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50583388C>T	uc002egg.1	+	3	338	c.114C>T	c.(112-114)ATC>ATT	p.I38I		NM_033119	NP_149110	Q969G9	NKD1_HUMAN	naked cuticle homolog 1	38					Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		AGGAGTGGATCGGGAGACAGC	0.692													12	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	25748679	25748679	+	RNA	SNP	A	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25748679A>C	uc002gzg.2	+	6		c.580A>C			uc002gzh.1_5'Flank					Homo sapiens similar to ubiquitin specific protease 6, mRNA (cDNA clone IMAGE:5168266), with apparent retained intron.																		ATGAGATGAAAGAGCAAGTGG	0.527													4	62	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35946642	35946642	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35946642C>T	uc002hoa.2	-	4	339	c.256G>A	c.(256-258)GGA>AGA	p.G86R	SYNRG_uc010wde.1_Missense_Mutation_p.G86R|SYNRG_uc010wdf.1_Missense_Mutation_p.G86R|SYNRG_uc002hoc.2_Missense_Mutation_p.G85R|SYNRG_uc002hoe.2_Missense_Mutation_p.G86R|SYNRG_uc002hod.2_Missense_Mutation_p.G86R|SYNRG_uc010wdg.1_Missense_Mutation_p.G86R|SYNRG_uc002hob.2_Missense_Mutation_p.G86R|SYNRG_uc002hog.1_Missense_Mutation_p.G119R|SYNRG_uc010wdh.1_Missense_Mutation_p.G86R	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	86					endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						GGCATTGGTCCCATTGGTATT	0.453													68	119	---	---	---	---	PASS
ITGA3	3675	broad.mit.edu	37	17	48148756	48148756	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48148756T>C	uc010dbl.2	+	6	1297	c.833T>C	c.(832-834)ATG>ACG	p.M278T	ITGA3_uc010dbm.2_Missense_Mutation_p.M278T	NM_002204	NP_002195	P26006	ITA3_HUMAN	integrin alpha 3 isoform a precursor	278	FG-GAP 4.|Extracellular (Potential).				blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|leukocyte migration	cell surface|integrin complex	protein binding|receptor activity			ovary(2)|pancreas(1)	3						CACCGACATATGGGCGCGGTG	0.612													7	80	---	---	---	---	PASS
CACNG5	27091	broad.mit.edu	37	17	64880873	64880873	+	Intron	SNP	A	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64880873A>G	uc010wqi.1	+						CACNG5_uc002jfr.2_Missense_Mutation_p.Q222R|CACNG5_uc010wqj.1_Intron	NM_145811	NP_665810	Q9UF02	CCG5_HUMAN	voltage-dependent calcium channel gamma-5						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|postsynaptic density|postsynaptic membrane	voltage-gated calcium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			GACATTCCACAACCATTTTGG	0.592													32	83	---	---	---	---	PASS
PSG8	440533	broad.mit.edu	37	19	43257324	43257324	+	3'UTR	SNP	T	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43257324T>G	uc002ouh.2	-	6					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_3'UTR|PSG8_uc010ein.2_3'UTR|PSG8_uc002ouj.3_3'UTR|PSG8_uc002ouk.3_3'UTR|PSG8_uc002oul.3_3'UTR|PSG8_uc002oum.3_3'UTR|PSG1_uc002oun.2_RNA	NM_001130167	NP_001123639	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform							extracellular region					0		Prostate(69;0.00899)				gtttacagtttgagcatctgt	0.000													2	16	---	---	---	---	PASS
PSG8	440533	broad.mit.edu	37	19	43257330	43257330	+	3'UTR	SNP	T	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43257330T>G	uc002ouh.2	-	6					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_3'UTR|PSG8_uc010ein.2_3'UTR|PSG8_uc002ouj.3_3'UTR|PSG8_uc002ouk.3_3'UTR|PSG8_uc002oul.3_3'UTR|PSG8_uc002oum.3_3'UTR|PSG1_uc002oun.2_RNA	NM_001130167	NP_001123639	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform							extracellular region					0		Prostate(69;0.00899)				agtttgagcatctgttgttat	0.000													2	17	---	---	---	---	PASS
ZNF347	84671	broad.mit.edu	37	19	53656986	53656986	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53656986C>G	uc002qbb.1	-	2	84	c.15G>C	c.(13-15)CAG>CAC	p.Q5H	ZNF347_uc010eql.1_Missense_Mutation_p.Q5H|ZNF347_uc002qbc.1_Missense_Mutation_p.Q5H	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN	zinc finger protein 347	5					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0179)		ATTACCTTACCTGGGTGAGAG	0.408													37	160	---	---	---	---	PASS
ACSS1	84532	broad.mit.edu	37	20	25011448	25011448	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25011448G>A	uc002wub.2	-	3	1456	c.578C>T	c.(577-579)ACA>ATA	p.T193I	ACSS1_uc002wuc.2_Missense_Mutation_p.T193I|ACSS1_uc010gdc.2_Missense_Mutation_p.T193I|ACSS1_uc002wua.2_Missense_Mutation_p.T110I	NM_032501	NP_115890	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	193					acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AAAGATGACTGTGTGGACAGC	0.597													31	71	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33575921	33575921	+	Silent	SNP	C	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33575921C>A	uc002xbi.1	+	17	1661	c.1569C>A	c.(1567-1569)ATC>ATA	p.I523I	MIR499_hsa-mir-499|MI0003183_5'Flank	NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	481	Myosin head-like.					membrane|myosin filament	actin binding|ATP binding|motor activity	p.I523M(1)		ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			AGCTGTGCATCAACTTCACCA	0.562													53	114	---	---	---	---	PASS
EDN3	1908	broad.mit.edu	37	20	57876745	57876745	+	Silent	SNP	C	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57876745C>T	uc002yap.2	+	2	702	c.333C>T	c.(331-333)TGC>TGT	p.C111C	EDN3_uc002yao.1_Silent_p.C111C|EDN3_uc002yaq.2_Silent_p.C111C|EDN3_uc002yar.2_Silent_p.C111C|EDN3_uc002yas.2_Silent_p.C111C	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein	111					cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					TCTACTATTGCCACCTGGACA	0.607													61	179	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60895706	60895706	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60895706A>C	uc002ycq.2	-	50	6735	c.6668T>G	c.(6667-6669)CTG>CGG	p.L2223R		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2223	Domain II and I.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCGGGGGCCCAGGGGGCTCCG	0.706													4	30	---	---	---	---	PASS
MED15	51586	broad.mit.edu	37	22	20920819	20920819	+	Silent	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20920819G>A	uc002zsp.2	+	7	836	c.756G>A	c.(754-756)CAG>CAA	p.Q252Q	MED15_uc002zso.2_Silent_p.Q181Q|MED15_uc002zsq.2_Silent_p.Q252Q|MED15_uc010gso.2_Silent_p.Q252Q|MED15_uc002zsr.2_Silent_p.Q226Q|MED15_uc011ahs.1_Silent_p.Q226Q|MED15_uc002zss.2_Silent_p.Q171Q|MED15_uc011ahu.1_5'UTR	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	252	Poly-Gln.			Missing (in Ref. 3; BAB85034).	regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			agcaacagcagcagcagcagc	0.318													2	5	---	---	---	---	PASS
BRD1	23774	broad.mit.edu	37	22	50187702	50187702	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50187702C>A	uc003biv.2	-	6	2826	c.2339G>T	c.(2338-2340)GGG>GTG	p.G780V	BRD1_uc011arf.1_Missense_Mutation_p.G375V|BRD1_uc011arg.1_Missense_Mutation_p.G829V|BRD1_uc011arh.1_Missense_Mutation_p.G780V|BRD1_uc003biu.3_Missense_Mutation_p.G780V	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	780					histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CGCCTCCGGCCCCAGCGCAGC	0.662													17	47	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50724518	50724518	+	Silent	SNP	G	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50724518G>T	uc003bkv.3	-	10	1993	c.1887C>A	c.(1885-1887)TCC>TCA	p.S629S		NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	629	Extracellular (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGCTCACGCAGGAGATGCACC	0.667													10	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2553	2553	+	5'Flank	SNP	G	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2553G>A	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		CGCCTGCCCAGTGACACATGT	0.338													4	1	---	---	---	---	PASS
TARDBP	23435	broad.mit.edu	37	1	11077259	11077259	+	Intron	DEL	C	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11077259delC	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		TGTTACCtttctttttttttt	0.025													6	4	---	---	---	---	
PDPN	10630	broad.mit.edu	37	1	13910742	13910744	+	Intron	DEL	GGA	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13910742_13910744delGGA	uc001avd.2	+						PDPN_uc001avc.2_Intron|PDPN_uc009vob.2_5'Flank|PDPN_uc009voc.2_5'Flank|PDPN_uc001ave.2_5'Flank|PDPN_uc001avf.2_5'Flank	NM_006474	NP_006465	Q86YL7	PDPN_HUMAN	lung type-I cell membrane-associated						cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		GCTGAGCGCCGGAGGAGGAGAGG	0.690													5	5	---	---	---	---	
MAN1C1	57134	broad.mit.edu	37	1	26073323	26073323	+	Intron	DEL	C	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26073323delC	uc001bkm.2	+						MAN1C1_uc009vry.1_Intron	NM_020379	NP_065112	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		CCAGAAGAGGCCCAACAGCCA	0.428													12	9	---	---	---	---	
PUM1	9698	broad.mit.edu	37	1	31480166	31480176	+	Intron	DEL	ACACTGATCAA	-	-	rs3831279		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31480166_31480176delACACTGATCAA	uc001bsi.1	-						PUM1_uc001bsg.1_5'Flank|PUM1_uc001bsh.1_Intron|PUM1_uc001bsj.1_Intron|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Intron|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2						cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		AGGGGTGGGGACACTGATCAAACCATCCAAT	0.436													4	2	---	---	---	---	
IPP	3652	broad.mit.edu	37	1	46182894	46182897	+	Intron	DEL	AAAA	-	-	rs66626104		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46182894_46182897delAAAA	uc001cou.2	-						IPP_uc001cos.3_Intron	NM_005897	NP_005888	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide							actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CTCTTTTGAGaaaaaaaaaaaaaa	0.157													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	99692254	99692255	+	IGR	DEL	AC	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99692254_99692255delAC								LPPR5 (221805 upstream) : LPPR4 (37645 downstream)																							acacacacaaacacacacacac	0.356													4	2	---	---	---	---	
PCP4L1	654790	broad.mit.edu	37	1	161254256	161254256	+	Frame_Shift_Del	DEL	G	-	-	rs116246087	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161254256delG	uc001gad.2	+	3	440	c.192delG	c.(190-192)AAGfs	p.K64fs		NM_001102566	NP_001096036	A6NKN8	PC4L1_HUMAN	Purkinje cell protein 4 like 1	64	IQ.										0	all_cancers(52;4.16e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AAAGGAAAAAGGATCCCAGCT	0.517													33	17	---	---	---	---	
FMO2	2327	broad.mit.edu	37	1	171154644	171154644	+	Intron	DEL	G	-	-	rs74555462		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171154644delG	uc001ghk.1	+						FMO2_uc010pmd.1_Intron	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2						drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ATGTAAGCAAGGTTTGCAACA	0.373													2	6	---	---	---	---	
DTL	51514	broad.mit.edu	37	1	212224845	212224846	+	Intron	INS	-	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212224845_212224846insT	uc009xdc.2	+						DTL_uc010ptb.1_Intron|DTL_uc001hiz.3_Intron	NM_016448	NP_057532	Q9NZJ0	DTL_HUMAN	denticleless homolog						DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		gaggtcctttattttttttttt	0.178													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223352880	223352881	+	IGR	INS	-	CTTCCTTT	CTTCCTTT	rs61837571	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223352880_223352881insCTTCCTTT								TLR5 (36256 upstream) : SUSD4 (41282 downstream)																							ttccttccttccttcctttctt	0.045													2	8	---	---	---	---	
BCL11A	53335	broad.mit.edu	37	2	60694268	60694268	+	Intron	DEL	T	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60694268delT	uc002sae.1	-						BCL11A_uc002sab.2_Intron|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Intron|BCL11A_uc002sad.1_Intron|BCL11A_uc002saf.1_Intron	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1						negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			gtggtgatggtggtgttggtg	0.040			T	IGH@	B-CLL								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90048090	90048091	+	Intron	DEL	CA	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90048090_90048091delCA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		cacacacactcacacacacaca	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176088041	176088045	+	IGR	DEL	TTTCT	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176088041_176088045delTTTCT								ATP5G3 (41551 upstream) : KIAA1715 (702365 downstream)																							tctttctttctttcttttctttctt	0.034													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	20255203	20255206	+	IGR	DEL	CTTC	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20255203_20255206delCTTC								SGOL1 (27520 upstream) : None (None downstream)																							ttctttctttcttcctttctttct	0.000													5	3	---	---	---	---	
GPD1L	23171	broad.mit.edu	37	3	32200958	32200958	+	Intron	DEL	A	-	-	rs35234737		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32200958delA	uc003cew.2	+							NM_015141	NP_055956	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like						glycerol-3-phosphate catabolic process	glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|NAD binding|protein homodimerization activity				0						cccattctctaaaaaaaaaaa	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110401054	110401054	+	IGR	DEL	T	-	-	rs113398685		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110401054delT								None (None upstream) : PVRL3 (389811 downstream)																							CTTTGACTTCTTTTTTTTTTT	0.408													4	2	---	---	---	---	
MBNL1	4154	broad.mit.edu	37	3	152165233	152165233	+	Intron	DEL	T	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152165233delT	uc003ezm.2	+						MBNL1_uc003ezh.2_Intron|MBNL1_uc003ezi.2_Intron|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezl.2_Intron|MBNL1_uc003ezp.2_Intron|MBNL1_uc003ezn.2_Intron|MBNL1_uc003ezo.2_Intron|MBNL1_uc010hvp.2_Intron	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c						embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTTATCTTGCTTTTTTTTTTT	0.328													4	2	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195494691	195494692	+	Intron	INS	-	CAT	CAT			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494691_195494692insCAT	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		accatcaccaccaccaccacca	0.000													4	3	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196288493	196288494	+	Intron	INS	-	A	A	rs140815446		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196288493_196288494insA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		ctcaattaattaaaaaaaaaaa	0.297													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25497611	25497612	+	IGR	INS	-	CTTT	CTTT	rs144415784	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25497611_25497612insCTTT								ANAPC4 (77492 upstream) : SLC34A2 (159823 downstream)																							ttccttccttccttccttcctt	0.040													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57500223	57500223	+	IGR	DEL	A	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57500223delA								ARL9 (110165 upstream) : HOPX (13931 downstream)																							ccctccaaccaaaaaaaaaaG	0.229													6	3	---	---	---	---	
CDS1	1040	broad.mit.edu	37	4	85530355	85530355	+	Intron	DEL	G	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85530355delG	uc011ccv.1	+							NM_001263	NP_001254	Q92903	CDS1_HUMAN	CDP-diacylglycerol synthase 1						signal transduction|visual perception	endoplasmic reticulum membrane|integral to membrane	diacylglycerol cholinephosphotransferase activity|phosphatidate cytidylyltransferase activity			large_intestine(2)|ovary(1)|breast(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		aaaaaaaaaagaaaagaaaAA	0.119													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	174691783	174691784	+	IGR	INS	-	TC	TC	rs148863560	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174691783_174691784insTC								MORF4 (153989 upstream) : FBXO8 (466028 downstream)																							tttttttcttttctctctctct	0.119													4	2	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183268148	183268149	+	Intron	INS	-	G	G	rs138363616	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183268148_183268149insG	uc003ivd.1	+						ODZ3_uc010irv.1_Intron	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		GTTGACTCCGCGGGGGGGGATG	0.302													4	8	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21344692	21344692	+	Intron	DEL	T	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21344692delT	uc011cnn.1	+											Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						ccttccttcctttccttcctt	0.000													3	4	---	---	---	---	
C5orf35	133383	broad.mit.edu	37	5	56209591	56209591	+	Intron	DEL	T	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56209591delT	uc003jqx.2	+						C5orf35_uc003jqy.2_Intron	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383											ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)		TACTAAAGTCTTTTTTTTTTT	0.259													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103048510	103048511	+	IGR	INS	-	TG	TG	rs55897784		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103048510_103048511insTG								NUDT12 (150020 upstream) : None (None downstream)																							TAAATAGCTATtgtgtgtgtgt	0.218													4	2	---	---	---	---	
FAT2	2196	broad.mit.edu	37	5	150901788	150901789	+	Intron	INS	-	A	A	rs143044940	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150901788_150901789insA	uc003lue.3	-						GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor						epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTGCATTTAGAAAAAAAAAAC	0.475													4	2	---	---	---	---	
SFXN1	94081	broad.mit.edu	37	5	174939208	174939208	+	Intron	DEL	A	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174939208delA	uc003mda.2	+						SFXN1_uc003mdb.1_Intron	NM_022754	NP_073591	Q9H9B4	SFXN1_HUMAN	sideroflexin 1						iron ion homeostasis	integral to membrane	cation transmembrane transporter activity|protein binding			ovary(1)	1	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AGGTAAGACGAATATGCACTC	0.373													94	44	---	---	---	---	
UNC5A	90249	broad.mit.edu	37	5	176235838	176235839	+	5'Flank	INS	-	AC	AC	rs146761724	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176235838_176235839insAC	uc003mey.2	+						UNC5A_uc003mex.1_5'Flank	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACACTGCTCCTacacacacaca	0.460													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14157275	14157282	+	IGR	DEL	TCCTTCCT	-	-	rs72201894		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14157275_14157282delTCCTTCCT								CD83 (20129 upstream) : None (None downstream)																							ATCCTGTGGCtccttccttccttccttc	0.183													3	3	---	---	---	---	
ORC3L	23595	broad.mit.edu	37	6	88330898	88330899	+	Intron	INS	-	A	A	rs146557982	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88330898_88330899insA	uc003pmh.2	+						ORC3L_uc011dzl.1_Intron|ORC3L_uc011dzm.1_Intron|ORC3L_uc011dzn.1_Intron|ORC3L_uc003pmg.2_Intron|ORC3L_uc003pmi.2_Intron|ORC3L_uc011dzo.1_Intron|ORC3L_uc011dzp.1_Intron	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		CTTAAAATATGGAGTTATATAG	0.282													4	4	---	---	---	---	
ANKRD6	22881	broad.mit.edu	37	6	90338835	90338835	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90338835delC	uc003pni.3	+	15	1831	c.1490delC	c.(1489-1491)TCCfs	p.S497fs	ANKRD6_uc003pne.3_Frame_Shift_Del_p.S497fs|ANKRD6_uc003pnf.3_Frame_Shift_Del_p.S462fs|ANKRD6_uc011dzy.1_Frame_Shift_Del_p.S497fs|ANKRD6_uc010kcd.2_Frame_Shift_Del_p.S438fs|LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|ANKRD6_uc003pnh.3_Frame_Shift_Del_p.S93fs|LYRM2_uc010kcf.1_Intron|ANKRD6_uc003pnj.3_Frame_Shift_Del_p.S93fs	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	497							protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		TTTAAGATATCCTTGGTGGAT	0.358													52	24	---	---	---	---	
CCR6	1235	broad.mit.edu	37	6	167505560	167505560	+	Intron	DEL	C	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167505560delC	uc003qvl.2	+							NM_031409	NP_113597	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6						cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|humoral immune response	integral to plasma membrane	C-C chemokine receptor activity			ovary(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		atgtggggtgccctggggagc	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22867852	22867853	+	IGR	INS	-	GAAT	GAAT	rs7787622	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22867852_22867853insGAAT								TOMM7 (5431 upstream) : SNORD93 (28379 downstream)																							aaggaaggaaggaaTTAAAAGA	0.054													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55327527	55327527	+	IGR	DEL	A	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55327527delA								EGFR (52497 upstream) : LANCL2 (105614 downstream)																							CATCTGTATTAATTCTTCATA	0.333													14	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56231403	56231403	+	IGR	DEL	A	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56231403delA								PSPH (47313 upstream) : DKFZp434L192 (332513 downstream)																							TGCTGCTGCGAAAAAAAAAAA	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65268571	65268572	+	IGR	INS	-	T	T	rs10601477		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65268571_65268572insT								CCT6P1 (39910 upstream) : VKORC1L1 (69685 downstream)																							CTTTTTCCTTCttttttaaaaa	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	82966322	82966323	+	IGR	INS	-	CCTT	CCTT			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82966322_82966323insCCTT								SNX16 (211801 upstream) : None (None downstream)																							ctccctccctcccttccttcct	0.287													5	3	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133492917	133492918	+	5'UTR	INS	-	C	C			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133492917_133492918insC	uc003ytj.2	-	1					KCNQ3_uc010mdt.2_5'UTR	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GCCCCTCCCCACCCCCCCCCAA	0.748													4	2	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGACCttttctttttttttt	0.139		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44084430	44084436	+	IGR	DEL	TTTGTAT	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44084430_44084436delTTTGTAT								FAM75A6 (453700 upstream) : FAM27C (905800 downstream)																							ATAACATTTCTTTGTATTTTATATTTT	0.261													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4159740	4159742	+	IGR	DEL	AGA	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4159740_4159742delAGA								KLF6 (332267 upstream) : LOC100216001 (461702 downstream)																							ggaaggaaggagaaagacagaga	0.000													4	2	---	---	---	---	
PDZD7	79955	broad.mit.edu	37	10	102777649	102777649	+	Intron	DEL	A	-	-	rs66819144		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102777649delA	uc001kso.1	-						PDZD7_uc001ksn.2_Intron	NM_024895	NP_079171	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7							cilium|nucleus	protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		agaaagaaagaaaagaaagaa	0.005													4	2	---	---	---	---	
GBF1	8729	broad.mit.edu	37	10	104134959	104134960	+	Intron	INS	-	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104134959_104134960insA	uc001kux.1	+						GBF1_uc001kuy.1_Intron|GBF1_uc001kuz.1_Intron	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine						COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		atttctatttgaaaaaaaaaaa	0.208													4	2	---	---	---	---	
SNHG1	23642	broad.mit.edu	37	11	62620163	62620164	+	Intron	INS	-	A	A	rs141427202	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62620163_62620164insA	uc001nvp.2	-						SNHG1_uc001nvo.2_Intron|SNHG1_uc001nvq.2_Intron|SNHG1_uc001nvs.2_Intron|SNHG1_uc001nvr.2_Intron|SNHG1_uc001nvt.2_Intron|SNHG1_uc001nvu.2_Intron					Homo sapiens cDNA FLJ38530 fis, clone HCHON2001039.												0						CCTGCAGAGGTAAAAAAAAAAG	0.351													3	3	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67829386	67829387	+	Intron	INS	-	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67829386_67829387insA	uc001onj.2	-						CHKA_uc001onk.2_Intron|uc001onl.1_5'Flank	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	GGAGTAGGAAGAAAAAAAAAAA	0.406													5	5	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99200993	99200996	+	Intron	DEL	AGAC	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99200993_99200996delAGAC	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ggaaggagagagacagagtaaggg	0.132													7	4	---	---	---	---	
SIK3	23387	broad.mit.edu	37	11	116797735	116797736	+	Intron	INS	-	A	A	rs34416738		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116797735_116797736insA	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						actcagtctcgaaaaaaaaaaa	0.139													3	3	---	---	---	---	
CHD4	1108	broad.mit.edu	37	12	6704290	6704291	+	Intron	INS	-	T	T			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6704290_6704291insT	uc001qpo.2	-						CHD4_uc001qpn.2_Intron|CHD4_uc001qpp.2_Intron	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						AATATACCTCCTTTTTTTTTTT	0.401													6	3	---	---	---	---	
AICDA	57379	broad.mit.edu	37	12	8757093	8757094	+	Intron	DEL	AA	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8757093_8757094delAA	uc001qur.2	-						AICDA_uc001qup.1_Intron|AICDA_uc001quq.1_Intron|AICDA_uc009zgd.1_Intron	NM_020661	NP_065712	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase						B cell differentiation|DNA demethylation|mRNA processing|negative regulation of methylation-dependent chromatin silencing	cytoplasm	cytidine deaminase activity|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung SC(5;0.184)					TTGTTTGTTTaaaaaaaaaaaa	0.322									Immune_Deficiency_with_Hyper-IgM				3	3	---	---	---	---	
TMBIM6	7009	broad.mit.edu	37	12	50151817	50151817	+	Intron	DEL	A	-	-	rs80171037		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50151817delA	uc001rux.2	+						TMBIM6_uc010sml.1_Intron|TMBIM6_uc001ruy.2_Intron|TMBIM6_uc001ruz.2_Intron	NM_003217	NP_003208	P55061	BI1_HUMAN	testis enhanced gene transcript (BAX inhibitor						apoptosis|negative regulation of apoptosis	endoplasmic reticulum|insoluble fraction|integral to plasma membrane|nucleus					0						CTATTTCTATAAAAAAAAAAA	0.353													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	92113663	92113664	+	IGR	INS	-	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92113663_92113664insA								DCN (536857 upstream) : BTG1 (265202 downstream)																							aggaaggaaagaaggaaggaag	0.000													11	5	---	---	---	---	
DRAM1	55332	broad.mit.edu	37	12	102283259	102283260	+	Intron	INS	-	GAAG	GAAG	rs146359103	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102283259_102283260insGAAG	uc001tix.2	+						DRAM1_uc010svv.1_Intron	NM_018370	NP_060840	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1						apoptosis|autophagy	integral to membrane|lysosomal membrane				ovary(1)	1						tgagaagagaagaaggaaggaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115761043	115761046	+	IGR	DEL	GAAA	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115761043_115761046delGAAA								TBX3 (639074 upstream) : MED13L (635337 downstream)																							gagaaagtaggaaagaaagaaaga	0.000													4	2	---	---	---	---	
FNDC3A	22862	broad.mit.edu	37	13	49752915	49752917	+	Intron	DEL	AGC	-	-	rs1407826	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49752915_49752917delAGC	uc001vcm.2	+						FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron|FNDC3A_uc001vcp.1_Intron|FNDC3A_uc001vcq.2_Intron	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		ctgtcacccaagctgctgcagtg	0.089													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55737398	55737399	+	IGR	INS	-	CA	CA	rs71916771		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55737398_55737399insCA								MIR1297 (851215 upstream) : None (None downstream)																							ctttctttctttctctttcttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	106148111	106148114	+	IGR	DEL	CTTC	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106148111_106148114delCTTC								DAOA (4729 upstream) : EFNB2 (993984 downstream)																							GGATCTTTCTcttccttccttcct	0.240													8	9	---	---	---	---	
METT11D1	64745	broad.mit.edu	37	14	21462443	21462443	+	Intron	DEL	T	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21462443delT	uc001vyn.2	+						METT11D1_uc001vym.2_Intron|METT11D1_uc001vyo.2_Intron|METT11D1_uc001vyp.2_Intron|METT11D1_uc001vyq.2_Intron	NM_022734	NP_073571	Q9H7H0	MET17_HUMAN	methyltransferase 11 domain containing 1 isoform						translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity				0	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)		CTCCCTGCCCTTttttttttt	0.234													4	3	---	---	---	---	
TUBGCP4	27229	broad.mit.edu	37	15	43690581	43690581	+	Intron	DEL	A	-	-	rs150462033		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43690581delA	uc001zro.2	+						TUBGCP4_uc001zrn.2_Intron|TUBGCP4_uc010bdh.2_Intron	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		cccatctcataaaaaaaaaaa	0.090													4	2	---	---	---	---	
PTPLAD1	51495	broad.mit.edu	37	15	65844283	65844284	+	Intron	DEL	AA	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65844283_65844284delAA	uc002apc.2	+						PTPLAD1_uc002apb.1_Intron|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain						activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0						acagtgaaggaaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13356488	13356489	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs147876951	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13356488_13356489insGGAAGGAA								SHISA9 (22216 upstream) : ERCC4 (657525 downstream)																							ATTGTTATTGTggaaggaagga	0.094													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32471773	32471774	+	IGR	INS	-	A	A	rs149995933	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32471773_32471774insA								HERC2P4 (307899 upstream) : TP53TG3B (213067 downstream)																							TATCACTTGCTAAAAAAAAATC	0.252													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33395820	33395821	+	IGR	INS	-	CAG	CAG	rs144984499	by1000genomes	TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33395820_33395821insCAG								SLC6A10P (499357 upstream) : MIR1826 (569687 downstream)																							aataataataataataatTTTT	0.183													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33939019	33939019	+	IGR	DEL	C	-	-	rs113683091		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33939019delC								None (None upstream) : MIR1826 (26489 downstream)																							GTTGCACAGGCCGCCTGCGTG	0.667													3	3	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57919461	57919462	+	Intron	INS	-	CTCT	CTCT	rs34366661		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919461_57919462insCTCT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						ttccttccttcctctctctctc	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87084802	87084803	+	IGR	DEL	TG	-	-	rs72174914		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87084802_87084803delTG								FOXL1 (469499 upstream) : FBXO31 (278141 downstream)																							TCAGTCCCCTtgtgtgtgtgtg	0.287													4	2	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377702	45377703	+	Intron	INS	-	GCGT	GCGT	rs72300893		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377702_45377703insGCGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	GTCTTACAGGCGCGCGCGCGCg	0.525													5	3	---	---	---	---	
UBXN6	80700	broad.mit.edu	37	19	4452146	4452146	+	Intron	DEL	A	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4452146delA	uc002man.1	-						UBXN6_uc010dty.1_Intron|UBXN6_uc002mam.1_Intron	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6							microtubule organizing center|nucleus	protein binding				0						actccatctcaaaaaaaaaaa	0.209													7	5	---	---	---	---	
MARCH2	51257	broad.mit.edu	37	19	8495419	8495419	+	Intron	DEL	A	-	-	rs74326673		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8495419delA	uc002mjv.2	+						MARCH2_uc002mjw.2_Intron|MARCH2_uc002mjx.2_Intron	NM_016496	NP_057580	Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2						endocytosis	cytoplasmic vesicle|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						aatctgtctcaaaaaaaaaaa	0.249													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28948775	28948775	+	Intron	DEL	T	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28948775delT	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																		tctttctctcttttttttttt	0.030													4	2	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41055990	41055990	+	Intron	DEL	A	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41055990delA	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron|SPTBN4_uc010egy.1_Intron|SPTBN4_uc002ooa.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			catctcaaagaaaaaaaaaaa	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54279184	54279184	+	IGR	DEL	T	-	-	rs62146188		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54279184delT								MIR519A2 (13500 upstream) : MIR371 (11745 downstream)																							TGAACTTCAATTTAAAAAAAA	0.214													3	3	---	---	---	---	
MMP9	4318	broad.mit.edu	37	20	44638967	44638968	+	Intron	INS	-	ACAAACAAAC	ACAAACAAAC	rs61268200		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44638967_44638968insACAAACAAAC	uc002xqz.2	+							NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein						collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	agacaaAAAAAAAAAAAAAAAA	0.218													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	53639037	53639038	+	IGR	INS	-	TC	TC			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53639037_53639038insTC								DOK5 (371328 upstream) : CBLN4 (933459 downstream)																							ccttccttccttccttccttcc	0.183													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58889721	58889722	+	Intron	INS	-	CCTC	CCTC			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58889721_58889722insCCTC	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		ctcccatccatccatcctccca	0.000													4	2	---	---	---	---	
ZGPAT	84619	broad.mit.edu	37	20	62339826	62339831	+	Intron	DEL	CGTGCC	-	-	rs71903646		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62339826_62339831delCGTGCC	uc002ygk.2	+						ARFRP1_uc002yga.2_5'Flank|ARFRP1_uc002ygc.2_5'Flank|ARFRP1_uc002ygh.3_5'Flank|ARFRP1_uc011abf.1_5'Flank|ARFRP1_uc011abg.1_5'Flank|ARFRP1_uc002yge.2_5'Flank|ARFRP1_uc002ygd.2_5'Flank|ARFRP1_uc002ygf.2_5'Flank|ARFRP1_uc002ygg.2_5'Flank|ARFRP1_uc011abh.1_5'Flank|ZGPAT_uc002ygi.2_Intron|ZGPAT_uc002ygj.2_Intron|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Intron|ZGPAT_uc002ygm.2_Intron|ZGPAT_uc002ygn.3_5'Flank	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain						negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GGAAAGGGGACGTGCCCGTGCCCGTG	0.714													4	7	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43226226	43226227	+	Intron	INS	-	A	A			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43226226_43226227insA	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						accatcaccatcaccaccacca	0.000													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756289	44756291	+	IGR	DEL	CAC	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756289_44756291delCAC								CRYAA (163376 upstream) : SIK1 (78107 downstream)																							ccaccaccatcaccaccaccaac	0.000													5	4	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26272012	26272013	+	Intron	DEL	TA	-	-	rs56708676		TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26272012_26272013delTA	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						tgtgtgtgtgtatgtgtTTTAA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48305869	48305869	+	IGR	DEL	T	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48305869delT								SSX4 (53084 upstream) : SLC38A5 (11059 downstream)																							ATAATACCCATTTTTTTTCTG	0.353													4	2	---	---	---	---	
TAF7L	54457	broad.mit.edu	37	X	100537603	100537604	+	Intron	DEL	TC	-	-			TCGA-BP-5175-01A-01D-1429-08	TCGA-BP-5175-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100537603_100537604delTC	uc004ehb.2	-						TAF7L_uc004eha.2_Intron|TAF7L_uc004ehc.1_Intron	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						ATTTTTGCAGTCTCTCTCTCTC	0.396													4	2	---	---	---	---	
